Supporting Information
for Adv. Funct. Mater., DOI 10.1002/adfm.202302814
Three Compartment Liposome Fusion: Functional Protocells for Biocatalytic Cascades and
Operation of Dynamic DNA Machineries
Fujian Huang*, Huiying Xue, Yuzhe Fu, Yu Ouyang, Danlong Chen, Fan Xia* and Itamar
Willner*
Supporting Information
Three Compartment Liposome Fusion: Functional Protocells for
Biocatalytic Cascades and Operation of Dynamic DNA Machineries
*, †, ‡
Fujian Huang, Huiying Xue, † Yuzhe Fu, † Yu Ouyang, §
Danlong Chen, † Fan Xia*, † and Itamar
Willner*, §
† State Key Laboratory of Biogeology and Environmental Geology, Engineering Research Center of
Nano-Geomaterials of Ministry of Education, Faculty of Materials Science and Chemistry, China
University of Geosciences, Wuhan 430074, China
‡ Hefei National Research Center for Physical Sciences at the Microscale, Hefei 230026, China
§ Institute of Chemistry, and Center for Nanoscience and Nanotechnology, The Hebrew University of
Jerusalem, Jerusalem 91904, Israel
Experimental Section
Materials. 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC),
1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), Cholesterol (Chol), Amplex Red
were purchased from Aladdin. Glucose Oxidase (GOx), Sulforhodamine B (SRB), Peroxidase
from horseradish lyophilized (HRP), NaOH were obtained from Sigma-Aldrich. Klenow
fragment (Polymerase), Nt.BbvCI (nickase), T7 RNA Polymerase were purchased from New
England Biolabs (NEB). Glucose and Malachite Green (MG) were purchased from
MACKLIN (Shanghai Macklin Biochemical Technology Co., Ltd). HCl was purchased from
Sinopharm Chemical Reagents Co. Ltd (China). Spin-column size exclusion chromatography
(SEC) were purchased from GE (GE. Healthcare Illustra Microspin S-200 HR Columns,
USA). The DNA sequences modified with and without cholesterol were synthesized and
HPLC purified by Sangon Biotech Co., Ltd. (Shanghai, China). Detail DNA sequences were
shown in Table S1. All the DNA sequences were quantified using a UV absorbance
spectroscopy at 260 nm.
Buffer conditions. Phosphate buffered saline (PBS) consisted of 20 mM NaH2PO4, 20
S1
mM Na2HPO4, 150 mM NaCl was used for the experiments, unless otherwise stated. The
buffer pH was adjusted by adding of HCl or NaOH. Ultrapure water (>18.2 MΩ/cm) was
used to prepare the buffer solution.
Preparation of liposomes. The liposomes were prepared as following procedure: 4 mM
DOPC, 2 mM DOPE and 2 mM Chol were added in a 10 mL round bottom flask and
dissolved in 4 mL chloroform. Subsequently, the stock solution in chloroform was evaporated
by a stream of N2 to form the lipid film and further dried under rotary evaporator. Liposomes
were obtained through hydrating the lipid film with 20 mM PBS (pH 7.0) to form a final lipid
concentration of 4 mM. Subsequently, the suspension was repeatedly passed, using a syringe,
for 21 times, through a polycarbonate membrane that includes 220 nm pores to form the
liposome suspension. The average diameter of liposomes was performed using dynamic light
scattering (DLS, Malvern, Nano-ZS90). The number (concentration) of the liposomes was
counted using a Nanocoulter counter (Resuntech, co., LTD, Shenzhen, China) equipped with
nanopore chips having a measuring range of 60–200 nm or 150–500 nm.
To prepare the SRB loaded liposomes, 20 mM SRB dissolved in 20 mM PBS (pH 7.0)
was used to hydrate the lipid film to form a final lipid concentration of 4 mM mL-1.
Unencapsulated SRB was removed by dialysis bag (MWCO = 3500) at 4℃ with 20 mM PBS
(pH 7.0) as dialysate. Other procedures were similar with the above methods.
The liposomes loaded with glucose (0.25 M), GOx (2 U mL-1), HRP (0.2 U mL-1) and
Amplex Red (100 μM), Klenow fragment (0.3 U mL-1), Nt.BbvCI (0.4 U mL-1) and dNTPs
(1.6 mM), T/P (300 nM), S (900 nM), T7 RNA Polymerase (3U mL-1) and NTPs (4 mM), AA’
(600 nM) and MG (1.5 μM) were obtained followed by the similar producers respectively.
The liposomes were purified by spin-column size exclusion chromatography (GE. Healthcare
Illustra Microspin S-200 HR Columns).
The resulting liposome suspension was diluted to form a liposome suspension with a
final DOPC lipid concentration of 138 μΜ and then interacted with the corresponding
cholesterol-modified nucleic acid for a time interval of 1h, bulk concentration of the nucleic
S2
acid 1 was 213 nM and the concentration of the nucleic acid 2 and 3 was 106 nM. The
resulting nucleic acid functionalized liposomes were purified by spin-column size exclusion
chromatography (GE. Healthcare Illustra Microspin S-200 HR Columns).
Preparation of giant vesicles (GUVs). The GUVs were prepared using the above
similar method. Briefly, 4 mM DOPC, 2 mM DOPE and 2 mM Chol were first dissolved in 4
mL chloroform by sonication at room temperature for 3 minutes in 10 mL round bottom
flasks. The mixture was then evaporated under a stream of N2, forming the thin lipid film.
The lipid film under in a rotary evaporator so that further dried film could form. A solution (1
ml) was added in dried film and the GUVs were formed through hydration, the final
concentration of lipid was 4 mM mL-1. The empty GUVs, GUVs loaded HRP (0.2 U mL-1)
and Amplex Red (100 μM), GUVs loaded Klenow fragment (0.3 U mL-1), Nt.BbvCI (0.4 U
mL-1) and dNTPs (1.6 mM), GUVs loaded T7 RNA Polymerase (3U mL-1) and NTPs (4 mM)
were obtained using the abovementioned methods. The liposomes were purified by
spin-column size exclusion chromatography (GE. Healthcare Illustra Microspin S-200 HR
Columns).
Fluorescence measurements. All time-dependent fluorescence and fluorescence spectra
measurements were obtained using a FS5 spectrofluorometer (Edinburgh Instruments). The
excitation of SRB, resorufin and MG were performed at 520, 571 and 618 nm, respectively.
The emission of SRB, resorufin and MG were recorded at 580, 585 and 658nm, respectively.
Measurements of liposomes diameter changes. The size of liposome samples was
verified via DLS. Three kinds of liposomes modified with DNA 1, 2 and 3 were mixed
together, and the mixing solution were irradiated with UV lamp (LUYOR-365, China) for 3
min at 365 nm. The change in average diameter of the liposomes was measured every 6 min
for 30 min using DLS. Then, the pH of mixture solution was changed from 8.0 to 5.0 by
adding appropriate HCl, the measurements of average diameter of the liposomes was
obtained every 6 min for 30 min.
Scanning electron microscopy (SEM). SEM images were recorded on a SU8010
S3
scanning transmission electron microscopy (Hitachi, Japan). A volume of 20 µl of the sample
was pipetted onto silicon slice and allowed to dry overnight at room temperature. SEM
samples were conducted at 5 kV, 5 μA.
Evaluation of the contents of fused liposomes. Liposome a, liposome b and liposome c
were mixed together (molar ratio of the liposomes was 3:1:3), the fluorescence (excitation:
520 nm; emission: 580 nm) was measured on a spectrofluorometer. Firstly, the fluorescence
of samples was measured every 60 s for 500 s before UV irradiation. Subsequently, the
samples were irradiated with UV, the variation of fluorescence was monitored every 60 s for
1250 s. After this, a certain amount of HCl was added to the samples and allowed to the pH
value of samples become to 5.0 from 8.0, the fluorescence was obtained every 60 s for 1250 s.
The time dependent fluorescence increase (ΔF) was calculated as: ΔF = Ft- F0, where Ft is the
fluorescence intensity measured at time t, F0 is the fluorescence intensity at t = 0 s.
Enzyme catalysis cascade reaction, polymerization/nicking DNA machinery and
transcription of a mRNA in the fused liposomes protocell. Briefly, 100 μL of mixed
liposomes containing 1:1:1 ratio corresponding liposome were used to follow the
fluorescence changes. The samples were irradiated with UV and the pH value of samples
became into 5.0 from 8.0 by adding HCl into above solution to trigger the process.
The fusion between nanometer-sized liposomes and GUVs. Typically, 100 µL
functionalized GUVs mixed with other two corresponding nanometer-sized liposomes and
incubated for 30 min at room temperature. After incubation, the samples were irradiated with
UV light (3 min) and incubation for 45 min at room temperature, followed by addition of a
certain of HCl to adjust the pH to 5.0 and incubated at room temperature for another 45 min.
Finally, GUVs were directly observed by Zeiss LSM 880 confocal microscope.
S4
Supporting table
Table S1: All DNA sequences used in this work
Name Sequence
1 5’-GGAGAAAGAAGGA-PC-Linker-ACACTATCCTTCTTTCTCCTCCGTCGT
GCCT-Chol-3’
2 5’-Chol-AGGCACGACGGAGGAGAAAGAAGGATAGTGT-3’
3 5’-Chol-AGGCACGACGGACCTCTTTCTTCCT-3’
4 5’-FAM-CGCATCTGTACTGTATTTCAC-Chol-3’
5 5’-TAMRA-CATGCGTAGCTTATCAGACTGATTGATT-3’
P 5’-TCGTAGGATTGATCTAAACT-3’
T 5’-ACTGAAACATGGGTGTAACCTGGTTAATCGCTGAACAGGCTGAGGAG
TTTAGATCAATCCTACGA-3’
S 5’-TAMRA-ACTGAAT/rA/GGAACAG-BHQ2-3’
A 5’-ACATCACTAATACGACTCACTATAGGGGGATCCCGACTGGCGAGAGC
CAGGTAACGAATGGATCCATACTGACAAAGTCAGAAATAGCATAACCCC
TTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG-3’
A’ 5’-CAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTA
TTTCTGACTTTGTCAGTATGGATCCATTCGTTACCTGGCTCTCGCCAGTC
GGGATCCCCCTATAGTGAGTCGTATTAGTGATGT-3’
S5
Supplementary figures: Figure S1-S10
Figure S1. Curve (a): sulforhodamine B fluorescence spectrum of fused (a)+(b)+(c)
liposomes. Curve (b): fluorescence spectrum of sulforhodamine B in the bulk surrounding
solution after chromatographical separation of the fused (a)+(b)+(c) liposomes.
S6
Figure S2. Concentration dependent fluorescence intensity changes of sulforhodamine B.
S7
Figure S3. Temporal fluorescence changes of liposomes system irradiated with UV and
treated at pH = 5.0. In this experiment, liposome (a) and inactive liposomes (b) and (c)
lacking the strand (2) and (3), yet loaded with the sulforhodamine B were irradiated at λ =
365 nm and treatment at pH = 5.0.
S8
Figure S4. Size distribution changes, evaluated by light scattering, upon stepwise fusion
according to Figure 1(B).
S9
Figure S5. Curve (i): time dependent fluorescence changes of the light-induced fusion of
liposomes (a)/(b) in the presence of the separated liposomes (c). Curve (ii): time dependent
fluorescence changes of the light/pH fusion of GOx-loaded (a), glucose-unloaded (b) and
HRP/Amplex Red loaded (c), and glucose 0.25 mM as auxiliary load in the bulk solution.
S10
Figure S6. Zoom out, large-area, confocal microscopy images of the liposomes shown in
Figure 3(B).
S11
Figure S7. Curve (a): sulforhodamine B fluorescence spectrum of fused (a)+(b)+(c)
liposomes after 24 hours keeping in room temperature. Curve (b): fluorescence spectrum of
sulforhodamine B in the bulk surrounding solution after chromatographical separation of the
fused (a)+(b)+(c) liposomes with 24 hours keeping in room temperature.
S12
Figure S8. Temporal fluorescence change of control experiments in polymerization/nicking
machinery synthesizing system as shown in Figure 4. Curve i: control experiment performed
with M1, M2 and M3 where the dNTPs mixture was omitted from M1. Curve ii: control
experiment performed with M1, M2 and M3 where the promoter P was omitted from the
liposome M2. Curve iii: control experiment performed with M1, M2 and M3 where the
Kelnow Fragment polymerase was omitted from the liposome M1. Curve iv: control
experiment performed with M1, M2 and M3 where the Nt.BbvCl nicking enzyme was omitted
from the liposome M1.
Figure S9. Zoom out, large-area, confocal microscopy images of the liposomes shown in
S13
Figure 4(D).
Figure S10. Zoom out, large-area, confocal microscopy images of the liposomes shown in
Figure 5(D).
S14
