Evolution:

Evolution: Change of organisms over time

-Evolution studies how modern organisms descended (evolved) from ancient organisms
-Lamarck: Inheritance of Acquired Characteristics
-Darwin & Wallace: Natural selection

Lamaracks Theory of Acquired Characteristics

● French naturalist- before Darwin
● First to recognize that…
○ organisms are somehow adapted to their environment
● Theory of Acquired Characteristics: Organisms acquire or lose traits during their lifetime. These traits are
passed to the offspring
○ Ex. If a giraffe stretches its neck and increases its length, its children will be born with longer
necks.
● Theory of Use and Disuse: if you don’t use a part of your body, eventually you lose the ability to use it. If
you use it, it gets bigger and stronger.

Charles Darwin: Major player

• Born in England, same day as Lincoln (1809)

• Invited to go on a 4 year trip around the world – H.M.S. Beagle

• Made accurate observations

• Collected specimens

• Observed different environments – desert, jungle, mountain tops, islands

• Asked Questions
Galapagos – Main source of DATA for Theory
• Volcanic Islands - close to each other but have very different climates.

– have different vegetation and different sources of food

• Islands colonized from mainland – Continent

Theory of Evolution:
Theory: A well supported testable explanation of phenomena that occur in the world
Theory of Evolution: Provides an explanation, that we can test, about how life has changed and diversified
over time.
Darwin’s Evidence:
1. Fossils: Some fossils are similar to present forms, others are different
-Why have some species disappeared?
-How are the fossils related to living species?
2. Adaptation:

- Different habitats have different organisms.

- Similar habitats have similar organisms.
- All organisms are well adapted to the environment they live in
- Environment determines what survives in it
EX- Finches: Species similar in the different islands – but beaks are different - FOOD

- Beak of finches adapted to food available

-
After Darwin’s Trip…
• Darwin studied his samples and thought about his discoveries
• His ideas were too revolutionary – he was afraid to publish them -- Victorian England was to conventional
• Then… Darwin receives a letter from Alfred Wallace, a naturalist working in Malaysia
• Wallace had the same ideas!!!!
• Darwin had to hurry up and publish his ideas in a book called “The Origin of Species” – 1858 (Darwin was
50 years old)

Alfred Wallace:
– naturalist from Malaysia

– came up with the same idea independently: Natural Selection by means of Survival of the Fittest

• Darwin’s and Wallace’s ideas were published at the same time

• But Wallace did not have as much evidence as Darwin

 Darwin’s Mechanism for Evolution: NATURAL SELECTION
- Life is a Struggle for Existence
Members of a species compete for resources –
Survival of the Fittest
- Who wins?
Better camouflaged, faster, better protected, better equipped –
Better adapted to the environment

Thomas Malthus:
• Economist

• Studied human population growth

• Populations get checked by diseases, famine, war

• Overpopulation demands death

Darwin’s theory of Natural Selection:

• Darwin proposed a mechanism to explain how organisms change over time
- a mechanism for evolution

• Darwin called this mechanism… Natural Selection

Natural Selection: 4 steps
1. Natural Varation: exists in nature
2. Competition: Organisms struggle to survive: more organisms are produced that the environment
can support
3. Survival of the Good Enough (fittest): Only the best adapted survives. Adaptations are
important
4. Organisms change over time: in response to the environment: organism change but they have a
common descent - they have common ancestors
Step 1 Natural Variability:
Variation (differences in traits) naturally exists in all populations.
• The variation (diversity) that exists in natural populations provides the raw material for Natural
Selection.
• Not all individuals of a given species are equally well adapted to the environment
EX: Some cows produce more milk than others, some animals are faster, some plants produce
sweeter fruits, etc.

• The environment allows only the fittest (the best) to survive and reproduce.
 • Only those that reproduce pass on the genes to the next generation

Sources of Variation:
Changes in the DNA within a population
1. Mutations: changes in the DNA sequence
ATCCGTTAA 🡪 TTTCGTTAA
2. Gene shuffling during meiosis, and crossing over.
3. Random matings in natural populations

VOCAB:
Gene Pool: all the genes in a population
Evolution: change in the
frequency (abundance)
of genes over time
High Genetic Variation (Diversity):
- Good for populations.
- More to choose from if the environment changes
- Tolerate change better
Low Genetic Variation (Diversity):
- Less tolerant to changes (less to choose from)
- More susceptible to diseases
- Inbreeding decreases genetic variability – nothing new
- Inbreeding: mating among a small number of organisms

Natural Selection vs. Artificial Selection

• Natural Selection: the environment is the selective force.

– Only those organisms that

are well adapted will survive
in the wild.

• Artificial Selection: nature provides

variation, and humans select
variations that we find useful.
 Ex: domestic animals and crops.
10,000 years of evolution by Artificial Selection
= Domestication

Step 2. Struggle for Existence - Competition:

• Competition is the struggle and “fight” among species for limited resources (food, territory, mates, etc…)

Members of each species compete to obtain food, living space, and mates.

• Who survives?

Predator: Faster, better grabbing, better eyesight

Prey: Better protected (porcupine), better camouflaged (stick insects), faster

Step 3. Survival of the fittest:

Survival of the fittest- individuals with favorable traits will survive and reproduce at a greater rate

The fittest organisms are the best adapted to their environment

Adaptations: inherited characteristics that allow individuals to be better suited to their environment
and increases their chance of survival and reproduction
a. Structural adaptations: type of wings, beaks, legs, feet, fur, quills in a porcupine [camouflage &
mimicry]
b. Behavioral adaptations: migration, hibernation, schooling in fishes, flocks in birds

Adaptations: inherited characteristics that allow individuals to “do better” in their environment.
Adaptations increase their chance of survival and reproduction

Structural Adaptation: Camouflage

• Camouflage: Adaptation that allows organisms to blend with the environment and avoid predators

Structural Adaptation: Mimicry

-Mimicry: mimicking or copying the appearance of other organisms for protection or other advantages (avoid
predation, avoid competition)
Example 1.
Hoverfly and Wasp:
Birds avoid (do not eat) the hoverfly because they “think” it is a wasp

Step 4. Descent with modification

• Over long periods of time, as the environment changes, natural selection selects organisms with slightly
different structures, niches, and characteristics.

• Species today look different from their ancestors

• Each living species has descended from others – and has changed, because their environment has
changed.
Common descent: species are derived from common ancestors but change over time due to environmental pressure

Natural Selection – and phenotypes

• Natural Selection on specific traits can lead to changes in allele frequencies

• Changes in allele frequencies result in changes in the population

• Natural selection can affect the distribution of phenotypes in a population in 3 ways:

1. Directional Selection
2. Disruptive Selection
3. Stabilizing Selection
How has natural selection changed since Darwin’s time?

• While theories (explanations) are constantly updated with new evidence, Darwin’s core mechanism of
natural selection has remained unchanged since its publication in 1858.

• IT HAS NEVER BEEN DISPROVEN!

• There have, however, been updates throughout the years that have strengthened our understanding of
evolution, such as…

• Genetic and DNA evidence

• Biochemical evidence
 • Additional fossil evidence

• Evolutionary Development (EvoDevo)

• Evolutionary Psychology

• Evolutionary and Cultural Anthropology

• Antibiotic resistance

• Punctuated Equilibrium

• Genetic Drift

• Gene Flow (migration, immigration)

• Sexual Selection

• Kin Selection

• Gene-Level Selection (the “Selfish Gene”)

• Group-selection and altruism

• Hardy-Weinberg Equilibrium

• …and more!

How do new species arise?

-- Speciation –
• Species: group of organisms that can interbreed and produce fertile offspring

• Speciation: the process by which genetically distinct species arise.

Speciation: Formation of new species

• As adaptations and differences accumulate, the organisms become so different that they cannot interbreed
(reproduce) anymore
 • The Unit of Evolution is a Population:
A population is a group of individuals, of the same species, living in the same area, that interbreed
(reproduce)

• Populations Have Genetic Variation (Variability)

Individuals in a population are different. Small differences are determined by their genes (DNA sequences)

Speciation: How does a Population become a New Species

• If a population becomes separated, or a group of individuals becomes isolated, they may change over
time.

• They may change so much that they cannot interbreed anymore with the members of the original
population. Reproductive Isolation.

• Reproductive Isolation is the first step towards the formation of a new species

• What influences reproductive isolation:

1. Geographic Isolation

2. Behavioral Isolation

3. Temporal Isolation

1. Geographic Isolation
• A physical barrier separates (splits) the original population

• As time passes, the environment may selects for different traits and the 2 populations become genetically
different AND can’t reproduce

• Barriers: Rivers, mountains, bodies of water

Kaibab and Abert Squirrels

- The Kaibab squirrel (Sciurus aberti kaibabensis) became geographically isolated from the common ancestor
about 10,000 years ago.
 - Its closest relative is the Abert squirrel (Sciurus aberti aberti)

- They live in opposite sides of the Grand Canyon

2. Temporal Isolation (Time of Reproduction)

• Groups of individuals reproduce at different times. The genes of the 2 groups do not mix.

• It is happening now with some of the migratory birds that decide not to migrate.

• The birds that do not migrate start mating before the migratory ones come back.

• Eventually they might become different enough that they may not recognize each other.
Robins usually migrate south to warmer climates. Some are not migrating. They reproduce before the migrating
individuals return.
Reproductive Isolation

3. Behavioral Isolation (Reproductive Behavior changes)

• If 2 populations have different courtship behaviors, they will not be able to interbreed

• Different songs (birds) or mating calls (frogs)

• Different scents (smells)

• A simple mutation can cause a change

How fast is evolution? How fast do organisms change?

Gradualism:
-Organisms go through gradual and continuous change
Punctuated Equilibrium:
-Organims go through fast periods of change followed by long periods of no change (according to fossil record)

Punctuated Equilibrium
Proposed by Stephen Jay Gould
(1941-2002)

Patterns of Evolution:
1. Convergent Evolution
Convergent Evolution: When 2 or more unrelated species become more similar due to similar adaptations
to their environment.

Patterns of Evolution:
2. Divergent Evolution-Adaptive Radiation

Divergent Evolution: when related species become more different as they adapt to different environments

• Divergent evolution leads to Adaptive Radiation

Cladograms
Evidence of Evolution
(= Evidence of change over time)

1. Fossil Record: Some species change, some don’t, some become extinct

2. Comparative Anatomy: Homologous, analogous, and vestigial structures

3. Embryology: Embryos start life looking very similar, with gills and tail

4. Molecular: DNA and protein sequences show similarities among organisms

5. Resistance to Pesticides & Antibiotics

Fossil Record
• The fossil record is incomplete but provides some evidence about the history of the earth.

• Fossils show the progression of ancient, primitive organisms to modern day forms.
• Fossil Record: The history of life on Earth can be partially constructed by dating (age) and comparing fossils
- Relative Dating: approximate age based on position on the rock layers
- Absolute Dating: Exact age determined by radioactive dating
 Comparative Anatomy:
A. Homologous structures: Homologous structures develop from the same tissues, but have different forms
with different functions.
Same origin -- different form/function
Divergent Evolution

• The similarity is due to having derived from the same common ancestor.
Example: Bone structure of arms and legs in all vertebrates.
• Homologous structures provide strong evidence that that all vertebrates descend, with some modifications,
from a common ancestor
Homologous Structures: if they are used for different functions it is called
Divergent Evolution

B. Analogous Structures: Different origin but have similar function. = Convergent Evolution
 C. Vestigial Structures: Structures used in the past, but not used today.

• Over time, natural selection eliminates a certain organ that is not useful.
Examples: Pelvis and back legs in whales and snakes. Appendix in humans

Embryological Development

• The early stages of embryos of vertebrates are very similar. All have gill slits and a tail (including humans).

• Some cells develop in the same order and have similar patterns.
This is evidence of common ancestry
 Molecular Evidence

• All life shares the universal genetic code

• Compare DNA or protein sequences of different organisms to determine relationship

• Shows common ancestry

• Quantitative data

• More similar the amino acid or DNA sequences = more closely related

- Sequence of nucleotides in DNA

ATTTCGCGGATAGGCCAATACA
 ATTTCGCGGATTGGCCAATACA

- Sequence of amino acid in proteins

The more similar the sequences are, the more closely related the organism are (share a closer common
ancestor)
Amino acid sequence of the protein cytochrome c in humans and other animals (cytochrome c is found in the
mitochondria)

Evolutionary changes can happen over short periods of time

If organisms reproduce fast enough (short generation time), we can “see” the changes in our lifetime

• Mosquitoes and Resistance to DDT (pesticide)

• Antibiotic Resistance in Bacteria

Natural Selection in Bacteria: Antibiotic Resistance

1. Antibiotics kill most bacteria but if just one bacteria cell is resistant to the antibiotic (not affected),
it will survive and reproduce
2. The surviving (resistant) bacteria will reproduce and all the descendents will be resistant to antibiotics
3. The antibiotic resistant bacteria becomes more common
4. Next time antibiotics are used, the bacteria may not be affected!!
5. Bacteria reproduce fast!!!
Hardy-Weinberg equilibrium OR How to determine if populations are changing over time:
The Gene Pool
● The genetic makeup of an individual is its genotype
(BB, Bb, bb)

● A population consists of many genotypes.

● All the genotypes in a population make up the gene pool.

● For each gene, the gene pool includes all the different alleles (B, b) for that gene in the population.

● The frequency (%) of the different alleles (B, b) in the gene pool can be quantified

● Allele frequency is how often an allele occurs in a gene pool.

Evolution - Change over time

Populations change over time because their gene (allele) frequencies change.

Factors that can make a population change over time:

● Natural Selection
● Choosing your mates - known as Sexual Selection
● Mutations - changes in the gene code
● Migration - new individuals bringing or taking aways traits
 ● Random events that affect individuals regardless of their fitness - happens in small populations - Genetic
Drift

Allele frequencies do not change in a population if :

1. There is no natural selection -- all individuals have an equal chance of reproducing and passing their genes to
the next generation.
2. Mating is random -- individuals do not choose mates based on genotype.
3. No new mutations occur -- no new alleles are being created.
4. There is no migration -- no one is moving into or out of the population.
5. The population is very large -- minimize the effect of random changes

The Hardy-Weinberg Equilibrium

● The Hardy-Weinberg Equilibrium is a tool to evaluate if a population is changing

(evolving) or not.

● If there is no mutation, no migration, no genetic drift, no natural selection, and

matings are random, then, the gene frequencies in a population should not change.

● the frequency of alleles (A, a) and genotypes (AA, Aa, aa) in a population will remain
constant over time if the population is not changing (evolving)
 Hardy Weinberg Calculations
ALLELES

p = A Dominant allele
q = a Recessive allele

Equation: p + q = 1

GENOTYPES

p2 = AA Homozygous dominant individuals

2pq = Aa Heterozygous individuals

q2 = aa Homozygous recessive individuals

Equation: p2 + 2pq + q2 = 1

Hints to solve problems:

1. If we know the frequency of one of the alleles (A or a), we can calculate the frequency of the other allele.
Remember that p + q = 1

2. If we know the frequency of homozygous recessive individuals (aa = q2), then √q2 = q. If you know q you
know p → p + q = 1

3. Use decimals for all calculations, NOT PERCENTAGES (37% = 0.37)

4. Determine what piece of information you have been given about the population: alleles frequencies (A, a),
frequency of recessive phenotypes (q2) or frequency of dominant phenotypes (p2 + 2pq)
 Sample Problem:

In a plant population red flowers are dominant to white flowers. In a population of 500 individuals, 36% of the
plants have white flowers.

(a) Calculate the frequency of all genotypes (AA, Aa, aa)

(b) How many individuals would you expect to be homozygous dominant and heterozygous for this trait?

1. q2 = frequency of the homozygous recessive (individuals with white flowers) = 36% = 0.36
Since q2 = 0.36, q = √0.36; q = 0.6 .
2. Now, p + q =1, so p = 0.4.
3. Homozygous dominant individuals are AA or p2 = (0.4)(0.4) = 0.16
Heterozygous individuals are calculated from 2pq = (2)(0.4)(0.6) = 0.48
Homozygous recessive individuals are aa or q2 = 0.36 (from data given)
4. Homozygous dominant individuals are (0.16)(500 individuals) = 80 individuals.
The heterozygous individuals are (0.48)(500 individuals) = 240 individuals.

Classification:
-To study the diversity of life, scientists use a classification system to name and group organisms in a logical
manner

-Taxonomy: the science of grouping and naming organisms based on:

-Physical similarities (Anatomy)

-Chemical makeup (DNA and proteins)

-Evolutionary relationship (Common ancestry-fossils)

-Developmental similarities (embryology)

Carolus Linnaeus (1700’s)
• Practical classification

• Hierarchical system with 7 levels

Kingdom (largest group)
Phylum
Class
Order
Family
Genus
species
(smallest group)

-Each level is called a taxon (plural=taxa)

includes a group of related phyla (phylum)

includes a group of related classes
includes a group of related orders
includes a group of related families
includes a group of related genera
includes a group of related species
group of organisms that can interbreed and produce fertile
offspring

Binomial Nomenclature:

-Naming system proposed by Linnaeus

-Each species is given a 2-word name

-Genus, species

-Both underlined or italics

-First one always capitalized

-Example: Canis familiaris Dog

Classification Today
-Same system used by Linnaeus but..

-Organism are grouped based on evolutionary relationships (common descent)

-Cladogram: Diagram that shows the evolutionary relationships among organisms (which ones are more closely
related)

Cladogram: Shows evolutionary relationships

Classification Today:

Based on:

-Homology - Organisms with homologous structures are grouped together.

-Homologous: same origin EX: bones of arms, wings, flipper

-Molecular Biology -Organisms with similar DNA are grouped together

-Chimps and Humans DNA is 98% identical

Classification can change:

-New discoveries:

-New technology - EX: DNA and bacteria

Dichotomous Keys:
• Because of the great diversity of life, scientists use dichotomous keys to identify species

• A dichotomous keys uses a series of yes/no questions to identify organisms using defining characteristics

– Words

– Pictures

Simple Key to identify

1. It has feathers …………… Go to 2

No feathers ………………. Go to 3
2. It has webbed feet………… Duck
No webbed feet …….…..... Chicken

3. It has legs……………………Go to 4
No legs…………………….. Snake

4. It has a “shell” …………….. Turtle

No shell……………………….Lizard

How are living organisms classified/organized?

1. Domain Archaea - Kingdom Archaebacteria
2. Domain Bacteria - Kingdom Eubacteria
3. Domain Eukarya -Kingdom Protista , Kingdom Fungi , Kingdom Plantae , Kingdom Animalia
 Kingdom
Archaebacteria:

● Prokaryotes (no nucleus)

● One cell (unicellular)
● Have Cell Wall without peptidoglycan
● Autotrophs (= producers = make own food) or
● Heterotrophs (need to eat others - consumers)
● Live in extreme environments
● (hot, cold, no oxygen)

Kingdom Eubacteria:

● Prokaryotes (no nucleus)

● Have Cell Wall WITH peptidoglycan
● One cell (unicellular)
● Autotrophs or Heterotrophs (consumers, decomposers)
● Common bacteria, Cyanobacteria (have chlorophyll)

Kingdom Protista:

● Eukaryotes (cells with nucleus and membrane-bound organelles)

● Most unicellular;
● Some multicellular
● Autotrophs (producers) or
● Heterotrophs (consumers)
 ● Amoebas, Paramecium, Slime molds, Algae (seaweed)
● Kingdom will be divided

Kingdom Fungi:
● Eukaryotes
● Most multicellular; some unicellular
● Cell wall made of chitin (a carbohydrate)
● Heterotrophs
● - consumers
○ - decomposers
● Mushrooms,
● yeasts, molds
Kingdom Plantae:
● Eukaryotes
● All multicellular
● Cell wall made of cellulose (a carbohydrate)
● Autotrophs (have chloroplasts) - producers
● Mosses, ferns, flowering plants, conifers

Kingdom Archaebacteria:

Virus:
• Viruses are non-living particles.

• Cannot be seen with light microscopes

• To reproduce, viruses need to infect cells

 • Viruses use the cell organelles and chemicals to make more viruses.

• Viruses are non-living because:

- not made of cells
- do not use energy
- do not reproduce on their own``

• Viruses are made of:

- A core of genetic material: DNA or RNA
- A protein coat that surrounds the genetic material. This coat is called a = CAPSID

The capsid protects

the genetic material
and allows the virus
to enter a host cell
Some capsids
might have lipids

This is the Influenza virus🡪 🡪

Three Common Viruses:

Bacteriophages:
Viruses that infect bacteria
 • Viruses are not given scientific names.

• Viruses are named

– after the disease they cause or

– given a catalog number

Viral Infections (reproduction):

A. Lytic Infection

1. Attach:
- The virus attaches to the cell’s membrane
2. Entry:
- Virus inserts its genetic material into the cell. - The host cell cannot tell the difference between
its own DNA
and the virus DNA

3. Replication and Assembly:

- The virus takes over the cell machinery and makes nucleic acids and capsid proteins.
Virus DNA + Coat Proteins = New Viruses
4. Lysis and Release:
The newly assembled viruses burst out of the cell membrane killing the host cell
Produces infection/disease – Not good

Viral Infections (reproduction):

B. Lysogenic Infection

1. A virus fuses its DNA to the DNA of the cell.

2. When the cell DNA replicates, the virus DNA replicates too.
3. The new cell receives a copy of the virus DNA

- The DNA of the virus is replicated, but no new viruses are made
Does not produce infection/disease
Defending aganist Viruses:

-Only defense: Vaccines

-Vaccine: A soultion containing weakened or killed viruses (pathogens)
-When teh weakended viruses are injected, the body’s immune system learns how to make defenses (antibodies)
aganist these viruses
-If the body is exposed to the same virus again, the body has the defenses ready and will destory the virus before it
has a chance to infect the cells.

Why don’t we have vaccines against all viruses?

-Vaccines only work against viruses that have proteins that do not change
-Smallpox, measles, and polio: have surface proteins that do not change from generation to generation- we have
vaccines that work
-HIV, Cold, Influenza: Have surface proteins that mutate often - Vaccines do not work
-Flu shots protect you against last year’s virus. If you get exposed to the newly mutated strands, you will get sick.
Antiviral Drugs:
-Antivirals are used to treat infections caused by viruses. Unlike antibiotics, antivirals are very specific and have
limited efficencey
-Antivirals do not cure infections, They reduce the rate of viral growth but will not inactivate the virus already
present

Antivirals attack the enzymes (proteins) needed for viral replication.

Kingdom Archaebacteria:
 • Unicellular (single-celled)

• Cell wall without peptidoglycan

• Prokaryotes (cell membrane, DNA, ribosomes

• Motile or non-motile

• Autotroph or Heterotroph

• Methanogens (make methane)

• Halophiles (love salty places)

• First organisms on Earth

• Live in extreme environments that resemble the early Earth (extremophiles)
- Salty pools (Great Salt Lake, Dead Sea)
- Volcanic hot springs, geysers (Yellowstone)
- Black organic mud (no oxygen) – Swamps
- Stomach of ruminants (cows, deer) – produce methane

Kingdom Eubacteria:

• Unicellular

• Thick cell wall with peptidoglycan

• Prokaryotes

• Autotroph (blue-green algae) or Heterotroph

• Some motile: move with flagella or spinning

• Some non-motile: do not move

• Common bacteria around you:

Streptococcus pyogenes, Escherichia coli,
Lactobacillus acidophillus, Salmonella enteritides
Reproduction:
-Bacteria can divide every 20 minutes
-Reproduction: Binary fission or conjugation
1. Binary fission (asexual): Cell divides in half producing 2 identical daughter cells. Clones
2. Conjugation (sexual reproduction): Cells exchange genetic material by connecting to each other
by a bridge (pili), Conjugation increases genetic diversity

Importance of Bacteria:
• Decomposers: Break down organic compounds into simpler, smaller molecules.
- We use them in water treatment plants

• Nitrogen Fixation: Bacteria convert nitrogen gas (N2) into ammonium (NH4). Plants can only use
ammonia as a source of nitrogen to make proteins
(Ammonia is the main ingredient of fertilizer)

• Food products: Bacteria carry on fermentation. Use sugar as energy and produce lactic acid as waste.

• Examples:– yogurt, pickles, sour cream, kimchi.

 • Vitamin K synthesis (up to half of daily value) in the large intestine

Bacterial Diseases:
Bacteria cause disease in 2 ways:
1. Damage the cells and tissues of the host. They use the cells for food!
 Ex: Mycobacterium tuberculosis in lungs
2. Bacteria release toxins (poisons) that travel through the body and disrupt normal activities
Ex: Streptococcus pyogenes (strep throat)
Fever, body aches

Preventing and Curing Bacterial Diseases:

• Preventing
Vaccines: Expose the body to killed or weakened bacteria. The body learns how to make antibodies
(defenses) before the real bacteria attack.

• Curing
Antibiotics: Chemical compounds that either kill the bacteria or prevents them from reproducing. Only
work on bacteria
Examples: Penicillin, ampicillin, amoxicillin

Controlling Bacterial Growth:

1. Disinfectants: Chemical solutions that kill pathogens
Lysol, soap, alcohol, iodine

2. Pasteurization (Sterilization by Heat): Most bacteria die at high temperatures.

Cooking food kills bacteria
Pasteurized milk, yogurt, beer, eggs

3. Refrigeration: Low temperatures prevent bacteria from reproducing.

The enzymes of bacteria are affected by temperature – bacteria cannot grow or reproduce at low
temperatures – to slow.
Kingdom Protista:
• Eukaryotes

• Most with one cell (Unicellular)

• Some with many cells (Multicellular): seaweed

• Autotrophs or Heterotrophs

• Protists contains organisms that do not fit into the other eukaryotic kingdoms

• Protists evolved from prokaryotes (bacteria)

• Protista can be:

Animal-like, Plant-like, Fungus-like

Movement in Protista
1. Flagella: long, whip-like projection
Most have just 1 or 2 flagella

Euglena has a photoreceptor

- Swim towards the light

- Photosynthesis

- Homeostasis
2. Cilia: Short, hair-like projections.
Too many cilia to count
Paramecium lives in freshwater
- Hypertonic to the environment
- Water comes in
- Contractile vacuole pumps it out
- Maintain Homeostasis

Reproduction:
1. Binary Fission:
Split into 2 identical cells

2. Conjugation:
Exchange
 pieces of DNA.
Then split in 2.
Increase genetic diversity

1. Animal-like Protista
All heterotrophic (like animals). Need to consume other organisms

2. Plant-like Protista = Algae

All autotrophic, like plants. Do photosynthesis
 Have chlorophyll inside chloroplasts.
Volvox: freshwater Diatoms: aquatic with a shell

Plankton: very small floating organisms in freshwater and marine environments.

Plankton = Phytoplankton + Zooplankton

1. Zooplankton: heterotrophic - crustaceans, worms, microscopic larval

stages of other organisms
2. Phytoplankton: autotrophic – Mostly plant-like protist (algae) and
cyanobacteria ( blue-green algae)
 Phytoplankton produce most of the oxygen on Earth!!

3. Fungus-Like Protista
All heterotrophs – Decomposers: Absorb nutrients from dead or decaying organic matter

Kingdom Fungi:
-Eukaryotes
-Cell wall made of chitin, a carbohydrate
-Most multicellular: mushrooms,molds
-Some unicellular: yeasts
-Heterotrophs: -Decomposers , Some parasites
-Body made is made of filaments called hyphae
-Reproduce using spores
Fungi are made of thin filaments called hyphae that are one cell thick but many cells long
The body of fungi is made of many hyphae tangled together into a thick mass called a mycelium

Reproduction:
-Mushrooms reproduce using spores
-Spores are small reproductive cells released from the gills
-Mushrooms can also reproduce when hyphae break off and grow on their own
 1. Most fungi are decomposers.
Break down organic material like dead animals, plantsm etc.
They feed by releasing digestive enzymes that break down oranic compounds. The cells (hyphae) then
absorb the digested compounds.
2. Some are parasites:Feed on other living organisms
-Althelet’s foot
-Candida albicans (vaginal and mouth yeast infections)
-Antibiotics are often used to kill the bacteria in Candida albicans

Useful Fungi
1. Some Fungi produce antibiotics
-Penicillium notatum makes Penicillin (antibiotic)
-Grows naturally in some fruits - oranges
2. Fungi used to make cheese:
Blue Cheese: Penicillium roquefortii is used to make blue cheeses: Roquefort, Gorgonzola, Stilton, etc.
The blue “ stuff “ seen on blue cheese are spores
3. Yeast: used to make bread, wine, beer
-Saccharomyces cerevisiae (baking). Unicellular
-Yeasts use sugars as a source of energy during anaerobic respiration
-Their waste products are CO2 and alcohol
Lichens:
-Symbiotic relationship between a fungus and a photosynthetic organism:
-Algae (Protista) or Cyanobacteria (Eubacteria)

Lichens are made of…

Diseases:
-Disease: any change, other than an injury, that disrupts the normal functions of the body.

– Disrupt Homeostasis

• Diseases caused by

– Living organisms - bacteria, viruses, fungi.

– Materials in the environment -cigarette smoke.

– Genetics – inherited - hemophilia, sickle cell anemia.

– Malfunction of body: cancer, arthritis

• Disease-causing agents are called pathogens

– Pathogens cause infectious diseases.

 Germ Theory of Disease:
• Cause of Disease before Robert Koch and Louis Pasteur

– Curses, evil spirits, bad humors

• Pasteur and Koch

– Observation of microorganisms – germs

– Koch proposed the Germ Theory of Disease:

Infectious diseases are caused by different types of microorganisms
Can this be tested?

Koch’s postulates – Testing a Hypothesis

1. A specific organism must always be observed in association with
the disease.

2. The organism must be isolated from an infected host and grown in

a pure culture in the laboratory.

3. When organisms from the pure culture are inoculated (‘given’) into
a susceptible host organism, they must cause the disease.

4. The infectious organism must be re-isolated from the diseased

organism and grown in pure culture

Agents of Disease:
• How do pathogens cause disease?

– Viruses, fungi, some bacteria, and some protists destroy cells as they grow.
HIV, athlete’s foot, tuberculosis, malaria

– Some bacteria release toxins that harm an organism.

E. coli. Streptococcus

– Parasitic worms, produce sickness when they block the flow of blood or lymph, or remove nutrients
 from the digestive system, and disrupt other bodily functions
– Schistosoma, elephantiasis

Speading the Disease:

• Physical Contact

– sexual contact

– touch

– cough

– Sneeze

• Contaminated Food and Water – food poisoning

– Bacteria in uncooked meat – from digestive system in slaughterhouses - E. coli, Salmonella

– Virus, Bacteria, Protist in water – released with feces - Vibrio cholera

• Infected Animals – Vectors: animals that carry pathogens from person to person

– Mosquitoes are vectors for malaria, West Nile Virus

– Ticks are vectors for Lyme disease

Preventing Infectious Diseases:

1. Vaccination: Injection of a weakened or damaged form of a pathogen (virus/bacteria) to produce
immunity.

2. Disinfectants: Chemical solutions that kill pathogens

Lysol, soap, alcohol, iodine

3. Pasteurization (Sterilization by Heat): Most bacteria die at high temperatures.

Cooking food, boiling water - kills bacteria
Pasteurized milk, yogurt, beer, eggs

4. Refrigeration: Low temperatures prevent bacteria from reproducing.

Fighting/Curing Infectious Diseases:

vb
1. Antibiotics: drugs that kill bacteria without harming the cells of the host.
 Amoxicillin, Zithromax, Penicillin

2. Antivirals: drugs that fight certain viral diseases but do not cure infections. They reduce the rate of viral
growth but will not inactivate the virus already present.
Tamiflu, Acyclovir

3. Antifungals: drugs that kill fungi

Lotrimin, Vagisil, Tolnaftate

Ecology:
Definition: the scientific study of interactions among organisms and between organisms and their environment or
surroundings

Levels of organization:
Individual: One (A)
Population: Group of individuals of the same species living in the same area (AAAAA)
Community: Different populations living together in an area (AAA+BBB+CCCC)
Ecosystem: all the communities in an area + all the non-living components of the environment
(AAA+BBB+CCCC + Non-living)
Biome: Group of ecosystem with the same climate and similar communities (example: desert biome)
Biosphere: part of the Earth in which life exists, including air, land, and water

Factors in an Ecosystem: Biotic vs. Abiotic

Biotic Factors – all living things, the bacteria (prokaryotes), protists, animals, fungi, and plants in the
environment
Abiotic Factors – all non-living things, the physical and chemical conditions
 -Sunlight, water, temperature, soil , wind , fires etc

Energy Flow:
Energy flows in one direction: from the sun to consumers
Sunlight is the main energy source

Producers (autotrophs) use sunlight and chemicals to produce food and harness energy

• Photosynthesis – uses light energy (Plants, algae=protists, bacteria)

• Chemosynthesis – uses chemical energy (Bacteria in volcanic vents)

Consumers (heterotrophs) rely on other organisms for energy

• Herbivores – eat only plants

• Carnivores – eat only meat

• Omnivores – eat both plants and animals

• Detritivores – eat plant and animal remains (Crabs, earthworms)

• Decomposers – breakdown organic matter (Bacteria, fungi)

How do we organize Producers and Consumers?

Food Chains: steps showing how organisms are consumed
Fewer steps mean greater energy for consumers
Food Web: links all food chains in an ecosystem together
Trophic Levels:
each step in a food chain or web starting with producers
Plants: 1st trophic level
Herbiv. Insect: 2nd trophic level
Spider: 3rd trophic level
Insectiv. Bird: 4th trophic level
Fox: 5th trophic level
Ecological Pyramids:
Diagrams that show the amounts of energy & matter within the trophic levels of food chains and webs (There are
3 types)

1.Energy Pyramid – energy passed between trophic levels. Only 10% of the
energy is transferred to the next level!!!
a. Energy pyramid shows the efficiency of energy flow

2. Biomass Pyramid – potential food available for each trophic level. It is measured in grams per unit area g/m2

3. Pyramid of Numbers – number of individual organisms at each trophic level. Not always a pyramid.

• The productivity of a system is a measurement of how much organic matter is

produced (biomass)

• Primary productivity: biomass produced by autotrophic organisms (Satellite:

measures chlorophyll)

Cycles of Matter:
Energy: flows from producers to consumers- One way flow
Only 10% of the Energy is transferred from one level to the next, the rest is used by the organisms or is lost as heat
Matter: Matter is recycled in a ecosystem, Matter (chemical elements) is not used up or destroyed, it is
transformed
Biogeochemical Cycles
Cycles of bio, geo and chemical aspects of the biosphere
Nutrient Cycles: Water-Carbon-Nitrogen-Phosphorus
-All living organisms are made of C, H, O, N, P , S
These elements are needed to build the bodies of all living organisms
-Producers are able to “put together” these elements into macromolecules (carbohydrates, lipids, proteins, nucleic
acids)
-Consumers acquire them by eating the producers

Water Cycle:
Water cycle: The movement of water through an ecosystem
-Water is essential for life on Earth
-About 70% of an organism is water , Cells are at least 70% water
-All chemical reactions in the body occur in water
-Precipitation-Runoff-Evaporation/Transpiration-Condensation

Transpiration: Water lost by plants through the leaves

-A Douglas fir (Christmas tree) can transpire 25 gallons of water (100 liters) in one summer day
-A corn plant transpires 60 gallons of water (250 liter) during its life (5-6 months)

Carbon Cycle:
-Plants, algae (protists) and photosynthetic bacteria take in CO2 to make carbohydrates (C6H12O6) through the
process of photosynthesis
-Consumers return CO2 to the atmosphere by respiration
-Fossil fuels (coal and petroleum oil) are the remains of organisms. When we burn coal or oil, we break them
down into CO2 that is returned to the atmosphere
-Carbon is needed to make carbohydrates (C,H,O), lipids (C,H,O), proteins (C,H,O,N), nucleic acids
(C,H,O,N,P)
Nitrogen Cycle:
-All organism need NITROGEN to make amino acids, which in turn are joined together to make proteins
-78% of the atmosphere is Nitrogen gas (N2)
-Nitrogen is also found in ammonia (NH4), nitrate ions (NO3) and nitrite ions (NO2)
-Plant fertilizers contain high amounts of Nitrogen
-Nitrogen Fixation: Bacteria convert nitrogen gas into ammonia This process removes nitrogen from the air
-Denitrification: Some soil bacteria convert nitrates into nitrogen gas This process releases nitrogen gas into the air
Phosphorus Cycle:
-Living organisms need phosphorus to make DNA, RNA, and bones (calcium phosphate)
-Phosphorous does not becomes gas It cycles among organism and between organisms and the soil

Limiting Nutrients:
Limiting Nutrients: Nutrients that are in short supply and are needed by the organisms to grow (build body parts)
Limitiung Nutrients in soil: N,P,K Fertilizers contain N, P, K
Limiting Nutrient in ocean: N
Limitg Nutrient in freshwater: P

-When an aquatic ecosystem reveiuves a large quantity of a limiting nutrient, the number of producers increases
rapidly and causes an algal bloom- algal blooms are NOT GOOD

Algal blooms disrupt the ecosystem:

1. Algae grow fast
2. When nutrients (N,P,K) are used up the algae die
3. When algae decompose they consume oxygen
4. This oxygen is taken away from other organisms
5. Other organisms die due to lack of oxygen

Fertilzer Fact:
The numbers in the bag are the percentage of:
-Nitrogen
-Phosphorus
-Potassium
Always in this order
Population:
Organisms of the same species living in an area

Chracteristics of a Population
1. Geographic distribution (=range): area where individuals live
2. Density: number of individuals per unit of area
3. Growth rate: how the NUMBER of individuals in a population increases or decreases over time

Population growth: How the number of individuals changes over time

Three factors affect population size:
1. Number of Births : Birth rate +++
2. Number of Deaths: Death rate —-
3. Number of individuals that enter or leave the population
-Immigration: coming in +++
-Emigration: leaving - - -

Types of Growth: 1 Exponential

-J- Shaped curve
-Unlimted resources
-Reproduce at a constant rate. Population doubles every time
-Exponential growth occurs under ideal conditions, with unlimited resources
-NOT REALISTIC but it might occur for a limited amount of time
-Remember the bacterial growth graph double every 20 min

Types of Growht: 2 Logistic

-S-Shaped curve
-As resources become less available, the growth of the population slows down or stops
-Carrying capacity: Maximum number of individuals that the resources available can support
-Point of stability
-Birth and death rate reaches equiliobrium
Carrying capacity is different for different envioronments

OVERVIEW:
Carrying capacity: Number of individuals that can be supported by the resources in an ecosystem
How many individuals can live in an area
-An ecosystem has different carrying capicites for different populations
-If the environment changes, the carrying capacity changes

Factors that limit the growth of populations:

1. Density-Dependent Factors: factors that become limiting when the density of the population reaches a
certain level
-Competiton: Use same resources
-Predation: Predator-prey
-Parasitism: Host-parasite
-Disease: Virus (bird flu), bacteria (bubonic plague)

2. Density Independent Factors: affect all population in the same way, regardless of the population size
-Weather
-Natural disasters: hurricanes, droughts
-Seasonal cycles: El Nino, La Nina
-Human activities: cutting forests, pollution

Interactions in the Ecosystem:

• Biotic and Abiotic factors affect the survival and growth of an organism

• Habitat: The area where an organism lives (includes biotic and abiotic factors)
This is like your address. A physical place.

• Niche: Role (job) of an organism in the ecosystem. Includes the habitat, feeding habits, who eats it,
interactions with other species, etc.
Two species CANNOT have the same niche
Warblers have different niches in a spruce tree.
By feeding on different areas they avoid competing with each other for food.

Interactions 1: Competition
• Competition occurs when 2 organisms try to use the same ecological
resource (food, nesting area, mate, etc.)

• No two species can occupy the same niche. This is known as the
Competitive Exclusion Principle.

Interactions 2: Predation
-Predation: One organism captures and feeds on another
-Predator: the organisms that does the killing (killer)
-Prey: The food organism, the one that gets eaten (killed)

Interactions 3: Symbiosis
Symbiosis: relationship in which 2 species live closely together

Three main types of symbiosis:

A. Mutualism
B. Commensalism
C. Parasitism

A. Mutualism:
• Mutualism: Both species benefit from the relationship
Flowers and pollinators: Flowers provide food and pollinators help them reproduce
The bacteria Rhizobium (nitrogen fixation) and the roots of legume plants (beans-type of plants)
Egyptian Plover eats parasites (gets food), Crocodile gets rid of parasites.

B. Commensalism:
• Commensalism: One organism benefits, the other is not helped or harmed (neutral or indifferent)
 Clownfishes live in of sea anemones; most predators avoid the poisonous tentacles and the fishes are
protected
Some tropical orchids use trees or branches of trees for support without harm or benefit to the tree.
Remoras attach to sharks. Remoras do not injure or benefit the shark, but enjoy the shark's protection and
live on food scraps

C. Parasitism:
Parasitism: One organism lives on or inside another and “harms” it. The parasite obtains most of its food
from the host.
Tapeworms, fleas, ticks, heartworms.

Interactions 4: Ecological Succession:

The series of predictable changes that occur in a ecosystem over time

Pioneer species: First species to arrive: usually lichens and mosses

Climax Community: last stage of ecological succession. When succession slows down, a stable community that
does not change anymore is established

A: Primary Succession:
Occurs on land where no soil exists.
Ex: Volcanic eruptions
Pioneer Species:
first species to populate the area
- Lichens (fungus & algae)
- Moss
B. Secondary Succession:
Follows a disturbance that destroys a community, but not the soil.
Ex: Fire, abandoned farming fields.
Succession occurs faster because there is soil!

Species present in the Climax community

change depending on the ecosystem
- Deciduous forest
- Desert
- Taiga
- Tropical forest
- Savanna
- Prairie

C: Aquatic Succession:
• Occurs in lakes and ponds.

• They fill in with sediment.

• More plants grow on the shoreline trapping even more

sediment.
The time it takes to fill in depends on the biotic and abiotic
conditions around the lake
Environmental Issues:
Nonrenewable Resources: resource that cannot be replenished by natural processes
Renewable Resources: resource that can regenerate quickly and that is replaceable
Sustainable Development: using resources without depleting them or causing environmental harm

1. Ozone Depletion
-Ozone = O3 = Protects living organisms from UV light (comes from sun)
-Chlorofluorocarbons (CFCs) react with O3 and destroys it, leave a hole in the atmosphere
-With the control of CFCs, the CFC molecules have declined (CFCs: propellants, AC)

2. Acid Rain
-The burning of fossil fuels (coal, natural gas, oil) releases nitrogen oxides and sulfur dioxide into the
atmosphere
-These compounds react with water vapor and form nitric acid and sulfuric acid which make the rain
acidic (low pH)... Affects plants, soil, rivers, lakes, etc

3. Climate Change
-Some gases in the atmosphere are capable of trapping heat (=greenhouse gases):
Carbon dioxide: CO2 , Methane: CH4
-Burning fossil fuels increases CO2 in the atmosphere, which increases the amount of heat trapped. Heat
does not escape into space

Kingdom Plantae:
• Eukaryotic cells

• Cell wall made of cellulose (a carbohydrate)

• All multicellular

• Autotrophs –photosynthesis-

• Almost all plants are terrestrial

• Plants have a waxy covering called a cuticle that reduces water loss

• Plants evolved from green algae - Protists

• Mosses, Ferns, Conifers, Flowering plants

• Parts of a Plant: Roots, Stems, Leaves

Roots:
Anchor the plant in the soil
- Absorb water and minerals
(N, K, Ca, P, Fe, Mg)
 - Store food (carrots)
Roots have root hairs
Root hairs increase the surface
area of the root allowing the root
to absorb more water

Roots store food: edible roots:

• Plants use the roots to store some of the extra food produced during photosynthesis

• Rich in carbohydrates
Carrots, Radishes, Parsnips, Sweet potatoes, Beets

Stems:
Support system for the plant
- Transport system between roots and leaves for water and food
- Produce leaves, branches, and flowers
- Stems can also
be used for storage

Stems: some store food, some edible

Some edible stems:

• Potatoes are underground stems that store food (starch)

• Sugar cane: stores sugar

• Celery

• Rhubarb

Vascular System
(=Transport system):
The vascular system is
made of:
Xylem and Phloem
 1. Xylem:
- Made of tube-like cells
- Carries water from the roots to the leaves – only one direction
- Water moves up by capillary action (adhesion and cohesion)

2. Phloem :

- Made of tube-like cells

- Carries sugars (food) from the leaves to other parts of the plant like roots and flowers

Leaves: make food - photosynthesis

• Cuticle: Waxy layer that covers the leaves. It protects the plant from water loss
--Water loss – Major problem for plants

• Epidermis: on top and bottom of the leaf. Lower epidermis has tiny holes called stomata

• Stomata: openings to allow gas exchange

• Guard cells: Cells that surround the stomata. Guard cells control the size of the opening.

• Mesophyll: Photosynthesis occurs in these cells

• Veins: Bundles of xylem and phloem

Leaf Adaptations:
• Leaves keep their stomata open just enough to allow gas exchange. Plants close the stomata to prevent
water loss.

• Cactus: the leaves are actually the thorns. They do not do photosynthesis. Photosynthesis is carried out by
the stem.
- Thorns are used for defense against predators

Why do we need plants?

• Oxygen production
Carbon dioxide + water = sugar + oxygen

• Food
Cereal, root crops, legumes, fruits, vegetables, nuts, spices, herbs, and flavorings

• Medicine
Digitalis, aspirin (pain), quinine (malaria), morphine (pain), and anticancer drugs (taxol)

• Other Resources such as….

Shelter, dyes, fuel, paper, furniture, musical instruments, ornamental trees, etc.
Sexual Reproduction in Plants:
1. Conifers = Gymnosperms:
Cones are used for sexual reproduction
Male cones are small and produce sperm (=pollen)
Female cones are much larger. Have ovules and receive the pollen.
The pollen fertilizes the ovules inside the female cones and forms
seeds.
OVULE + SPERM = SEED

2. Flowering Plants = Angiosperms

Flowers are the sexual organs in plants
Most flowers have 4 specialized structures:
1. Sepals: leaf-like, usually green, protect the flower bud
2. Petals: leaf-like, usually colorful, function in attracting insects and other pollinators
3. Stamens: male reproductive organs, produce pollen (sperm). Stamen=Filament + Anther
4. Pistil: female reproductive organ, receives pollen. Pistil = Stigma + Style + Ovary

Pollination:
• Pollination: Movement of pollen from the anthers to the stigma
 • Self-pollination: pollen from the same flower

• Cross-pollination: pollen from other flowers

Which type of pollination
leads to greater variation?
Pollen is carried
by wind or animals

• Many plants, mainly conifers, are wind pollinated ---

Lots of pollen, cheap dispersal, pure luck

• Many flowering plants rely on animals: bees, bats, flies, butterflies, birds (hummingbirds)

• Animal-pollinated plants have adaptations to attract animals: bright colors and sweet nectar (free food!)

• The animals go for the food (nectar) and accidentally transport pollen from one plant to another
Less pollen, expensive dispersal, sure destination

Fertilization:
1. Pollen lands in the sticky stigma.
2. The pollen grows a tube all the way down to the ovary. The ovary contains ovules (eggs)
3. When a pollen tube reaches and ovule (egg), it fertilizes it, forming a seed.

After fertilization, most of the flower parts die and the seeds develop inside the uterus

• The ovules become seeds

• The ovary becomes the fruit

Fruits:
Fruits are ripened ovaries that contain seeds
Seed Dispersal:
Plants try to disperse (spread) their seeds to minimize competition among themselves and to find the best
location to grow new individuals.

1. Dispersal by wind:
Lightweight, large amounts of seeds, pure luck.

2. Dispersal by Animals: These seeds are inside fleshy fruits.

• The fruits attract the animals (free food!) The seeds are protected and resist digestion.

• When the animal defecates, the seeds sprout in the feces (great fertilizer).

• Some are dispersed

by attaching to animal fur:
Burrs, sweetgum balls
Heavier, fewer seeds,
sure dispersal.

3. Dispersal by water: seeds float in water

Tropical trees rely on rivers, ocean currents.
Coconuts germinating

Seed Germination:

• Seed germination is the growth of a seed into a new plant.

• During the early stages of growth, before the leaves are formed, the new plant grows using the energy stored
in the seed.

• Once the leaves are formed, the new plant can start making its own food through photosynthesis.

• Seeds store food/energy. That’s why we eat so many seeds!!!

• Corn, wheat, rice, beans, peanuts, nuts in general

 Kingdom Animalia: (Invertebrates)

• Eukaryotic

• Multicellular

• Heterotrophic (consumers)

• Animals evolved from animal-like Protists

Types of Symmetry:
Radial: body parts are arranged around a central point.
Bilateral: body can be divided into two halves that mirror each other.

2 Groups:
Invertebrates = have NO backbone
Vertebrates = have a backbone

Symmetry: Radial and Bilateral

Phylum Porifera: Sponges

• Simple animals with pores

• aquatic

• have NO symmetry
 • body is a hollow cylinder

• Do not move: sessile

• Filter feeders: filter the water and catch the plankton

• Gas exchange: diffusion

Phylum Cnidaria: Stinging Animals– Sea anemone, Jellyfish, Hydra, Corals

• Aquatic

• Radial symmetry

• Have a bag-like digestive system: only one opening

• Have tentacles with stinging cells on them

• Gas exchange: diffusion through skin

Phylum Platyhelminthes: Flatworms and Tapeworms

• Aquatic & terrestrial, some are parasitic

• Bilateral symmetry

• 1st to show cephalization: concentration of sense organs and nerve

cells at the anterior end of the body

• Only mouth present

 • Gas Exchange: Diffusion
Planaria, tapeworms

Phylum Nematoda: Roundworms

• Free-living & parasitic

• Bilateral symmetry

• Have a mouth and an anus!!! –digestive system is a tube

• Gas Exchange: Diffusion

Example: Hookworm, heartworm, pinworm,
trichinosis

Phylum Annelida: Segmented Worms (ring-like

sections)
• Earthworms, leeches, bait worms for fishing

• Gas exchange: diffusion through skin

• Body divided into segments

• Bilateral symmetry

• Have mouth and anus

• Have primitive heart

• More complex organ systems

• Blood has hemoglobin

Phylum Mollusca: mollusks

• Snails, slugs, mussels, clams,
scallops, octopus, squid

• Most have a hard shell used for protection

• Shell made of calcium carbonate in marine species

• Have muscular foot used for movement

 • Mouth and Anus. More complex digestive system

• Well developed head: cephalization

• Gas exchange: lung (terrestrial), gills (aquatic)

Phylum Arthropoda:
joint-legged animals

• Largest phylum: Insects, crustaceans, chelicerates

• Have jointed appendages

• Body divided into head, thorax, abdomen

• Have exoskeleton used for protection (made of chitin or calcium carbonate).

• Shed exoskeleton to grow (molting)

• Bilateral symmetry

• Complete digestive system. Well developed mouth parts

• Gas exchange: Terrestrial: system of tubes trough the body called trachea. Aquatic: gills

Arthropods:

• To grow, arthropods need to replace the exoskeleton for a bigger one. This process is called molting.

• Insects go through different stages of development called metamorphosis.

a. Incomplete metamorphosis: gradual changes. All stages look like a miniature of the adult. Crickets and
cockroaches have incomplete metamorphosis
b. Complete metamorphosis: Larval stages go through drastic changes and they do not look like the adult.
Larva-eats, Pupa-rests, Adult-reproduces
Phylum Echinodermata

• Starfish, sea urchin, sand dollars, brittle stars

• Radial symmetry. No cephalization

• Have exoskeleton (CaCO3), sometimes with spines

• Have tube feet used for locomotion and gas exchange (diffusion)

• Marine animals

Kingdom Animalia Chordata: (Vertebrates)

• embryos have a notochord

• have a dorsal nerve cord
• have pharyngeal pouches
Vertebrates: backbone
• Have a backbone (vertebrae)

• Internal skeleton: endoskeleton

• Complete digestive, circulatory, respiratory, reproductive, and skeletal systems

• Ectotherms: Cannot completely regulate their body temperature. Body temp. is similar to the environment
(a.k.a. cold-blooded)

• Endotherms: Regulate their body temperature. Body temperature is constant, independent of the
environment (a.k.a. warm-blooded)

Fishes:
• Ectotherms

• Gas exchange: Gills

• Body with mucus and scales (protection)

• Most release eggs and sperm into the water

1. Agnathans: fishes without jaws (lampreys)
2. Chondrichthyes: fishes with cartilage (sharks, rays)
3. Osteichthyes: fishes with bones (trout, salmon, tuna, goldfish)
osteo- = bone

Amphibians:
 • Toads, frogs, salamanders

• Ectotherms

• Skin is moist. Most need to live in moist places

• Lay eggs in a jelly-like substance in the water.

• Born in water. In water they breathe using gills (tadpoles); in land they use lungs and skin.

• Very sensitive to pollution. Skin absorbs everything.

• Complex life cycle with metamorphosis:

Egg – tadpole – adult

Reptiles:
• Lizards, turtles, crocodiles, snakes, dinosaurs

• Lay eggs on land; Amniotic sac

• Eggs have a hard, leathery cover used for protection –independent of water.

• Dry skin with scales. Skin is waterproof to prevent dehydration

• Ectotherms
Birds:
• Lay eggs on land (nests)

• Eggs have a hard cover (CaCO3) used for protection

• Body covered with feathers

 • Endotherms

• Feet have scales.

• Mouth without teeth

• Adaptations for flying: hollow bones, powerful pectoral muscles (chicken breast)
Mammals:

• Deer, whales, dolphins, bats, kangaroos

• Bodies covered with hair

• Produce milk to feed their offspring

• 3 inner ear bones (incus, stapes, malleus)

– Evolved from reptile jaw

• Endotherms