ARTICLE

pubs.acs.org/JACS

Site-Specific Labeling of DNA and RNA Using an Efficiently Replicated

and Transcribed Class of Unnatural Base Pairs
Young Jun Seo,† Denis A. Malyshev,† Thomas Lavergne,† Phillip Ordoukhanian, and Floyd E. Romesberg*
Department of Chemistry and Center for Protein and Nucleic Acid Research, The Scripps Research Institute,
10550 N. Torrey Pines Road, La Jolla, California 92037, United States
bS Supporting Information
ABSTRACT: Site-specific labeling of enzymatically synthesized DNA or RNA has many
potential uses in basic and applied research, ranging from facilitating biophysical studies to the
in vitro evolution of functional nucleic acids and the construction of various nanomaterials and
biosensors. As part of our efforts to expand the genetic alphabet, we have developed a class of
unnatural base pairs, exemplified by d5SICS-dMMO2 and d5SICS-dNaM, which are efficiently
replicated and transcribed, and which may be ideal for the site-specific labeling of DNA and RNA.
Here, we report the synthesis and analysis of the ribo- and deoxyribo-variants, (d)5SICS and
(d)MMO2, modified with free or protected propargylamine linkers that allow for the site-specific
modification of DNA or RNA during or after enzymatic synthesis. We also synthesized and
evaluated the α-phosphorothioate variant of d5SICSTP, which provides a route to backbone
thiolation and an additional strategy for the postamplification site-specific labeling of DNA. The
deoxynucleotides were characterized via steady-state kinetics and PCR, while the ribonucleosides
were characterized by the transcription of both a short, model RNA as well as full length tRNA.
The data reveal that while there are interesting nucleotide and polymerase-specific sensitivities to linker attachment, both
(d)MMO2 and (d)5SICS may be used to produce DNA or RNA site-specifically modified with multiple, different functional groups
with sufficient efficiency and fidelity for practical applications.

1. INTRODUCTION DNA, the efficiency of modified triphosphate incorporation is

The sequence-specific amplification of DNA and RNA has generally reduced compared to their natural counterparts, result-
revolutionized biotechnological and biomedical research, making ing in lower yields of amplified product as well as strong sequence
techniques such as cloning and sequencing routine and also en- dependences.14,25 For oligonucleotide evolution experiments, this
abling a variety of emerging techniques with important applica- sequence-dependent efficiency is especially problematic because it
tions in diverse fields ranging from synthetic biology1 to nano- decouples amplification level from copy number, and thus from
materials2,3 and medical diagnostics.4,5 In addition, the use of fitness, during the amplification step required after or during
polymerases to amplify DNA molecules has made it possible to selection. Moreover, high functional group density is unavoidable
evolve functional DNAs or RNAs with desired ligand recognition or in any nucleotide-specific labeling strategy (i.e., all or none of a given
catalytic properties.6,7 However, the potential physical and functional nucleotide must be modified), but the majority of functional groups
properties of nucleic acids are restricted by the limited diversity are unlikely to contribute to any desired property while still
of their constituent nucleotides. While the potential diversity contributing to biases in replication. Finally, it is note-
of DNA or RNA may be expanded via chemically synthesizing the worthy that proteins rarely (if ever) employ such a high density
oligonuclotides,8
10 this approach is incompatible with enzymatic of functional groups but instead typically have only one or a few that
amplification. Thus, efforts have been directed toward the modifica- are embedded in a controlled environment where their activity (i.e.,
tion of one or more of the natural triphosphates with linkers that pKa, nucleophilicity, redox potential, etc.) can be manipulated. Thus,
enable the attachment of different functional groups without ablating methods to site-specifically label nucleic acids with one or a few
polymerase recognition.11
21 The best sites of linker attachment functional groups attached to the fifth and sixth nucleotides of an
have proven to be the nucleobases: specifically, the C5 position expanded genetic alphabet would enable less biased selections and
of the pyrimidines and the C7 position of the 7-deaza purine potentially the construction of more protein-like environments.
scaffold. With the pyrimidine scaffold, the detailed structure of The development of an efficiently replicated and transcribed
the linker is critical,13,15 with rigid alkynes or trans-alkenes being unnatural base pair would make possible the site-specific mod-
optimal.13,19,22,23 At least with the propargylamide-like linkers and ification of DNA and RNA. While the four-letter genetic alphabet
A-family polymerases (such as Taq), this appears to result at least in based on complementary hydrogen-bonding (H-bonding)
part from favorable hydrogen-bonding interactions between the is conserved throughout nature, and orthogonal H-bonding
polymerase and the amide carbonyl group of the linker.24
While the linker modification of one or more natural dNTPs Received: August 21, 2011
allows for the polymerase-mediated synthesis of highly functionalized Published: October 08, 2011

r 2011 American Chemical Society 19878 dx.doi.org/10.1021/ja207907d | J. Am. Chem. Soc. 2011, 133, 19878–19888
Journal of the American Chemical Society ARTICLE

Figure 1. (A) Parental unnatural base pairs, (B) linker-modified analogues, and (C) α-phosphorothioate variant of d5SICSTP. Sugar and phosphate
backbone are omitted for clarity in A and B.

patterns have been used to design unnatural base pairs,26
29 to site-specifically introduce a thiolate for functional group
we30
41 and others43
47 have demonstrated the potential of attachment. Overall, we demonstrate that several of the modified
hydrophobic and packing forces to control the efficient and nucleotides are sufficiently well recognized by polymerases to
selective replication of unnatural base pairs. However, as with the enable practical applications based on the site-specific labeling of
natural nucleotides, the general use of an unnatural base pair for nucleic acids with multiple different functionalities.
the site-specific labeling of DNA or RNA requires that the
unnatural nucleotides bear linkers or other functionalities that 2. RESULTS
allow different groups to be attached without ablating polymerase
recognition. 2.1. Synthesis of Modified Unnatural Nucleotides. With
Two of the most promising unnatural base pairs that we have natural triphosphates, propargylamide linkers are relatively well
developed are those formed between d5SICS and dMMO2 tolerated by different polymerases.13,23 To explore the use of
(d5SICS-dMMO2) or dNaM (d5SICS-dNaM) (Figure 1A). similar linkers with d5SICS-dNaM and d5SICS-dMMO2, we
Both unnatural base pairs can be amplified by PCR with good synthesized (d)5SICSPATP, (d)5SICSATP, d5SICSBIOTP,
to excellent efficiency and fidelity using a variety of DNA poly- d5SICSSSBIOTP, (d)MMO2PATP, (d)MMO2ATP, and (d)-
merases, even when embedded within difficult to replicate MMO2BIOTP (Figure 1B), as described in detail in the Support-
sequences.30,34,38,42 While d5SICS-dNaM is replicated and tran- ing Information. Briefly, d5SICSPA was generated from the
scribed with greater efficiency, our efforts to develop an un- isosteryl compound, which was iodinated and then sulfonylated.
natural base pair for in vitro applications include both d5SICS- The modified base was coupled to (2R,5R)-5-chloro-2-(((4-
dNaM and d5SICS-dMMO2, because unlike the annular ring methylbenzoyl)oxy)methyl)tetrahydrofuran-3-yl 4-methylbenzoate,
scaffold of dNaM, the dMMO2 scaffold may be modified with resulting in anomeric mixtures of nucleosides, with the pure
linkers at a position that is analogous to the C5 position of the β-anomer obtained by column chromatography. After removal of
natural pyrimidines. the toluoyl group, the iodo functionality was used to attach the
Here, we report the synthesis and evaluation of protected and dichloro acetyl protected propargylamine via Sonogashira cou-
free propargylamine linker-derivatized variants of both the deoxy- pling. Phosphorylation under Ludwig conditions49 provided
and ribonucleosides of MMO2 and 5SICS ((d)MMO2PA, (d)- d5SICSPATP, which was purified by anion exchange chroma-
MMO2A, (d)5SICSPA, and (d)5SICSA), as well as the biotiny- tography followed by HPLC, and then deprotected to provide
lated deoxynucleotides dMMO2SSBIO, d5SICSBIO, and d5SICSSSBIO d5SICSATP. The biotinylated analogues, d5SICSBIOTP and
(Figure 1B). The deoxynucleotides were characterized via both d5SICSSSBIOTP, were synthesized by coupling d5SICSATP to
steady-state kinetics and PCR, and the ribonucleosides were NHS-PEG4-biotin or NHS-SS-PEG4-biotin, respectively. To
characterized by the transcription of short model RNAs as well as explore the use of a site-specifically incorporated backbone thiolate,
a full length amber suppressor tyrosyl tRNA (tRNATyr CUA) from d5SICSαSTP (Figure 1C) was synthesized via the phosphoryla-
Methanocaldococcus jannaschii.48 Both the protected and free tion of the corresponding nucleoside in the presence of thiopho-
amino variants were evaluated to fully explore double labeling sphoryl chloride.50 Note that this usually results in a mixture of
strategies, including those involving postsynthetic modification. Sp and Rp stereoisomers and that only the Sp is recognized by
The data reveals that the modifications of the unnatural nucleo- DNA polymerases.51 For dMMO2 derivatives, we iodinated the
tides have varying effects on the different steps of replication and free nucleoside, which was synthesized as described previously,40
transcription and that the linkers are generally less perturbative and then attached the dichloro acetyl protected propargylamine
within the (d)MMO2 scaffold. We also report the synthesis and to provide the desired protected nucleoside.52 The nucleo-
evaluation of the α-phosphorothioate variant of d5SICSTP side was then phosphorylated to provide dMMO2PATP, which
(d5SICSαSTP, Figure 1C) and show that it is an efficient route was subsequently deprotected to provide dMMO2ATP. The
19879 dx.doi.org/10.1021/ja207907d |J. Am. Chem. Soc. 2011, 133, 19878–19888
Journal of the American Chemical Society ARTICLE

Table 1. Steady-State Kinetic Data for Kf-Mediated Insertion of Modified Triphosphates (dYTP) Opposite Their Cognate
Nucleotide in the Template (X)

50 -d(TAATACGACTCACTATAGGGAGA)
30 -d(ATTATGCTGAGTGATATCCCTCTXGCTAGGTTACGGCAGGATCGC)

X Y kcat (min
1) KM (μM) kcat/KM  105 (M
1 min
1)

T Aa 4.1 ( 0.3 0.0053 ( 0.0004 7700

5SICS NaMa 14.6 ( 0.8 0.25 ( 0.04 580
MMO2a 14 ( 2 35.8 ( 0.6 4.0
MMO2PA 11 ( 2 15 ( 2 7.2
MMO2A 6.7 ( 0.3 69 ( 8 0.97
MMO2SSBIO 1.5 ( 0.3 45 ( 10 0.34
NaM 5SICSa 8.3 ( 1.1 0.039 ( 0.004 2100
5SICSPA 8.1 ( 0.9 1.0 ( 0.1 83
5SICSA 0.085 ( 0.05 19 ( 4 0.045
5SICSαSb 6.5 ( 1.5 0.42 ( 0.16 160
5SICSBIO 0.55 ( 0.13 31 ( 12 0.18
5SICSSSBIO 1.3 ( 0.3 29 ( 9 0.45
a
Ref 42. b Mixture of Sp and Rp diastereomers.

cleavable biotinylated analogue, dMMO2SSBIOTP, was synthe- d5SICS with an efficiency of 4  105 M
1 min
1.31 Interestingly,
sized via coupling of dMMO2ATP with NHS-SS-PEG4-biotin. we found that dMMO2PATP is inserted more efficiently (kcat/
For the 5SICS ribonucleoside derivatives, 5-methyl isocarbos- KM = 7.2  105 M
1 min
1) than dMMO2TP, because of a
tyril was first coupled with (2R)-2-((benzoyloxy)methyl)-5- 2-fold decrease in the apparent KM, while dMMO2ATP is
oxotetrahydrofuran-3,4-diyl dibenzoate. The pure β anomer was inserted only slightly less efficiently (kcat/KM = 9.7  104 M
1
purified from an anomeric mixture by column chromatography min
1), because of small changes in both the apparent kcat and
to provide the desired benzoyl protected nucleoside. Iodination, KM. Because d5SICSSSBIOTP was more efficiently recognized
sulfonylation, and benzoyl deprotection, followed by coupling than d5SICSBIOTP, we also characterized dMMO2SSBIOTP and
with the dichloro acetyl propargylamine, then provided found that it is inserted by Kf opposite d5SICS with an efficiency
5SICSPA; phosphorylation provided 5SICSPATP, and deprotec- of 3.4  104 M
1 min
1, because of a 9-fold decrease in the
tion provided 5SICSATP. For the MMO2 derivatives, the free apparent kcat.
nucleoside was synthesized as reported previously,39 iodinated, 2.3. PCR Amplification of Modified DNA. To characterize
and then finally coupled to the dichloro acetyl protected pro- the effect of the linkers on the PCR amplification of DNA
pargylamine to produce MMO2PA. Phosphorylation and depro- containing the unnatural base pair, we incorporated dMMO2-
tection proceeded as with d5SICSA to provide MMO2PATP and d5SICS into the middle of a 149-mer DNA duplex. The duplex
MMO2ATP. DNA was then PCR amplified using DeepVent (exo+) DNA
2.2. Steady-State Kinetic Analysis of Linker-Modified polymerase and a wide variety of different combinations of the
Unnatural Base Pair Synthesis. To characterize polymerase modified triphosphates. The amplification level was determined
recognition of the modified unnatural base pairs, we first explored for each combination of triphosphates, and then the amplicons
the efficiency with which the exonuclease deficient Klenow were sequenced to determine replication fidelity (Table 2, and
fragment of E. coli DNA polymerase I (Kf) inserts the linker- Figure S1, Supporting Information). In most cases, the amplifica-
modified derivatives of d5SICSTP opposite dNaM (Table 1). tion efficiency approaches that of the fully natural control (996-
For comparison, Kf inserts dATP opposite dT and d5SICSTP fold amplification), and the fidelity as measured by sequencing
opposite dNaM with an efficiency of 7.7  108 M
1 min
1 and is in excess of 99% per doubling. The single exceptions are the
2.1  108 M
1 min
1, respectively.42 We found that Kf inserts amplifications with d5SICSATP, where the amplification level
d5SICSPATP with an efficiency of 8.3  106 M
1 min
1. The was only ∼200-fold and the fidelity only ∼90% per round. This
25-fold decreased insertion efficiency relative to d5SICSTP is agrees well with the steady-state kinetic data, which demon-
due entirely to an elevated apparent KM. d5SICSBIOTP and strated that d5SICSATP insertion is inefficient. However,
d5SICSSSBIOTP were inserted less efficiently, with second- despite the slight reduction in steady-state insertion efficiency
order rate constants of 1.8  104 M
1 min
1 and 4.5  104 of d5SICSPATP and d5SICSαSTP, relative to d5SICSTP, no
M
1 min
1, respectively, again, largely because of elevated significant or systematic differences were apparent in amplifica-
apparent KM values. The insertion of d5SICSATP opposite tion efficiency or fidelity with these three triphosphates. Fidelities
dNaM by Kf is even less efficient, proceeding with a second- of PCR amplifications involving biotin-modified triphosphates
order rate constant of only 4.5  103 M
1 min
1. In this case, the were also determined by streptavidin gel shift (Figure 2). These
reduced insertion efficiency relative to d5SICSTP is due to both fidelities paralleled those determined by sequencing but were gene-
a decreased apparent kcat and an increased apparent KM. rally somewhat reduced. We attribute the differences to incomplete
We then characterized the efficiency with which Kf inserts binding of streptavidin to the biotin tag due to its location in the
the linker-modified derivatives of dMMO2TP opposite d5SICS middle of the large duplex where it is more obscured than when
(Table 1). For comparison, Kf inserts dMMO2TP opposite present at the terminus, as has been more commonly examined.
19880 dx.doi.org/10.1021/ja207907d |J. Am. Chem. Soc. 2011, 133, 19878–19888
Journal of the American Chemical Society ARTICLE

Table 2. PCR Fidelities and Amplification Efficienciesa duplexes modified. We next attempted to immobilize the biotin-
labeled DNA to streptavidin solid support; however, unlike con-
fidelity fidelity
ventional end-labeling via biotinylated primers,53 we found that
dXTPs incorporated amplification (sequencing)b (gel shift)c the nature and length of the spacer arm used to attach the
dNaM and d5SICS 735 >99.7
biotin is critical. Virtually all of the biotinylated DNA was bound
dMMO2 and d5SICS 609 99.6
to the solid support when the linker was conjugated to biotin
dNaM and d5SICSαSd 662 99.6

via a hydrophilic PEG4 spacer (29 Å spacer arm) or an SS-PEG4
spacer (38 Å spacer arm including a cleavable disulfide bridge,
dMMO2PA and d5SICS 489 >99.7

Figure 4A, B) coupled to dMMO2A, but only small amounts of
dMMO2A, d5SICS 528 99.5

the DNA were bound when shorter and more hydrophobic
dNaM and d5SICSPA 888 >99.7
spacers were used (for example, after conjugation to EZ-Link
dNaM and d5SICSA 160 91.1
sulfo-NHS-SS-biotin which has a 24 Å spacer arm, data not
dMMO2PA and d5SICSPA 960 >99.7
shown). In the case of SS-PEG4-immobilized DNA, after washing
dMMO2A and d5SICSA 279 90.9
to remove any contaminating natural DNA and cleaving the
dMMO2A and d5SICSPA 624 98.7
disulfide with DTT, the double-stranded DNA was efficiently
dMMO2PA and d5SICSA 167 91.4
released and then reconjugated to iodoacetyl-PEG2-biotin. Gel-
dMMO2A and d5SICSαSd 378 99.4
shift assays before and after the final conjugation revealed that
dMMO2SSBIO and d5SICS 351 99.2 95.0 greater than 50% of the duplexes were labeled (Figure 4C).
dNaM and d5SICSSSBIO 690 >99.7 95.4
To explore the postamplification labeling of DNA with two
different groups, we pursued two strategies. First, we examined
dNaM and d5SICSBIO 624 >99.7 96.5
the amplification of DNA containing either d5SICSPA-dMMO2A
dNaM only 164e
e

or d5SICSA-dMMO2PA (Figure 5A,B). After amplification, the
d5SICS only 217e
e
free amino groups were labeled with NHS-SS-PEG4-biotin and
a
See Materials and Methods for experimental details. b Calculated as characterized by gel mobility. After propargylamine deprotec-
average fidelities in both directions per doubling (see Materials and tion, the newly liberated amine was labeled with sulfo-NHS-biotin,
Methods for details). c Calculated from gel mobility assay (see text).
d with the labeling efficiency again characterized via gel mobility.
d5SICSαS was used as a mixture of Sp and Rp diastereomers.
e
Unnatural base pair lost during amplification. Labeling efficiencies were 60
85% for each step of labeling via
d5SICSPA-dMMO2A and d5SICSA-dMMO2PA (Figure 5D). A
second strategy for double labeling was based on the amplifica-
tion of DNA using d5SICSATP and dMMO2SSBIOTP (Figure 5C).
The level of biotinylation via direct dMMO2SSBIO incorporation
was characterized via streptavidin gel shift, and a second biotin
was then attached via coupling (DTT resistant) NHS-PEG4-
biotin to d5SICSA. After treatment with DTT to selectively
remove the biotin from dMMO2 (quantitative removal based on
control reactions, Figure 5E), the level of biotinylation at d5SICS
was characterized. Labeling efficiencies were 85% and 68%, respec-
tively, for the first and second steps via d5SICSA-dMMO2SSBIO
(Figure 5E).
2.5. Thiolation of DNA as a Route to Site-Specific Labeling.
Figure 2. PCR fidelity determination via gel mobility. Based on We also explored the use of d5SICSαSTP to site-specifically in-
the intensity of the DNA band that shifts in the presence of corporate a reactive center into the backbone of DNA (Figure 3C).
added streptavidin (SA), the biotin incorporation level is 65% for As expected, steady-state kinetics revealed that the α-phos-
d5SICS-dMMO2SSBIO, 64% for d5SICSSSBIO-dNaM, and 72% for phorothioate is only slightly perturbative, with Kf inserting
d5SICSBIO-dNaM. (Note that the slightly slower migrating band in lane d5SICSαSTP opposite dNaM with an efficiency of 1.6 
1 corresponds to unbiotinylated single-stranded DNA resulting from 107 M
1 min
1 (Table 1). To explore the use of labeling with
incomplete annealing after PCR.) The overall incorporation levels are d5SICSαS for postamplification modification, we amplified DNA
converted to fidelities (Table 2) by normalizing by the number of with dNaMTP and d5SICSαSTP. As expected, d5SICSαS-dNaM
doublings. A 50 bp DNA ladder is loaded in the rightmost lane.
amplified with excellent efficiency and fidelity (Table 2). To
explore postsynthetic labeling, the resulting duplex DNA was
This conclusion is consistent with the immobilization studies conjugated to EZ-Link iodoacetyl-PEG2-biotin. Gel-shift assays
described below. However, we cannot exclude the possibility that with streptavidin demonstrated that 70% of the duplexes were
some of the biotin may have been lost by disulfide cleavage or labeled (Figure 3D), in good agreement with values reported in
exchange during PCR. the literature for chemically synthesized α-phosphorothioate
2.4. Postamplification Modification of DNA. To examine DNA.54,55
the postamplification labeling of DNA with a single functional 2.6. Site-Specifically Modified RNA. To explore the site-
group, we first explored strategies based on the PCR amplifica- specific modification of RNA, we first characterized the ability of
tion of DNA with d5SICSATP and dNaMTP or d5SICSTP and the RNA polymerase from T7 bacteriophage (T7 RNAP) to
dMMO2ATP (Figure 3A,B). The resulting duplexes were bioti- incorporate the linker-modified unnatural ribonucleotide tripho-
nylated using sulfo-NHS-SS-biotin and the labeling efficiency sphates into 17 nt transcripts (Figure 6A). We first examined the
was determined by streptavidin gel shift (Figure 3D). We found transcription of a template containing d5SICS with the natural
that the reactions were complete after 1 h, with 60
70% of the ribotriphosphates and either MMO2PATP or MMO2ATP.
19881 dx.doi.org/10.1021/ja207907d |J. Am. Chem. Soc. 2011, 133, 19878–19888
Journal of the American Chemical Society ARTICLE

Figure 3. Postamplification DNA labeling with single functional groups, using (A) d5SICSA, (B) dMMO2A, and (C) d5SICSαS. (D) Determination of
labeling efficiency via streptavidin gel shift. The biotin incorporation level is 55% for d5SICS-dMMO2A, 70% for d5SICSA-dNaM, and 70% for
d5SICSαS-dNaM. A 50 bp DNA ladder is included in the rightmost lane of the gel. The faster migrating, strong band corresponds to dsDNA, while the
slower migrating band corresponds to the 1:1 complex between dsDNA and streptavidin. The faint and most slowly migrating band in lane 6
corresponds to the 2:1 complex of dsDNA and streptavidin.

Figure 4. (A) Immobilization of biotinylated dsDNA on streptavidin affinity resin. (B) Gel mobility assay of PCR amplicons labeled with NHS-SS-
PEG4-biotin (P) compared to the unbound fraction remaining in the supernatant (S) after binding to the streptavidin solid support. Biotinylation levels
are 53% for d5SICS-dMMO2A and 70% for d5SICSA-dNaM. A 100 bp DNA ladder is loaded in the leftmost lane. (C) Conjugation of dsDNA to
iodoacetyl-PEG2-biotin after release from the streptavidin affinity resin via DTT treatment. Biotin incorporation levels are 89% for d5SICS-dMMO2A
and 53% for d5SICSA-dNaM. A 50 bp DNA ladder is loaded in the leftmost lane. In B and C, the faster migrating, strong band corresponds to dsDNA,
while the slower migrating band corresponds to the 1:1 complex between dsDNA and streptavidin.

Under the conditions employed, no full length product was opposite strand context by examining the ability of dNaM to tem-
observed in the absence of an unnatural triphosphate or in the plate the transcription of RNA containing 5SICSPA or 5SICSA.
presence of only a 5SICSTP derivative, and most of the Again, in the absence of an unnatural triphosphate, virtually no
truncated product corresponded to the termination of transcrip- full-length product was observed, but addition of either cognate
tion immediately before d5SICS in the template (Figure 6B). In unnatural triphosphate, 5SICSPATP or 5SICSATP, resulted
contrast, when either MMO2PATP or MMO2ATP was present, in the efficient production of the full-length transcription
we observed efficient conversion to full-length product. We then product (Figure 6B). To characterize the fidelity of transcription,
characterized transcription of the unnatural base pair in the the experiments were again run with [α-32P]ATP and the
19882 dx.doi.org/10.1021/ja207907d |J. Am. Chem. Soc. 2011, 133, 19878–19888
Journal of the American Chemical Society ARTICLE

Table 3. Nucleotide Composition Analysis of T7 RNAP Transcription Productsa

normalized composition of nucleotides incorporated 50 to A during transcription of 17 nt RNA

template YTP Ap Gp Cp Up Yp

d5SICS dMMO2 A
1.02 ( 0.01 [1] 1.94 ( 0.03 [2] n.d. [0]b
n.d. [0] b
1.03 ( 0.02 [1]
d5SICS dMMO2PA 0.99 ( 0.03 [1] 1.99 ( 0.03 [2] n.d. [0]b n.d. [0]b 1.01 ( 0.04 [1]
dNaM d5SICSA 1.03 ( 0.02 [1] 2.00 ( 0.01 [2] n.d. [0]b n.d. [0]b 0.96 ( 0.02 [1]
dNaM d5SICSPA 1.07 ( 0.01 [1] 1.95 ( 0.02 [2] n.d. [0]b n.d. [0]b 0.95 ( 0.01 [1]

normalized composition of nucleotides incorporated 50 to A during transcription of tRNATyr

CUA

template YTP Ap Gp Cp Up Yp

d5SICS MMO2A 4.06 ( 0.13 [4] 3.03 ( 0.07 [3] 5.91 ( 0.17 [6] 0.98 ( 0.03 [1] 1.02 ( 0.05 [1]
dNaM 5SICSA 4.16 ( 0.16 [4] 3.10 ( 0.04 [3] 5.86 ( 0.06 [6] 1.01 ( 0.02 [1] 0.92 ( 0.04 [1]
a
Values were determined by dividing the radioactivity observed for a particular monophosphate by the product of the total radioactivity and the expected
number of nucleotides. Predicted values assuming 100% fidelity are shown in brackets. The error reported is the standard deviation of at least three
independent determinations. b Below detection limit.

Figure 5. Postamplification DNA labeling with two different functional groups, using (A) d5SICSPA-dMMO2A, (B) d5SICSA-dMMO2PA, and
(C) d5SICSA-dMMO2SSBIO. (D) Efficiencies of first and second labeling of DNA from containing d5SICSPA-dMMO2A and d5SICSA-dMMO2PA.
First labeling efficiencies are 61% for d5SICSPA-dMMO2A and 66% for d5SICSA-dMMO2PA, and second labeling efficiencies are 85% for d5SICSPA-
dMMO2A and 78% for d5SICSA-dMMO2PA. A 100 bp ladder is loaded in the rightmost lane of each gel. (E) First and second labeling efficiencies of
DNA containing d5SICSA-dMMO2SSBIO. The first labeling efficiency is 85% in the absence of DTT and 0% in the presence of DTT (due to linker
cleavage). The second labeling efficiency is 68%. A 50 bp DNA ladder is loaded in the rightmost lane. In D and E, the faster migrating, strong band
corresponds to dsDNA, while the slower migrating band corresponds to the 1:1 complex between dsDNA and streptavidin. The faint and more slowly
migrating bands correspond to higher order complexes of dsDNA and streptavidin.

19883 dx.doi.org/10.1021/ja207907d |J. Am. Chem. Soc. 2011, 133, 19878–19888

Journal of the American Chemical Society ARTICLE

resulting transcripts were digested to nucleoside 30 -phosphates, DNA fragment encoding the 77-nt M. jannaschii tRNATyr CUA with
which were separated by 2D-TLC (Figure S2, Supporting either dNaM or d5SICS at the third position of the anticodon
Information), and the relative amount of each was quantified (nucleotide 37). Full length product was efficiently produced in
via densitometry (Table 3). Nucleotide-composition analysis the presence of each natural triphosphate and the cognate
confirmed that both unnatural nucleotides direct the transcrip- unnatural triphosphate. However, unlike with the shorter model
tion of RNA containing a cognate unnatural nucleotide with template, we were unable to identify conditions where product
good selectivity. Interestingly, unlike with the replication of the formation depended only upon the addition of the correct un-
deoxy-variants discussed above, we observed little difference in the natural ribotriphosphate, likely due to the higher concentrations
efficiency or fidelity of 5SICSATP or 5SICSPATP incorporation. of natural NTPs required for efficient transcription of the longer
To further explore the T7 RNAP-mediated transcription of RNA. Thus, we characterized the fidelity of transcription of the
RNA for more practical applications, we synthesized a 96-nt DNA template containing dNaM with 5SICSA and of the
template containing d5SICS with MMO2A by 2D-TLC and
densitometry (Table 3, and Figure S3, Supporting Information).
The incorporation of MMO2A opposite d5SICS proceeded with
excellent fidelity, while the incorporation of 5SICSA opposite
dNaM proceeded with a more modest fidelity of 92%, suggesting
that as with the deoxy variants and DNA polymerases, the free
amine is tolerated better in the MMO2 scaffold than in the
5SICS scaffold.
Finally, we explored the post-transcription site-specific
labeling of RNA (Figure 7). Purified tRNATyr CUY product with
Y = MMO2A at the third position of the anticodon loop was first
unfolded by heating to 85 °C in the presence of 20% DMSO and
then reacted with NHS-PEG4-biotin at 37 °C for 1 h. Based on
streptavidin gel shift, the efficiency of site-specific biotin attach-
ment was greater than 75%.

3. DISCUSSION
The development of an unnatural base pair is the first step
toward creating semisynthetic organisms with increased poten-
tial for information storage and retrieval but would likely find
more immediate use in different applications based on the pro-
duction of site-specifically modified DNA or RNA. While func-
tional unnatural base pairs that make site-specific labeling pos-
Figure 6. T7 RNAP transcription of site-selectively modified RNA. (A) sible have recently been identified,29,34,39,44,46 little is known
Sequences of DNA template and transcription product. (B) Denaturing about their ability to accommodate the linkers required to attach
PAGE analysis with sequence indicated. Note that the bands for the the various functional groups of interest. Presumably, just as
linker-modified full length transcripts are shifted slightly more than the development of the unnatural base pairs required extensive
those of the unlabeled full length product. optimization, so too will development of the linkers. Previously,

Figure 7. (A) Transcription of M. jannaschii tRNATyr A Tyr

CUA site-selectively modified with MMO2 . (B) PAGE analysis of the modified tRNACUA containing
A
MMO2 before (left two lanes) and after (right two lanes) coupling to NHS-PEG4-biotin. Coupling efficiency calculated as greater than 75%. A 25 bp
DNA ladder is loaded in the rightmost lane.

19884 dx.doi.org/10.1021/ja207907d |J. Am. Chem. Soc. 2011, 133, 19878–19888

Journal of the American Chemical Society ARTICLE

the Hirao group demonstrated the use of the same propargyl- straightforward to incorporate many different functional groups
amine linker used here, along with an acetamidohexanamide into duplex DNA via amide linkage to either unnatural tripho-
spacer, to attach a single fluorophore to a promising unnatural sphate. Moreover, different combinations of unnatural tripho-
base pair within DNA, as well as to directly attach a biotin tag to a sphates bearing protected or free amines may also be incorpo-
constituent nucleotide in RNA.44,46 To further explore the rated into DNA via PCR and thereby provide a versatile route to
potential of linker-modified unnatural base pairs to site-specifi- the postsynthetic labeling of DNA with two different functional
cally label DNA or RNA with one or more different moieties, groups, although with d5SICS, the most efficient replication
either during or after enzymatic synthesis, we have explored the requires that the amine is incorporated in a protected form. Thus,
replication and transcription of d5SICS-dMMO2/dNaM with the most simple route to the labeling of DNA with two different
unnatural triphosphates bearing propargylamine-based linkers or functionalities would be either the use of triphosphates already
an α-phosphorothioate. bearing the functional groups of interest or the amplification of
The steady-state kinetics with Kf polymerase revealed that DNA containing d5SICSPA-dMMO2A, followed by modification
replication of the unnatural base pair is sensitive to the structure of dMMO2A, deprotection, and finally modification of d5SICSA.
of the linker, with the protected amino linker being the best The use of d5SICSSSBIO-dMMO2A also provides a convenient
accommodated. However, the effects of linker attachment were route to purify DNA containing the unnatural base pair, and the
not the same for both nucleotides. While modification of use of spacers that are longer and more hydrophilic to connect
dMMO2TP with the free or the dithiol-linked biotin-modified the linkers to the functional groups of interest facilitates post-
linker reduced the efficiency of insertion opposite d5SICS 4- to amplification modification.
10-fold, modification with the protected amino linker actually While the efficiency of d5SICSPA insertion is likely sufficient
increased insertion efficiency by 2-fold. In contrast, modifica- for practical labeling applications, we nonetheless demonstrated
tion of d5SICSTP with any of the linkers examined resulted that the incorporation of d5SICSαSTP opposite dNaM, which
in reduced insertion efficiency opposite dNaM. Relative to proceeds with a 2-fold greater efficiency, also provides a con-
d5SICSTP, the insertion efficiency of d5SICSBIOTP and venient route to site-specific labeling via the modification of the
d5SICSSSBIOTP is 3- to 4-orders of magnitude reduced, pre- α-phosphorothioate. While amplification with d5SICSPATP,
dominantly because of a reduction in the apparent binding of the d5SICSαSTP, or d5SICSTP all proceeded with similar efficien-
triphosphate. The decrease was even larger for d5SICSATP cies and fidelities within the sequence context examined, it is pos-
because of effects on both the apparent binding and turnover. sible that other sequences may be more sensitive to the specific
In contrast, the insertion efficiency of d5SICSPATP opposite triphosphate used. Also note that the α-phosphorothioate- and
dNaM was reduced only 25-fold (because of reduced apparent linker-based strategies are not mutually exclusive and when com-
binding). bined should allow for a given site to be simultaneously modified
Relative to the dMMO2, the greater sensitivity of d5SICSTP with up to three different functional groups, one attached to the
insertion to linker modification may result from its being more nucleobase of d5SICS, a second attached to the nucleobase of
efficiently recognized, making it more susceptible to perturba- dMMO2, and a third attached to the backbone immediately 50 to
tion. However, the increase in insertion efficiency observed with an unnatural nucleotide (Figure 8).
dMMO2PA, and the fact that d5SICSATP is inserted less As observed with the deoxy variants and Kf DNA polymerase,
efficiently opposite dNaM than dMMO2ATP is inserted oppo- the linker-modified unnatural ribotriphosphates were found to
site d5SICS, suggests that the dMMO2 scaffold is more tolerant be substrates for T7 RNAP. While we only characterized the
of the modifications examined. Perhaps, hydrophobic and pack- transcription of the protected- and free-amine modified ribotri-
ing interactions between the π-rich triple bond of the linker and phosphates, the data suggest that just as with their deoxy counter-
the flanking nucleobases within the major groove are more parts, the direct attachment of different functional groups to the
favorable when accessed from the dMMO2 scaffold than from ribotriphosphates should be possible, providing a direct route to
the d5SICS scaffold. This is consistent with the recently reported the transcription of RNA labeled with one or two functional
structure of the ternary complex of the large fragment of Taq groups. In addition, we demonstrated that the incorporation of
DNA polymerase, which is homologous to Kf, bound to C5- ribotriphosphates bearing free amine groups should provide a
propargylamide-modified dTTP, which shows that the amide general route to the post-transcription labeling of RNA with
moiety of the linker forms a stabilizing hydrogen-bonding inter- different functionalities of interest (Figure 8). In contrast to the
action with the side chain of polymerase residue R660.24 This Arg
residue is conserved in Kf, and because the ring structure of
dMMO2 is similar in size and shape to a natural pyrimidine, it
likely engages in a similar stabilizing interaction with the pro-
pargylamide linker when presented within the dMMO2 scaffold.
Perhaps the extra aromatic ring of the d5SICS scaffold disrupts
this stabilizing interaction. The same model likely accounts for
the decreased tolerance of the free amine linker, as it is expected
to be protonated and thus to introduce electrostatic repulsion
with the positively charged side chain of R660.
Regardless of the detailed rates with which the different tri-
phosphates are inserted opposite their cognate unnatural nucleo- Figure 8. General scheme for labeling DNA with three different
tide in the template, PCR experiments with DeepVent clearly functional groups and RNA with two different functional groups. R1
demonstrate that different combinations of the propargylamine- and R2 may correspond to either amide-coupled functional groups of
modified nucleotides may be efficiently and site-selectively incor- interest or a combination of protected and free amine linkers for further
porated into DNA with reasonable fidelity. Thus, it should be elaboration as described in the text.

19885 dx.doi.org/10.1021/ja207907d |J. Am. Chem. Soc. 2011, 133, 19878–19888

Journal of the American Chemical Society ARTICLE

differences in replication observed with d5SICSATP and the 4.3. Kinetic Assay. Primer oligonucleotides were 50 -radiolabeled
other d5SICSTP derivatives, the transcription of short RNAs with [γ-32P]ATP and T4 polynucleotide kinase and annealed to
with 5SICS and 5SICSA appears similar, although fidelity was template oligonucleotides by heating to 95 °C followed by slow cooling
somewhat reduced for the incorporation of 5SICSA into the to room temperature. Reactions were initiated by adding a solution
tRNA, which is longer and more challenging to transcribe. of 2 dNTP solution (5 μL) to a solution containing Kf polymerase
Because alkylated α-phosphorothioates undergo strand cleavage (0.10
1.23 nM) and primer template (40 nM) in 5 μL of Kf reaction
in RNA, this route for backbone labeling is not possible, and the buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 1 mM DTT, and
current methodology is limited to the site-specific labeling 50 μg/mL acetylated BSA). After incubation at 25 °C for 3
10 min, the
of RNA with only two different functional groups. However, reactions were quenched with 20 μL of loading dye (95% formamide,
20 mM EDTA, and sufficient amounts of bromophenol blue and xylene
the ability to induce site-specific RNA cleavage could also find
cyanol). Reaction products were resolved by 8 M urea 15% polyacry-
interesting applications.56,57
lamide gel electrophoresis, and gel band intensities corresponding to pri-
Our goal is to expand the potential physical and functional mer and extended primer were quantified by phosphorimaging (Storm
properties of DNA and RNA without losing the inherent advan- Imager, Molecular Dynamics) and Quantity One (BioRad) software.
tages possessed by these biopolymers relative to other materials. Plots of kobs versus triphosphate concentration were fit to the Michaelis

One property of DNA that has received much recent attention is Menten equation using the program Origin (Microcal Software) to
its ability to act as a scaffold for the display of different functio- determine Vmax and KM. kcat was determined from Vmax by normalizing
nalities with nanometer length-scale control for nanomaterial by the total enzyme concentration. Each reaction was run in triplicate,
development.2,3 The site-specific labeling approach described and standard deviations for both kinetic parameters were determined.
here seems well suited to contribute to these efforts, as many of 4.4. PCR Amplification. dsDNA template D1 was prepared as des-
the possible applications involve a level of distance control and cribed previously34 (see Supporting Information for details) and ampli-
functional group isolation that would be challenging or impos- fied by PCR under the following conditions: 1 ng of the template, 1
sible to obtain with the higher functionalization density inherent ThermoPol reaction buffer (New England Biolabs), MgSO4 adjusted
to nucleotide-specific labeling approaches. From the perspective to 6.0 mM, 0.6 mM of dNTP, 0.2 mM of each unnatural triphosphates,
of creating (or evolving) controlled environments for molecular 1 μM of each primers, and 0.03 U/μL of DeepVent (exo+, New England
recognition or catalysis,6,7 relative to the nucleotide-specific label- Biolabs) in an iCycler Thermal Cycler (Bio-Rad) with a total volume
ing approach, the site-specific approach is more analogous to that of 25 μL under the following thermal cycling conditions: 94 °C, 30 s;
employed by proteins, where the position of one or only a few 48 °C, 30 s; 65 °C, 8 min, 14 cycles. Sybr Green I (Invitrogen) was added
reactive centers are controlled within an environment provided to the final concentration of 0.5 to monitor amplification by qPCR.
by the remainder of the oligonucleotide. Moreover, including Upon completion, a 5 μL aliquot was analyzed by 2% agarose gel, and the
only one or a few modified nucleotides in different members remaining material was purified utilizing the PureLink PCR Purification
of an oligonucleotide library is less likely to incur unnecessary Kit (Invitrogen). Amplification efficiency was quantified by fluorescent
replication biases than more heavily or fully functionalized DNA. dye binding (Quant-iT dsDNA HS Assay kit, Invitrogen), and fidelity
Efforts to deploy the linker-modified unnatural base pairs in was quantified by either sequencing (3730 DNA Analyzer, Applied
materials applications and for the selection of DNAs or RNAs Biosystems) (see Supporting Information and Malyshev et al.34) or gel
with expanded functional potential are currently underway. mobility (see below).
4.5. Gel Mobility Assays. DNA samples (10
50 ng) were mixed
with 1 μg of streptavidin (Promega) in phosphate labeling buffer
4. MATERIALS AND METHODS (50 mM sodium phosphate, pH 7.5, 150 mM NaCl, 1 mM EDTA),
4.1. General. All reactions were carried out in oven-dried glassware incubated for 30 min at 37 °C, mixed with 5 nondenaturing loading
under inert atmosphere, and all solvents were dried over 4 Å molecular buffer (Qiagen), and loaded on 10% nondenaturing PAGE. The gel
sieves with the exceptions of dichloromethane, which was distilled from was run at 180 V for 25
40 min, then soaked in 1 Sybr Gold Nucleic
CaH2, and tetrahydrofuran, which was distilled from sodium metal. All Acid Stain (Invitrogen) for 30 min and visualized using a Molecular
other reagents were purchased from Aldrich and Acros. 1H, 13C, and 31P Imager Gel Doc XR+ equipped with 520DF30 filter (Bio-Rad). Strong
NMR spectra were recorded on Varian Mercury 300, Varian Inova-400, bands corresponding to dsDNA (at ∼150 bp) and the 1:1 complex
or Bruker AMX-400 spectrometers. High-resolution mass spectroscopic between dsDNA and streptavidin (at ∼400 bp) were apparent. Faint
data were obtained on an ESI-TOF mass spectrometer (Agilent 6200 bands corresponding to higher order (slower migrating) complexes of
Series) at the TSRI Open Access Mass Spectrometry Lab; MALDI-TOF DNA and streptavidin or from unbiotinylated, single-stranded DNA
mass spectrometry (Applied Biosystems Voyager DE-PRO System resulting from incomplete annealing after PCR in some cases were also
6008) was performed at the TSRI Center for Protein and Nucleic Acid apparent.
Research. Polynucleotide kinase and Kf were purchased from New 4.6. General Procedures for Postamplification DNA Labeling.
England Biolabs, T7 RNAP from Takara USA, and [α-32P]ATP and For postenzymatic synthesis labeling, dsDNA with a free amino group
[γ-32P]ATP from MP Biomedicals. DNA ladders were obtained from was incubated with 10 mM EZ-Link sulfo-NHS-SS-biotin or EZ-Link
Invitrogen. NHS-PEG4-biotin (Thermo Scientific) for 1 h at rt in phosphate labeling
4.2. Oligonucleotide Synthesis. Fully natural oligonucleotides buffer and then purified using the Qiagen PCR purification kit. With
were purchased from Integrated DNA Technologies. Oligonucleotides either dMMO2PA or d5SICSPA, the amine first required deprotection,
containing an unnatural nucleotide were prepared by the β-cyanoethyl which was accomplished by overnight incubation in a concentrated
phosphoramidite method on controlled pore glass supports (1 μmol) aqueous ammonia solution at rt. Ammonia was removed via a SpeedVac
using an Applied Biosystems Inc. 392 DNA/RNA synthesizer. After concentrator (water aspirator followed by oil vacuum pump). To cleave
automated synthesis, the oligonucleotides were cleaved from the sup- the disulfide-containing linkers (i.e., SS-biotin or SS-PEG4-biotin), dsDNA
port and deprotected by heating in aqueous ammonia at 55 °C for 12 h. was treated with DTT (final concentration of 30 mM) for 1 h at 37 °C.
After purification via 8 M urea 15% polyacrylamide gel electrophoresis For backbone labeling, dsDNA with a backbone phosphorothioate was
(PAGE), the oligonucleotides were electroeluted and ethanol precipi- incubated with 25 mM EZ-Link iodoacetyl-PEG2-biotin (Thermo
tated. Oligonucleotide concentration was determined by UV absorption. Scientific) in phosphate labeling buffer overnight at 50 °C, and products

19886 dx.doi.org/10.1021/ja207907d |J. Am. Chem. Soc. 2011, 133, 19878–19888

Journal of the American Chemical Society ARTICLE

were purified with Qiagen PCR Purification Kit. All reactions manip- dryness with a SpeedVac concentrator. The transcripts were digested
ulating attached biotin moieties were quantified by streptavidin gel-shift with RNaseI (10 U, 1 μL, Epicenter, WI) in 2 μL of 10 RNaseI dilution
assays. buffer in a final volume of 20 μL at 37 °C for 120 min. The digestion
4.7. DNA Immobilization on Streptavidin Solid Support. products were analyzed by 2D TLC using high performance thin layer
Streptavidin Sepharose High Performance affinity resin (GE Healthcare) chromatography (HPTLC) plates (100  100 mm) (Merck, Darmstadt,
was washed twice with phosphate labeling buffer to remove ethanol. Germany) with the following developing solvents: isobutyric acid

Site-specifically biotinylated dsDNA was added to the prewashed resin ammonia
water (66:1:33 v/v/v) for the first dimension, and sodium phos-
and incubated with occasional gentle mixing. After 1 h, the supernatant phate (0.1 M, pH 6.8), ammonium sulfate, n-propanol (100:60:2 v/w/v)
was removed (and analyzed by gel shift mobility to confirm the absence for the second dimension. The products on the gels and the TLC plates
of biotinylated DNA), and the resin was washed three times with were analyzed by phosphorimaging using ImageQuant (Quantity One).
phosphate labeling buffer to remove any unbound DNA. dsDNA was For post-transcriptional labeling of tRNATyr CUA, the purified full length
recovered via DTT treatment (final concentration of 30 mM) for 1 h at RNA containing MMO2A (60 μL, 2.2 ng/μL) was mixed with 15 μL of
37 °C, followed by filtration and purification with the Qiagen PCR DMSO, heated at 85 °C for 5 min, and cooled immediately on ice. The
Purification Kit. resulting solution was incubated with EZ-Link NHS-PEG4-biotin
4.8. Transcription Experiments. For the transcription of short, (Thermo Scientific) (1.5 mg) in 30 μL of 4 phosphate labeling buffer
17 nt RNAs, the 35 nt DNA template 50 -CACTXCTCGGGATTCCC- for 1 h at 37 °C. After ethanol precipitation, 10% of the resulting material
TATAGTGAGTCGTATTAT (X = d5SICS or dNaM) and 21 nt DNA (3 μL) was mixed with 3 μL of 5 denaturing loading buffer, heated to
primer 50 -ATAATACGACTCACTATAGGG were annealed in a 1:1 85 °C, cooled on ice, mixed with 3 μL of streptavidin (1 mg/mL), and
ratio in 10 mM Tris-HCl buffer (pH 7.6) containing 10 mM NaCl, by incubated for 30 min at 37 °C. The efficiency of labeling was determined
heating at 95 °C for 3 min and slow cooling to 4 °C. Transcription was by streptavidin gel shift on a 7 M urea 15% polyacrylamide gel using 1
carried out at 37 °C in 10 μL reactions containing 100 nM DNA primer- TBE buffer (180 V for 25
40 min).
template, 20 μM NTP, 0.25 mCi [α-32P]ATP, 50 U T7 RNAP (Takara),
and 10 μM MMO2PATP, MMO2ATP, 5SICSPATP, or 5SICSATP ’ ASSOCIATED CONTENT
in 1 Takara buffer (40 mM Tris-HCl, pH 8.0, 8 mM MgCl2, 2 mM
spermidine). All solutions were prepared with DEPC-treated and nuclease- bS Supporting Information. Nucleoside synthesis and char-
free sterilized water (Fisher Bioreagents). After incubation for 2 h at acterization as well as details of kinetic experiments, sequencing,
37 °C, the reactions were quenched by addition of gel loading dye solu- and transcription analysis.This material is available free of charge
tion (10 μL of 10 M urea, 0.05% bromophenol blue). This mixture was via the Internet at http://pubs.acs.org.
heated at 75 °C for 3 min and then separated on a 7 M urea 20%
polyacrylamide gel using 1 TBE buffer. The gel was removed from the
apparatus, and radioactivity was quantified by phosphorimaging (overnight ’ AUTHOR INFORMATION
exposure) using ImageQuant (Quantity One).
0 Corresponding Author
For transcription of M. jannaschii tRNATyr CUY, the template strand 5 -
fl[email protected]
TGG TCC GGC GGG CCG GAT TTG AAC CAG CGC CAT GCG
GAT TXA GAG TCC GCC GTT CTG CCC TGC TGA ACT ACC Author Contributions
GCC GGT ATA GTG AGT CGT ATT ATC (X = d5SICS or dNaM) †
These authors contributed equally.
and the nontemplate strand 50 - GAT AAT ACG ACT CAC TAT ACC
GGC GGT AGT TCA GCA GGG CAG AAC GGC GGA CTC TAA
ATC CGC ATG GCG CTG GTT CAA ATC CGG CCC GCC GGA ’ ACKNOWLEDGMENT
CCA were annealed in Tris-HCl buffer (pH 7.6) containing 10 mM
Funding for this work was provided by the National Institute
NaCl, by heating at 95 °C for 3 min and cooling to 4 °C. Transcription
for Health (GM060005).
was carried out at 37 °C in 20 μL reactions containing 2 μM DNA
primer-template, 1 mM NTP, 0.25 mCi [α-32P]ATP (MP Biomedicals,
LLC, Solon, OH), 50 U T7 RNAP (Takara Bio Inc.), and 1 mM ’ REFERENCES
MMO2ATP or 5SICSATP in 1 Takara buffer (40 mM Tris-HCl, pH (1) Benner, S. A.; Sismour, A. M. Nat. Rev. Genet. 2005, 6, 533–543.
8.0, 8 mM MgCl2, 2 mM spermidine). All solutions were prepared with (2) Wang, H.; Yang, R.; Yang, L.; Tan, W. ACS Nano 2009, 3,
DEPC treated and nuclease-free sterilized water (Fisher Bioreagents). 2451–2460.
After incubation for 3 h at 37 °C, the reaction was quenched by the (3) Chen, T.; Shukoor, M. I.; Chen, Y.; Yuan, Q.; Zhu, Z.; Zhao, Z.;
addition of gel loading dye solution (20 μL of 10 M urea, 0.05% bromo- Gulbakan, B.; Tan, W. Nanoscale 2011, 3, 546–556.
phenol blue). This mixture was heated at 75 °C for 3 min and then (4) Ruigrok, V. J.; Levisson, M.; Eppink, M. H.; Smidt, H.; van der
separated on a 7 M urea 12% polyacrylamide gel using 1 TBE buffer. Oost, J. Biochem. J. 2011, 436, 1–13.
The gel was removed from the apparatus, and radioactivity was quan- (5) Heyduk, T. Biophys. Chem. 2010, 151, 91–95.
tified by phosphorimaging (overnight exposure) using ImageQuant (6) Syed, M. A.; Pervaiz, S. Oligonucleotides 2010, 20, 215–224.
(Molecular Dynamics). (7) Mayer, G. Angew. Chem., Int. Ed. 2009, 48, 2672–2689.
(8) Lonnberg, H. Bioconjugate Chem. 2009, 20, 1065–1094.
Transcription fidelity was characterized by 2D TLC analysis. Briefly,
(9) Paredes, E.; Evans, M.; Das, S. R. Methods 2011, 54, 251–259.
gels containing transcription products were imaged (overnight exposure
(10) Lavergne, T.; Bertrand, J. R.; Vasseur, J. J.; Debart, F. Chem.—
with Kodak X-OmatAR5 film), and the image was used to identify the Eur. J. 2008, 14, 9135–9138.
radioactive spots corresponding to the full-length [32P]-RNA tran- (11) Battersby, T. R.; Ang, D. N.; Burgstaller, P.; Jurczyk, S. C.;
scripts. These portions of the gel were then excised and transferred to Bowser, M. T.; Buchanan, D. D.; Kennedy, R. T.; Benner, S. A. J. Am.
2 mL microcentrifuge tubes for passive elution (6
12 h) at room tem- Chem. Soc. 1999, 121, 9781–9789.
perature with 400 μL of sterilized water. Eluted full-length products were (12) Brakmann, S.; Lobermann, S. Angew. Chem., Int. Ed. 2001, 40,
precipitated with cold ethanol (1.2 mL), CH3COONa (0.3 M, 20 μL), 1427–1429.
and E. coli tRNA (1 mM, 1 μL, Sigma Aldrich) for 2 h. After centri- (13) Gourlain, T.; Sidorov, A.; Mignet, N.; Thorpe, S. J.; Lee, S. E.;
fugation, the ethanol was removed and the product was evaporated to Grasby, J. A.; Williams, D. M. Nucleic Acids Res. 2001, 29, 1898–1905.

19887 dx.doi.org/10.1021/ja207907d |J. Am. Chem. Soc. 2011, 133, 19878–19888

Journal of the American Chemical Society ARTICLE

(14) Jager, S.; Rasched, G.; Kornreich-Leshem, H.; Engeser, M.; (47) Mitsui, T.; Kitamura, A.; Kimoto, M.; To, T.; Sato, A.; Hirao, I.;
Thum, O.; Famulok, M. J. Am. Chem. Soc. 2005, 127, 15071–15082. Yokoyama, S. J. Am. Chem. Soc. 2003, 125, 5298–5307.
(15) Kuwahara, M.; Nagashima, J.; Hasegawa, M.; Tamura, T.; (48) Liu, C. C.; Schultz, P. G. Annu. Rev. Biochem. 2010, 79,
Kitagata, R.; Hanawa, K.; Hososhima, S.; Kasamatsu, T.; Ozaki, H.; 413–444.
Sawai, H. Nucleic Acids Res. 2006, 34, 5383–5394. (49) Ludwig, J.; Eckstein, F. J. Org. Chem. 1989, 54, 631–635.
(16) Mehedi Masud, M.; Ozaki-Nakamura, A.; Kuwahara, M.; Ozaki, (50) Burgess, K.; Cook, D. Chem. Rev. 2000, 100, 2047–2060.
H.; Sawai, H. ChemBioChem 2003, 4, 584–588. (51) Eckstein, F. Annu. Rev. Biochem. 1985, 54, 367–402.
(17) Perrin, D. M.; Garestier, T.; Helene, C. Nucleosides Nucleotides (52) Kawai, R.; Kimoto, M.; Ikeda, S.; Mitsui, T.; Endo, M.;
1999, 18, 377–391. Yokoyama, S.; Hirao, I. J. Am. Chem. Soc. 2005, 127, 17286–17295.
(18) Roychowdhury, A.; Illangkoon, H.; Hendrickson, C. L.; Benner, (53) Rapley, R. The Nucleic Acid Protocols Handbook; Humana Press:
S. A. Org. Lett. 2004, 6, 489–492. New York, NY, 2000.
(19) Sakthivel, K.; Barbas, C. F., III. Angew. Chem., Int. Ed. 1998, (54) Fidanza, J. A.; Ozaki, H.; McLaughlin, L. W. Methods Mol. Biol.
37, 2872–2875. 1994, 26, 121–143.
(20) Tasara, T.; Angerer, B.; Damond, M.; Winter, H.; Dorhofer, S.; (55) Padmanabhan, S.; Coughlin, J. E.; Zhang, G.; Kirk, C. J.; Iyer,
Hubscher, U.; Amacker, M. Nucleic Acids Res. 2003, 31, 2636–2646. R. P. Bioorg. Med. Chem. Lett. 2006, 16, 1491–1494.
(21) Hollenstein, M.; Hipolito, C. J.; Lam, C. H.; Perrin, D. M. (56) Gish, G.; Eckstein, F. Science 1988, 240, 1520–1522.
Nucleic Acids Res. 2009, 37, 1638–1649. (57) Strobel, S. A.; Shetty, K. Proc. Natl. Acad. Sci. U.S.A. 1997, 94,
(22) Held, H. A.; Benner, S. A. Nucleic Acids Res. 2002, 30, 3857– 2903–2908.
3869.
(23) Lee, S. E.; Sidorov, A.; Gourlain, T.; Mignet, N.; Thorpe, S. J.;
Brazier, J. A.; Dickman, M. J.; Hornby, D. P.; Grasby, J. A.; Williams,
D. M. Nucleic Acids Res. 2001, 29, 1565–1573.
(24) Obeid, S.; Baccaro, A.; Welte, W.; Diederichs, K.; Marx, A. Proc.
Natl. Acad. Sci. U.S.A. 2010, 107, 21327–21331.
(25) Zhu, Z.; Waggoner, A. S. Cytometry 1997, 28, 206–211.
(26) Horlacher, J.; Hottiger, M.; Podust, V. N.; H€ubscher, U.;
Benner, S. A. Proc. Natl. Acad. Sci. U.S.A. 1995, 92, 6329–6333.
(27) Lutz, M. J.; Held, H. A.; Hottiger, M.; H€ubscher, U.; Benner,
S. A. Nucleic Acids Res. 1996, 24, 1308–1313.
(28) Piccirilli, J. A.; Krauch, T.; Moroney, S. E.; Benner, S. A. Nature
1990, 343, 33–37.
(29) Yang, Z.; Chen, F.; Chamberlin, S. G.; Benner, S. A. Angew.
Chem., Int. Ed. 2010, 49, 177–180.
(30) Hwang, G. T.; Romesberg, F. E. J. Am. Chem. Soc. 2008, 130,
14872–14882.
(31) Leconte, A. M.; Hwang, G. T.; Matsuda, S.; Capek, P.; Hari, Y.;
Romesberg, F. E. J. Am. Chem. Soc. 2008, 130, 2336–2343.
(32) Leconte, A. M.; Romesberg, F. E. In Protein Engineering;
RajBhandary, C. K. a. U. L., Ed.; Springer-Verlag: Berlin, 2009; pp
291
314.
(33) Malyshev, D. A.; Pfaff, D. A.; Ippoliti, S. I.; Hwang, G. T.;
Dwyer, T. J.; Romesberg, F. E. Chem.—Eur. J. 2010, 16, 12650–12659.
(34) Malyshev, D. A.; Seo, Y. J.; Ordoukhanian, P.; Romesberg, F. E.
J. Am. Chem. Soc. 2009, 131, 14620–14621.
(35) Matsuda, S.; Fillo, J. D.; Henry, A. A.; Rai, P.; Wilkens, S. J.;
Dwyer, T. J.; Geierstanger, B. H.; Wemmer, D. E.; Schultz, P. G.;
Spraggon, G.; Romesberg, F. E. J. Am. Chem. Soc. 2007, 129, 10466–10473.
(36) Matsuda, S.; Leconte, A. M.; Romesberg, F. E. J. Am. Chem. Soc.
2007, 129, 5551–5557.
(37) McMinn, D. L.; Ogawa, A. K.; Wu, Y.; Liu, J.; Schultz, P. G.;
Romesberg, F. E. J. Am. Chem. Soc. 1999, 121, 11585–11586.
(38) Seo, Y. J.; Hwang, G. T.; Ordoukhanian, P.; Romesberg, F. E.
J. Am. Chem. Soc. 2009, 131, 3246–3252.
(39) Seo, Y. J.; Matsuda, S.; Romesberg, F. E. J. Am. Chem. Soc. 2009,
131, 5046–5047.
(40) Seo, Y. J.; Romesberg, F. E. ChemBioChem 2009, 10, 2394–
2400.
(41) Yu, C.; Henry, A. A.; Romesberg, F. E.; Schultz, P. G. Angew.
Chem., Int. Ed. 2002, 41, 3841–3844.
(42) Lavergne, T.; Malyshev, D. A.; Romesberg, F. E. Chem. Eur. J.
2011, in press, DOI: 10.1002/chem.201102066.
(43) Hirao, I. Curr. Opin. Chem. Biol. 2006, 10, 622–627.
(44) Hirao, I.; Kimoto, M.; Mitsui, T.; Fujiwara, T.; Kawai, R.; Sato,
A.; Harada, Y.; Yokoyama, S. Nat. Methods 2006, 3, 729–735.
(45) Hirao, I.; Mitsui, T.; Kimoto, M.; Yokoyama, S. J. Am. Chem.
Soc. 2007, 129, 15549–15555.
(46) Kimoto, M.; Kawai, R.; Mitsui, T.; Yokoyama, S.; Hirao, I.
Nucleic Acids Res. 2009, 37, e14.

19888 dx.doi.org/10.1021/ja207907d |J. Am. Chem. Soc. 2011, 133, 19878–19888