Phytopathology In Plants Philip Stewart Sabine

Globig download

https://ebookbell.com/product/phytopathology-in-plants-philip-
stewart-sabine-globig-4422046

Explore and download more ebooks at ebookbell.com

Here are some recommended products that we believe you will be
interested in. You can click the link to download.

In Splendid Isolation A History Of The Willie Commelin Scholten

Phytopathology Laboratory 18941992 Patricia E Faasse Eliane Smits Van
Waesberghe Hans Boutellier Fouzia Outmany

https://ebookbell.com/product/in-splendid-isolation-a-history-of-the-
willie-commelin-scholten-phytopathology-laboratory-18941992-patricia-
e-faasse-eliane-smits-van-waesberghe-hans-boutellier-fouzia-
outmany-51756414

Research In Physiopathology As Basis Of Guided Chemotherapy With

Special Application To Cancer Emanuel Revici Md

https://ebookbell.com/product/research-in-physiopathology-as-basis-of-
guided-chemotherapy-with-special-application-to-cancer-emanuel-revici-
md-49407418

Comprehensive And Molecular Phytopathology 1st Edition Yuri Dyakov

https://ebookbell.com/product/comprehensive-and-molecular-
phytopathology-1st-edition-yuri-dyakov-1782450

Physiology And Physiopathology Of Adipose Tissue 1st Edition Tala

Mohsenkanson

https://ebookbell.com/product/physiology-and-physiopathology-of-
adipose-tissue-1st-edition-tala-mohsenkanson-4290262
Oral Candidosis Physiopathology Decision Making And Therapeutics 1st
Edition Edvaldo Antonio Ribeiro Rosa Eds

https://ebookbell.com/product/oral-candidosis-physiopathology-
decision-making-and-therapeutics-1st-edition-edvaldo-antonio-ribeiro-
rosa-eds-5237728

Biochemistry Of Oxidative Stress Physiopathology And Clinical Aspects

1st Edition Ricardo Jorge Gelpi

https://ebookbell.com/product/biochemistry-of-oxidative-stress-
physiopathology-and-clinical-aspects-1st-edition-ricardo-jorge-
gelpi-5736714

Revival Cannabis Physiopathology Epidemiology Detection 1992 First

Edition Nahas

https://ebookbell.com/product/revival-cannabis-physiopathology-
epidemiology-detection-1992-first-edition-nahas-6637918

Handbook Of Obesity Epidemology Etiology And Physiopathology Bray

https://ebookbell.com/product/handbook-of-obesity-epidemology-
etiology-and-physiopathology-bray-4647642
Phytopathology
in Plants
 Research Progress in Botany

Phytopathology
in Plants

Philip Stewart, PhD

Head, Multinational Plant Breeding Program; Author;
Member, US Rosaceae Genomics, Genetics and
Breeding Executive Committee; North Central Regional Association
of State Agricultural Experiment Station Directors, U.S.A.

Sabine Globig
Associate Professor of Biology, Hazard Community
and Technical College, Kentucky, U.S.A.

Apple Academic Press

Research Progress in Botany Series
Phytopathology in Plants

© Copyright 2011*
Apple Academic Press Inc.

This book contains information obtained from authentic and highly regarded sources. A wide variety of refer-
ences are listed. Reasonable efforts have been made to publish reliable data and information, but the editors and
the publisher cannot assume responsibility for the validity of all materials or for the consequences of their use.

First Published in the Canada, 2011

Apple Academic Press Inc.
3333 Mistwell Crescent
Oakville, ON L6L 0A2
Tel. : (888) 241-2035
Fax: (866) 222-9549
E-mail: [email protected]
www.appleacademicpress.com

The full-color tables, figures, diagrams, and images in this book may be viewed at
www.appleacademicpress.com

ISBN 978-1-926692-80-7

Philip Stewart, PhD

Sabine Globig

Printed at Thomson Press (I) Ltd.

987654321

Cover Design: Psqua

Library and Archives Canada Cataloguing in Publication Data
CIP Data on file with the Library and Archives Canada

*To the best of the publisher's knowledge, all articles in this book are copyrighted to the individual authors and are
licensed and distributed under the Creative Commons Attribution License, which permits unrestricted use, distribu-
tion, and reproduction in any medium, provided the original work is properly cited.
 Contents

Introduction 9
1. Expanding the Paradigms of Plant Pathogen Life History and 11
Evolution of Parasitic Fitness Beyond Agricultural Boundaries
Cindy E. Morris, Marc Bardin, Linda L. Kinke, Benoit Moury,
Philippe C. Nicot and David C. Sands
2. Two Plant Viral Suppressors of Silencing Require the 29
Ethylene-Inducible Host Transcription Factor RAV2 to Block
RNA Silencing
Matthew W. Endres, Brian D. Gregory, Zhihuan Gao,
Amy Wahba Foreman, Sizolwenkosi Mlotshwa, Xin Ge,
Gail J. Pruss, Joseph R. Ecker, Lewis H. Bowman and Vicki Vance
3. Enhanced Disease Susceptibility 1 and Salicylic Acid Act 56
Redundantly to Regulate Resistance Gene-Mediated Signaling
Srivathsa C. Venugopal, Rae-Dong Jeong, Mihir K. Mandal,
Shifeng Zhu, A. C. Chandra-Shekara, Ye Xia, Matthew Hersh,
Arnold J. Stromberg, DuRoy Navarre, Aardra Kachroo and
Pradeep Kachroo
4. Strategies of Nitrosomonas europaea 19718 to Counter Low 88
Dissolved Oxygen and High Nitrite Concentrations
Ran Yu and Kartik Chandran
6 Phytopathology in Plants

5. A Novel Pathogenicity Gene is Required in the Rice Blast Fungus 107

to Suppress the Basal Defenses of the Host
Myoung-Hwan Chi, Sook-Young Park, Soonok Kim and
Yong-Hwan Lee
6. Differential Gene Expression in Incompatible Interaction 142
between Wheat and Stripe Rust Fungus Revealed by Cdna-AFLP
and Comparison to Compatible Interaction
Xiaojie Wang, Wei Liu, Xianming Chen, Chunlei Tang, Yanling Dong,
Jinbiao Ma, Xueling Huang, Guorong Wei, Qingmei Han, Lili Huang
and Zhensheng Kang
7. Generation and Analysis of Expression Sequence Tags from 169
Haustoria of the Wheat Stripe Rust Fungus Puccinia striiformis
f. sp. Tritici
Chuntao Yin, Xianming Chen, Xiaojie Wang, Qingmei Han,
Zhensheng Kang and Scot H. Hulbert
8. Living the Sweet Life: How does a Plant Pathogenic Fungus 186
Acquire Sugar from Plants?
Nicholas J. Talbot
9. FRAP Analysis on Red Alga Reveals the Fluorescence Recovery 193
is Ascribed to Intrinsic Photoprocesses of Phycobilisomes Rather
Than Large-Scale Diffusion
Lu-Ning Liu, Thijs J. Aartsma, Jean-Claude Thomas, Bai-Cheng Zhou
and Yu-Zhong Zhang
10. Distinct, Ecotype-Specific Genome and Proteome Signatures 213
in the Marine Cyanobacteria Prochlorococcus
Sandip Paul, Anirban Dutta, Sumit K. Bag, Sabyasachi Das
and Chitra Dutta
11. Global Expression Analysis of the Brown Alga Ectocarpus 241
siliculosus (Phaeophyceae) Reveals Large-Scale Reprogramming
of the Transcriptome in Response to Abiotic Stress
Simon M. Dittami, Delphine Scornet, Jean-Louis Petit,
Béatrice Ségurens, Corinne Da Silva, Erwan Corre, Michael Dondrup,
Karl-Heinz Glatting, Rainer König, Lieven Sterck, Pierre Rouzé,
Yves Van de Peer, J. Mark Cock, Catherine Boyen and Thierry Tonon
 Contents  7

12. Chloroplast Genome Sequence of the Moss Tortula ruralis: 278

Gene Content, Polymorphism, and Structural Arrangement
Relative to Other Green Plant Chloroplast Genomes
Melvin J. Oliver, Andrew G. Murdock, Brent D. Mishler,
Jennifer V. Kuehl, Jeffrey L. Boore, Dina F. Mandoli,
Karin D. E. Everett, Paul G. Wolf, Aaron M. Duffy and
Kenneth G. Karol
13. Erwinia Carotovora Elicitors and Botrytis Cinerea Activate 293
Defense Responses in Physcomitrella patens
Inés Ponce de León, Juan Pablo Oliver, Alexandra Castro,
Carina Gaggero, Marcel Bentancor and Sabina Vidal
Index 318
 introduction

This volume includes the latest research into the diseases that affect plants.
Phytopathology, the scientific study of plant diseases caused by pathogens (infec-
tious diseases) and environmental conditions (physiological factors), is an ever-
growing field, with research constantly bringing to light new information. Or-
ganisms that cause infectious disease include fungi, oomycetes, bacteria, viruses,
viroids, virus-like organisms, phytoplasmas, protozoa, nematodes, and parasitic
plants. Chapters within this book bring to light the most recent studies of patho-
gen identification, disease etiology, disease cycles, economic impact, plant disease
epidemiology, plant disease resistance, how plant diseases affect humans and ani-
mals, pathosystem genetics, and management of plant diseases. The information
provided here will allow readers to stay current with this field’s ongoing research
and ever-developing knowledge base.

— Philip Stewart, PhD

 Expanding the Paradigms of
Plant Pathogen Life History
and Evolution of Parasitic
Fitness Beyond Agricultural
Boundaries

Cindy E. Morris, Marc Bardin, Linda L. Kinke, Benoit Moury,

Philippe C. Nicot and David C. Sands

Introduction
How do pathogens, whether they parasitize plants or animals, acquire virulence to
new hosts and resistance to the arms we deploy to control disease? The significance
of these questions for microbiology and for society at large can be illustrated by
the recent worldwide efforts to track and limit the emergence of human transmis-
sible strains of swine and avian influenza virus and of multidrug-resistant lines
of human pathogenic bacteria, and to restrain the spread of Ug99, a strain of
12 Phytopathology in Plants

stem rust of wheat. Recent research in medical epidemiology has elucidated the
impact of pathogen ecology in environmental reservoirs on the evolution of novel
or enhanced pathogen virulence. In contrast, the evolution of virulence in plant
pathogens has been investigated from a predominantly agro-centric perspective,
and has focused overwhelmingly on evolutionary forces related to interactions
with the primary plant host. Here, we argue that current concepts from the field
of medical epidemiology regarding mechanisms that lead to acquisition of novel
virulence, biocide resistance, and enhanced pathogenic fitness can serve as an im-
portant foundation for novel hypotheses about the evolution of plant pathogens.
We present numerous examples of virulence traits in plant pathogenic microor-
ganisms that also have a function in their survival and growth in nonagricultural
and nonplant habitats. Based on this evidence, we make an appeal to expand con-
cepts of the life history of plant pathogens and the drivers of pathogen evolution
beyond the current agro-centric perspective.

Paradigms of Evolution of Virulence in Human

“Environmental Pathogens”
The classification of diseases in terms of their epidemiology is a useful starting
point for a comparison of plant and human pathogens [1]. In medical epidemiol-
ogy, anthroponoses are diseases transmitted among humans that have no other
known reservoirs for multiplication. Typhoid fever, smallpox, and certain vene-
real diseases are examples. Zoonoses, such as rabies, lyme disease, severe acute
respiratory syndrome (SARS), and avian and swine influenzas, are transmitted
to humans from living animals. Sapronoses are diseases transmitted to humans
from environmental reservoirs where the pathogen thrives saprophytically. These
habitats include soil, water, and decaying plant and animal matter. Examples in-
clude Legionnaire’s disease, cholera, aspergillosis, and the emerging epidemics of
melioidosis (Burkholderia pseudomallei). Human pathogens with saprophytic
phases or residing in environmental reservoirs are also referred to as “environmen-
tal pathogens” [2]–[6].
Studies of virulence factors of human pathogens in environmental reservoirs
have begun to reveal the importance of alternate hosts, of dual-use virulence fac-
tors, and in general of how environmental habitats can select for traits that confer
enhanced fitness as human pathogens. For example, interactions with microbial
eukaryotes seem to have led to the acquisition of traits useful for pathogenicity to
mammalian cells. Numerous environmental pathogens, including Cryptococcus
neoformans, Legionella spp., Chlamydophila pneumoniae, Mycobacterium avi-
um, Listeria monocytogenes, Pseudomonas aeruginosa, and Francisella tularensis,
 Expanding the Paradigms of Plant Pathogen Life History 13

might have acquired virulence traits via their resistance to predation by amoebae.
This resistance, associated with the ability to grow inside the amoebae—which
are essentially alternate hosts—has likely led to the selection of traits conferring
survival in macrophages [7]. Resistance to macrophages involves the capacity of
the bacteria to resist or debilitate the macrophage’s phagosomes and to multiply in
the cytoplasm. Many of the traits essential for virulence to humans likewise seem
to play roles in adaption to the environments where the organisms are saprophytes
(Table 1). These traits have dual roles in environmental and parasitic fitness and
are thus referred to as “dual-use traits”. Melanins, siderophores, and the capac-
ity to form biofilms are among the frequently cited examples. C. neoformans
provides one of the richest examples of dual-use traits. This fungus, frequently
found in soils that contain high levels of bird guano and in association with cer-
tain plants, causes meningoencephalitis. A nonexhaustive list of its dual-use traits
includes capsule formation and production of melanin, laccase, phospholipase,
proteases, and ureases [8]. In the environment these traits contribute to survival
and in human hosts they contribute to the capacity of C. neoformans to avoid
host resistance mechanisms and to attack host tissue. Microbial efflux pumps have
also evolved dual uses. These transport systems are used for managing toxic com-
pounds in the environment of the microorganism and can have a broad spectra
of activity leading to multidrug resistance among environmental microorganisms
[9]. Human activities resulting in the disposal of a wide range of chemical prod-
ucts into the environment, including household cleaners that contain the broad
spectrum antimicrobial triclosan, may be inadvertently exacerbating the abun-
dance of multidrug-resistant bacteria [10].

Table 1. Examples of putative dual-use traits related to pathogenic and environmental fitness of human
pathogens.
14 Phytopathology in Plants

Virulence of environmental pathogens has been described as a set of cards, or a

diverse set of attributes acquired as a function of the life history of a pathogen and
its adaptation to different environments [3],[8]. It is becoming increasingly clear
that evolutionary forces outside the context of human–pathogen interactions are
responsible for the acquisition and maintenance of some virulence factors [11].
Genomics and phylogenetics are revealing the evolutionary link between, for
example, commensal strains of Escherichia coli and modern pathogens such as
enterohaemorrhagic strains of this species (such as O157). The mechanisms pro-
posed to explain how these commensals have become pathogens are grounded
in their ecology and life histories, culminating in the notion of ecological evolu-
tion (“eco-evo”) [11]. The eco-evo approach to understanding the emergence of
pathogens gives credence, from the perspective of genomics, to evolutionary and
adaptive scenarios that are surmised from a thorough understanding of the ecol-
ogy and life history of pathogens.

Links Between Plant Pathogenicity, Adaptation

to Biotic and Chemical Stress, and Key Vital
Functions
At present, epidemiological classifications of plant diseases are based on the in-
teraction of the pathogen and the host (biotrophic or necrotrophic, obligate or
facultative), on the number of cycles of propagule production (mono- and poly-
cyclic diseases), on the importance of latency in symptom expression, and on the
role of vectors, but there is no formalized equivalent of “sapronoses”. Neverthe-
less, numerous plant pathogens are present in diverse nonagricultural habitats or
survive saprophytically in agricultural contexts. These include a range of bacteria,
fungi, and stable viruses (a nonexhaustive list of examples is presented in Table 2).
A striking characteristic of many of the virulence factors of these plant pathogens
is that they are linked to—or are in themselves—traits critical to adaptation to
the nonplant environment, as will be illustrated below. This provides a compelling
reason to adopt a holistic view of the life history and evolution of plant pathogens,
to move beyond the traditional borders of agriculture and the presumed “pri-
mary” plant host. Adaptation to biotic and abiotic stresses, within or outside of
agricultural habitats, likely plays as important a role in the evolution of parasitic
fitness of plant pathogens as it does for human pathogens.
As illustrated above, traits that confer fitness in response to biotic and abi-
otic environmental stress can have dual-use as virulence factors in human patho-
gens. Toxins and toxin transport systems (including efflux pumps, in particular)
are among the common adaptations for antagonizing and defending against the
 Expanding the Paradigms of Plant Pathogen Life History 15

co-inhabitants of a habitat. In plant pathogens, the transport systems for toxins

and antimicrobials can have broad spectrum activity, leading to resistance to agri-
cultural fungicides and also contributing to virulence [12]. Genes coding for wide
spectrum efflux pumps are present in the chromosomes of all living organisms [9].
The efflux pump BcAtrB of Botrytis cinerea confers resistance to antimicrobials
produced by soil and plant microflora (2,4-diacetylphloroglucinol and phenazine
antibiotics) [13],[14] and also to the fungicide fenpiclonil and the plant defen-
sive phytoalexin resveratrol [15]. The transporter ABC1 from Magnaporthe grisea
protects the fungus against azole fungicides and the rice phytoalexin sakurane-
tin [12]. Numerous plant pathogenic bacteria, including Erwinia amylovora,

Table 2. Examples of plant pathogens reported to thrive in nonagricultural habitats or to survive saprophytically
in agricultural contexts in the absence of host plants.
16 Phytopathology in Plants

Dickeya spp. (formerly the multiple biovars of E. chrysanthemi), and Agrobacte-

rium tumefaciens, also produce efflux pumps that are involved in their resistance
to plant antimicrobials (reviewed by Martinez et al. [9]). Toxins themselves can
have a broad spectrum of action. For example, mycotoxins, well known for their
human and animal toxicity, have broad spectrum activity and are thought to have
evolved as a defense against predators (nematodes) and antagonists (other micro-
organisms) [16]. One family of these, the trichothecenes, contributes significantly
to the virulence of many Gibberella (Fusarium) species [17].
Adaptation to biotic stress also implicates systems for the detection or inhibi-
tion of arms of aggression used by co-inhabitants. Recent work on fungi suggests
that systems to detect enzymes that degrade fungal cell walls are also deployed as
virulence factors. Lysin motifs (LysMs) are carbohydrate-binding protein mod-
ules that have been found in mammalian and plant pathogenic fungi as well as
in saprophytes [18]. Bolton et al. [19] demonstrated that the LysM protein Ecp6
acts as a virulence factor in the plant pathogenic fungus Cladosporium fulvum.
As virulence factors they may suppress host defenses by sequestrating chitin oli-
gosaccharides that are known to act as elicitors of plant defense responses [19]
and also as activators of host immune responses in mammals [20]. de Jonge and
Thomma [18] suggest that these proteins may also have a role in the protection
of saprophytic fungi against chitinase-secreting competitor microbes or myco-
parasites.
Protection against abiotic stress can involve molecules that have also become
virulence factors. Siderophores [21]–[23] and various pigments including mela-
nins [24] are virulence factors in some human pathogens. Siderophores contrib-
ute to resistance to oxidative stress and sequestering iron when it is rare in the
environment. In the plant pathogens Alternaria brassicicola, Cochliobolus spp.,
Fusarium graminearum [25], and M. grisea [26], siderophores or their precur-
sors are virulence factors. Melanins offer protection from extreme temperatures,
UV radiation, and antimicrobials. In the plant pathogens M. grisea and Col-
letotrichum spp., melanins are also virulence factors via their essential role in
the formation of tissue-penetration structures such as appressoria [17]. In many
cases, toxins and siderophores are produced by nonribosomal peptide synthase or
polyketide synthase pathways. These pathways, widely distributed in the micro-
bial world, are highly adaptable and have given rise to a wide range of compounds
with a plethora of activities, including many of pharmaceutical importance [27].
HC-toxin of Cochliobilus carbonum, victorin in C. victoriae, and T-toxin in C.
heterostrophus are products of these pathways [28]. The key virulence factor of
Streptomyces spp., thaxtomin [29], and the multitude of host-specific and non-
specific toxins in Pseudomonas syringae pathovars [30] are also produced by these
pathways.
 Expanding the Paradigms of Plant Pathogen Life History 17

The capacity to detect changes in conditions of the abiotic environment has

also become part of the virulence factors of some plant pathogens. For example, to
detect changes in environmental conditions, organisms exploit two-component
histidine kinase complexes. These are key elements of the machinery for signal
sensing, allowing bacteria, yeasts, fungi, and plants to adapt to changing environ-
ments. In the plant pathogen B. cinerea, one of its multiple histidine kinases,
BOS1, not only mediates osmosensitivity and resistance to fungicides, but is also
essential for formation of macroconidia and expression of virulence [31].
Recognition and understanding of the full complexity of the life history of
plant pathogens will enhance our capacity to evaluate the diversity and intensity
of environmental stresses that microorganisms face and will contribute novel hy-
potheses concerning the role of environmental stresses in the evolution of patho-
genicity. Stress is considered to play an important role in adaptive evolution in
general, in particular via its effect on mutation rates [32]. For certain fungi and
bacteria, including plant pathogens, stress increases the activity of transposable
elements [33]–[35] and induces the SOS response and other systems involved in
the modification or repair of DNA [32]. Mutations can target the ensemble of the
microbial genome. However, it has been suggested that adaptation of bacteria to
multiple stresses can lead, in particular, to the acquisition of virulence factors and
to the emergence of pathogenic variants [36].
Adaptation to specific habitats—which involves adapting to a particular
ensemble of biotic and abiotic parameters—could also influence the evolution
of parasitic fitness. Available examples focus on soil-borne and rhizosphere mi-
croorganisms. The rhizosphere is a dynamic soup whose chemistry changes as
plants grow, die, and degrade. Chemicals in the rhizosphere are food substrates
and means of communication, antagonism, and collaboration among microor-
ganisms, among plants, and between plants and microorganisms. To decompose
dead plant material and recycle carbon, microorganisms have developed a range
of cell wall–degrading enzymes, without which our planet would be quite encum-
bered by the accumulation of tissue from dead plants. Pectolytic, cellulolytic, and
lignolytic enzymes are also well-known pathogenicity factors [37]–[39]. To hone
the efficiency of these enzymes in planta, pectinolytic fungi are adept at modulat-
ing the surrounding pH. Alternaria, Penicillium, Fusarium spp., and Sclerotinia
sclerotiorum also exploit these pH changes to enhance the action of these en-
zymes as virulence factors [40]. Streptomyces spp. are considered quintessential
soil inhabitants. Their ability to degrade biopolymers, including cellulose and
chitin, contributes greatly to nutrient cycling, and their vast array of antimicro-
bials contributes to survival and microbial communication in soil [29]. Some
Streptomyces species are pathogenic to root crops and to potatoes in particular.
A recently discovered virulence factor in Streptomyces, a saponinase homologue
18 Phytopathology in Plants

[29], may be the result of adaptation to the rhizosphere. Saponins are plant gly-
cosides that contribute to resistance against fungi and insect herbivores. Bacteria,
and especially Gram-positive bacteria, can also be sensitive. Saponins are also ex-
uded from the roots of some plant species where they have allelopathic as well as
antimicrobial activity [41],[42].
Key vital functions, housekeeping functions, and basic life cycle processes
should also be considered for their potential to give rise to pathogenicity factors.
Traits fundamental to fitness and survival in general can confer or enhance patho-
genic fitness. In plant pathogenic bacteria these include flagella, motility, lipo-
and exo- polysaccharides, O-antigens, fimbriae, mechanisms for iron acquisition
and for quorum sensing, toxin production, cell wall–degrading enzymes, and re-
sistance to oxidative stress [43]. Motility, for example, is essential to dispersal and
for attaining new resources. In Ralstonia solanacearum it is also essential for early
stages of plant invasion and colonization during pathogenesis [44]. In the fungus
Aschochyta rabiei, kinesins that are essential for polarized growth and transport of
organelles are suspected to be a virulence factor [45]. An F-box protein of Giber-
rella zeae has been reported to be involved in sexual reproduction and in pathoge-
nicity [46]. The enzymes that allow fungi to detoxify compounds resulting from
plant defense mechanisms are probably also simply means of acquiring nutrients
[47]. For example, detoxification of tomatine in tomatoes by Septoria lycoper-
cici and by Fusarium oxysporum f. sp. lycopersici is achieved by the deployment
of glycosyl hydrolases by these fungi; Gaeumannomyces graminis detoxifies ave-
nacins in oats via a beta-glucosidase [28]. Another example of adaptation of basic
cellular functions into pathogenicity factors concerns elicitins. Elicitins are part of
one of the most highly conserved protein families in the Phytophthora genus and
are widespread throughout Phytophthora species. Elicitins of P. infestans induce
hypersensitivity in plants. Recent work from Jiang and colleagues [48] suggests
that a primary function of elicitins is the acquisition of sterols from the environ-
ment.

Toward New Paradigms about the Evolution of

Plant Pathogenicity: The Roles of Dual-Use Traits
and Exaptation
How can we make sense of the processes that have led to the wide variety of
pathogenicity factors in plant pathogens and that continue to drive the evolu-
tion of pathogens? Bacterial plant pathogens are particularly illustrative of the
differences in suites of secretion systems [43],[49],[50],[51] and of effectors
[50],[51],[52],[53],[54],[55] among members of different genera, species, or
 Expanding the Paradigms of Plant Pathogen Life History 19

strains of the same species that attack plants. Effectors are proteins secreted by
plant pathogens that modulate plant defense reactions, thereby enabling the
pathogen to colonize the plant tissues. It is tempting to wonder if the effectors and
secretion systems have critical roles in fitness elsewhere other than in association
with the host plant. The examples listed above that describe traits that play roles
in both environmental fitness and virulence to plants provide a compelling incen-
tive to expand our paradigms concerning the forces that drive evolution of plant
pathogenicity. The evolutionary forces that have been described to date for plant
pathogens [56] need to be extended beyond the current agro-centric paradigm.
To expand this paradigm we propose that the life cycles and life histories of
plant pathogens be reconsidered. Studies of pathogen ecology, evolution, and life
history should include the full range of habitats and reservoirs these organisms
can inhabit. This in turn will permit testing a range of novel hypotheses about the
role of ecological contexts—other than direct interaction with host plants—as
forces of evolution. In Table 3 we propose some such hypotheses. For example,
rates of mutation and of transposition of insertion sequences or of transposable
elements including phages might be different when a microorganism inhabits
nonagricultural habitats (biofilms, lake water, or inert surfaces exposed to UV, for
example) than when it colonizes plants. The consequences of these mutations for
pathogenicity might in turn be markedly different than for fitness in nonagricul-
tural habitats. Likewise, the formation of spores or aggregates that can be released
into the air and their survival over long distances might be highly influenced by
the nature of the reservoir that the pathogen colonizes, resulting in direct effects
of habitat on gene flow. Furthermore, the biotic and abiotic stresses endured in
nonagricultural habitats might exert positive selection for adaptive survival traits
that have dual-use as virulence factors as illustrated in the examples above. These
questions are clearly pertinent for pathogens that are not obligate biotrophs.
However, the complexity of the biotic and abiotic environment perceived by ob-
ligate biotrophs during colonization of plants (powdery mildews on leaf surfaces
inhabited by other microorganisms, for example) or during their dissemination
(survival in air or in association with vectors) are also likely to exert selection inde-
pendent of that due to the host plant genotype per se. These are only some of the
ways in which environmental parameters other than the host plant are expected to
have a marked influence on the diversification of plant pathogens.
If nonagricultural environments can foster the evolution of traits that contrib-
ute to pathogen virulence, other scenarios are also probable where i) crop plants
foster the emergence of traits antagonistic to survival outside of agricultural con-
texts ii) or nonagricultural environments foster the emergence of traits that are
detrimental to pathogen virulence in crops. Understanding the prevalence and
significance of alternative habitats to pathogen life history is crucial to determining
20 Phytopathology in Plants

the broad costs of virulence for pathogen fitness. The cost of virulence in terms of
fitness in association with plants has been explored extensively for several obligate
parasites such as rusts and powdery mildews. Work by Thrall and Burdon [57] has
shown clear fitness tradeoffs between pathogen aggressiveness (capacity to induce
intense disease symptoms) and dissemination (via intense spore production). For
nonobligate pathogens we do not know the cost of fitness outside of agricultural
habitats. The interplay between evolutionary forces and habitat has not been ex-
plored for plant pathogens and might be a key feature in the emergence of certain
diseases.

Table 3. Novel hypotheses to be tested concerning the impact of substrates other than host plants on the
evolutionary potential of plant pathogens.

By expanding our paradigms concerning pathogen life history and the selective
forces that drive plant pathogen evolution, we will enhance our understanding of
how pathogens survive in the absence of hosts, how and where new pathotypes are
likely to emerge, and the significance of natural habitats to agricultural epidemics.
Insights will come from fundamental research to identify the mechanisms that
drive the evolution of pathogenic traits and to explore the ecological significance
of pathogenic traits to microbial fitness apart from the plant host. Distinguish-
ing the role of adaptation sensu stricto in the emergence of plant pathogenic-
ity relative to that of exaptation [58], the useful cooptation of phenotypes that
have arisen under natural selection due to forces unrelated to interaction with the
 Expanding the Paradigms of Plant Pathogen Life History 21

primary host plant, will yield critical insight into how plant pathogens evolve
independently of agricultural practices. A more complete understanding of the
forces that drive plant pathogen evolution will be critical to enhancing and diver-
sifying sustainable disease control strategies, and will improve prediction of the
conditions that support the emergence of novel pathogens.

Acknowledgements
We thank the three anonymous reviewers for their constructive comments and for
the suggestion of additional materials to incorporate into the text. We also thank
Dr. Melodie Putnam (Oregon State University, United States of America) for use-
ful discussions about the ecology of bacterial plant pathogens.

Competing Interests
The authors have declared that no competing interests exist.

References
1. Hubálek Z (2003) Emerging human infectious diseases: anthroponoses,
zoonoses and sapronoses. Emerg Infect Dis 9: 403–404.
2. Cangelosi GA, Freitag NE, Buckley MR (2004) From outside to inside: envi-
ronmental microorganisms as human pathogens. A report from the American
Academy of Microbiology. Washington (D.C.): American Academy of Micro-
biology. 18 p. Available: http://academy.asm.org/images/stories/do​cuments/
fromoutsidetoinsidecolor.pdf . Accessed 29 November 2009.
3. Casadevall A, Pirofski L (2007) Accidental virulence, cryptic pathogenesis,
Martians, lost hosts, and the pathogenicity of environmental microbes. Eu-
karyotic Cell 6: 2169–2174.
4. Hall-Stoodley L, Stoodley P (2005) Biofilm formation and dispersal and the
transmission of human pathogens. Trends Microbiol 13: 7–10.
5. Reedy JL, Bastidas RJ, Heitman J (2007) The virulence of human pathogenic
fungi: notes from the south of France. Cell Host Microbe 2: 77–83.
6. Yildiz FH (2007) Processes controlling the transmission of bacterial pathogens
in the environment. Res Microbiol 158: 195–202.
7. Greub G, Raoult D (2004) Microorganisms resistant to free-living amoebae.
Clin Microbiol Rev 17: 413–433.
22 Phytopathology in Plants

8. Casadevall A, Steenbergen JN, Nosanchuk JD (2003) ‘Ready made’ virulence

and ‘dual use’ virulence factors in pathogenic environmental fungi—the Cryp-
tococcus neoformans paradigm. Curr Opin Microbiol 6: 332–337.
9. Martinez JL, Sánchez MB, Martínez-Solano L, Hernandez A, Garmendia L,
et al. (2009) Functional role of bacterial multidrug efflux pumps in microbial
natural ecosystems. FEMS Microbial Rev 33: 430–449.
10. Sanchez P, Moreno E, Martinez JL (2005) The biocide triclosan selects Stenotro-
phomonas maltophilia mutants that overproduce the SmeDEF multidrug ef-
flux pump. Antimicrob Agents Chemother 2: 781–782.
11. Pallen MJ, Wren MW (2007) Bacterial pathogenomics. Nature 449: 835–
842.
12. Del Sorbo G, Schoonbeek H, De Waard MA (2000) Fungal transporters in-
volved in efflux of natural toxic compounds and fungicides. Fungal Genet Biol
30: 1–15.
13. Schoonbeek HJ, Raaijmakers JM, De Waard MA (2002) Fungal ABC trans-
porters and microbial interactions in natural environments. Mol Plant Microbe
Interact 15: 1165–1172.
14. Schouten A, Maksimova O, Cuesta-Arenas Y, van den Berg G, Raaijmakers JM
(2008) Involvement of the ABC transporter BcAtrB and the laccase BcLCC2
in defence of Botrytic cinerea against the broad-spectrum antibiotic 2,4-di-
acetylphloroglucinol. Environ Microbiol 10: 1145–1157.
15. Schoonbeek H, Del Sorbo G, De Waard MA (2001) The ABC transporter
BcatrB affects the sensitivity of Botrytis cinerea to the phytoalexin resveratol
and the fungicide fenpiclonil. Mol Plant Microbe Interact 14: 562–571.
16. Etzel RA (2002) Mycotoxins. JAMA 287: 425–427.
17. Idnurum A, Howlett BJ (2001) Pathogenicity genes of phytopathogenic fungi.
Mol Plant Pathol 2: 241–255.
18. de Jonge R, Thomma BPHJ (2009) Fungal LysM effectors: extinguishers of
host immunity? Trends Microbiol 17: 151–157.
19. Bolton MD, van Esse HP, Vossen JH, de Jonge R, Stergiopoulos I, et al. (2008)
The novel Cladosporium fulvum lysin motif effector Ecp6 is a virulence factor
with orthologues in other fungal species. Mol Microbiol 69: 119–136.
20. Da Silva CA, Hartl D, Liu W, Lee CG, Elias JA (2008) TLR-2 and IL-17A
in chitin-induced macrophage activation and acute inflammation. J Immunol
181: 4279–4286.
 Expanding the Paradigms of Plant Pathogen Life History 23

21. Hwang LH, Mayfield JA, Rine J, Sil A (2008) Histoplasma requires SID1, a
member of an iron-regulated siderophore gene cluster, for host colonization.
PLoS Pathog 4: e1000044. doi:1000010.1001371/journal.ppat.1000044.
22. Ratledge C, Dover LG (2000) Iron metabolism in pathogenic bacteria. Annu
Rev Microbiol 54: 881–941.
23. Schrettl M, Bignell E, Kragl C, Sabiha Y, Loss O, et al. (2007) Distinct roles for
intra- and extracellular siderophores during Aspergillus fumigatus infection.
PLoS Pathog 3: e128.
24. Liu GY, Nizet V (2009) Color me bad: microbial pigments as virulence factors.
Trends Microbiol 17: 406–413.
25. Lee BN, Kroken S, Chou DYT, Robbertse B, Yoder OC, et al. (2005) Func-
tional analysis of all nonribosomal peptide synthetases in Cochliobolus het-
erostrophus reveals a factor, NPS6, involved in virulence and resistance to oxi-
dative stress. Eukaryot Cell 4: 545–555.
26. Hof C, Eisfeld K, Welzel K, Antelo L, Foster AJ, et al. (2007) Ferricrocin syn-
thesis in Magnaporthe grisea and its role in pathogenicity in rice. Molec Plant
Pathol 8: 163–172.
27. Rausch CR, Hoof I, Weber T, Wohlleben W, Huson DH (2007) Phylogenetic
analysis of condensation domains in NRPS sheds light on their functional evo-
lution. BMC Evol Biol 7: 78.
28. Berbee ML (2001) The phylogeny of plant and animal pathogens in the Asco-
mycota. Physiol Mol Plant Pathol 59: 165–187.
29. Loria R, Kers J, Joshi M (2006) Evolution of plant pathogenicity in Streptomy-
ces. Annu Rev Phytopathol 44: 469–487.
30. Bender CL, Alarcon-Chaidez F, Gross DC (1999) Pseudomonas syringae phy-
totoxins: Mode of action, regulation and biosynthesis by peptide and polyketide
synthetases. Microbiol Molec Biol Rev 63: 266–292.
31. Viaud M, Fillinger S, Liu W, Polepalli JS, Le Pêcheur P, et al. (2006) A class III
histidine kinase acts as a novel virulence factor in Botrytis cinerea. Mol Plant
Microbe Interact 9: 1042–1050.
32. Bjedov I, Tenaillon O, Gérard B, Souza V, Denamur E, et al. (2003) Stress-
induced mutagenisis in bacteria. Science 300: 1404–1409.
33. Ikeda K, Nakayashiki H, Takagi M, Tosa Y, Mayama S (2001) Heat shock,
copper sulfate and oxidative stress activate the retrotransposon MAGGY resi-
dent in the plant pathogenic fungus Magnaporthe grisea. Mol Genet Genom-
ics 266: 318–325.
24 Phytopathology in Plants

34. Ilves H, Hõrak R, Teras R, Kivisaar M (2004) IHF is the limiting host factor in
transposition of Pseudomonas putida transposon Tn4652 in stationary phase.
Mol Microbiol 51: 1773–1785.
35. Mes JJ, Haring MA, Cornelissen BJC (2000) Foxy: an active family of short
interspersed nuclear elements from Fusarium oxysporum. Mol Gen Genet 263:
271–280.
36. Arnold DL, Jackson RW, Waterfield NR, Mansfield J (2007) Evolution of mi-
crobial virulence: the benefits of stress. Trends Genet 23: 293–300.
37. Annis SL, Goodwin PH (1997) Mini review: recent advances in the molecular
genetics of plant cell wall-degrading enzymes produced by plant pathogenic
fungi. Europ J Plant Pathol 103: 1–14.
38. Collmer A, Bauer DW, He SY, Lindeberg M, Kelemu S, et al. (1990) Pectic
enzyme production and bacterial plant pathogenicity. In: Hennecke H, Verma
DPS, editors. Advances in molecular genetics of plant-microbe interactions.
Kluwer Academic Publishers. pp. 65–72.
39. Reignault P, Valette-Collet O, Boccara M (2008) The importance of fungal
pectinolytic enzymes in plant invasion, host adaptability and symptom type.
Eur J Plant Pathol 120: 1–11.
40. Prusky D, Yakoby N (2003) Pathogenic fungi: leading or led by ambient pH?
Mol Plant Pathol 5: 509–516.
41. Bais HP, Weir TL, Perry LT, Gilroy S, Vivanco JM (2006) The role of root exu-
dates in rhizosphere interactions with plants and other organisms. Annu Rev
Plant Biol 57: 233–266.
42. Oleszek WA, Hoagland RE, Zablotwicz RM (1999) Ecological significance of
plant saponins. In: Inderjit D, Foy CL, editors. Principles and practices in plant
ecology: allelochemical interactions. Baton Rouge: CRC Press. pp. 451–465.
43. Toth IK, Pritchard L, Birch PRJ (2006) Comparative genomics reveals what
makes an enterobacterial plant pathogen. Annu Rev Phytopathol 44: 305–
336.
44. Tans-Kersten J, Huang H, Allen C (2001) Ralstonia solanacearum needs mo-
tility for invasive virulence on tomato. J Bacteriol 183: 3597–3605.
45. White D, Chen W (2007) Towards identifying pathogenic determinants of the
chickpea pathogen Ascochyta rabiei. Eur J Plant Pathol 119: 3–12.
46. Han YK, Kim MD, Lee SH, Yun SH, Lee YW (2007) A novel F-box protein
involved in sexual development and pathogenesis in Gibberella zeae. Molec
Microbiol 63: 768–779.
 Expanding the Paradigms of Plant Pathogen Life History 25

47. Divon HH, Fluhr R (2007) Nutrition acquisition strategies during fungal in-
fection of plants. FEMS Microbial Lett 266: 65–74.
48. Jiang RHY, Tyler BM, Whisson SC, Hardham AR, Govers F (2006) Ancient
origin of elicitin gene clusters in Phytophthora genomes. Molec Biol Evol 23:
338–351.
49. Bell KS, Sebaihia M, Pritchard L, Holden MTG, Hyman LJ, et al. (2004) Ge-
nome sequence of the enterobacterial phytopathogen Erwinia carotovora sub-
sp. atroseptica and characterization of virulence factors. 101: 11105–11110.
50. da Silva ACR, Ferro JA, Reinach FC, Farah CS, Furlan LR, et al. (2002) Com-
parison of the genomes of two Xanthomonas pathogens with differing host
specificities. Nature 417: 459–463.
51. Thieme F, Koebnik R, Bekel T, Berger C, Boch J, et al. (2005) Insights into
genome plasticity and pathogenicity of the plant pathogenic bacterium Xan-
thomonas campestris pv. vesicatoria revealed by the complete genome sequence.
J Bacteriol 187: 7254–7266.
52. Lindeberg M, Myers CR, Collmer A, Schneider DJ (2008) Roadmap to new
virulence determinants in Pseudomonas syringae: insights from comparative
genomics and genome organization. Mol Plant Microbe Interact 21: 685–
700.
53. Rohmer L, Guttman DS, Dangl JL (2004) Diverse evolutionary mechanisms
shape the type III effector virulence factor repertoire in the plant pathogen
Pseudomonas syringae. Genetics 167: 1341–1360.
54. Kamoun S (2007) Groovy times: filamentous pathogen effectors revealed. Curr
Opinion Plant Biol 10: 358–365.
55. Setubal JC, Moreira AM, da Silva ACR (2005) Bacterial phytopathogens and
genome science. Curr Opinion Microbiol 8: 595–600.
56. McDonald BA, Linde C (2002) The population genetics of plant pathogens
and breeding strategies for durable resistance. Euphytica 124: 163–180.
57. Thrall PH, Burdon JJ (2003) Evolution of virulence in a plant host-pathogen
metapopulation. Science 299: 1735–1737.
58. Gould SJ, Vrba E (1982) Exaptation–A missing term in the science of form.
Paleobiology 8: 4–14.
59. Pruzzo C, Vezzulli L, Colwell RR (2008) Global impact of Vibrio cholerea
interactions with chitin. Environ Microbiol 10: 1400–1410.
60. Reguera G, Kolter R (2005) Virulence and the environment: a novel role for
Vibrio cholera toxin-coregulated pili in biofilm formation on chitin. J Bacteriol
187: 3551–3555.
26 Phytopathology in Plants

61. Albert-Weissenberger C, Cazalet C, Buchrieser C (2007) Legionella pneimo-

phila–a human pathogen that co-evolved with fresh water protozoa. Cell Mol
Life Sci 84: 432–448.
62. Huber B, Feldmann F, Köthe M, Vandamme P, Wopperer J, et al. (2004) Iden-
tification of a novel virulence factor in Burkholderia cenocepacia H111 re-
quired for efficient slow killing of Caenorhabditis elegans. Infect Immun 72:
7220–7230.
63. Jarrett CO, Deak E, Isherwood KE, Oyston PC, Fischer ER, et al. (2004)
Transmission of Yersinia pestis from an infectious biofilm in the flea vector.
Journal of Infectious Diseases 190: 283–292.
64. Alonso A, Martínez JL (2000) Cloning and characterization of SmeDEF, a
novel multidrug efflux pump from Stenotrophomonas maltophilia. Antimi-
crob Agents Chemother 44: 3079–3086.
65. Nikaido H (1996) Multidrug efflux pumps of Gram-negative bacteria. J Bacte-
riol 178: 5853–5859.
66. Peleg AY, Seifert H, Paterson DL (2008) Acinetobacter baumannii: Emergence
of a successful pathogen. Clin Microbiol Rev 21: 538–582.
67. Parke JL, Gurian-Sherman D (2001) Diversity of the Burkholderia cepacia
complex and implications for risk assessment of biological control strains.
Annu Rev Phytopathol 39: 225–258.
68. Cother EJ, Gilbert RL (1990) Presence of Erwinia chrysanthemi in two ma-
jor river systems and their alpine sources in Australia. J Appl Bacteriol 69:
729–738.
69. Franc GD (1988) Long distance transport of Erwinia carotovora in the at-
mosphere and surface water [PhD dissertation]. Fort Collins: Colorado State
University. 131 p.
70. Harrison MD, Franc GD, Maddox DA, Michaud JE, McCarter-Zorner NJ
(1987) Presence of Erwinia carotovora in surface water in North America.
J Appl Bacteriol 62: 565–570.
71. McCarter-Zorner NJ, Franc GD, Harrison MD, Michaud JE, Quinn CE
(1984) Soft rot Erwinia bacteria in surface and underground waters in southen
Scotland and in Colorado, United-States. J Appl Bacteriol 57: 95–105.
72. Cruz AT, Cazacu AC, Allen CH (2007) Pantoea agglomerans, a plant pathogen
causing human disease. J Clin Microbiol 45: 1989–1992.
73. Manulis S, Barash I (2003) Pantoea agglomerans pvs. gypsophilae and betae,
recently evolved pathogens? Mol Plant Pathol 4: 307–314.
 Expanding the Paradigms of Plant Pathogen Life History 27

74. Morris CE, Kinkel LL, Kun X, Prior P, Sands DC (2007) A surprising niche for
the plant pathogen Pseudomonas syringae. Infection, Genetics and Evolution
7: 84–92.
75. Morris CE, Sands DC, Vinatzer BA, Glaux C, Guilbaud C, et al. (2008) The
life history of the plant pathogen Pseudomonas syringae is linked to the water
cycle. ISME Journal 2: 321–334.
76. Larkin MJ, DeMot R, Kulakov LA, Nagy I (1998) Applied aspects of Rhodo-
coccus genetics. Antonie van Leeuwenhoek 74: 133–153.
77. Putnam ML, Miller ML (2007) Rhodococcus fascians in herbaceous perenni-
als. Plant Dis 91: 1064–1076.
78. Vereecke D, Cornelis K, Temmerman W, Holsters M, Goethals K (2002) Ver-
satile persistence pathways for pathogens of animals and plants. Trends Micro-
biol 10: 485–488.
79. Frohlich-Nowoisky J, Pickersgill DA, Despres VR, Pöschl U (2009) High diver-
sity of fungi in air particulate matter. Proc Nat Acad Sci 106: 12814–12819.
80. Thomma BPHJ (2003) Alternaria spp.: from general saprophyte to specific
parasite. Molec Plant Pathol 4: 225–236.
81. Azmi OR, Seppelt RD (1998) The broad-scale distribution of microfungi in
the Windmill Islands region, continental Antarctica. Polar Biol 19: 92–100.
82. Baakza A, Vala AK, Dave BP, Dube HC (2004) A comparative study of sidero-
phore production by fungi from marine and terrestrial habitats. J Exp Mar Biol
Ecol 311: 1–9.
83. Keller L, Bidochka MJ (1998) Habitat and temporal differences among soil
microfungal assemblages in Ontario. Can J Bot 76: 1798–1805.
84. St. Leger RJ, Screen SE, Shams-Pirzadeh B (2000) Lack of host specialization
in Aspergillus flavus. Appl Environ Microbiol 66: 320–324.
85. Baker R (1981) Ecology of the fungus, Fusarium: competition. In: Nelson PE,
Toussoun TA, Cook RJ, editors. Fusarium, diseases, biology, and taxonomy.
University Park: The Pennsylvania State University Press. pp. 245–249.
86. Burgess LW (1981) General ecology of the fusaria. In: Nelson PE, Toussoun
TA, Cook RJ, editors. Fusarium, diseases, biology, and taxonomy. University
Park: The Pennsylvania State University Press. pp. 225–235.
87. Mandeel QA (2006) Biodiversity of the genus Fusarium in saline soil habitats.
J Basic Microbiol 46: 480–494.
88. Palmero Llamas D, de Cara Gonzalez M, Iglesias Gonzalez C, Ruíz Lopez G,
Tello Marquina JC (2008) Effects of water potential on spore germination and
viability of Fusarium species. J Ind Microbiol Biotechnol 35: 1411–1418.
28 Phytopathology in Plants

89. Vesonder RF, Hesseltine CW (1981) Metabolites of Fusarium. In: Nelson PE,
Toussoun TA, Cook RJ, editors. Fusarium, diseases, biology, and taxonomy.
University Park: The Pennsylvania State University Press. pp. 350–364.
90. Rouxel T, Balesdent MH (2005) The stem canker (blackleg) fungus, Lep-
tosphaeria maculans, enters the genomic era. Mol Plant Pathol 6: 225–241.
91. Sun BD, Yu HY, Chen AJ, Liu XZ (2008) Insect-associated fungi in soils of
field crops and orchards. Crop Protect 27: 1421–1426.
92. Nechwatal J, Wielgoss A, Mendgen K (2008) Diversity, host, and habitat speci-
ficity of oomycete communities in declining reed stands (Phragmites australis)
of a large freshwater lake. Mycol Res 112: 689–696.
93. Sonjak S, Frisvad JC, Gunde-Cimerman N (2006) Penicillium mycobiota in
Arctic subglacial ice. Microbial Ecol 52: 207–216.
94. Castello JD, Lakshman DK, Tavantzis SM, Rogers SO, Bachand GD, et al.
(1995) Detection of infectious tomato mosaic tobamovirus in fog and clouds.
Phytopathology 85: 1409–1412.
95. Castello JD, Rogers SO, Starmer WT, Catrianis CM, Ma L, et al. (1999) De-
tection of tomato mosaic tobamovirus RNA in ancient glacial ice. Polar Biol
22: 207–212.
96. Fillhart RC, Bachand GD, Castello JD (1998) Detection of infectious tobamo-
virus in forest soils. Appl Environ Microbiol 64: 1430–1435.
Two Plant Viral Suppressors
of Silencing Require the
Ethylene-Inducible Host
Transcription Factor RAV2 to
Block RNA Silencing

Matthew W. Endres, Brian D. Gregory, Zhihuan Gao,

Amy Wahba Foreman, Sizolwenkosi Mlotshwa, Xin Ge,
Gail J. Pruss, Joseph R. Ecker, Lewis H. Bowman
and Vicki Vance

Abstract
RNA silencing is a highly conserved pathway in the network of interconnect-
ed defense responses that are activated during viral infection. As a counter-
defense, many plant viruses encode proteins that block silencing, often also in-
terfering with endogenous small RNA pathways. However, the mechanism of
30 Phytopathology in Plants

action of viral suppressors is not well understood and the role of host factors in
the process is just beginning to emerge. Here we report that the ethylene-in-
ducible transcription factor RAV2 is required for suppression of RNA silenc-
ing by two unrelated plant viral proteins, potyvirus HC-Pro and carmovirus
P38. Using a hairpin transgene silencing system, we find that both viral sup-
pressors require RAV2 to block the activity of primary siRNAs, whereas sup-
pression of transitive silencing is RAV2-independent. RAV2 is also required
for many HC-Pro-mediated morphological anomalies in transgenic plants,
but not for the associated defects in the microRNA pathway. Whole genome
tiling microarray experiments demonstrate that expression of genes known to
be required for silencing is unchanged in HC-Pro plants, whereas a striking
number of genes involved in other biotic and abiotic stress responses are in-
duced, many in a RAV2-dependent manner. Among the genes that require
RAV2 for induction by HC-Pro are FRY1 and CML38, genes implicated as
endogenous suppressors of silencing. These findings raise the intriguing possi-
bility that HC-Pro-suppression of silencing is not caused by decreased expres-
sion of genes that are required for silencing, but instead, by induction of stress
and defense responses, some components of which interfere with antiviral si-
lencing. Furthermore, the observation that two unrelated viral suppressors
require the activity of the same factor to block silencing suggests that RAV2
represents a control point that can be readily subverted by viruses to block an-
tiviral silencing.

Author Summary
RNA silencing is an important antiviral defense in plants, and many
plant viruses encode proteins that block RNA silencing. However, the
mechanism of action of the viral suppressors is complex, and little is
known about the role of host plant proteins in the process. Here we report
the first example of a host protein that plays a required role in viral sup-
pression of silencing—a transcription factor called RAV2 that is required
for suppression of silencing by two different and unrelated viral proteins.
Analysis of plant gene expression patterns shows that RAV2 is required for
induction of many genes involved in other stress and defense pathways,
including genes implicated as plant suppressors of silencing. Overall, the
results suggest that RAV2 is an important factor in viral suppression of
silencing and that the role of RAV2 is to divert host defenses toward re-
sponses that interfere with antiviral silencing.
 Two Plant Viral Suppressors of Silencing Require 31

Introduction
Plants have a complex interconnected system of defense and stress pathways [1],[2]
that receives incoming stimuli, transduces the signal and initiates the appropriate
response. The process is orchestrated by a variety of plant hormones and small sig-
naling molecules, and the final shape of the response is refined by crosstalk among
different pathways in the network. Evidence emerging over the last decade has
made it clear that RNA silencing and endogenous small RNA pathways constitute
a major response to a variety of biotic and abiotic stresses [3],[4],[5]. Surpris-
ingly, however, although many of the components of the silencing machinery are
known, little is yet known about how silencing is regulated or how it is integrated
into the network of other defense and stress pathways.
RNA silencing is a sequence specific RNA degradation mechanism that serves
an important antiviral role in plants [6]. Antiviral silencing is triggered by double
stranded RNA (dsRNA) that arises during virus infection. The dsRNA trigger
is processed by DICER-LIKE (DCL) ribonucleases into primary short interfer-
ing RNAs (siRNAs), which incorporate into an ARGONAUTE (AGO) protein-
containing effector complex and guide it to complementary target RNAs. The
destruction of target RNAs can be amplified via a process called transitive silenc-
ing, in which the target RNA serves as template for host RNA-dependent RNA
polymerases (RDRs) to produce additional dsRNA that is subsequently processed
into secondary siRNAs. In addition to these RDRs, a number of other genes, in-
cluding DCL2, AGO1 and SUPPRESSOR OF GENE SILENCING 3 (SGS3),
are required for transitive silencing, but not for primary silencing [7],[8],[9]. The
primary and transitive silencing pathways work together to limit the accumula-
tion of viral RNAs during both the initial and systemic phases of infection.
In addition to antiviral silencing and related pathways that target invading
nucleic acids, there are endogenous small RNA pathways that regulate gene ex-
pression by directing cleavage of target RNA, inhibition of mRNA translation, or
modification of chromatin structure. The best studied of the endogenous small
RNAs are the microRNAs (miRNAs), which play major roles in development and
in response to a variety of stresses [10],[11],[12]. Although different small RNA
mediated pathways have unique genetic requirements, all make use of an overlap-
ping set of genes for their biogenesis (four DCL genes) and function (ten AGO
genes), and there is growing evidence that these pathways are interconnected and
compete with one another. For example, DCL1, the Dicer that produces most
miRNAs, represses antiviral silencing by down-regulation of DCL3 and DCL4
[13] and, when over-expressed, blocks silencing induced by a sense transgene
[14]. In addition, many viral suppressors of RNA silencing also interfere with
the biogenesis and/or function of endogenous small RNAs such as miRNAs and
32 Phytopathology in Plants

trans-acting small interfering RNAs (tasiRNAs) [15],[16]. However, the mecha-

nisms that regulate and integrate the various small RNA pathways are just begin-
ning to be elucidated.
Plant viruses have evolved a variety of effective counter-defensive strategies
to suppress silencing. Numerous plant viruses encode proteins that block some
aspect of RNA silencing [15],[16]. These viral proteins are highly diverse in pri-
mary sequence and protein structure, though they may share certain mechanistic
features. For example, the ability to bind small RNAs is a feature of many viral
suppressors of silencing, including the two used in the present work. Indeed, it
has been proposed that most viral suppressors of silencing work by binding and
sequestering small RNAs, thereby blocking their activity [17],[18]. However, the
physiological significance of small RNA binding is not yet clear in many cases [6],
and some suppressors manipulate silencing via interaction with host proteins that
are either components of the silencing machinery [19],[20],[21],[22] or proposed
regulators of the pathway [23]. Thus, the mechanism of action of viral suppressors
is likely both diverse and complex and is not yet fully understood.
Our studies have focused on understanding the mechanism of action of HC-
Pro, a potent viral suppressor of silencing that blocks both primary and transitive
silencing. Our approach has been to identify host proteins that physically interact
with HC-Pro and examine the effect of altering the levels of these proteins on
both RNA silencing and the ability of HC-Pro to block silencing [23]. Using
this approach, we find that RAV2/EDF2 (hereafter referred to as RAV2), an HC-
Pro-interacting protein that is a member of the RAV/EDF family of transcription
factors, is required for suppression of silencing not only by potyvirus HC-Pro, but
also by carmovirus P38, the silencing suppressor from a virus family unrelated to
potyviruses. Interestingly, RAV2 is required exclusively for blocking the activity
of primary siRNAs, whereas suppression of transitive silencing and effects on the
endogenous microRNA pathway are RAV2-independent. Whole genome tiling
microarray experiments were used to characterize HC-Pro-mediated changes in
host expression and identify which, if any, were RAV2-dependent. The results
raise the interesting possibility that HC-Pro-suppression of silencing is not caused
by decreased expression of genes that are required for silencing, but instead, by
induction of stress and defense pathways that interfere with antiviral silencing.

Results
Ectopic Expression of a RAV/EDF Transcription Factor Delays
the Onset of Transgene-Induced RNA Silencing in Tobacco
In previous work we used a yeast two-hybrid screen to identify Nicotiana tabacum
proteins that interact with Tobacco Etch Potyvirus (TEV) HC-Pro [23]. One of
 Two Plant Viral Suppressors of Silencing Require 33

the proteins identified in this way was named ntRAV because of its relatedness
to the Arabidopsis thaliana RAV/EDF family of transcription factors. The RAV/
EDF protein family has six members, and these are unique among transcrip-
tion factors in having two unrelated DNA binding domains (AP2 and B3) [24].
Members of this family are responsive to numerous biotic and abiotic stresses
[25],[26],[27],[28] and are inducible by the plant hormone ethylene [29], which
controls many aspects of plant physiology, including defense against pathogens
[30],[31].
In vitro pull-down experiments were used to confirm a physical interaction
between TEV HC-Pro and ntRAV. 35S-methionine-labeled ntRAV produced in
a coupled in vitro transcription/translation system co-purified with an HC-Pro-
GST fusion protein isolated from recombinant bacteria, but not with GST alone
(Fig. 1A). This result validates the HC-Pro-ntRAV interaction initially identified
in the yeast two-hybrid system.

Figure 1. ntRAV Interacts with HC-Pro and Delays the Onset of Sense Transgene Silencing when Over-
expressed in Tobacco. (A) Tobacco ntRAV interacts with TEV HC-Pro in in vitro pulldown experiments.
35S-labelled ntRAV co-purifies with HC-Pro-GST (lane 3), but not with GST (lane 2). Lane 1 shows the
amount of input 35S-labelled ntRAV protein used in the pulldown experiments. (B) The accumulation
of ntRAV mRNA at 24, 30 and 37 days after germination in whole leaves of wild type (WT) tobacco
plants (lanes 1–3), plants heterozygous for the silenced 6b5 GUS transgene (WT X 6b5) (lanes 4–6), and
plants heterozygous for the silenced 6b5 GUS transgene and expressing the 35S:ntRAV transgene (lanes
7–9). (C) Histochemical staining of leaves from HC-Pro X 6b5 (left panel), WT X 6b5 (center panel) and
35S:ntRAV X 6b5 leaves (right panel) at 26 days after germination. (D) GUS mRNA levels in the veins
of leaves of HC-Pro X 6b5 (lane 1), WT X 6b5 (lane 2) and 35SntRAV X 6b5 plants (lane 3) at 26 days
after germination.
34 Phytopathology in Plants

To determine if ntRAV plays a role in RNA silencing, we evaluated the effect

of ntRAV over-expression on transgene-induced silencing. In tobacco, ntRAV is
normally expressed at high levels throughout fully expanded healthy leaves of
young plants, but expression decreases greatly starting at about 24 days after ger-
mination (Fig. 1B, lanes 1–6). In contrast, a tobacco line that ectopically expresses
ntRAV from the constitutive Cauliflower mosaic virus (CaMV) 35S promoter
maintains high level expression of ntRAV (Fig. 1B, lanes 7–9). We crossed the
35S:ntRAV transgenic line, as well as wild type and HC-Pro-expressing control
lines, to the well-characterized tobacco transgenic line 6b5 [32], which is post-
transcriptionally silenced for a transgene encoding β-glucuronidase (GUS). Si-
lencing of the GUS locus in line 6b5 reinitiates every generation, starting in the
vascular tissue of the oldest leaves and then spreading throughout the leaf. The
expression of GUS in F1 progeny of these crosses was assayed histochemically in
leaves (Fig. 1C) and by northern blots of RNA from the vascular tissue (Fig. 1D)
at 26 days after germination. In these young plants, ectopic expression of ntRAV
blocked silencing of GUS in vascular tissue of fully expanded, healthy leaves about
as well as HC-Pro (Fig. 1C and D). However, unlike HC-Pro, which completely
blocks silencing over the lifetime of the plant, ectopic expression of ntRAV only
delayed the onset of silencing, and GUS was eventually silenced throughout the
leaf (data not shown). These results, together with those showing a physical in-
teraction between ntRAV and TEV HC-Pro proteins, raised the possibility that
ntRAV plays a role in HC-Pro-mediated suppression of silencing.

Experiments in the Model Plant, Arabidopsis Thaliana

To further investigate the role of ntRAV in HC-Pro suppression of silencing, we
switched from tobacco to Arabidopsis thaliana, in order to take advantage of the
numerous genetic tools available in that model system. Our experiments focused
on a RAV gene family member closely related to the tobacco ntRAV, Arabidop-
sis RAV2 (At1g68840), which had already been cloned and characterized, and
for which a validated T-DNA insertional knockout line was available [29]. The
change in experimental system also necessitated a change from the HC-Pro en-
coded by TEV to that encoded by turnip mosaic virus (TuMV), a related potyvi-
rus that infects Arabidopsis. Like the TEV HC-Pro transgene in tobacco, expres-
sion of the TuMV HC-Pro in transgenic Arabidopsis plants has been shown to
suppress both virus- and transgene-induced RNA silencing [14],[33]. The TuMV
HC-Pro transgenic line used in our experiments expresses HC-Pro at a high level
and is highly phenotypic [14].
We used in vivo pull-down experiments to determine whether the TuMV HC-
Pro and RAV2 proteins interact, as would be expected if RAV2 were a functional
 Two Plant Viral Suppressors of Silencing Require 35

homolog of ntRAV. In these experiments, the homozygous rav2 knockout line

[29] was transformed with a construct designed to express a transgene encod-
ing FLAG-tagged RAV2. A transformant that expressed the FLAG-RAV2 trans-
gene was crossed to our TuMV HC-Pro transgenic line [14], and expression of
both transgenes in the F1 offspring was confirmed by RNA gel blot analysis (data
not shown). Pull-down experiments using antiserum specific to the FLAG tag,
followed by western blot analysis, showed that TuMV HC-Pro co-immunopre-
cipitates with the Flag-tagged RAV2 (Fig. 2), indicating that RAV2 and TuMV
HC-Pro interact in planta in Arabidopsis. This result confirms that RAV2 is a
functional homolog of ntRAV and also provides evidence that the interaction
between potyviral HC-Pro and host RAV-like transcription factors is a conserved
feature of these proteins.

Figure 2. In vivo Interaction of RAV2 and TuMV HC-Pro in Arabidopsis. Proteins isolated from plants
expressing either FLAG-tagged RAV2 (Flag-RAV2) alone, TuMV HC-Pro alone or both Flag-RAV2 and TuMV
HC-Pro were incubated with anti-FLAG agarose beads. The bound protein was fractionated on acrylamide gels
and subjected to western blot analysis using either HC-Pro antiserum (left panel) or RAV2 antiserum (center
panel). The far right panel shows the relative input amounts of protein used in the pulldown experiments as
determined by Coomassie blue staining.

RAV2 is Required for HC-Pro Suppression of Virus Induced

Gene Silencing (VIGS)
Our initial experiments to examine the role of RAV2 in HC-Pro suppression of
silencing focused on VIGS. These experiments used the well characterized gemi-
nivirus silencing vector, cabbage leaf curl virus (CaLCV), which carried a por-
tion of the endogenous CHLORATA42 (CH42) gene [34]. CH42 is required for
36 Phytopathology in Plants

chlorophyll accumulation, and VIGS of CH42 in wild type plants results in exten-
sive chlorosis and marked reduction in the level of CH42 mRNA. These changes
are accompanied by a pronounced accumulation of 24-nt siRNAs that derive from
the CH42 sequences within the viral vector [14],[34]. HC-Pro transgenic plants
become infected when bombarded with the CH42 VIGS vector and, although
high levels of siRNAs accumulate in the plants, the CH42 gene is not silenced as
evidenced by accumulation of CH42 mRNA and the absence of chlorosis [14]. To
determine if RAV2 is required for HC-Pro suppression of VIGS, plants express-
ing HC-Pro in either the wild type or the rav2 knockout background, along with
control plants, were bombarded with the CH42 VIGS vector. Wild type control
plants as well as rav2 knockout plants exhibited chlorosis of infected tissues (Fig.
3A, top two panels) accompanied by reduction in CH42 mRNA levels and the
concomitant accumulation of siRNAs, as expected for VIGS (Fig. 3B, lanes 1–4).
HC-Pro transgenic plants were suppressed for VIGS of CH42, remaining green
(Fig. 3A, bottom left panel) and accumulating wild type levels of CH42 mRNA
as previously reported (Fig. 3B, lanes 5 and 6). In contrast, HC-Pro transgenic
plants in the rav2 knockout background were competent for VIGS of CH42 as
evidenced by systemic chlorosis (Fig. 3A, bottom right panel) accompanied by
reduction in CH42 mRNA levels (Fig. 3B, lanes 7–9). This result indicates that
RAV2 is required for HC-Pro suppression of VIGS.

Figure 3. RAV2 is Required for HC-Pro Suppression of Virus Induced Gene Silencing (VIGS). (A) Phenotype
of plants bombarded with CaLCV vector carrying a portion of the endogenous CH42 gene. VIGS of CH42
results in pronounced yellowing in wild type or rav2 knockout plants (upper left and right panels, respectively).
Plants expressing HC-Pro are suppressed for VIGS and therefore remain green (lower left panel); whereas HC-
Pro plants in the rav2 knockout background fail to block silencing and display yellowing typical of wild type
plants (lower right panel). (B) RNA gel blot analysis of CH42 mRNA, HC-Pro and CH42 siRNA levels in wild
type (lanes 1 and 2), rav2 knockout (lanes 3 and 4), HC-Pro plants (lanes 5 and 6) and HC-Pro plants in the
rav2 background (lanes 7–9) either uninfected (lanes 1, 3, 5 and 7) or after bombardment with the CH42 VIGS
vector (lanes 2, 4, 6, 8 and 9). Ethidium staining of rRNA is shown as the loading control for the high molecular
weight blots and the hybridization signal for U6 is shown as the loading control for the small RNA blot. The
migration of 24 nt siRNAs is marked by an arrow.
 Two Plant Viral Suppressors of Silencing Require 37

RAV2 is Required for HC-Pro-Suppression of the Primary,

but not the Transitive, Branch of Hairpin Transgene-Induced
RNA Silencing
To examine the role of RAV2 in HC-Pro-suppression of transgene silencing,
we used a well-characterized system in which silencing occurs through both the
primary and transitive branches of the silencing pathway [7],[35]. This system
is composed of two transgenes, the 306 and 6b4 loci (Fig. 4A). The 6b4 locus
encodes an expressing GUS transgene that includes the entire GUS coding se-
quence, while the 306 locus encodes a hairpin construct designed to silence GUS
expression. The GUS sequence in the 306 locus has a 231 nucleotide deletion in
the coding region (Fig. 4A, shown in green) so that RNAs originating from the
6b4 transcript can be unambiguously distinguished. The primary and transitive
branches of silencing can be easily differentiated in this system. Basically, primary
siRNAs derive only from the stem of the 306 hairpin transcript (Fig. 4A, shown
in red, probe 1), whereas secondary siRNAs arise from either locus during an
RDR6-dependent process called transitive silencing. In the case of the 306 trans-
gene, siRNAs that arise from the loop of hairpin transcript are secondary siRNAs
(Fig. 4A, shown in blue, probe 3). In contrast to the 306 hairpin transcript, the
6b4 mRNA produces only RDR6-dependent secondary siRNAs (Fig. 4A, shown
in red, green and blue; [7]. Thus, in the 306/6b4 system, 6b4 mRNA can be
degraded by two mechanisms. It can be targeted by a RISC complex directed
by siRNAs, or it can be a substrate for RDR6, producing dsRNA that is subse-
quently processed by DCL to produce secondary siRNAs via transitive silencing.
HC-Pro suppresses silencing in the 306/6b4 system, but has different effects on
primary and secondary siRNAs: accumulation of secondary siRNAs is eliminated,
as shown by the failure to detect any siRNAs when using either probe 2 or probe
3 [7]. In contrast, high levels of primary siRNAs accumulate, but are unable to
mediate degradation of the 6b4 target RNA [7].
To determine if RAV2 is required for HC-Pro suppression of hairpin trans-
gene silencing, we crossed the homozygous rav2 knockout line to a transgenic
line homozygous for the 306 and 6b4 loci and hemizygous for the TuMV HC-
Pro locus. F1 offspring of this cross were allowed to self-fertilize, producing an
F2 population that was segregating for all four loci. F2 plants were genotyped,
and individuals containing the 306/6b4/HC-Pro loci in the homozygous rav2
mutant background were identified, along with control plants containing all three
loci in the wild type RAV2 background. The absence of RAV2 mRNA in rav2
knockout plants was verified by RNA gel blot analysis (Fig. 4B). Initial analysis
of the 306/6b4/HC-Pro plant lines addressed the possibility of transcriptional
gene silencing (TGS) of the three transgenes involved, all of which are under the
control of the CaMV 35S promoter. This was especially important because it has
38 Phytopathology in Plants

been shown that T-DNA insertion mutants that carry 35S promoter sequences,
such as the rav2 knockout line used in this work, can induce TGS of other 35S
promoters in the genome [36] and because HC-Pro cannot suppress silencing at
the transcriptional level [37],[38]. RNA gel blot analysis showed that the level of
HC-Pro mRNA was similar in all plants carrying the HC-Pro transgene (Fig. 4B),
arguing against transcriptional silencing of 35S promoter sequences in the plants.
In addition, the presence of siRNAs that derive from the GUS transcripts (Fig.
4C) indicates that the observed silencing of the GUS transgenes is at the post-
transcriptional rather than the transcriptional level.

Figure 4. RAV2 is Required for Suppression of Hairpin Transgene Silencing by Two Unrelated Viral Suppressors.
(A) Diagrams showing the structures of the 6b4 and 306 transgene loci. The 6b4 locus is an expressing locus
which encodes a functional GUS protein. The 306 locus produces a GUS hairpin RNA that acts in trans to
silence the 6b4 locus. The locations of the hybridization probes used in parts B, C and D are indicated. (B and
D) The accumulation of RAV2, TCV-P38 and/or TuMV HC-Pro mRNA in plants of the genotypes indicated
at the top of the lanes. (C and E) The top panel of each shows the accumulation of 6b4 GUS mRNA in plants
of the genotypes indicated at the top of the lanes, and the bottom two panels show the accumulation of primary
and secondary siRNAs in the same samples. The size of 21-, 22- and 24-nt marker RNAs are indicated to the left
of the small RNA panels and the probes used are indicated to the right of each panel.
 Two Plant Viral Suppressors of Silencing Require 39

The role of RAV2 in HC-Pro suppression of hairpin transgene silencing was

assayed using northern blot analysis to measure the accumulation of 6b4 GUS
target mRNA as well as that of GUS primary and secondary siRNAs (Fig. 4C). As
previously reported [7], HC-Pro blocked target RNA degradation when 306/6b4/
HC-Pro transgenic plants were wild type for RAV2, showing the characteristic ab-
sence of secondary siRNAs accompanied by high levels of nonfunctional primary
siRNAs (Fig. 4C, compare lanes 3 and 4). In contrast, HC-Pro failed to prevent
degradation of the 6b4 GUS mRNA target in the rav2 knockout background
(Fig. 4C, lanes 1 and 2). In addition, accumulation of GUS primary siRNAs
was reduced in the rav2 compared to the RAV2 background and was similar to
that in 306/6b4 plants without HC-Pro (Fig. 4C, lanes 1–4). Accumulation of
secondary siRNAs, which are diagnostic of transitive silencing, was suppressed
in HC-Pro transgenic plants even in the rav2 knockout background (Fig. 4C,
lanes 1–3), suggesting that HC-Pro-suppression of transitive silencing is RAV2-
independent. In this experiment, however, we cannot rule out the possibility that
the rav2 knockout itself eliminates accumulation of secondary siRNAs. Therefore,
our results suggest that RAV2 is required for the HC-Pro-mediated block in pri-
mary siRNA activity, but not for HC-Pro suppression of transitive silencing.

RAV2 is Required for Suppression of Hairpin Transgene-

Induced Silencing by the Carmovirus Suppressor of
Silencing, P38
To determine if RAV2 plays a general role in viral suppression of silencing, we
used the 306/6b4 hairpin transgene silencing system to investigate whether Tur-
nip Crinkle Virus (TCV) P38, a viral suppressor of silencing from a different virus
family than TuMV HC-Pro [39], requires RAV2 to block silencing. The rav2
knockout line was crossed to a 306/6b4 line that expresses P38, and the resultant
F1 plants were allowed to self-fertilize. F2 plants were genotyped, and individuals
containing the 306/6b4/P38 loci in the homozygous rav2 mutant background
were identified along with control plants containing all three loci in the RAV2
background.
We used northern blot analysis to confirm the expected pattern of expres-
sion of RAV2 and P38 in these two sets of plants (Fig. 4D) and to examine
suppression of silencing by P38 in the presence and absence of RAV2. Previ-
ous experiments showed that P38 behaves much like HC-Pro in the 306/6b4
transgene silencing system, blocking silencing and allowing 6b4 GUS mRNA
to accumulate, even though high levels of GUS primary siRNAs also accumu-
late [7]. Similar to HC-Pro, P38 also blocks transitive silencing in this system
as indicated by the absence of GUS secondary siRNAs [7]. In the current
40 Phytopathology in Plants

work, P38 transgenic 306/6b4 plants with at least one copy of the wild type
RAV2 locus replicated those earlier results, showing P38 suppression of silenc-
ing, with a concomitant increase in accumulation of GUS primary siRNAs
and elimination of GUS secondary siRNAs (Fig. 4E, compare lanes 3 and 4).
In contrast, P38 suppression of silencing was strongly diminished in the rav2
knockout background (Fig. 4E, lanes 1 and 2). Similar to our results with
HC-Pro, accumulation of primary siRNAs in plants expressing P38 was much
reduced in the rav2 compared to the RAV2 background, whereas second-
ary siRNA accumulation was unaffected by the loss of RAV2 and remained
undetectable (Fig. 4E, compare lanes 1 and 2 with lane 3). The variability in
accumulation of primary siRNAs observed in the rav2 background (Fig. 4E,
lanes 1 and 2) probably reflects the facts that individual plants were tested
and accumulation of primary siRNAs is greatly reduced, but not eliminated in
the absence of RAV2. Altogether our results indicate that RAV2 plays similar
roles in suppression of silencing by P38 and HC-Pro. Interestingly, in both
cases, RAV2 function is required for suppression of primary siRNA-directed
target degradation, but dispensable for the block to transitive silencing.

RAV2 is Required for Some of the Phenotypic Defects

Induced by HC-Pro, but not for HC-Pro-Mediated Defects in
the miRNA Pathway
Arabidopsis plants expressing TuMV HC-Pro display a number of developmental
anomalies: the plants are dwarfed with serrated leaves and have abnormal flower
morphology associated with severely reduced fertility (Fig. 5A; [14],[33]). The
phenotype of homozygous rav2 knockout plants, however, is indistinguishable
from that of wild type plants (data not shown). To determine if RAV2 is required
for any of the HC-Pro associated developmental anomalies, we compared the
phenotype of HC-Pro plants in the wild type RAV2 background to that of plants
expressing approximately equal levels of HC-Pro mRNA, but in the rav2 knock-
out background. The HC-Pro-mediated defects in flower morphology and fertil-
ity are completely alleviated in the absence of RAV2 (Fig. 5 and data not shown).
In addition, both the dwarfing and serrated leaf phenotypes are mitigated–but
not eliminated–in the rav2 knockout background, resulting in an intermediate
phenotype that is most visible when the plants are young (Fig. 5A), but becomes
less distinguishable from that of wild type after the plants have flowered (Fig. 3A,
5A, and data not shown). These observations indicate that RAV2 is required for
HC-Pro-mediated flower and fertility defects and contributes to the defects in
plant size and leaf shape.
 Two Plant Viral Suppressors of Silencing Require 41

Figure 5. RAV2 is Required for Many HC-Pro-associated Morphological Anomalies but not for Defects in
MicroRNA Biogenesis. (A) Flower morphological defects in HC-Pro transgenic plants (top left panel) are
rescued in the rav2 knockout background (top middle panel) resulting in flower phenotype indistinguishable
from wild type (top right panel). Rosette dwarfing and leaf serration in transgenic plants (bottom left panel) are
partially rescued in the rav2 knockout background (bottom middle panel) resulting in a phenotype intermediate
between wild type (bottom right panel) and Hc-Pro plants. (B) The accumulation of the indicated miRNAs and
miRNA*s was determined from RNA gel blot analysis of low molecular weight RNA from wild type (WT),
rav2 knockout plants (rav2), HC-Pro plants (HC) and HC-Pro plants in the rav2 knockout background (rav2,
HC). Ethidium bromide (EtBr) staining of the predominant RNA species in the low molecular weight fraction
is shown as a loading control.

In addition to its role in suppression of silencing, HC-Pro also causes de-

fects in the biogenesis and function of certain endogenous small RNAs, including
miRNAs, a class of small regulatory RNAs that plays critical roles in development.
MiRNAs arise by processing of stem-loop primary transcripts by a Dicer-like en-
zyme, usually DCL1. The initial product is a 21-nt duplex, composed of the ma-
ture miRNA and the imperfectly complementary opposite strand, which is called
miRNA*. The two strands separate and the mature miRNA binds to an AGO
protein, forming the core of the miRNA effector complex. In HC-Pro transgen-
ic plants, the level of many miRNAs is increased, often dramatically [33],[40].
Despite the increased level of the miRNA in the HC-Pro plants, the miRNA-
targeted messenger RNAs also show an increased accumulation, suggesting that
the miRNAs have reduced function [33],[41]. In addition, the miRNA* strand,
which is unstable and fails to accumulate in wild type plants, characteristically ac-
cumulates to high levels in HC-Pro transgenic plants [33]. Together these results
have led to the idea that HC-Pro impedes the proper separation of the strands
of the miRNA:miRNA* duplex, leading to reduced association of the mature
miRNA with AGO and thereby reducing miRNA function.
Because RAV2 is required for HC-Pro effects on the biogenesis and function
of primary siRNAs, as well as for many of the HC-Pro-associated developmental
42 Phytopathology in Plants

anomalies, we hypothesized that RAV2 might also be required for HC-Pro-me-

diated defects in the miRNA pathway. To address the role of RAV2 in HC-Pro-
associated defects in miRNA biogenesis, we compared the levels of a variety of
miRNAs and their corresponding miRNA* strands in HC-Pro plants in the pres-
ence and absence of RAV2. In all cases, the levels of miRNA and miRNA* were
independent of RAV2 (Fig. 5B). These results indicate that RAV2 is not required
for the HC-Pro-associated defects in miRNA biogenesis.
To determine if RAV2 is involved in HC-Pro-associated defects in miRNA
function, we compared the levels of a set of known miRNA-targeted messen-
ger RNAs in RAV2/HC-Pro plants to those in rav2/HC-Pro plants using whole
genome tiling microarray data (see following section for details of the tiling ar-
ray experiments). Because HC-Pro interferes with the activity of some miRNAs
[33],[41], we expected the tiling array data to show increased expression of at least
some miRNA-targeted genes in HC-Pro plants. The tiling array data supported this
expectation. Specifically, out of 146 verified miRNA targets [42],[43],[44],[45],
we found that 39 showed altered expression in the HC-Pro transgenic line com-
pared to the wild type control. Of these, 35 had increased expression, and only
one of these was up-regulated in HC-Pro/RAV2 versus HC-Pro/rav2 plants, sug-
gesting that RAV2 does not play a general role in HC-Pro inhibition of miRNA
activity. Altogether, the results suggest that, although RAV2 is required for many
of the morphological anomalies in HC-Pro transgenic plants, it is not required for
the HC-Pro-mediated defects in either the biogenesis or function of miRNAs.
Whole genome tiling analysis links HC-Pro suppression of silencing to the
network of host defense pathways
Because RAV2 is a transcription factor, we expected that it might be required
for some HC-Pro-mediated changes in gene expression and that identifying these
genes could provide insight into the role of RAV2 in HC-Pro suppression of
silencing. To address this idea, we employed whole genome tiling microarray ex-
periments to determine if the global pattern of gene expression is altered in HC-
Pro transgenic plants and, if so, whether any of the changes are dependent on
RAV2 function. Arabidopsis plants with four different genotypes were used in
this experiment: 1) a rav2 mutant line, 2) an HC-Pro expressing line, 3) the rav2
mutant line expressing HC-Pro, and 4) the wild type (Columbia ecotype) control.
We grew all four genotypes under identical conditions, extracted total RNA from
plants just before bolting and used poly-A RNA to generate probes for hybrid-
ization to the Arabidopsis tiling arrays as previously described [46],[47]. Tile-
Map [48] was used to identify genes that are significantly up- or down-regulated
in each line as compared to wild type plants, as well as to compare the pattern
of gene expression in RAV2/HC-Pro plants versus rav2/HC-Pro plants (Tables
S2–S9). To check the tiling results, the expression of ten genes in these plant lines
 Two Plant Viral Suppressors of Silencing Require 43

was additionally examined using real-time quantitative PCR (RT qPCR). This
analysis confirmed the relative levels of expression of these genes determined by
the tiling array in 33 of 40 two-way comparisons between the four genotypes (Fig.
6A and B).

Figure 6. Tiling Microarray Analysis and RT qPCR Show RAV2-dependent Up-regulation of Silencing-
associated Genes by HC-Pro. (A) The mRNA levels for AGO2 (At1g31280), FRY1 (At5g63980) and CML38
(At1g76650) in rav2 knockout plants (rav2), HC-Pro transgenic plants (HC), HC plants in the rav2 knockout
background (rav2/HC) and wild type control plants (WT) were determined by oligo(dT)-primed RT qPCR
analysis. Error bars, ±SD. (B) The mRNA levels for the same genes shown in (A) were determined by Arabidopsis
whole-genome tiling microarray expression analysis. The top four tracks show the level of these mRNAs in the
genotypes indicated to the left of the track. The bottom track indicates the annotated gene models for the three
loci. (C) Gene ontology (GO) analysis results for genes that are up-regulated in HC-Pro transgenic plants as
compared to wild type plants. The top five over-represented biological processes categories and the associated
hypergeometric distribution P-values are shown. (D) GO analysis results for genes that are up-regulated by
HC-Pro in a RAV2-dependent manner. The top five over-represented biological processes categories and the
associated hypergeometric distribution P-values are shown.

One of the first questions we addressed was whether genes involved in an-
tiviral silencing and other small RNA pathways were affected by HC-Pro and
RAV2. Unexpectedly, none of the genes encoding components of the silencing
machinery or otherwise known to be required for silencing were down-regulated
in the HC-Pro plants. Expression of RAV2 itself was also not altered in HC-
Pro plants. However, a number of silencing-associated genes were up-regulated
in HC-Pro plants. The up-regulated genes included three of the ten Arabidopsis
44 Phytopathology in Plants

AGO family members, AGO2, AGO3, and AGO4. AGO4 is required for some
kinds of transcriptional silencing. The roles of AGO2 and AGO3 are unknown,
but neither has been associated with antiviral silencing [49],[50]. Interestingly,
two genes implicated as endogenous suppressors of silencing were also up-regulat-
ed in HC-Pro: Arabidopsis FIERY1 (FRY1), which negatively regulates transitive
silencing [51], and CML38 (At1g76650), which is a likely Arabidopsis homolog
of rgsCaM, an endogenous suppressor of antiviral silencing in tobacco [23]. Like
RAV2, rgsCaM was originally identified as an HC-Pro interacting protein [23];
however, it is not yet known whether rgsCaM is required for HC-Pro to suppress
silencing. RT qPCR confirmed the relative expression levels of AGO2, FRY1, and
CML38 in the HC-Pro expressing line compared to wild type plants (compare
Fig. 6A and 6B). The RT qPCR data also showed that increases in both FRY1 and
CML38 expression required RAV2, whereas the increase in AGO2 expression was
only partially dependent on RAV2 (Fig. 6A). These results argue that the mecha-
nism for HC-Pro suppression of silencing does not involve down-regulation of
genes required for silencing, but rather a RAV2-dependent up-regulation of genes
that potentially antagonize antiviral silencing.
The tiling array analysis was used to identify global HC-Pro-mediated changes
in gene expression and determine which, if any, depended on RAV2. A significant
number of genes were differentially regulated in the HC-Pro plants; 2580 were
up-regulated and 2060 were down-regulated. Many fewer genes were differen-
tially affected in RAV2/HC-Pro compared to rav2/HC-Pro plants (Tables S4 and
S5). Of 265 genes that showed dependence on RAV2 for up-regulation by HC-
Pro, only a small number showed changed expression in rav2 mutant plants in
the absence of HC-Pro as compared to wild type (20 of 265 were up-regulated;
17 of 265 were down-regulated). Similarly, of 433 genes that showed dependence
on RAV2 for down-regulation by HC-Pro, a relatively small number showed
changed expression in the rav2 knockout plants in the absence of HC-Pro as com-
pared to wild type (15 of 433 were up-regulated; 98 of 433 were down-regulated).
Together, these results suggest that HC-Pro causes major changes in global gene
expression patterns, some of which are mediated by RAV2. Interestingly, based on
comparison of the set of genes with altered expression in rav2 mutant plants with
the set altered by HC-Pro in a RAV2-dependent manner, it appears that HC-Pro
changes the scope and spectrum of genes that are controlled by RAV2.
Gene Ontology (GO) term analysis was used to give a functional characteriza-
tion of the tiling array results [52]. A key finding of this analysis was that multiple
stress and defense responses were induced in HC-Pro expressing plants. The top
four biological process categories that were over-represented among genes up-
regulated in HC-Pro compared to wild type plants were: response to wounding
(67 of 119 genes), response to jasmonic acid (JA) stimulus (48 of 119 genes), cold
 Two Plant Viral Suppressors of Silencing Require 45

stress (49 of 197 genes) and heat stress (33 of 109 genes) (Fig. 6C). Strikingly,
genes in these same four categories were also over-represented among the genes
that are up-regulated by HC-Pro in a RAV2-dependent manner (Fig. 6D). Tables
showing the specific genes that are up-regulated by HC-Pro in each of these GO
categories, as well as the subsets that require RAV2 for HC-Pro up-regulation
results indicate that RAV2 plays a role in altered expression of stress and defense
pathways in HC-Pro plants. Interestingly, FRY1 and CML38, both of which have
been implicated as suppressors of silencing [23],[51] and are induced by HC-Pro
in a RAV2-dependent manner (Fig. 6B), have GO annotations of response to cold
and wounding, respectively, suggesting a link between silencing and other stress
and defense pathways.

Discussion
It has been over a decade since the first plant viral suppressors of RNA silenc-
ing were reported [53],[54],[55], providing an early clue that silencing serves as
an anti-viral defense in plants and leading to the identification of many other
such silencing suppressors [56]. However, the mechanisms by which these viral
proteins manipulate silencing have remained largely elusive. Here we report the
identification of a host protein, the transcription factor RAV2, that is required
for suppression of silencing mediated by two unrelated viral proteins, potyviral
HC-Pro and carmoviral P38. RAV2 is part of a gene family that comprises six
members, two of which (RAV1; At1g13260 and RAV2-like; At1g25560) are very
closely related to RAV2. Surprisingly, however, neither of these related genes is
able to compensate for the loss of RAV2 with respect to suppression of silencing
mediated by either HC-Pro or P38. This result indicates that RAV2 provides a
unique function in suppression of silencing. The identification of RAV2 as an im-
portant element in viral suppression of silencing provides a handle for identifying
additional host partners and thereby unraveling the pathway of host involvement
in that process.
The discovery that plant viruses from many unrelated families encode suppres-
sors of silencing has underscored the importance of silencing in antiviral defense.
Similarly, we expect our finding that viral suppressors from two unrelated viruses
have evolved independently to require RAV2 underscores the importance of host
proteins in viral counter-defense. In addition, it suggests that RAV2 represents an
effective and readily subverted control point—either for suppression of silencing
in general or for a subset of suppressors with some mechanistic features in com-
mon. It will be interesting to see how general the requirement for RAV2 is in viral
suppression of silencing.
46 Phytopathology in Plants

How could a transcription factor such as RAV2 be used to suppress silenc-

ing? Two reports have identified RAV2 as a repressor of at least some target genes
[57],[58]. Therefore, it seemed reasonable to hypothesize that the role of RAV2 in
HC-Pro suppression of silencing is to repress transcription of genes that encode
components of the silencing machinery for the anti-viral branch of the silencing
pathway. However, our global analysis of genome expression indicates that the
expression of genes known to be required for RNA silencing is unchanged in
HC-Pro transgenic plants as compared to wild type controls. Instead, our data
shows that RAV2 is required for HC-Pro-mediated up-regulation of some stress
and defense response genes. Earlier work showing that induction of both biotic
and abiotic stresses interferes with RNA silencing induced by a viral amplicon
in tobacco is consistent with a mechanism in which induction of other defense
responses can divert the host from antiviral silencing [59]. The observation that
RAV2 is induced by the ethylene defense pathway and is also required for viral
suppression of silencing emphasizes the importance of crosstalk among defense
pathways and supports the idea that RAV2 constitutes an important control point
for the integration of defense responses during virus infection.
One puzzle raised by the observation that HC-Pro, which is a cytoplasmic
protein [60],[61], interacts with a host transcription factor is: How and where
do the two proteins have the opportunity to meet? Although HC-Pro has been
shown to accumulate in nuclear inclusions in certain potyviral infections, it is
thought that such inclusions represent storage of excess protein [61]. Thus, it
seems more likely that HC-Pro and RAV2 interact in the cytoplasm. Seques-
tering transcription factors in the cytoplasm is a common mechanism used in
eukaryotic organisms for controlling the activity of such proteins [62],[63]. The
interaction of HC-Pro with RAV2 in the cytoplasm could either reflect a direct
involvement of RAV2 itself in suppression of silencing or interference by HC-
Pro in the cellular control of RAV2—either to block activation or promote inap-
propriate activation—thereby changing host gene expression in such a way that
promotes suppression of silencing. Elucidating these issues, as well as examining
whether P38 also physically interacts with RAV2, is likely to be a fruitful area of
research.
Another particularly interesting aspect of our results is the differential require-
ment for RAV2 in suppression of different small RNA-mediated processes. Both
HC-Pro and P38 suppress transitive silencing in the absence of RAV2; yet, both
suppressors require RAV2 for suppression of target degradation via the activity
of primary siRNAs. Furthermore, although HC-Pro requires RAV2 to block the
activity of primary siRNAs, RAV2 is not required for HC-Pro-mediated defects
in miRNA activity. Our present work does not distinguish whether these differen-
tial requirements for RAV2 indicate a fundamental difference in the mechanisms
 Two Plant Viral Suppressors of Silencing Require 47

responsible for suppression of these processes or simply a difference in the cofac-

tor requirements of a common mechanism.
One current model for viral suppression of small RNA pathways posits a gen-
eral mechanism in which small RNA duplexes are bound by the suppressor, there-
by blocking the incorporation of one strand of the duplex into an active effector
complex [17],[64]. Our data showing a role for RAV2 in suppression of silencing
does not directly support this proposed mechanism, but is also not inconsistent
with it. Indeed, it has been shown that small RNA binding by HC-Pro in vitro is
enhanced by unknown cellular factors [17],[64]. Thus, RAV2 might be one such
factor, acting either directly or indirectly to enhance small RNA binding.
Expression of HC-Pro in transgenic plants causes a set of morphological
anomalies that have been attributed to defects in the biogenesis and function of
endogenous miRNAs [33]. However, there is emerging evidence that suggests
that the phenotypic changes are largely independent of the miRNA pathway
[14],[15],[20],[65]. In support of this notion, the data we have presented here
indicate that many of the HC-Pro-mediated morphological anomalies are RAV2-
dependent whereas the defects in the miRNA pathway are RAV2-independent,
arguing against a causative role for miRNAs in most HC-Pro-associated morpho-
logical anomalies
Although the mechanism by which HC-Pro uses RAV2 to suppress silenc-
ing is not yet clear, the results of our tiling array analysis suggest two interest-
ing, though speculative, possibilities. The first of these relates to the induction of
AGO2 and a subset of other AGO genes in HC-Pro transgenic plants, an effect
that is only partially dependent on RAV2. The AGO genes that are up-regulated
by HC-Pro are not required for post-transcriptional gene silencing (PTGS). These
results suggest that an alteration of the mix of AGO proteins in the cell might
tip the balance away from PTGS towards other small RNA pathways that are
not directly involved in anti-viral defense. The recent demonstration that chang-
ing the 5′ nucleotide of a miRNA so as to favor binding to AGO2 instead of
AGO1 inactivates that miRNA [66] supports the idea that an overabundance
of the wrong AGO proteins could contribute to suppression of silencing. The
second interesting possibility suggested by our tiling data concerns the result that
HC-Pro requires RAV2 to induce expression of FRY1 and CML38, both of which
have been implicated as endogenous suppressors of silencing and both of which
are associated with stress or defense responses. Induction of endogenous suppres-
sors of silencing may be more widespread than we know because most have prob-
ably not yet been identified [51]. It is tempting to speculate that the induction
of stress and defense pathways by HC-Pro might have the counter-productive
result—from the plant’s perspective—of inducing a set of endogenous suppressors
of antiviral silencing.
48 Phytopathology in Plants

Materials and Methods

Plant Material and Transgenic Lines
The tobacco 6b5 [32] and Arabidopsis TuMV HC-Pro [CT25 [14]], TCV-P38
[39], 306 and 6b4 [35] lines have been previously described. The Arabidopsis
rav2/edf2 (At1g68840) T-DNA insertion line (SALK_070847) was used and did
not express detectable levels of RAV2 mRNA as assayed by northern analysis.

GUS Histochemical Staining

Histochemical staining for GUS activity was carried out as described [53].

VIGS Silencing Assays

The silencing of endogenous CH42 expression using the geminivirus CaLCV vec-
tor was performed exactly as described previously [14].

RNA Isolation and Northern Analysis

RNA isolation and RNA gel blot analysis of high and low molecular weight RNA
were performed exactly as previously described [14],[40],[67]. Probes for detec-
tion of TuMV HC-Pro, TCV-P38 and 6b4 mRNAs, miRNA as well as those for
primary and secondary siRNAs from the 6b4/306 transgene silencing system were
previously described [7]. The RAV2 probe was generated using the primer set (5′
primer-TTGGAAAGTTCGGTCTGGTC and 3′ primer-TAATACGACTCAC-
TATAGGGACCGCAAACATAT​CATCAACATCTC ), which generate a 152 bp
fragment from the 3′ end of the gene. The 3′ RAV2 primer contains T7 promoter
sequences and a 4 nucleotide spacer at its 5′ end to facilitate synthesis of the probe
using T7 polymerase.

GST Pulldown Assays

To determine if HC-Pro-GST and ntRAV interact, approximately equimolar
amounts of GST or HC-Pro-GST fusion protein were added to 20 µl of glutathi-
one sepharose 4B beads (GE Healthcare) in GLB buffer (50 mM Tris-HCl, pH
8.0, 150 mM NaCl, 1 mM EDTA, and 1 mM PMSF) supplemented to contain
100 µg/ml BSA and 0.1% NP-40 (Roche) and shaken gently for 1 hour at 4°C.
After rinsing with supplemented GLB, an equal amount of 35S-methionine la-
beled ntRAV was added to each sample, shaken gently at 4°C for 2 hours and
 Two Plant Viral Suppressors of Silencing Require 49

rinsed again with supplemented GLB. Bound protein was eluted from the beads
with Laemmli sample buffer, resolved by SDS-PAGE, and transferred to PVDF
membrane. 35S-methionine labeled ntRAV was visualized by autoradiography.

Co-Immunoprecipitation of RAV2 and HC-Pro

Protein was extracted from 0.5 g of Arabidopsis rosette leaf tissue by the follow-
ing procedure. Tissue was frozen in liquid nitrogen, ground into powder with a
mortar and pestle, homogenized in 4 ml of protein extraction buffer (40 mM
Tris-Cl, pH 8.0, 200 mM NaCl, 2.5 mM EDTA, 1% Triton X-100, 0.1% NP-
40) containing protease inhibitor cocktail (Roche), and centrifuged (12,000 g
at 4°C). The supernatant was incubated with 100 µl pre-washed anti-FLAG M2
agarose beads (Sigma F2426) at 4°C for two hours. Agarose beads containing
protein complexes were washed three times with extraction buffer, boiled in SDS
sample buffer, resolved on a 10% SDS polyacrylamide gel, and subjected to west-
ern blotting. The presence of RAV2 protein was detected using a rabbit anti-
RAV2 peptide antibody generated from the peptide GGKRSRDVDDMFALRC,
and a rabbit anti-HC-Pro peptide antibody generated from the peptide KEFT-
KVVRDKLVGE was used to detect HC-Pro. Both RAV2 and HC-Pro peptide
antibodies were produced by Sigma-Genosys.

Tiling Microarray Analysis

Total RNA was isolated as described above from the above ground portions of six
week old plants that had not yet bolted. Generation of probes to poly-A RNA and
hybridization to the tiling arrays were performed as described previously [46],[47].
The data was analyzed using the program TileMap with a posterior probability of
0.8 [48]. The TileMap program identifies sequences that have significant changes
in expression compared to controls, but does not provide fold-differences in ex-
pression levels. GO analysis was performed using ProfCom [68].

Competing Interests
The authors have declared that no competing interests exist.

Acknowledgements
We thank Jim Carrington for seeds of the TCV-P38 transgenic line and Herve
Vaucheret for seeds of the 6b4 and 306 lines.
50 Phytopathology in Plants

Authors’ Contributions
Conceived and designed the experiments: JRE LHB VV. Performed the experi-
ments: MWE BDG ZG AWF SM XG. Analyzed the data: MWE BDG GJP LHB
VV. Contributed reagents/materials/analysis tools: JRE. Wrote the paper: MWE
GJP VV.

References
1. Fujita M, Fujita Y, Noutoshi Y, Takahashi F, Narusaka Y, et al. (2006) Crosstalk
between abiotic and biotic stress responses: a current view from the points of
convergence in the stress signaling networks. Curr Opin Plant Biol 9: 436–
442.
2. Kunkel BN, Brooks DM (2002) Cross talk between signaling pathways in
pathogen defense. Current Opinion in Plant Biology 5: 325–331.
3. Sunkar R, Zhu JK (2004) Novel and stress-regulated microRNAs and other
small RNAs from Arabidopsis. Plant Cell 16: 2001–2019. Epub 2004 Jul
2016.
4. Hamilton AJ, Baulcombe DC (1999) A species of small antisense RNA in
posttranscriptional gene silencing in plants. Science 286: 950–952.
5. Ratcliff F, Harrison BD, Baulcombe DC (1997) A Similarity Between Viral
Defense and Gene Silencing in Plants. Science 276: 1558–1560.
6. Ding SW, Voinnet O (2007) Antiviral immunity directed by small RNAs. Cell
130: 413–426.
7. Mlotshwa S, Pruss GJ, Peragine A, Endres MW, Li J, et al. (2008) DICER-
LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.
PLoS ONE 3: e1755.
8. Fagard M, Boutet S, Morel JB, Bellini C, Vaucheret H (2000) AGO1, QDE-2,
and RDE-1 are related proteins required for post-transcriptional gene silencing
in plants, quelling in fungi, and RNA interference in animals. Proc Natl Acad
Sci USA 97: 11650–11654.
9. Mourrain P, Beclin C, Elmayan T, Feuerbach F, Godon C, et al. (2000) Arabi-
dopsis SGS2 and SGS3 genes are required for posttranscriptional gene silenc-
ing and natural virus resistance. Cell 101: 533–542.
10. Chuck G, Candela H, Hake S (2009) Big impacts by small RNAs in plant
development. Curr Opin Plant Biol 12: 81–86.
 Two Plant Viral Suppressors of Silencing Require 51

11. Mallory AC, Vaucheret H (2006) Functions of microRNAs and related small
RNAs in plants. Nat Genet 38: S31–36.
12. Sunkar R, Chinnusamy V, Zhu J, Zhu JK (2007) Small RNAs as big players
in plant abiotic stress responses and nutrient deprivation. Trends Plant Sci 12:
301–309.
13. Qu F, Ye X, Morris TJ (2008) Arabidopsis DRB4, AGO1, AGO7, and RDR6
participate in a DCL4-initiated antiviral RNA silencing pathway negatively
regulated by DCL1. Proc Natl Acad Sci USA 105: 14732–14737.
14. Mlotshwa S, Schauer SE, Smith TH, Mallory AC, Herr JM Jr, et al. (2005)
Ectopic DICER-LIKE1 expression in P1/HC-Pro Arabidopsis rescues pheno-
typic anomalies but not defects in microRNA and silencing pathways. Plant
Cell 17: 2873–2885.
15. Diaz-Pendon JA, Ding SW (2008) Direct and indirect roles of viral suppressors
of RNA silencing in pathogenesis. Annu Rev Phytopathol 46: 303–326.
16. Burgyan J (2008) Role of silencing suppressor proteins. Methods Mol Biol
451: 69–79.
17. Lakatos L, Csorba T, Pantaleo V, Chapman EJ, Carrington JC, et al. (2006)
Small RNA binding is a common strategy to suppress RNA silencing by several
viral suppressors. Embo J 25: 2768–2780.
18. Merai Z, Kerenyi Z, Kertesz S, Magna M, Lakatos L, et al. (2006) Double-
stranded RNA binding may be a general plant RNA viral strategy to suppress
RNA silencing. J Virol 80: 5747–5756.
19. Baumberger N, Tsai CH, Lie M, Havecker E, Baulcombe DC (2007) The Pole-
rovirus silencing suppressor P0 targets ARGONAUTE proteins for degrada-
tion. Curr Biol 17: 1609–1614.
20. Deleris A, Gallego-Bartolome J, Bao J, Kasschau KD, Carrington JC, et al.
(2006) Hierarchical action and inhibition of plant Dicer-like proteins in anti-
viral defense. Science 313: 68–71.
21. Glick E, Zrachya A, Levy Y, Mett A, Gidoni D, et al. (2008) Interaction with
host SGS3 is required for suppression of RNA silencing by tomato yellow leaf
curl virus V2 protein. Proc Natl Acad Sci USA 105: 157–161.
22. Zhang X, Yuan YR, Pei Y, Lin SS, Tuschl T, et al. (2006) Cucumber mosaic
virus-encoded 2b suppressor inhibits Arabidopsis Argonaute1 cleavage activity
to counter plant defense. Genes Dev 20: 3255–3268.
23. Anandalakshmi R, Marathe R, Ge X, Herr JM Jr, Mau C, et al. (2000) A
calmodulin-related protein that suppresses posttranscriptional gene silencing
in plants. Science 290: 142–144.
52 Phytopathology in Plants

24. Kagaya Y, Ohmiya K, Hattori T (1999) RAV1, a novel DNA-binding protein,

binds to bipartite recognition sequence through two distinct DNA-binding
domains uniquely found in higher plants. Nucleic Acids Res 27: 470–478.
25. Sohn KH, Lee SC, Jung HW, Hong JK, Hwang BK (2006) Expression and
functional roles of the pepper pathogen-induced transcription factor RAV1
in bacterial disease resistance, and drought and salt stress tolerance. Plant Mol
Biol 61: 897–915.
26. Kim SY, Kim YC, Lee JH, Oh SK, Chung E, et al. (2005) Identification of a
CaRAV1 possessing an AP2/ERF and B3 DNA-binding domain from pepper
leaves infected with Xanthomonas axonopodis pv. glycines 8ra by differential
display. Biochim Biophys Acta 1729: 141–146.
27. Kagaya Y, Hattori T (2009) Arabidopsis transcription factors, RAV1 and
RAV2, are regulated by touch-related stimuli in a dose-dependent and biphasic
manner. Genes Genet Syst 84: 95–99.
28. Fowler S, Thomashow MF (2002) Arabidopsis transcriptome profiling indi-
cates that multiple regulatory pathways are activated during cold acclimation
in addition to the CBF cold response pathway. Plant Cell 14: 1675–1690.
29. Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, et al. (2003) Genome-
wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657.
30. Broekaert WF, Delaure SL, De Bolle MF, Cammue BP (2006) The role of eth-
ylene in host-pathogen interactions. Annu Rev Phytopathol 44: 393–416.
31. Guo H, Ecker JR (2004) The ethylene signaling pathway: new insights. Curr
Opin Plant Biol 7: 40–49.
32. Elmayan T, Vaucheret H (1996) Expression of single copies of a strongly ex-
pressed 35S transgene can be silenced post-transcriptionally. Plant Journal 9:
787–797.
33. Kasschau KD, Xie Z, Allen E, Llave C, Chapman EJ, et al. (2003) P1/HC-Pro,
a viral suppressor of RNA silencing, interferes with Arabidopsis development
and miRNA function. Dev Cell 4: 205–217.
34. Turnage MA, Muangsan N, Peele CG, Robertson D (2002) Geminivirus-based
vectors for gene silencing in Arabidopsis. Plant J 30: 107–114.
35. Beclin C, Boutet S, Waterhouse P, Vaucheret H (2002) A branched pathway for
transgene-induced RNA silencing in plants. Curr Biol 12: 684–688.
36. Daxinger L, Hunter B, Sheikh M, Jauvion V, Gasciolli V, et al. (2008) Unex-
pected silencing effects from T-DNA tags in Arabidopsis. Trends Plant Sci 13:
4–6.
 Two Plant Viral Suppressors of Silencing Require 53

37. Marathe R, Smith TH, Anandalakshmi R, Bowman LH, Fagard M, et al.

(2000) Plant viral suppressors of post-transcriptional silencing do not suppress
transcriptional silencing. Plant J 22: 51–59.
38. Mette MF, Matzke AJ, Matzke MA (2001) Resistance of RNA-mediated TGS
to HC-Pro, a viral suppressor of PTGS, suggests alternative pathways for dsR-
NA processing. Curr Biol 11: 1119–1123.
39. Chapman EJ, Prokhnevsky AI, Gopinath K, Dolja VV, Carrington JC (2004)
Viral RNA silencing suppressors inhibit the microRNA pathway at an interme-
diate step. Genes Dev 18: 1179–1186.
40. Mallory AC, Reinhart BJ, Bartel D, Vance VB, Bowman LH (2002) From the
Cover: A viral suppressor of RNA silencing differentially regulates the accumu-
lation of short interfering RNAs and micro-RNAs in tobacco. Proc Natl Acad
Sci USA 99: 15228–15233.
41. Dunoyer P, Lecellier CH, Parizotto EA, Himber C, Voinnet O (2004) Probing
the microRNA and small interfering RNA pathways with virus-encoded sup-
pressors of RNA silencing. Plant Cell 16: 1235–1250.
42. Allen E, Xie Z, Gustafson AM, Carrington JC (2005) microRNA-directed
phasing during trans-acting siRNA biogenesis in plants. Cell 121: 207–221.
43. German MA, Pillay M, Jeong DH, Hetawal A, Luo S, et al. (2008) Global
identification of microRNA-target RNA pairs by parallel analysis of RNA ends.
Nat Biotechnol 26: 941–946.
44. Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, et al.
(2007) High-throughput sequencing of Arabidopsis microRNAs: evidence for
frequent birth and death of MIRNA genes. PLoS ONE 2: e219.
45. Howell MD, Fahlgren N, Chapman EJ, Cumbie JS, Sullivan CM, et al. (2007)
Genome-wide analysis of the RNA-DEPENDENT RNA POLYMERASE6/
DICER-LIKE4 pathway in Arabidopsis reveals dependency on miRNA- and
tasiRNA-directed targeting. Plant Cell 19: 926–942.
46. Gregory BD, O’Malley RC, Lister R, Urich MA, Tonti-Filippini J, et al. (2008)
A link between RNA metabolism and silencing affecting Arabidopsis develop-
ment. Dev Cell 14: 854–866.
47. Chekanova JA, Gregory BD, Reverdatto SV, Chen H, Kumar R, et al. (2007)
Genome-wide high-resolution mapping of exosome substrates reveals hidden
features in the Arabidopsis transcriptome. Cell 131: 1340–1353.
48. Ji H, Wong WH (2005) TileMap: create chromosomal map of tiling array
hybridizations. Bioinformatics 21: 3629–3636.
 Another Random Document on
Scribd Without Any Related Topics
which He Himself proposed to visit. He conferred on them the power
to work miracles, in attestation of their authority, and of the divine
character of Him by whom they were sent. He imposed upon them
strict rules of conduct, and directed them to make known to every
one who would hear them the good news of the coming
dispensation. As soon as He sent them forth, He Himself went
immediately abroad to teach and to preach in their cities. As their
Master and Lord, He might reasonably have claimed exemption from
the personal toil and the rigid self-denials to which they were by
necessity subjected. But He had laid no claim to such exemption. He
commenced without delay the performance of the very same duties
which He had imposed upon them. He felt himself under obligation
to set an example of obedience to His own rules. "The Son of Man,"
said He, "came not to be ministered unto, but to minister, and to
give His life a ransom for many." "Which," said He, "is greater, he
that sitteth at meat, or he that serveth? but I am among you as He
that serveth." Would it not be well, if, in this respect, we copied
more minutely the example of our Lord, and held ourselves
responsible for the performance of the very same duties which we
so willingly impose upon our brethren? We best prove that we
believe an act obligatory, when we commence the performance of it
ourselves. Many zealous Christians employ themselves in no other
labor than that of urging their brethren to effort. Our Savior acted
otherwise. In this respect, His example is specially to be imitated by
His ministers. When they urge upon others a moral duty, they must
be the first to perform it. When they inculcate an act of self-denial,
they themselves must make the noblest sacrifice. Can we conceive
of anything which could so much increase the moral power of the
ministry, and rouse to a flame the dormant energy of the churches,
as obedience to this teaching of Christ by the preachers of His
gospel?
It seems that the Savior had selected a well-known spot, at the
head of the lake, for the place of meeting for his apostles, after this
their first missionary tour had been completed. "The apostles
gathered themselves unto Jesus, and told Him all things, both what
they had done, and what they had taught." There is something
delightful in this filial confidence which these simple-hearted men
reposed in their almighty Redeemer. They told Him of their success
and their failure, of their wisdom and their folly, of their reliance and
their unbelief. We can almost imagine ourselves spectators of this
meeting between Christ and them, after this their first separation
from each other. The place appointed was most probably some well-
known locality on the shore of the lake, under the shadow of its
overhanging rocks, where the cool air from the bosom of the water
refreshed each returning laborer, as he came back beaten out with
the fatigues of travel, under the burning sun of Syria. You can
imagine the joy with which each drew near to the Master, after this
temporary absence; and the honest greetings with which every
newcomer was welcomed by those who had chanced to arrive
before him. We can seem to perceive the Savior of men listening
with affectionate earnestness to the recital of their various
adventures; and interposing, from time to time, a word either of
encouragement or of caution, as the character and circumstances of
each narrator required it. The bosom of each was unveiled before
the Searcher of Hearts, and the consolation which each one needed
was bestowed upon him abundantly. The toilsomeness of their
journey was no longer remembered, as each one received from the
Son of God the smile of His approbation. That was truly a joyful
meeting. Of all that company there is not one who has forgotten
that day; nor will he forget it ever. With unreserved frankness they
told Jesus of all that they had done, and what they had taught; of all
their acts, and all their conversations. Would it not be better for us,
if we cultivated more assiduously this habit of intimate intercourse
with the Savior? Were we every day to tell Jesus of all that we have
done and said; did we spread before Him our joys and our sorrows,
our faults and our infirmities, our successes and our failures, we
should be saved from many an error and many a sin. Setting the
Lord always before us, He would be on our right hand, and we
should not be moved. "He that dwelleth in the secret place of the
most High shall abide under the shadow of the Almighty."
 The Savior perceived that the apostles needed much instruction
which could not be communicated in a place where both He and
they were so well known. They had committed many errors, which
He preferred to correct in private. By doing His will, they had learned
to repose greater confidence in His wisdom, and were prepared to
receive from Him more important instruction. But these lessons
could not be delivered in the hearing of a promiscuous audience. Nor
was this all. He perceived that the apostles were worn out with their
labors, and needed repose. Surrounded as they were by the
multitude, which had already begun to collect about them, rest and
retirement were equally impossible. "There were many coming and
going, and they had no leisure, even so much as to eat." He
therefore said to them, "Come ye yourselves apart into a desert
place, and rest a while." For this purpose, He "took ship, and crossed
over with his disciples alone, and went into a desert place belonging
to Bethsaida."
The religion of Christ imposes upon us duties of retirement, as
well as duties of publicity. The apostles had been for some time past
before the eyes of all men, preaching and working miracles. Their
souls needed retirement. "Solitude," said Cecil, "is my great
ordinance." They would be greatly improved by private communion
both with Him and with each other. It was for the purpose of
affording them such a season of moral recreation, that our Lord
withdrew them from the public gaze into a desert place. Nor was this
all. Their labor for some weeks past had been severe. They had
traveled on foot under a tropical sun, reasoning with unbelievers,
instructing the ignorant, and comforting the cast-down. Called upon,
at all hours, both of the day and night, to work cures on those that
were opprest with diseases, their bodies, no less than their spirits,
needed rest. Our Lord saw this, and He made provision for it. He
withdrew them from labor, that they might find, tho it were but for a
day, the repose which their exhausted natures demanded. The
religion of Christ is ever merciful, and ever consistent in its
benevolence. It is thoughtful of the benefactor as well as the
recipient. It requires of us all labor and self-sacrifice, but to these it
affixes a limit. It never commands us to ruin our health and enfeeble
our minds by unnatural exhaustion. It teaches us to obey the laws of
our physical organization, and to prepare ourselves for the labors of
to-morrow by the judiciously conducted labors of to-day. It was on
this principle that our Lord conducted His intercourse with His
disciples. "He knew their frame, and remembered that they were
dust."
May we not from this incident derive a lesson of practical
instruction? I well know that there are persons who are always
sparing themselves, who, while it is difficult to tell what they do, are
always complaining of the crushing weight of their labors, and who
are rather exhausted with the dread of what they shall do, than with
the experience of what they have actually done. It is not of those
that we speak. Those who do not labor have no need of rest. It is to
the honest, the painstaking, the laborious, that we address the
example in the text. We sometimes meet with the industrious, self-
denying servant of Christ, in feeble health, and with an exhausted
nature, bemoaning his condition, and condemning himself because
he can accomplish no more, while so much yet remains to be done.
To such a one we may safely present the example of the blessed
Savior. When His apostles had done to the utmost of their strength,
altho the harvest was great, and the laborers few, He did not urge
upon them additional labor, nor tell them that because there was so
much to be done they must never cease from doing. No; He tells
them to turn aside and rest for a while. It is as tho He had said,
"Your strength is exhausted; you cannot be qualified for subsequent
duty until you be refreshed. Economize, then, your power, that you
may accomplish the more." The Savior addresses the same language
to us now. When we are worn down in His service, as in any other,
He would have us rest, not for the sake of self-indulgence, but that
we may be the better prepared for future effort. We do nothing at
variance with His will, when we, with a good conscience, use the
liberty which he has thus conceded to us.
Jesus, with His disciples, crossed the water, and entered the
desert; that is, the sparsely inhabited country of Bethsaida. Desert,
or wilderness, in the New Testament, does not mean an arid waste,
but pasture land, forest, or any district to which one could retire for
seclusion. Here, in the cool and tranquil neighborhood of the lake,
he began to instruct His disciples, and, without interruption, make
known to them the mysteries of the kingdom. It was one of those
seasons that the Savior Himself rarely enjoyed. Everything tended to
repose: the rustling leaves, the rippling waves, the song of the birds,
heard more distinctly in this rural solitude, all served to calm the
spirit ruffled by the agitations of the world, and prepared it to listen
to the truths which unveil to us eternity. Here our Lord could
unbosom Himself, without reserve, to His chosen few, and hold with
them that communion which He was rarely permitted to enjoy during
His ministry on earth.
Soon, however, the whole scene is changed. The multitude, whom
he had so recently left, having observed the direction in which He
had gone, have discovered the place of His retreat. An immense
crowd approaches, and the little company is surrounded by a dense
mass of human beings pressing upon them on every side. These are,
however, only the pioneers. At last, five thousand men, besides
women and children, are beheld thronging around them.
Some of these suitors present most importunate claims. They are
in search of cure for diseases which have baffled the skill of the
medical profession, and, as a last resort, they have come to the
Messiah for aid. Here was a parent bringing a consumptive child.
There were children bearing on a couch a paralytic parent. Here was
a sister leading a brother blind from his birth, while her supplications
were drowned by the shout of a frenzied lunatic who was standing
by her side. Every one, believing his own claim to be the most
urgent, prest forward with selfish importunity. Each one, caring for
no other than himself, was striving to attain the front rank, while
those behind, disappointed, and fearing to lose this important
opportunity, were eager to occupy the places of those more
fortunate than themselves. The necessary tumult and disorder of
such a scene you can better imagine than I can describe.
 This was, doubtless, by no means a welcome interruption. The
apostles needed the time for rest; for they were worn out in the
public service. They wanted it for instruction; for such opportunities
of intercourse with Christ were rare. But what did they do? Did our
Lord inform the multitude that this day was set apart for their own
refreshment and improvement, and that they could not be
interrupted? As He beheld them approaching, did He quietly take to
His boat, and leave them to go home disappointed? Did He plead His
own convenience, or His need of repose, as any reason for not
attending to the pressing necessities of His fellow men?
No, my brethren, very far from it. That providence of God had
brought these multitudes before Him, and that same providence
forbade Him to send them away unblest. He at once broke up the
conference with His disciples and addrest Himself to the work before
Him. His instructions were of inestimable importance; but I doubt if
even they were as important as the example of deep humility,
exhaustless kindness, and affecting compassion which He here
exhibited. When the Master places work before us which can be
done at no other time, our convenience must yield to other men's
necessities. "The Son of Man came not to be ministered unto, but to
minister." You can imagine to yourself the Savior rising from His seat,
in the midst of His disciples, and presenting Himself to the
approaching multitudes. His calm dignity awes into silence this
tumultuous gathering of the people. Those who came out to witness
the tricks of an empiric, or listen to the ravings of a fanatic, find
themselves, unexpectedly, in a presence that repels every emotion
but that of profound veneration. The light-hearted and frivolous are
awestruck by the unearthly majesty that seems to clothe the
Messiah as with a garment. And yet it was a majesty that shone
forth conspicuous, most of all, by the manifestation of unparalleled
goodness. Every eye that met the eye of the Savior quailed before
Him; for it looked into a soul that had never sinned; and the spirit of
the sinner felt, for the first time, the full power of immaculate virtue.
Thus the Savior passed among the crowd, and "healed all that had
need of healing." The lame walked, the lepers were cleansed, the
blind received their sight, the paralytic were restored to soundness,
and the bloom of health revisited the cheeks of those that but just
now were sick unto death.
The work to be done for the bodies of men was accomplished, and
there yet remained some hours of the summer's day unconsumed.
The power and goodness displayed in this miraculous healing would
naturally predispose the people to listen to the instructions of the
Savior. This was too valuable an opportunity to be lost. Our Lord
therefore proceeded to speak to them of the things concerning the
kingdom of God. We can seem to perceive the Savior seeking an
eminence from whence He could the more conveniently address this
vast assembly. You hear Him unfold the laws of God's moral
government. He unmasks the hypocrisy of the Pharisees; He rebukes
the infidelity of the Sadducees; He exposes the folly of the frivolous,
as well as of the selfish worldling; He speaks peaceably to the
humble penitent; He encourages the meek, and comforts those that
be cast down. The intellect and the conscience of this vast assembly
are swayed at His will. The soul of man bows down in reverence in
the presence of its Creator. "He stilleth the noise of the seas, the
noise of their waves, and the tumult of the people." As He closes His
address, every eye is moistened with compunction for sin. Every soul
cherishes the hope of amendment. Every one is conscious that a
new moral light has dawned upon his soul, and that a new moral
universe has been unveiled to his spiritual vision. As the closing
words of the Savior fell upon their ears, the whole multitude stood
for a while unmoved, as tho transfixt to the earth by some mighty
spell; until, at last, the murmur is heard from thousands of voices,
"Never man spake like this man."
But the shades of evening are gathering around them. The
multitude have nothing to eat. To send them away fasting would be
inhuman, for divers of them came from far, and many were women
and children, who could not perform their journey homeward
without previous refreshment. To purchase food in the surrounding
towns and villages would be difficult; but even were this possible,
whence could the necessary funds be provided? A famishing
multitude was thus unexpectedly cast upon the bounty of our Lord.
He had not tempted God by leading them into the wilderness. They
came to Him of themselves, to hear His words and to be healed of
their infirmities. He could not "send them away fasting, lest they
should faint by the way." In this dilemma, what was to be done? He
puts this question to His disciples, and they can suggest no means of
relief. The little stock of provisions which they had brought with
them was barely sufficient for themselves. They can perceive no
means whatever by which the multitude can be fed, and they at
once confess it.
The Savior, however, commands the twelve to give them to eat.
They produce their slender store of provisions, amounting to five
loaves and two small fishes. He commands the multitude to sit down
by companies on the grass. As soon as silence is obtained, He lifts
up His eyes to heaven, and supplicates the blessing of God upon
their scanty meal. He begins to break the loaves and fishes, and
distribute them to His disciples, and His disciples distribute them to
the multitude. He continues to break and distribute. Basket after
basket is filled and emptied, yet the supply is undiminished. Food is
carried in abundance to the famishing thousands. Company after
company is supplied with food, but the five loaves and two fishes
remain unexhausted. At last, the baskets are returned full, and it is
announced that the wants of the multitude are supplied. The miracle
then ceases, and the multiplication of food is at an end.
But even here the provident care of the Savior is manifested. Altho
this food has been so easily provided, it is not right that it be lightly
suffered to perish. Christ wrought no miracles for the sake of
teaching men wastefulness. That food, by what means soever
provided, was a creature of God, and it were sin to allow it to decay
without accomplishing the purposes for which it was created.
"Gather up the fragments," said the Master of the feast, "that
nothing be lost." "And they gathered up the fragments that
remained, twelve baskets full."
 Dissimilar as are our circumstances to those of our Lord, we may
learn from this latter incident a lesson of instruction.
In the first place, as I have remarked, the Savior did not lead the
multitude into the wilderness without making provision for their
sustenance. This would have been presumption. They followed Him
without His command, and He found Himself with them in this
necessity. He had provided for His own wants, but they had not
provided for theirs. The providence of God had, however, placed Him
in His present circumstances, and He might therefore properly look
to providence for deliverance. This event, then, furnishes the rule by
which we are to be governed. When we plunge ourselves into
difficulty, by a neglect of the means or by a misuse of the faculties
which God has bestowed upon us, it is to be expected that He will
leave us to our own devices. But when, in the honest discharge of
our duties, we find ourselves in circumstances beyond the reach of
human aid, we may then confidently look up to God for deliverance.
He will always take care of us while we are in the spot where He has
placed us. When He appoints for us trials, He also appoints for us
the means of escape. The path of duty, tho it may seem arduous, is
ever the path of safety. We can more easily maintain ourselves in the
most difficult position, God being our helper, than in apparent
security relying on our own strength.
The Savior, in full reliance upon God, with only five loaves and two
fishes, commenced the distribution of food amongst the vast
multitude. Tho His whole store was barely sufficient to supply the
wants of His immediate family, He began to share it with the
thousands who surrounded Him. Small as was His provision at the
commencement, it remained unconsumed until the deed of mercy
was done, and the wants of the famished host supplied. Nor were
the disciples losers by this act of charity. After the multitude had
eaten and were satisfied, twelve baskets full of fragments remained,
a reward for their deed of benevolence.
From this portion of the narrative, we may, I think, learn that if we
act in faith, and in the spirit of Christian love, we may frequently be
justified in commencing the most important good work, even when
in possession of apparently inadequate means. If the work be of
God, He will furnish us with helpers as fast as they are needed. In all
ages, God has rewarded abundantly simple trust in Him, and has
bestowed upon it in the highest honor. We must, however,
remember the conditions upon which alone we may expect His aid,
lest we be led into fanaticism. The service which we undertake must
be such as God has commanded, and His providence must either
designate us for the work, or, at least, open the door by which we
shall enter upon it. It must be God's work, and not our own; for the
good of others, and not for the gratification of our own passions;
and, in the doing of it, we must, first of all, make sacrifice of
ourselves, and not of others. Under such circumstances, there is
hardly a good design which we may not undertake with cheerful
hopes of success, for God has promised us His assistance. "If God be
for us, who can be against us?" The calculations of the men of this
world are of small account in such a matter. It would have provoked
the smile of an infidel to behold the Savior commencing the work of
feeding five thousand men with a handful of provisions. But the
supply increased as fast as it was needed, and it ceased not until all
that He had prayed for was accomplished.
Perhaps, also, we may learn from this incident another lesson. If I
mistake not, it suggests to us that in works of benevolence we are
accustomed to rely too much on human, and too little on divine, aid.
When we attempt to do good, we commence by forming large
associations, and suppose that our success depends upon the
number of men whom we can unite in the promotion of our
undertaking. Every one is apt thus to forget his own personal duty,
and rely upon the labor of others, and it is well if he does not put his
organization in the place of God Himself. Would it not be better if we
made benevolence much more a matter between God and our own
souls, each one doing with his own hands, in firm reliance on divine
aid, the work which Providence has placed directly before him? Our
Lord did not send to the villages round to organize a general effort
to relieve the famishing. In reliance upon God, He set about to work
Himself, with just such means as God had afforded Him. All the
miracles of benevolence have, if I mistake not, been wrought in the
same manner. The little band of disciples in Jerusalem accomplished
more for the conversion of the world than all the Christians of the
present day united. And why? Because every individual Christian felt
that the conversion of the world was a work for which he himself,
and not an abstraction that he called the Church, was responsible.
Instead of relying on man for aid, every one looked up directly to
God, and went forth to the work. God was thus exalted, the power
was confest to be His own, and, in a few years, the standard of the
Cross was carried to the remotest extremities of the then known
world.
Such has, I think, been the case ever since. Every great moral
reformation has proceeded upon principles analogous of these. It
was Luther, standing up alone in simple reliance upon God, that
smote the Papal hierarchy; and the effects of that blow are now
agitating the nations of Europe. Roger Williams, amid persecution
and banishment, held forth that doctrine of soul-liberty which, in its
onward march, is disenthralling a world. Howard, alone, undertook
the work of showing mercy to the prisoner, and his example is now
enlisting the choicest minds in Christendom in this labor of
benevolence. Clarkson, unaided, a young man, and without
influences, consecrated himself to the work of abolishing the slave
trade; and, before he rested from his labor, his country had repented
of and forsaken this atrocious sin. Raikes saw the children of
Gloucester profaning the Sabbath day; he set on foot a Sabbath
school on his own account, and now millions of children are reaping
the benefit of his labors, and his example has turned the attention of
the whole world to the religious instruction of the young. With such
facts before us, we surely should be encouraged to attempt
individually the accomplishment of some good design, relying in
humility and faith upon Him who is able to grant prosperity to the
feeblest effort put forth in earnest reliance on His almightiness.
Such were the occupations that filled up a day in the life of Jesus
of Nazareth. There was not an act done for Himself; all was done for
others. Every hour was employed in the labor which that hour set
before Him. Private kindness, the relief of distress, public teaching,
and ministration to the wants of the famishing, filled up the entire
day. Let His disciples learn to follow His example. Let us, like Him,
forget ourselves, our own wants, and our own weariness, that we
may, as he did, scatter blessings on every side, as we move onward
in the pathway of our daily life. If such were the occupations of the
Son of God, can we do more wisely than to imitate His example?
Every disciple would then be as a city set upon a hill, and men,
seeing our good works, would glorify our Father who is in heaven.
"Then would our righteousness go forth as brightness, and our
salvation as a lamp that burneth."
 VINET
THE MYSTERIES OF CHRISTIANITY

BIOGRAPHICAL NOTE

Alexander Vinet, the eminent Swiss divine and author, was born at
Ouchy, Canton, in 1797. He was professor of theology at Lausanne
(1837-45), where he gained reputation as a preacher, a philosopher,
and a writer. He was tolerant tho critical, and many of his utterances
are marked by rare brilliancy. His supreme and intense faith led him
to say: "The gospel is believed when it has ceased to be to us an
external and has become an internal truth, when it has become a
fact in our consciousness. Christianity is conscience raised to its
highest exercise." He died in 1847.
 VINET
1797-1847
THE MYSTERIES OF CHRISTIANITY

Things which have not entered into the heart of man.—1 Cor. ii.,
9.
"I do not comprehend, therefore I do not believe." "The gospel is
full of mysteries, therefore I do not receive the gospel:"—such is one
of the favorite arguments of infidelity. To see how much is made of
this, and what confidence it inspires, we might believe it solid, or, at
least, specious; but it is neither the one nor the other; it will not
bear the slightest attention, the most superficial examination of
reason; and if it still enjoys some favor in the world, this is but a
proof of the lightness of our judgments upon things worthy of our
most serious attention.
Upon what, in fact, does this argument rest? Upon the claim of
comprehending every thing in the religion which God has offered or
could offer us—a claim equally unjust, unreasonable, useless. This
we proceed to develop.
1. In the first place, it is an unjust claim. It is to demand of God
what He does not owe us. To prove this, let us suppose that God has
given a religion to man, and let us further suppose that religion to
be the gospel: for this absolutely changes nothing to the argument.
We may believe that God was free, at least, with reference to us, to
give us or not to give us a religion; but it must be admitted that in
granting it He contracts engagements to us, and that the first favor
lays Him under a necessity of conferring other favors. For this is
merely to say that God must be consistent, and that He finishes
what He has begun. Since it is by a written revelation He manifests
His designs respecting us, it is necessary He should fortify that
revelation by all the authority which would at least determine us to
receive it; it is necessary He should give us the means of judging
whether the men who speak to us in His name are really sent by
Him; in a word, it is necessary we should be assured that the Bible is
truly the Word of God.
It would not indeed be necessary that the conviction of each of us
should be gained by the same kind of evidence. Some shall be led to
Christianity by the historical or external arguments; they shall prove
to themselves the truth of the Bible as the truth of all history is
proved; they shall satisfy themselves that the books of which it is
composed are certainly those of the times and of the authors to
which they are ascribed. This settled, they shall compare the
prophecies contained in these ancient documents with the events
that have happened in subsequent ages; they shall assure
themselves of the reality of the miraculous facts related in these
books, and shall thence infer the necessary intervention of divine
power, which alone disposes the forces of nature, and can alone
interrupt or modify their action. Others, less fitted for such
investigations, shall be struck with the internal evidence of the Holy
Scriptures. Finding there the state of their souls perfectly described,
their wants fully exprest, and the true remedies for their maladies
completely indicated; struck with a character of truth and candor
which nothing can imitate; in fine, feeling themselves in their inner
nature moved, changed, renovated, by the mysterious influence of
these holy writings, they shall acquire, by such means, a conviction
of which they can not always give an account to others, but which is
not the less legitimate, irresistible, and immovable. Such is the
double road by which an entrance is gained into the asylum of faith.
But it was due from the wisdom of God, from His justice, and, we
venture to say it, from the honor of His government, that He should
open to man this double road; for, if He desired man to be saved by
knowledge, on the same principle He engaged Himself to furnish him
the means of knowledge.
 Behold, whence come the obligations of the Deity with reference
to us, which obligations He has fulfilled. Enter on this double method
of proof. Interrogate history, time and places, respecting the
authenticity of the Scriptures; grasp all the difficulties, sound all the
objections; do not permit yourselves to be too easily convinced; be
the more severe upon that book, as it professes to contain the
sovereign rule of your life, and the disposal of your destiny; you are
permitted to do this, nay, you are encouraged to do it, provided you
proceed to the investigation with the requisite capacities and with
pure intentions. Or, if you prefer another method, examine, with an
honest heart, the contents of the Scriptures; inquire, while you run
over the words of Jesus, if ever man spake like this Man; inquire if
the wants of your soul, long deceived, and the anxieties of your
spirit, long cherished in vain, do not, in the teaching and work of
Christ, find that satisfaction and repose which no wisdom was ever
able to procure you; breathe, if I may thus express myself, that
perfume of truth, of candor and purity, which exhales from every
page of the gospel; see, if, in all these respects, it does not bear the
undeniable seal of inspiration and divinity. Finally, test it, and if the
gospel produces upon you a contrary effect, return to the books and
the wisdom of men, and ask of them what Christ has not been able
to give you.
But if, neglecting these two ways, made accessible to you, and
trodden by the feet of ages, you desire, before all, that the Christian
religion should, in every point, render itself comprehensible to your
mind, and complacently strip itself of all mysteries; if you wish to
penetrate beyond the veil, to find there, not the aliment which gives
life to the soul, but that which would gratify your restless curiosity, I
maintain that you raise against God a claim the most indiscreet, the
most rash and unjust; for He has never engaged, either tacitly or
expressly, to discover to you the secret which your eye craves; and
such audacious importunity is fit to excite His indignation. He has
given you what He owed you, more indeed than He owed you; the
rest is with Himself.
 If a claim so unjust could be admitted, where, I ask you, would be
the limit of your demands? Already you require more from God than
He has accorded to angels; for these eternal mysteries which trouble
you, the harmony of the divine prescience with human freedom, the
origin of evil and its ineffable remedy, the incarnation of the eternal
Word—the relations of the God-man with His Father—the atoning
virtue of His sacrifice, the regenerating efficacy of the Spirit-
comforter, all these things are secrets, the knowledge of which is
hidden from angels themselves, who, according to the word of the
Apostle, stoop to explore their depths, and can not.
If you reproach the Eternal for having kept the knowledge of these
divine mysteries to Himself, why do you not reproach Him for the
thousand other limits He has prescribed for you? Why not reproach
Him for not having given you wings like a bird, to visit the regions,
which, till now, have been scanned only by your eyes? Why not
reproach Him for not giving you, besides the five senses with which
you are provided, ten other senses which He has perhaps granted to
other creatures, and which procure for them perceptions of which
you have no idea? Why not, in fine, reproach Him for having caused
the darkness of night to succeed the brightness of day invariably on
the earth? Ah! you do not reproach Him for that. You love that night
which brings rest to so many fatigued bodies and weary spirits;
which suspends in so many wretches, the feeling of grief; that night,
during which orphans, slaves, and criminals cease to be, because
over all their misfortunes and sufferings it spreads, with the opiate
of sleep, the thick veil of oblivion; you love that night which,
peopling the deserts of the heavens with ten thousand stars, not
known to the day, reveals the infinite to our ravished imagination.
Well, then, why do you not, for a similar reason, love the night of
divine mysteries, night, gracious and salutary, in which reason
humbles itself, and finds refreshment and repose; where the
darkness even is a revelation; where one of the principal attributes
of God, immensity, discovers itself much more fully to our mind;
where, in fine, the tender relations He has permitted us to form with
Himself, are guarded from all admixture of familiarity by the thought
that the Being who has humbled Himself to us, is, at the same time,
the inconceivable God who reigns before all time, who includes in
Himself all existences and all conditions of existence, the center of
all thought, the law of all law, the supreme and final reason of every
thing! So that, if you are just, instead of reproaching Him for the
secrets of religion, you will bless Him that He has enveloped you in
mysteries.
2. But this claim is not only unjust toward God; it is also in itself
exceedingly unreasonable.
What is religion? It is God putting Himself in communication with
man; the Creator with the creature, the infinite with the finite. There
already, without going further, is a mystery; a mystery common to all
religions, impenetrable in all religions. If, then, every thing which is a
mystery offends you, you are arrested on the threshold, I will not
say of Christianity, but of every religion; I say, even of that religion
which is called natural, because it rejects revelation and miracles; for
it necessarily implies, at the very least, a connection, a
communication of some sort between God and man—the contrary
being equivalent to atheism. Your claim prevents you from having
any belief; and because you have not been willing to be Christians, it
will not allow you to be deists.
"It is of no consequence," you say, "we pass over that difficulty;
we suppose between God and us connections we can not conceive;
we admit them because they are necessary to us. But this is the only
step we are willing to take: we have already yielded too much to
yield more." Say more, say you have granted too much not to grant
much more, not to grant all! You have consented to admit, without
comprehending it, that there may be communications from God to
you, and from you to God. But consider well what is implied in such
a supposition. It implies that you are dependent, and yet free: this
you do not comprehend; it implies that the Spirit of God can make
itself understood by your spirit: this you do not comprehend; it
implies that your prayers may exert an influence on the will of God:
this you do not comprehend. It is necessary you should receive all
these mysteries, in order to establish with God connections the most
vague and superficial, and by the very side of which atheism is
placed. And when, by a powerful effort with yourselves you have
done so much as to admit these mysteries, you recoil from those of
Christianity! You have accepted the foundation, and refuse the
superstructure! You have accepted the principle and refuse the
details! You are right, no doubt, so soon as it is proved to you, that
the religion which contains these mysteries does not come from
God; or rather, that these mysteries contain contradictory ideas. But
you are not justified in denying them, for the sole reason that you
do not understand them; and the reception you have given to the
first kind of mysteries compels you, by the same rule, to receive the
others.
This is not all. Not only are mysteries an inseparable part, nay, the
very substance of all religion, but it is absolutely impossible that a
true religion should not present a great number of mysteries. If it is
true, it ought to teach more truths respecting God and divine things
than any other, than all others together; but each of these truths has
a relation to the infinite, and by consequence borders on a mystery.
How should it be otherwise in religion, when it is thus in nature
itself? Behold God in nature! The more He gives us to contemplate,
the more He gives to astonish us. To each creature is attached some
mystery. A grain of sand is an abyss! Now, if the manifestations
which God has made of Himself in nature suggest to the observer a
thousand questions which can not be answered, how will it be, when
to that first revelation, another is added; when God the Creator and
Preserver reveals Himself under new aspects as God the Reconciler
and Savior? Shall not mysteries multiply with discoveries? With each
new day shall we not see associated a new night? And shall we not
purchase each increase of knowledge with an increase of ignorance?
Has not the doctrine of grace, so necessary, so consoling, alone
opened a profound abyss, into which, for eighteen centuries, rash
and restless spirits have been constantly plunging?
It is, then, clearly necessary that Christianity should, more than
any other religion, be mysterious, simply because it is true. Like
mountains, which, the higher they are, cast the larger shadows, the
gospel is the more obscure and mysterious on account of its
sublimity. After this, will you be indignant that you do not
comprehend every thing in the gospel? It would, forsooth, be a truly
surprising thing if the ocean could not be held in the hollow of your
hand, or uncreated wisdom within the limits of your intelligence! It
would be truly unfortunate if a finite being could not embrace the
infinite, and that, in the vast assemblage of things there should be
some idea beyond its grasp! In other words, it would be truly
unfortunate if God Himself should know something which man does
not know!
Let us acknowledge, then, how insensate is such a claim when it is
made with reference to religion.
But let us also recollect how much, in making such a claim, we
shall be in opposition to ourselves; for the submission we dislike in
religion, we cherish in a thousand other things. It happens to us
every day to admit things we do not understand, and to do so
without the least repugnance. The things, the knowledge of which is
refused us, are much more numerous than we perhaps think. Few
diamonds are perfectly pure; still fewer truths are perfectly clear.
The union of our soul with our body is a mystery—our most familiar
emotions and affections are a mystery—the action of thought and of
will is a mystery—our very existence is a mystery. Why do we admit
these various facts? Is it because we understand them? No,
certainly, but because they are self-evident, and because they are
truths by which we live. In religion we have no other course to take.
We ought to know whether it is true and necessary; and once
convinced of these two points, we ought, like the angels, to submit
to the necessity of being ignorant of some things. And why do we
not submit cheerfully to a privation which, after all, is not one?
3. To desire the knowledge of mysteries is to desire what is utterly
useless; it is to raise, as I have said before, a claim the most vain
and idle. What in reference to us is the object of the gospel?
Evidently to regenerate and save us. But it attains this end wholly by
the things it reveals. Of what use would it be to know those it
conceals from us? We possess the knowledge which can enlighten
our consciences, rectify our inclinations, renew our hearts; what
should we gain if we possest other knowledge? It infinitely concerns
us to know that the Bible is the Word of God; does it equally concern
us to know in what way the holy men that wrote it were moved by
the Holy Ghost? It is of infinite moment to us to know that Jesus
Christ is the Son of God; need we know precisely in what way the
divine and human natures are united in His adorable person? It is of
infinite importance for us to know that unless we are born again we
can not enter the kingdom of God, and that the Holy Spirit is the
author of the new birth; shall we be further advanced if we know the
divine process by which that wonder is performed? Is it not enough
for us to know the truths that save? Of what use, then, would it be
to know those which have not the slightest bearing on our salvation?
"Tho I know all mysteries," says St. Paul, "and have not charity, I am
nothing." St. Paul was content not to know, provided he had charity;
shall not we, following his example, be content also without
knowledge, provided that, like him, we have charity, that is to say,
life?
But some one will say "If the knowledge of mysteries is really
without influence on our salvation, why have they been indicated to
us at all?" What if it should be to teach us not to be too prodigal of
our "wherefores!" if it should be to serve as an exercise of our faith,
a test of our submission! But we will not stop with such a reply.
Observe, I pray you, in what manner the mysteries of which you
complain have taken their part in religion. You readily perceive they
are not by themselves, but associated with truths which have a
direct bearing on your salvation. They contain them, they serve to
develop them; but they are not themselves the truths that save. It is
with these mysteries as it is with the vessel that contains a medicinal
draft—it is not the vessel that cures, but the draft; yet the draft
could not be presented without the vessel. Thus each truth that
saves is contained in a mystery, which, in itself, has no power to
save. So the great work of expiation is necessarily attached to the
incarnation of the Son of God, which is a mystery; so the sanctifying
graces of the new covenant are necessarily connected with the
effluence of the Holy Spirit, which is a mystery; so, too, the divinity
of religion finds a seal and an attestation in the miracles, which are
mysteries. Everywhere the light is born from darkness, and darkness
accompanies the light. These two orders of truths are so united, so
interlinked, that you can not remove the one without the other, and
each of the mysteries you attempt to tear from religion would carry
with it one of the truths which bear directly on your regeneration
and salvation. Accept the mysteries, then, not as truths that can
save you, but as the necessary conditions of the merciful work of the
Lord in your behalf.
The true point at issue in reference to religion is this:—Does the
religion which is proposed to us change the heart, unite to God,
prepare for heaven? If Christianity produces these effects, we will
leave the enemies of the cross free to revolt against its mysteries,
and tax them with absurdity. The gospel, we will say to them, is then
an absurdity; you have discovered it. But behold what a new species
of absurdity that certainly is which attaches man to all his duties,
regulates human life better than all the doctrines of sages, plants in
his bosom harmony, order, and peace, causes him joyfully to fulfil all
the offices of civil life, renders him better fitted to live, better fitted
to die, and which, were it generally received, would be the support
and safeguard of society! Cite to us, among all human absurdities, a
single one which produces such effects. If that "foolishness" we
preach produces effects like these, is it not natural to conclude that
it is truth itself? And if these things have not entered the heart of
man, it is not because they are absurd, but because they are divine.
Make but a single reflection. You are obliged to confess that none
of the religions which man may invent can satisfy his wants, or save
his soul. Thereupon you have a choice to make. You will either reject
them all as insufficient and false, and seek for nothing better, since
man can not invent better, and then you will abandon to chance, to
caprice of temperament or of opinion, your moral life and future
destiny; or you will adopt that other religion which some treat as
folly, and it will render you holy and pure, blameless in the midst of
a perverse generation, united to God by love, and to your brethren
by charity, indefatigable in doing good, happy in life, happy in death.
Suppose, after all this, you shall be told that this religion is false; but
meanwhile, it has restored in you the image of God, reestablished
your primitive connections with that great Being, and put you in a
condition to enjoy life and the happiness of heaven. By means of it
you have become such that at the last day, it is impossible that God
should not receive you as His children and make you partakers of His
glory. You are made fit for paradise, nay, paradise has commenced
for you even here, because you love. This religion has done for you
what all religions propose, and what no other has realized.
Nevertheless, by the supposition, it is false! And what more could it
do, were it true? Rather do you not see that this is a splendid proof
of its truth? Do you not see that it is impossible that a religion which
leads to God should not come from God, and that the absurdity is
precisely that of supposing that you can be regenerated by a
falsehood?
Suppose that afterward, as at the first, you do not comprehend. It
seems necessary, then, you should be saved by the things you do
not comprehend. Is that a misfortune? Are you the less saved? Does
it become you to demand from God an explanation of an obscurity
which does not injure you, when, with reference to every thing
essential, He has been prodigal of light? The first disciples of Jesus,
men without culture and learning, received truths which they did not
comprehend, and spread them through the world. A crowd of sages
and men of genius have received, from the hands of these poor
people, truths which they comprehended no more than they. The
ignorance of the one, and the science of the other, have been
equally docile. Do, then, as the ignorant and the wise have done.
Embrace with affection those truths which have never entered into
your heart, and which will save you. Do not lose, in vain discussions,
the time which is gliding away, and which is bearing you into the
cheering or appalling light of eternity. Hasten to be saved. Love now;
one day you will know. May the Lord Jesus prepare you for that
period of light, of repose, and of happiness!
 SUMMERFIELD
THE HEAVENLY INHERITANCE

BIOGRAPHICAL NOTE

John Summerfield was born in England in 1798, and came to New

York in 1821, where he soon became one of the most popular and
eloquent preachers of that day. He belonged to the Methodist
Communion and his name is still perpetuated in the names of many
Methodist churches. He was unusually simple and modest in his
tastes and habits, but when he spoke from the pulpit he produced a
great impression by the force and daring of his style. He gave
promise of equaling Whitefield as a pulpit orator, but he was subject
to delicate health and prematurely died in 1825, twenty-seven years
of age.
 SUMMERFIELD
1798-1825
THE HEAVENLY INHERITANCE

For so an entrance shall be ministered unto you abundantly into

the everlasting kingdom of our Lord and Saviour Jesus Christ.—2
Peter i., 11.
Of all the causes which may be adduced to account for the
indifference which is so generally manifested toward those great
concerns of eternity, in which men are so awfully interested, none
appears to me so likely to resolve the mystery, as that unbelief
which lies at the core of every heart, hindering repentance, and so
making faith impossible. Men hear that there is a hell to shun, a
heaven to win; and, though they give their assent to both these
truths, they never impress them on their mind. It is plain that,
whatever their lips may confess, they never believed with the heart,
otherwise some effect would have been produced in the life. The
germ of unbelief lies within, and discovers itself in all that
indifference which is displayed, in the majority of that class of beings
whose existence is to be perpetuated throughout eternity. If these
thoughts do sometimes obtrude themselves on their serious
attention, they are immediately banished from their minds; and the
dying exclamation of Moses may be taken up with tears by every
lover of perishing sinners: "O! that they were wise, that they
understood this, that they would consider their latter end!" When
God, by His prophet Isaiah, called the Israelites to a sense of their
awful departure from Him, His language was, "My people do not
know: My people do not consider." How few are there like Mary, who
"ponder those things in their heart," who are willing to look at
themselves, to pry into eternity, to put the question home,

"Shall I be with the damn'd cast out,

Or numbered with the bless'd?"

This question must sooner or later have a place in your minds, or

awful will be your state indeed; let it reach your hearts to-day; and if
you pray to the Father of light, you will soon be enabled in His light
to discern so much of yourselves as will cause you to cry, "What
shall I do to be saved?" While we shall this morning attempt to point
out some of the privileges of the sons of God, oh! may your hearts
catch the strong desire to be conformed to the living Head, that so
an abundant entrance may be administered unto you also, into the
everlasting kingdom of our Lord and Savior, Jesus Christ.
The privilege to which our text leads us, is exclusively applicable
to those to whom that question has been solved by the Spirit of
God; those who have believed to the saving of their souls; who have
experienced redemption through His blood, and the forgiveness of
sins; and who are walking in the fear of the Lord and in the comfort
of the Holy Ghost.
I. The state to which we look forward: the "everlasting kingdom of
our Lord and Savior."
1. It is a kingdom. By this figurative expression our Lord has
described the state of grace here and of glory hereafter; our
happiness in time and our happiness in eternity. They were wisely so
called: Jesus has said, as well as done, all things well; for these two
states differ not in kind, but in degree; the one is merely a
preparative for the other, and he who has been a subject of the
former kingdom will be a subject of the latter. Grace is but the seed
of glory, glory is the maturity of grace; grace is but the bud of glory,
glory is grace full blown; grace is but the blossom of glory, glory is
the ripe fruit of grace; grace is but the infant of glory, glory is the
perfection of grace. Hence our hymn beautifully says, "The men of
grace have found glory begun below," agreeing with our Lord's own
words, "He that believeth hath everlasting life"; he feels even here
its glories beginning—a foretaste of its bliss.
Now the propriety with which these two states are called
kingdoms is manifest from the analogy which might be traced
between them and the model of a human sovereignty. Two or three
of the outlines of this model will be sufficient.
In the idea of a kingdom it is implied that in some part of its
extent there is the residence of a sovereign; for this is essential to
constitute it. Now in the kingdom of grace the heart of the believer
is made the residence of the King invisible! "Know ye not that your
body is the temple of the Holy Ghost which is in you?" Such know
what that promise means, "I will dwell in them, and they shall be my
people." St. Paul exultingly cries, "Christ liveth in me."
Again, it is essential that the inhabitants of a kingdom be under
the government of its laws. An empire without laws is no sovereignty
at all; it ceases to be such, for every inhabitant has an equal right to
do that which seems good in his own eyes. Now the subjects of
Christ's kingdom of grace are "not without law, but are under a law
to Christ"; they do His righteous will!
Lastly, it is essential that the subjects of a kingdom be under the
protection of the presiding monarch, and that they repose their
confidence in him. To the subjects of the kingdom of grace, Christ
imparts His kingly protection; this is their heritage: "No weapon
formed against them shall prosper"; nay, He imparts to them of His
royal bounty, and they enjoy all the blessings of an inward heaven.
But how great the perfection of the kingdom of glory mentioned in
our text! Does He make these vile bodies His residence here? How
much more glorious is His temple above! how splendid the court of
heaven! There, indeed, he fixes His throne, and they see Him as He
is. Does He exercise His authority here and rule His happy subjects
by the law, the perfect law of love? How much more in heaven! He
reigns there forever over them; His government is there wholly by
Himself; He knows nothing of a rival there; His rule is sole and
perfect: there they serve Him day and night. Are His subjects here
partakers of His kingly bounty? Much more in heaven! He calls them
to a participation of all the joys, the spiritual joys which are at His
right hand, and the pleasures which are there forevermore. Yet,
after all our descriptions of that glory, it is not yet revealed, and,
therefore, inconceivable. But who would not hail such a Son of
David? who would not desire to be swayed by such a Prince of
Peace? Whose heart would not ascend with the affections of our
poet, "O! that with yonder sacred throng, we at His feet may fall"?
2. But it is an everlasting kingdom! Here it rises in the scale of
comparison. Weigh the kingdoms of this world in this balance, and
they are found wanting; for on many we read their fatal history, and
ere long we shall see them all branded with the writing of the
invisible Agent, "The kingdom is taken from thee, and given to a
nation bringing forth the fruits thereof"; "For the kingdoms of this
world have become the kingdoms of our Lord and of his Christ";
they will be absorbed and swallowed up in the fulness of eternity,
and leave not a wrack behind! Every thing here is perishable! The
towering diadem of Caesar has fallen from his head and crumbled
into dust; and that kingdom whose scepter once swayed the world,
betwixt whose colossal stride all nations were glad to creep to find
themselves dishonored graves, is now forgotten, or, if its recollection
be preserved, its history is emphatically called "The Decline and
Fall."
But bring the matter nearer home; apply it not to multitudes of
subjects, but to your individual experience, and has not that good
teacher instructed you in this sad lesson? We tremble to look at our
earthly possessions and employments, lest we should see them in
motion, spreading their wings to fly away! How many are there
already who, in talking of their comforts, are obliged to go back in
their reckoning! Would not this be the language of some of you: "I
had—I had a husband, the sharer of my joys, the soother of my
sorrows; but he is not! I had a wife, a helpmeet for me; but where is
she? I had children to whom I looked up as my support and staff in
the decline of life, while passing down the hill; but I am bereaved of
my children! I had health, and I highly prized its wealth; but now my
emaciated frame, my shriveled system, and the pains of nature
bespeak that comfort fled! I had, or fondly thought I had, happiness
in possession! Then I said with Job, 'I shall die in my nest!' but ah!
an unexpected blast passed over me, and now my joys are blighted!
'They have fled as a shadow, and continued not.'" Yes! time
promised you much! perhaps it performed a little; but it can not do
any thing for you on which it can grave "eternal." Its name is mortal,
its nature is decay; it was born with man, and when the generations
of men shall cease to exist, it will cease also: "Time shall be no
longer!" We know concerning these that, "All flesh is as grass, and
all the glory of man as the flower of grass. The grass withereth, and
the flower fadeth, but the word of the Lord endureth forever." Yes!
His kingdom is an everlasting kingdom; glory can not corrupt! the
crown of glory can not fade! Why? Death will be destroyed; Christ
will put this last enemy under His feet, and all will then be eternal
life! Oh, happy, happy kingdom; nay, thrice happy he who shall be
privileged to be its subject!
3. It is the everlasting kingdom of our own Lord and Savior Jesus
Christ. It is His by claim: "Him hath God the Father highly exalted";
yea, Him hath He appointed to be "the judge of quick and dead"; for
tho by the sufferings of death He was made a little lower than the
angels, yet immediately after His resurrection He declares that now
"All power is given unto him in heaven and in earth"! The Father
hath committed all judgment unto the Son, and He has now the
disposal of the offices and privileges of the empire among His
faithful followers. This is the idea that the penitent dying thief had
on the subject: "Lord, remember me when thou comest into thy
kingdom"; and St. Paul expresses the same when he says to
Timothy in the confidence of faith, "The Lord shall deliver me and
preserve me unto his heavenly kingdom." Oh! how pleasing the
thought to the child of God, that his ruler to all eternity will be his
elder Brother; for He who sanctifieth and they who are sanctified are
all of one; and though He is heir of all things, yet we, as younger
branches of the same heavenly family, shall be joint heirs, fellow-
Welcome to our website – the perfect destination for book lovers and
knowledge seekers. We believe that every book holds a new world,
offering opportunities for learning, discovery, and personal growth.
That’s why we are dedicated to bringing you a diverse collection of
books, ranging from classic literature and specialized publications to
self-development guides and children's books.

More than just a book-buying platform, we strive to be a bridge

connecting you with timeless cultural and intellectual values. With an
elegant, user-friendly interface and a smart search system, you can
quickly find the books that best suit your interests. Additionally,
our special promotions and home delivery services help you save time
and fully enjoy the joy of reading.

Join us on a journey of knowledge exploration, passion nurturing, and

personal growth every day!

ebookbell.com