Fundamentals of DNA

typing and its application

Dr Ajee Kuruvilla
Professor, Department of Forensic Medicine and Toxicology
MSU-Ramaiah International Medical School, Bangalore
HISTORY-FORENSIC SCIENCE LABS
• Edmond Locard's (1877--1966) was first to set up the world's first forensic
laboratory in his native country Lyon, France in 1910.
• During British period 5 chemical examiners were established in India.
• In 1849 Chemical Examiner’s Laboratory in Chennai
• Followed by Calcutta, Agra, Mumbai, Peshawar
• 1952, Bengal Government established the first state Forensic Science
Laboratory by merging the Chemical Examiner’s Laboratory with it
• 1959-State Forensic Science Laboratories were established in Bombay,
Chennai, Punjab, Bihar, Rajasthan and Madhya Pradesh.
Central Forensic Science Laboratories
• Calcutta, Chandigarh, Hyderabad, New Delhi, Pune, Bhopal and
Guwahati
• The CFSL New Delhi comes under the Central Bureau of
Investigation, Delhi, and investigates cases on its behalf.
• The other laboratories are under the control of the Directorate of
Forensic Science Services (DFSS) of the Ministry of Home Affairs.
State Forensic Science Laboratory
• Between 1957 and 1980 every state in India started their own state
Forensic Science Laboratories.
• Tamil nadu and Maharashtra started their own Regional Forensic
Science Laboratories and District Mobile Forensic Science
Laboratories between 1971 and 1996.
• All the forensic science laboratories in India (Central and state)
which were earlier working under the police department have now
been brought under the control of the Ministries of Home Affairs
(Central and state).
Objectives of FSLs
• to contribute scientific assistance to the agencies involved in criminal
investigation. ·
• To examine the crime related exhibits referred by Police, Judiciary, and other
government departments and undertakings and give opinion.
• To provide scientific aids to investigation officers (I.Os) in scientific
investigation of crime and to help in recognizing, collecting evidences
properly from scene of crime, its proper packing, sealing and forwarding to
laboratory for examination along with a list of queries.
• To provide knowledge and training about the role of Forensic Science and its
application to crime investigation to police personnel; Judiciary officers and
other related officers.
Objectives of FSLs

• To perform research in the field of forensics and continuously

updating the techniques and methods used for analysis of physical
evidences in the Forensic science laboratories.
• Finally to improve the quality of laboratory services provided to
criminal justice.
Hierarchy in FSL
• Director

• assisted by Additional or Joint Director (technical) and an Administrative Officer (non-

technical)
• All the divisions are generally headed by Deputy Directors
• assisted by Assistant Director, Senior and Junior Scientific Officers, senior and junior
scientific assistants, laboratory assistants and attendants.
• Non-technical staff carries out clerical work; maintenance of store, supplies and
maintenance duties.
Divisions in the Forensic Science Lab
• Forensic Physics- physical evidence-physical attributes viz. density, refractive index, resistivity,
temperature, luminescence, elasticity and composition. The physical evidences that are
examined are paint, glass, soil, fibres, metallic pieces, threads, ropes, knots and obliterated
marks.
• Forensic Chemistry- identification and determination of adulterants in food, cosmetics,
cement, alcohol etc. Nature and composition of fire accelerates
• Forensic Biology-examination of biological fluids (blood, saliva, seminal stains, vaginal
stains etc) skeletal remnants, diatoms, hair, seeds, maggots, vegetable fibres, wood etc
• Forensic Toxicology-performs analysis on medicines, poisons, adulterated foods, narcotics
and hallucinogenic and/or harmful chemicals in various biological samples and on-site evidence
• Forensic serology & DNA analysis-  is primarily responsible for the detection and
identification of biological material (i.e., blood, semen, saliva, and urine) on physical evidence
Divisions in the Forensic Science Lab
• Cyber forensic- Extraction and analysis of data from Computer hard disks, USB devices, floppy, CD, DVD, and Flash drives.
mobile phones,
Tracking and analysis of e-mails, social medias, websites, cloud storage etc
• Ballistics and Explosives- identification and comparison of Firearms, ammunition of various make and calibre,
homemade/improvised firearms and ammunition, bullets, pellets, wads, propellant, cartridge cases and the appliances used for
the manufacture of firearm ammunition.
• Instrumentation - undertaking maintenance of these sophisticated instruments like GC, GCMS, LCMS, HPLC, HPTLC, Raman-
spectrometer, SEM
• Finger print division- Maintaining fingerprint record slips of specified categories of criminals. Examining and
comparing the chance prints with available data bank in Automated Fingerprint Identification System (AFIS).
• Questioned document - signatures and initials, anonymous letters, Inks, Examinations of Erasures, alterations or
obliterations, forgery, counterfeiting.
• Photography- Identification of Source camera - Comparisons of questioned digital photograph with digital
photographs obtained from questioned camera, Preparing photographic evidences for further comparisons
and documenting them for Court Presentation, Crime Scene Photography - Covering the scene of crime for
reconstruction by documenting important physical evidences and its vicinity, Post Mortem
Photography/Videography 
Primarily, the administration of criminal
justice system rest on:
• Police
• Courts and
• Forensic Science
Administration of criminal justice system
POLICE

COURTS FORENSIC SCIENCE

Inter relations
• Police- Central Detective Training School, Bureau of Police Research
and Development, Police Academies
• Forensic scientist- student- in the curriculum- Police administration,
visit to police station, Criminal law, procedure of examination of a
victim, court visit etc
• Lawyer- How much of Forensic science is he aware of ? Does he have
the opportunity to understand the basics of Forensic Science before
he starts practicing?
Relevance of Forensic Science in Law
• During trial of a case, the importance of science (and understanding
the limits of science) cannot be denied.
• Judges and lawyers should not lack the scientific expertise necessary
to comprehend and evaluate forensic evidence.
• A basic knowledge of Forensic Science is mandatory for lawyers
DNA TYPING
At the end of the class, the students will be
able to
• Explain the fundamental principles of DNA typing
• Discuss the applications of DNA typing
History of DNA Typing
• Nov 21st 1983: 15 yr old Lynda Mann of Narborogh (Britain) raped &
strangled.
• April 1984: blood tests failed to give any evidence
• August 1984: Dr Alec Jeffrey (Leicester University) discovered a
variance in DNA.
• Sep 1984: Jeffreys-
-individualistic radioactive pattern
-genetic finger prints were inherited
- bands were consistent in all bodily material
History of DNA Typing
• Aug 2nd 1986: 15 yr old Dawn Ashworth of Enderby (England) found
raped & strangled to death near Narborough.
Police arrested Richard Buckland who confessed. Buckland’s father
asked for his sample to be sent to Dr Jeffreys.
Police shocked! Jeffreys- “Buckland could not have been the
murderer”
Nov 21st 1986: Buckland released!
History of DNA Typing
• Jan 17th 1987: Police- all males 17-34 yrs old to provide blood & saliva
samples for DNA typing
• Six months later: No samples matched
• Aug 1st 1987: Ian Kelly boasted of having given proxy blood for Colin
Pitchfork
• Aug 2nd 1987: Colin Pitchfork arrested
History of DNA Typing
• Perfect DNA profile matching with victims!
• Jan 1988:
Pitchfork confesses of both murders & indecent assault charges
He was sentencd to life for 2 murders,
3 yrs for sexual assaults, 3 yrs for conspiracy
Basics of DNA
DNA-
• DNA, the active substance of the genes, carries the coded messages
of heredity in every living thing: animals, plants, bacteria, and other
microorganisms.
• In humans, the code-carrying DNA occurs in all cells that have a
nucleus, including white blood cells, sperm, cells surrounding hair
roots, and cells in saliva. These would be the cells of greatest interest
in forensic studies.
• Human genes are carried in 23 pairs of chromosomes
• Those 23 pairs form the total genetic makeup of a person
• The messages of heredity are transmitted by these chromosomes
• The genetic code itself is spelled out in strings of nucleotides of four
types- A, C, G, and T (Adenine, Cytosine, Guanine, and Thymine)
• The total number of nucleotides in a set of 23 chromosomes is about 3
billion
• Except for identical twins, the DNA of a person is for practical purposes
unique. That is because one chromosome of each pair comes from the
father and one from the mother
Molecular structure of DNA
• DNA is a double-stranded structure
coiled into a helix.

• Made up of 2 phosphate-sugar
strands (deoxyribose) bridged by pairs
of nucleotides (bases).

• Bases – Adenine, Guanine, Cytosine,

Thymine.
A–T;G–C
• A & G are purines, C & T are
pyrimidines

• Each person has 3 billion nucleotides.

• DNA is a nucleic acid that contains the genetic instructions for the
biological development of a cellular form of life.

• DNA fingerprinting is done by extracting DNA from the cells in a

sample of blood, saliva, semen, or other appropriate fluid or tissue.
“Your fate does not lie in your destiny, it is locked up in your
genes” William Fontaine
Scientific basis of DNA typing
Several DNA molecules

genes

chromosomes
(in humans 23 pairs of chromosomes in a cell)
At some places (loci) on the chromosome, some
variability in DNA sequencing maybe seen. Alleles are
detectable variations in a single genetic locus
Forensic techniques of DNA typing
• Restriction Fraction Length Polymorphism (RFLP)
• Polymerase Chain Reaction (PCR)
• Short Tandem Repeats (STR)
• Mitochondrial DNA
• Rapid DNA ID Microchip-Based Genetic Detectors
RFLP analysis
• Uses a restriction enzyme to cut the DNA into
fragments which are separated into bands during
agarose gel electrophoresis.
• The bands of DNA are transferred from the
agarose gel to a nylon membrane via a technique
called Southern blotting.
• This is treated with a radioactively-labeled DNA
probe which binds to certain specific DNA
sequences on the membrane.
• An X-ray film placed next to the nylon membrane,
which detects the radioactive pattern called a DNA
fingerprint.
RFLP analysis
Solve this

Person 1 GCGCATGTTGCGCAAGAGCGC
Person 2 GCGCATTGAATGCAAGTAGCGC
RFLP analysis

Person 1 GCGCATGTTGCGCAAGAGCGC
Person 2 GCGCATTGAATGCAAGTAGCGC
enzyme
Person 1 CGCATGTTG CGCAAGAG
Person 2 CGCATTGAATGCAAGTAG
Drawback of RFLP:
• RFLP is a time consuming method.
• Required relatively high quantity of DNA.
Polymerase Chain Reaction (PCR)
• PCR involves the amplification of specific regions of DNA using a
cycling of temperature and a thermostable polymerase enzyme.
Advantages:
• Small quantity of samples.
• Can be done very fast.
 STR (short tandem repeat) analysis

• Extracting nuclear DNA from the samples & amplifying specific

regions by means of PCR.

• After amplification, determine how many repeats of the STR sequence

in question are present.

• A short tandem repeat (STR) in DNA is a repetitive pattern of two or

more nucleotides at a given locus.
• Counting the number of repetition of a specific STR sequence at a
given locus helps to identify genetic profile of an individual.
Applications of DNA Typing
• Paternity disputes
• Maternity resolution
• Establishment of biological relationship
• Detection of cases of child swapping
• Identification of rapist (also gang rapes)
• Identification of mutilated remains
• Identification in exhumation cases
• All cases of wildlife identification
Technique of DNA profiling
• Strict guidelines to be followed while collecting or forwarding samples
• The infallibility of the DNA analysis depends mostly on the skill, ability
and integrity shown by police officers and medical officers
• Since it involves a technology that is so powerful and so sensitive, the
DNA analyst must also be cautious (If he sneezes while working, his
DNA could contaminate the sample !)
• Legal scrutiny -Questions related to collecting, forwarding and
authentication of the samples
Collection of samples
• 2-5 ml iv drawn blood in heparin / EDTA vacuitainers, labelled &
packed in ice (to be sent immediately or store in refrigerator
• Air dried vaginal swabs in dry sterile tubes, sealed & labeled
• Genital parts swabbed with wet cotton.
• Air dried clothes of victim packed in dry paper
• Hair samples packed in clean paper and sealed
• Fingernail scrapings in polyethylene sheet
Status of DNA typing as a forensic tool
• Most conclusive method of identification
• Can be applied on very old stains
• Extremely small quantity of body fluid or tissue is sufficient
DISADVANTAGES
• Cannot differentiate between identical twins
• Relatively expensive
• Requires great deal of expertise and experience in interpretation
• Improper collection or preservation of sample could produce erroneous
results
THANK YOU