Crash course on

Python
programming

Presented by:
Shailender Nagpal, Al Ritacco
Research Computing
UMASS Medical School
Information Services, 09/17/2012
 AGENDA
Python Basics: Lists, Tuples, Expressions, Printing
Built-in functions, Blocks, Branching, Loops
Hash arrays, String and Array operations
File reading and writing
Writing custom functions
Regular expressions: Find/replace/count
Providing input to programs
Using Python scripts with the LSF cluster
2 Information Services, 00/00/2010
 What is Python?
• Python is a high-level, general-purpose, interpreted,
interactive programming language
• Provides a simple iterative, top-down, left to right
programming environment for users to create small,
and large programs

3 Information Services, 00/00/2010

 Features of Python
• Python code is portable between Linux, Mac, Windows
• Easy to use and lots of resources are available
• Procedural and object-oriented programming, not
strongly "typed"
• Similar programming syntax as other languages
– if, if-then-else, while, for, functions, classes, etc
• Provides several methods to manipulate data
– Lists, Hashes, Objects
• Statements are not terminated by semi-colon

4 Information Services, 00/00/2010

 Advantages of Python
• Python is a general-purpose programming language
like C, Java, etc. But it is "higher" level, means is
advantageous to use it in certain applications like
Bioinformatics
– Fewer lines of code than C, Java
– No compilation necessary. Prototype and run!
– Run every line of code interactively
– Vast function library geared towards scientific computing
– Save coding time and automate computing tasks
– Intuitive. Code is concise, but human readable

5 Information Services, 00/00/2010

 First Python program
• The obligatory "Hello World" program
#!/usr/bin/python
# Comment: 1st program: variable, print
name = "World"
print "Hello %s" % name
• Save these lines of text as a text file with the ".py"
extension, then at the command prompt (linux):
python hello.py
Hello World

6 Information Services, 00/00/2010

 Understanding the code
• The first line of a Python script requires an interpreter
location, which is the path to the Python executable
#!/path/to/python
• 2nd line: A comment, beginning with "#"
• 3rd line: Declaration of a string variable
• 4th line: Printing some text to the shell with a variable,
whose value is interpolated by %s
• The quotes are not printed, and "name" is replaced by
"World" in the output.

7 Information Services, 00/00/2010

 Second program
• Report summary statistics of DNA sequence
#!/usr/bin/python
dna= "ATAGCAGATAGCAGACGACGAGA"
print "Length of DNA is “, len(dna)
print "Number of A bases are “, dna.count('A')
print "Number of C bases are “, dna.count('C')
print "Number of G bases are “, dna.count('G')
print "Number of T bases are “, dna.count('T')
print "Number of G+C bases are “, (dna.count('G') + dna.count('C'))
print "Number of GC dinucleotides are “, dna.count('GC')
print "G+C percent content is “, (dna.count('G') + dna.count('C'))
/len(dna)*100

• In 10 lines of code, we can summarize our data!

• Can re-use this code to find motifs, RE sites, etc

8 Information Services, 00/00/2010

 Python Comments
• Use "#" character at beginning of line for adding
comments into your code
• Helps you and others to understand your thought
process
• Lets say you intend to sum up a list of numbers
# (sum from 1 to 100 of X)
•The code would look like this:
sum = 0 # Initialize variable called "sum" to 0
for x in range(1,100): # Use "for" loop to iterate over 1 to 100
sum=sum+x # Add the previous sum to x
print "The sum of 1..x is %s\n" % sum # Report the result

9 Information Services, 00/00/2010

 Python Variables
• Variables
– Provide a location to "store" data we are interested in
• Strings, decimals, integers, characters, lists, …
– What is a character – a single letter or number
– What is a string – a list of characters
– What is an integer – a number 4.7 (sometimes referred to
as a real if there is a decimal point)
• Variables can be assigned or changed easily within a
Python script

10 Information Services, 00/00/2010

 Variables and built-in keywords
• Variable names should represent or describe the data
they contain
– Do not use meta-characters, stick to alphabets, digits and
underscores. Begin variable with alphabet
• Python as a language has keywords that should not
be used as variable names. They are reserved for
writing syntax and logical flow of the program
– Examples include: if, then, else, for, foreach, while, do,
unless, until, break, continue, switch, def, class

11 Information Services, 00/00/2010

 Variables, Lists
• Variables that hold single strings are string variables
• Variables that hold single numbers are numeric
variables
score = 5.3
dna = "ATAGGATAGCGA"
name = "Shailender"
• Collection of variables are called lists. They hold an
array of values – could be a list of students in a class,
scores from a test, etc
students = ["Alan", "Shailender", "Chris"]
scores = [89.1, 65.9, 92.4]
binding_pos = [9439984, 114028942]

12 Information Services, 00/00/2010

 Printing text
• Using triple, double and single quotes
• Using single or double quotes process all items
within them. Ex:
– print "This \t is a test\nwith text"
– Output:
This is a test
With text
• Tripple quotes are useful for multi-line prints or
prints with quotes included. Ex:
– print """'This \t is a test\nwith text'"""
– Output:
'This \t is a test\nwith text'
13 Information Services, 00/00/2010
 Printing variables
• Scalar variables can be printed easily within double-
quotes following a print statement. Variables names
are "interpolated", printing the values they contain
x = 5
name = "John"
print "%s has %d dollars\n" % (name,x)
• If you run this as a program, you get this output
John has 5 dollars

14 Information Services, 00/00/2010

 Printing List variables
• Array variables can also be printed as a list with a
default delimiter, but another way to print arrays is
put them in a loop and print them as scalars
students = ["Alan", "Shailender", "Chris"]
print "students\n" # Does not work!
print "%s\n" % students # Method 1
print "%s %s %s" %
(students[0],students[1],students[2]) # Method 2
• If you run this as a program, you get this output:
["Alan", "Shailender", "Chris"] # Method 1
Alan Shailender Chris # Method 2

15 Information Services, 00/00/2010

 Math Operators and Expressions
• Math operators
– Eg: 3 + 2
– + is the operator
– We read this left to right
– Basic operators such as + - / * ** ( ^ )
– Variables can be used
print "Sum of 2 and 3 is ".(2+3)
x=3
print "Sum of 2 and x is ".(2+x)
• PEMDAS rules are followed to build mathematical
expressions. Built-in math functions can be used
16 Information Services, 00/00/2010
 Mathematical operations
• x=3
• y=5
• z=y+x
– Is this the same: z=x+y ?
– Yes, but not in-terms of computing it (LR grammar)
• x=x*z
• y=y+1
• y++

17 Information Services, 00/00/2010

 Python built-in functions
• The Python language comes with many built-in
functions that can be used with variables to produce
summary output, eg,
• Many mathematical functions are also available

18 Information Services, 00/00/2010

 Built-in mathematical functions

• Some functions are:

min(x) max(x) len(x)
sum(x) abs(x) float(x)
pow(x,y) range(x) round(x,n)
ceil(x) cos(x) degrees(x)
radians(x) exp(x) floor(x)
hypot(x,y) log(x,base) sin(x)
sqrt(x) tan(x) int(x)
 Lists
• Lists can contain an array of numerical or string values, eg:
genes = ['ATM1', 'BRCA', 'TNLP2']
gene_scores = [48.1, 129.7, 73.2]
• List elements can be accessed by their index, beginning with
0, eg:
genes[0]
gene_scores[0:2]
 List Indexing
• Lists can be indexed by number to retrieve individual
elements
• Indexes have range 0 to (n-1), where 0 is the index of the
first element and n-1 is the last item's index
nucleotides=["adenine", "cytosine", "guanine",
"thymine", "uracil"]
nucleotides[3] is equal to  thymine
nucleotides[4] is equal to what?
• Any element of an array can be re-assigned (Lists are
mutable)

21 Information Services, 00/00/2010

 List Operations
• append(x) Add an item to the end of the list
• extend(L) Extend the list by appending all the items in the given
list
• insert(i, x) Insert an item at a given position. The first argument
is the index of the element before which to insert
• remove(x) Remove the first item from the list whose value is x.
It is an error if there is no such item
data = [10, 20]
data.append(30)# [10, 20, 30]
data.extend([40,50,60])# [10, 20, 30, 40, 50, 60]
data.insert(0,5) #[5, 10, 20, 30, 40, 50, 60]
data.remove(20)#[5, 10, 30, 40, 50, 60]
 List Operations (…contd)
• pop([i]) Remove the item at the given position in the list, and
return it. If no index is specified, pop removes and returns the
last item in the list
• index(x) Return the index in the list of the first item whose
value is x. It is an error if there is no such item
• count(x) Return the number of times x appears in the list
• sort() Sort the items of the list, in place
• reverse() Reverse the elements of the list, in place
 List operations
fruits = [] # Undefined
fruits = ["apples", "bananas", "cherries"] # Assigned
fruits.append("dates") # Lengthen
fruits.append("acorn") # Add an item to the front
nut = fruits.pop() # Remove from the front
print "Well, a squirrel would think a %s was a fruit!\n" % nut
fruits.append("mango") # Add an item to the end
food = fruits.pop() # Remove from the end
print "My, that was a yummy %s\n" % food
Output:
Well, a squirrel would think a acorn was a fruit!
My, that was a yummy mango!

24 Information Services, 00/00/2010

 Tuples
• Tuples, which is a list of fixed numbers or strings, eg:
calendar = 'Jan', 'Feb', 'Mar'
• For single-item tuple, to distinguish it from string
calendar = 'Jan',
• Tuple with 0 elements
calendar = ()
• Tuples may be nested
u = calendar, 'Apr', 'May'
u = u, ('Jun', 'Jul')
 Tuples (…contd)
• Tuples have many uses. For example: (x, y) coordinate pairs,
employee records from a database
• Tuples, like strings, are immutable: it is not possible to assign
to the individual items of a tuple
• It is also possible to create tuples which contain mutable
objects, such as lists
t = 2,54,'hello!' # Tuple "packing"
x, y, z = t # "unpacking"
 Tuples (…contd)
• Sequence unpacking requires the list of variables on the left
to have the same number of elements as the length of the
sequence
• Note that multiple assignment is really just a combination of
tuple packing and sequence unpacking!
• There is a small bit of asymmetry here: packing multiple
values always creates a tuple, and unpacking works for any
sequence
 Sets
• A set is an unordered collection with no duplicate elements,
they support mathematical operations like union,
intersection, difference, and symmetric difference
• Create a list
basket = ['apple', 'orange', 'apple', 'pear',
'banana']
• Create a set without duplicates
fruit = set(basket)
• Tests if present in set
'orange' in fruit
 Sets (…contd)
• Two sets can be created, and various operations can be
performed between them
– the result of a set operation is also a "set", not a list
– Union (&)
– Intersection (|)
– And (^)
– Difference (-)
 Assignment: Working with "Sets"
• Example with two sets of characters
a = set('abracadabra')
b = set('alacazam')
a # unique letters ['a', 'r', 'b', 'c',
'd']
a - b # letters in a but not in b ['r',
'd','b']
a | b # letters in either a or b ['a', 'c',
'r', 'd', 'b', 'm', 'z', 'l']
a & b # letters in both a and b ['a', 'c']
a ^ b # letters in a or b but not both ['r',
'd', 'b', 'm', 'z', 'l']
 Dictionary

• A dictionary is an unordered set of key: value pairs,

with the requirement that the keys are unique
• Example data pairs that are suited to be stored in a
hash array (as opposed to storing them in 2 separate
arrays)
– Words (key) and their meanings (value)
– Gene symbols (key) and their full names (value)
– Country names (key) and their capitals/ currencies (value)
• A pair of braces creates an empty dictionary: {}
 Dictionary (…contd)
• Placing a comma-separated list of key:value pairs within the
braces adds initial key:value pairs to the dictionary
dict = {"Gene1":"Breast Cancer Gene"}
• The main operations on a dictionary are storing a value with
some key and extracting the value given the key
• It is also possible to delete a key:value pair with del
• If you store using a key that is already in use, the old value
associated with that key is forgotten
• The keys() method of a dictionary object returns a list of all
the keys used in the dictionary, in arbitrary order (if you want
it sorted, just apply the sort() method to the list of keys)
 Dictionary (…contd)
• To check whether a single key is in the dictionary, either use
the dictionary's has_key() method or the "in" keyword
tel = {'jack': 4098, 'sape': 4139}
tel['guido'] = 4127
tel['irv'] = 4129
tel['jack']
• Deleting a key-value pair
del tel['sape']
• Get the keys of the dictionary
tel.keys()
 Dictionary (…contd)
• Check if the dictionary has a key
tel.has_key('guido')
• Check if the dictionary has a key (another method)
'guido' in tel
 Dictionary, cont.
• Two ways to create a dictionary:
dessert = {pie: "apple", cake: "carrot", sorbet:
"orange"} # Method 1
Dessert["pie"] = "apple"
Dessert["cake"] = "carrot"
Dessert["sorbet"] = "orange"
print "I would like %s pie" % dessert["pie"]
Output:
I would like apple pie.

35 Information Services, 00/00/2010

 Hash Array iteration (...contd)
sounds = {"cow": "moooo", "duck": "quack", "horse":
"whinny", "sheep": "baa", "hen": "cluck", "pig":
"oink"}
for animal in sounds.keys():
print "Old MacDonald had a %s" % animal
print " With a %s! %s! here..." % sounds[animal]
Output:
Old MacDonald had a hen. With a cluck! cluck!
here...
Old MacDonald had a cow. With a moooo! moooo!
here...
Old MacDonald had a sheep. With a baa! baa! here...

36 Information Services, 00/00/2010

 String Operations: Split
• Python provides excellent features for handling strings
contained in variables
• The "split" command allows users to search for patterns in a
string and use them as a delimiter to break the string apart
• For example, to extract the words in a sentence, we use the
space delimiter to capture the words
x = "This is a sentence"
words = x.split(" ")
• Now words contains the words
words[0] = "This"
words[1] = "is"
words[2] = "a"
words[3] = "sentence"
 String Operations
• Two literal strings placed next to one another with a space will
concatenate automatically
• To manually concatenate two strings once, the "+" operator is
used
• To paste multiple copies of a string, multiply (*) it by a number
word = 'Help' + 'A'
word*5
'<' + word*5 + '>'
'Help' 'A'
'Help'.strip() 'A'# This first is not a literal
string
'Help'.strip() + 'A' # Manual concatenation
 String Sub-scripting
• Once a string is created, it can be subscripted using its indices
that begin with 0
word = "Programming"
word[0] # "P"
word[0:3] # "Prog"
word[:3] # "Prog"
word[3:] # "ramming"
• Slices of python strings cannot be assigned, eg
word[:3] = "C" # This won't work
 String subscripting (…contd)
• Subscripted strings can however be used in string expressions
word[2:3] + 're' # "ogre"
• If the string subscript is out of range, it uses the starting or
end character of the string
word[:200] # "Programming"
• If –ve subscript is used, the index begins from the last
character to first
word[-2:] # "ng"
 String Functions
• Some functions
x = 'python'
x.capitalize()
x.upper()
x.lower()
x.trim()
x.find("pattern")
x.center(20)
x = " "
x.join("python")
 String Functions (…contd)

• Some functions
x.strip()
x.lstrip()
x.rstrip()
x.split("\t")
x.count("p")
if x.startswith('#'):
if x.endswith('a'):
if x.isalpha():
if x.islower():
if x.isupper():
 Iterating over Lists with "in"
• Ok, so we have these lists, but how do we work with
each element automatically?
– How can we iterate over them and perform the same
operation to each element?
• We use looping logic to work with the arrays
• We use Python's "for", more specifically foreach
for named_item in array:
named_item = <some expression>

43 Information Services, 00/00/2010

 Python Lists (...contd)
• Example:
nucleotides=["adenine", "cytosine", "guanine",
"thymine", "uracil"]
for nt in nucleotides:
print "Nucleotide is: %s\n" % nt

Output:
Nucleotide is: adenine
Nucleotide is: cytosine
Nucleotide is: guanine
Nucleotide is: thymine
Nucleotide is: uracil

44 Information Services, 00/00/2010

 Flow Control: "For" loop
• "For" loops allow users to repeat a set of statements a set
number of time.
x = ['a', 'b', 'c']
for strvar in x:
print strvar, len(strvar)
for i in range(0,2)
print x[i], len(x[i])
 Break and Continue Statements

• The "break" statement in a "for" or "while" loop transfers

control execution outside the loop
• The "continue" statement in a "for" or "while" loop
transfers control to the next iteration of the loop,
skipping remainder statements after it
 Boolean Operations
• Boolean operators provide Boolean context
• Many types of operators are provided
– Relational (<, >)
– Equality (==, !=)
– Logical (and, or, not)
– Conditional (?:)

47 Information Services, 00/00/2010

 Commands blocks in Python
• A group of statements surrounded by braces {}
– No! There are no curly braces in Python!
– Python blocks are all about “indenting”
• Creates a new context for statements and commands
• Ex:
if(x>1):
print "Test\n"
print "x is greater than 1\n"

48 Information Services, 00/00/2010

 Iterating over Lists with "while"
• Example:
nucleotides=["adenine", "cytosine", "guanine",
"thymine", "uracil"]
i = 0
while(i<length(nucleotides)):
print "Nucleotide is: %s\n" % nucleotides[i]
i++
Output:
Nucleotide is: adenine
Nucleotide is: cytosine
Nucleotide is: guanine
Nucleotide is: thymine
Nucleotide is: uracil

49 Information Services, 00/00/2010

 Conditional operations with "if-
then-else"
• If-then-else syntax allows programmers to introduce
logic in their programs
• Blocks of code can be branched to execute only when
certain conditions are met
if(condition1 is true):
<statements if condition1 is true>
else:
<statements if condition1 is false>

50 Information Services, 00/00/2010

 Python nested blocks
• Blocks within blocks
if (x>1):
if (y>2):
print "y>2\n"
print "x>1\n"

51 Information Services, 00/00/2010

 Python File access
• What is file access?
– set of Python commands/syntax to work with data files
• Why do we need it?
– Makes reading data from files easy, we can also create new
data files
• What different types are there?
– Read, write, append

52 Information Services, 00/00/2010

 File I/O
• Python easily reads and writes ASCII/text files.
f = open(filename, mode)
f.read() # Reads entire file
f.read(10) # Reads 10 bytes
f.readline() # Reads one line at a time
f.readlines() # Reads all lines into a list
f.close() # Closes the file
• To read lines automatically one by one
for line in f:
print line
 File I/O (…contd)
• Other funtions
f.write('abcd') # writes to file
f.tell( ) # current position in file
f.seek( ) # go to position in file
f.close( ) # close the file
• To write files, use:
output.write(f, list)
 Python File access Example
• Example
f = open("mailing_list", "r")
for line in f:
fields = line.split(":")
print "%s %s" % (fields[1], fields[0])
print "%s %s" % (fields[3], fields[4])
print "%s %s %s" % (fields[5],fields[6],fields[7])
f.close() Input file:
• Output: Last name:First name:Age:Address:Apartment:City:State:ZIP
Smith:Al:18:123 Apple St.:Apt. #1:Cambridge:MA:02139
Al Smith
123 Apple St., Apt. #1
Cambridge, MA 02139

55 Information Services, 00/00/2010

 Python File access writing
• Writing to files
– print writes to a file
– print writes to a STDOUT by default
– Be sure that the file is open for writing first
• Check for errors along the way

56 Information Services, 00/00/2010

 Python File access writing
• Example writing to a file
import os
readfile = "mailing_list"
if(os.path.isfile(readfile)):
fr = open(readfile, "r")
fw = open("labels", "w")
for line in fr:
line.rstrip()
fields = line.split(":")
fw.write("%s %s\n" % (fields[1], fields[0]))
fw.write("%s %s\n” % (fields[3], fields[4]))
fw.write(“%s %s %s” % (fields[5],fields[6],fields[7]))
fr.close()
fw.close()

57 Information Services, 00/00/2010

 Functions
• What is a function?
– group related statements into a single task
– segment code into logical blocks
– avoid code and variable based collision
– can be "called" by segments of other code
• Subroutines return values
– Explicitly with the return command
– Implicitly as the value of the last executed statement
• Return values can be a scalar or a flat list

58 Information Services, 00/00/2010

 Functions
• A function can be written in any Python program, it is
identified by the "def" keyword
• Writing a function
def printstars():
print "***********************"
printstars()
• Notice the indenting after declaring the function, and the use
of empty parenthesis
 Functions with Inputs and Outputs
• The "return" statement can be used to return some output
from the function
def fib2(n):
"""Generate the Fibonacci series """
result = []
a, b = 0, 1
while b < n:
result.append(b)
a, b = b, a+b
return result
• The function can then be called
fib100 = fib2(100)
 Functions with Argument lists
def isEnzyme(enzymePrompt, tries = 4):
while True:
enzyme = raw_input(enzymePrompt)
if enzyme in ["ATGG", "GTAC", "CCAA"]:
return True
tries = tries - 1
if tries<0:
print "Enough tries already!"
break
• Can be executed as
isEnzyme("Enter an enzyme: ")
isEnzyme("Enter enzyme: ", 3)
 Functions with Argument lists (…contd)
• In general, an argument list must have any positional
arguments followed by any keyword arguments
• The keywords must be chosen from the formal parameter
names
• It's not important whether a formal parameter has a default
value or not
• No argument may receive a value more than once -- formal
parameter names corresponding to positional arguments
cannot be used as keywords in the same calls
 Python Subroutines
def fibonacci(n):
return 1 if n <= 2
return (fibonacci(n-1) + fibonacci(n-2))

for i in range(1,5):
fib = fibonacci(i)
print "fibonacci(%d) is %s\n" % (i,fib)
• Example Output:
fibonacci(1) is 1
fibonacci(2) is 1
fibonacci(3) is 2
fibonacci(4) is 3
fibonacci(5) is 5

63 Information Services, 00/00/2010

 Providing input to programs
• It is sometimes convenient not to have to edit a
program to change certain data variables
• Python allows you to read data from shell directly
into program variables with the "raw_input"
command
• Examples:
x = raw_input("Enter your name: ")
• If "x" is a number
x = int(x)

64 Information Services, 00/00/2010

 Command Line Arguments

• Command line arguments are optional data values

that can be passed as input to the Python program as
the program is run
– After the name of the program, place string or numeric
values with spaces separating them
– Accessed them by the sys.argv variable inside the program
– Avoid entering or replacing data by editing the program
• Examples:
python arguments.py arg1 arg2 10 20
python arguments2.py 10 20 30 40 50
 Using Python programs on the
cluster
• Python scripts can easily be submitted as jobs to be
run on the MGHPCC infrastructure
• Basic understanding of Linux commands is required,
and an account on the cluster
• Lots of useful and account registration information at
www.umassrc.org
• Feel free to reach out to Research Computing for
help
[email protected]

66 Information Services, 00/00/2010

 What is a computing "Job"?
• A computing "job" is an instruction to the HPC
system to execute a command or script
– Simple linux commands or Python/Python/R scripts that
can be executed within miliseconds would probably not
qualify to be submitted as a "job"
– Any command that is expected to take up a big portion of
CPU or memory for more than a few seconds on a node
would qualify to be submitted as a "job". Why? (Hint:
multi-user environment)

67
 How to submit a "job"
• The basic syntax is:
bsub <valid linux command>
• bsub: LSF command for submitting a job
• Lets say user wants to execute a Python script.
On a linux PC, the command is
Python countDNA.py
• To submit a job to do the work, do
bsub Python countDNA.py

68
 Specifying more "job" options
• Jobs can be marked with options for better job
tracking and resource management
– Job should be submitted with parameters such as queue
name, estimated runtime, job name, memory required,
output and error files, etc.
• These can be passed on in the bsub command
bsub –q short –W 1:00 –R rusage[mem=2048] –J
"Myjob" –o hpc.out –e hpc.err Python countDNA.py

69
 Job submission "options"
Option flag or Description
name
-q Name of queue to use. On our systems, possible values are "short"
(<=4 hrs execution time), "long" and "interactive"
-W Allocation of node time. Specify hours and minutes as HH:MM
-J Job name. Eg "Myjob"

-o Output file. Eg. "hpc.out"

-e Error file. Eg. "hpc.err"
-R Resources requested from assigned node. Eg: "-R
rusage[mem=1024]", "-R hosts[span=1]"
-n Number of cores to use on assigned node. Eg. "-n 8"

70
 Why use the correct queue?
• Match requirements to resources
• Jobs dispatch quicker
• Better for entire cluster
• Help GHPCC staff determine when new resources are
needed

71
 Questions?
• How can we help further?
• Please check out books we recommend as
well as web references (next 2 slides)

72 Information Services, 00/00/2010

 Python Books
• Python books which may be helpful
– http://shop.oreilly.com/product/9780596154516.do  
• Bioinformatics Programming Using Python
– http://shop.oreilly.com/product/0636920028154.do    
• Learning Python
– http://shop.oreilly.com/product/0636920027072.do   
• Python Cookbook
– http://shop.oreilly.com/product/9780596158118.do  
• Programming Python – 4th Edition

73 Information Services, 00/00/2010

 Python References
• http://en.wikipedia.org/wiki/Python
• http://www.tutorialspoint.com//python/index.htm
• https://docs.python.org/2/tutorial/
• https://docs.python.org/2/tutorial/
• http://www.codecademy.com/en/tracks/python
• http://
fab.cba.mit.edu/classes/MIT/863.07/people/stephen
/tutorialPython.pdf

74 Information Services, 00/00/2010