AGB 351

Transcription and Translation in

Prokaryotes and Eukaryotes

Stephen Amoah
The cell
 The cell is the basic unit of life
 All living organisms are made up of one or more cells
The plant cell
The Prokaryotic cell
 Prokaryotes are organisms whose cells lack a
membrane-bound nucleus.
 The DNA in a prokaryotic cell is contained in the
central area of the cell called the nucleoid
 Prokaryotic cells are surrounded by a plasma
membrane, but they have no internal membrane-
bound organelles within their cytoplasm
 Many prokaryotes also carry small circular DNA
molecules called plasmids. These are different from
the chromosomal DNA
The Eukaryotic cell
 Eukaryotic cells are larger and more complex in structure
than prokaryotic cells.
 Eukaryotic cells contain true nuclei. The nucleus is
bounded by a nuclear membrane.
 The genetic material, the DNA, is located in the nucleus.
Genome organization
 Nucleosomes
 Chromatin
 Chromosomes
Definitions
 Genes are DNA sequences that are responsible for
making proteins and functional ribonucleic acids (RNAs)

 A protein is one or more polypeptides with specific

amino acid sequence and a specific three-dimensional
structure.

 Gene expression refers to the entire process of

decoding the genetic information of active genes
RNA polymerase
 RNA polymerases are enzymes that catalyse the synthesis of RNA
molecules on a DNA template.

 Promoter
 A defined DNA region at the 5′ end of a gene that binds to
transcription factors and RNA polymerase during the initiation of
transcription.

 Sigma factor
 A subunit of bacterial RNA polymerase needed for transcriptional
initiation and particularly responsible for promoter selection.

 Genetic code
 The correspondence between triplets in DNA (or RNA) and amino
acids in protein
 Transcription Factor (TF)
 Any protein required to initiate or regulate transcription in
eukaryotes.

 Rho factor
 A protein involved in termination of transcription in E. coli

 Open Reading Frame (ORF)

 A DNA sequence of variable length that does not contain a
stop codon and therefore can be translated

 Ribosome
 A large assembly of RNA and proteins that serve as the sites
of protein synthesis
Transcription & Translation
 Transcription is the process of synthesising an RNA on
a DNA template and is catalysed by RNA polymerase.
This is the first step of gene expression.

 Translation is the process of synthesising a protein on

an RNA template.
Transcription & Translation

DNA
5′ 3′
3′ 5′

Transcription
(RNA synthesis)

RNA
5′ 3′

Translation
(Protein synthesis)
PROTEIN
H2N COOH

amino acids
Transcription can be divided into three
steps
1. Initiation:
 involves promoter recognition, transcription factor binding, and
the assembly and orientation of the RNA polymerase complex
at the promoter.

2. Elongation:
 involves the step-by-step addition of nucleotides to the 3´
terminus and may involve editing (i.e. the correction of mis-
incorporated events by cleavage of mispaired nucleotides from
3´).

3. Termination:
 termination step stops the elongation process by dissociating the
transcription complex and releasing the nascent RNA
polymerase
Transcription cycle of a prokaryotic RNA
polymerase
σ actor
RNA 1. RNA polymerase holoenzyme
(core RNA polymerase and a
detachable sigma factor) locates a
7 1
promoter.

2. RNA polymerase unwinds DNA

3. Transcription begins
6 2
4. Initiation phase shifts to elongation
phase. Sigma factor is detached

3 5. Elongation phase continues

5
6. Transcription terminates when
4 RNA polymerase encounters
termination signals

7. RNA is released and the cycle re-

starts
General structure of prokaryotic RNA
polymerase

 The prokaryotic RNA polymerase is made up of four

subunits.

 2 α subunits (α2)
 β subunit
 β′ subunit
 σ subunit

The complete set of the enzyme is called the holoenzyme.

The holoenzyme thus, consists of α2ββ′σ.
The sigma (σ) subunit can be detached from the rest of the
subunits

The core enzyme is made of α2ββ′

- Core enzyme cannot distinguish promoters from other DNA
sequences
- Core enzyme cannot initiate transcription.
Functions of prokaryotic RNA polymerase
subunits

Subunit Function
2 α subunits (α2) Enzyme assembly, promoter recognition,
(40 kD each) interaction with regulatory factors
β subunit (155kD)
β′ subunit (160kD) Catalytic centre
σ subunit (32-90 kD) Promoter recognition and specificity

Note: α, β and β′ have constant sizes in different bacterial species

whiles σ varies more widely between species
Different types of sigma factors exist in
prokaryotes

 A sigma factor can be substituted. This is necessary when

there’s the need to switch between genes

Gene σ Factor Use

rpoD σ70 General
rpoS σS Stress
rpoH σ32 Heat shock
rpoE σE Heat shock
rpoN σ54 Nitrogen starvation
fliA σ28 (σF) Flagella structure
 The general sigma factor (σ70) is required for most of the
transcription in prokaryotes

 Alternative sigma factors σS, σ32, σE, σ70 and σ54 are
activated in response to environmental changes

 Substitution sigma factors causes holoenzymes to

recognise different sets of promoters
 Consensus sequences in the promoter
region of prokaryotes

 Promoter sequences in bacteria are heterogeneous

 Promoter sequences have certain common features which makes

it possible for σ factors to recognise them

 These common features are often summarised in the form of a

consensus sequence.

 In prokaryotes promoters are characterised by two hexameric

DNA sequences, -35 and -10. The names were given based on
their approximate locations relative to the start point of
transcription (designated +1)
 The -10 site is 5′ - TATAAT - 3′. This is commonly
referred to as the TATA box.
 The -35 sequence is 5′ - TATTGACA - 3′.

Promoter region

5’TAGTGTATTGACATGATAGAAGCACTCTACTATAATCTCAATAGGTCCACG 3’
3’ATCACATAACTGTACTATCTTCGTGAGATGATATTAGAGTTATCCAGGTGC 5’
-35 sequence -10 sequence
Frequencies of nucleotide at -10 and -35 promoter regions
Illustration of consensus sequences
Function of the -35 and -10 sequences
 The function of the -35 sequence is to provide the signal
for recognition by RNA polymerase

 The -10 sequence allows the complex to convert from

closed form to open form.

 The exclusive A-T base pairs at the -10 sequence assist in

the initial melting of DNA into single strands
 The -10 site is 5′ - TATAAT - 3′.
 The -35 sequence is 5′ - TATTGACA - 3′.

TAGTGTATTGACATGATAGAAGCACTCTACTATAATCTCAATAGGTCCACG
ATCACATAACTGTACTATCTTCGTGAGATGATATTAGAGTTATCCAGGTGC
-35 sequence -10 sequence
Stages of transcriptional initiation

Holoenzyme

Closed binary complex (DNA remains duplex)

Open binary complex (a short region of the DNA opens

Ternary complex (first two nucleotides incorporated

and phosphodiester bonds formed)

RNA synthesis begins

 Several nucleotides are added up to 9 bases without any
enzyme movement.

 Abortive initiation occurs when this short RNA chain is

released. Enzyme begins again until initiation is successful.

 When initiation succeeds sigma is no longer needed.

 RNA polymerase moves along the DNA as it leaves the

promoter. Promoter clearance time is the time it takes
the RNA polymerase to leave the promoter. This is
generally 1-2 seconds.
 RNA polymerase changes in size as it moves from initiation to
elongation.

What are the roles of -35 and -10

promoter regions?
Transcription elongation
 Transcription elongation constitutes the step-by-step
addition of nucleotides to the 3´ terminus.

 Elongation can pause and re-start

DNA supercoiling during transcription elongation

 Positive supercoiling occurs ahead of the transcription

machinery and refers tightly wound DNA.
 Negative supercoiling occurs behind the transcription
machinery and refers to partially unwound DNA. Negative
supercoiling may help transcription

 For each helical turn traversed by RNA polymerase +1

turn is generated ahead and -1 turn behind

 The enzymes ‘gyrase’ and ‘topoisomerase’ removes

positive and negative supercoils respectively
Positive and negative supercoiling
Transcription termination in prokaryotes
 Once the RNA polymerase has started transcription, the
enzyme moves along the template until it meets a terminator
signal

 The termination step stops the elongation process by

dissociating the transcription complex and releasing the nascent
RNA polymerase

 Termination may require both the recognition of terminator

sequence and the formation of a hairpin structure in the RNA
product.

 Terminator sequence in the transcribed product is responsible

for termination.
Transcription termination
Types of terminators
1. Intrinsic terminators (Rho-independent terminators):
terminates transcription by disrupting RNA-DNA-RNA
polymerase complex without the help of any external
factor. Intrinsic terminators have two structural features
 a hairpin and
 U chain
Intrinsic terminator in prokaryotes
 Rho-dependent terminators

Rho-dependent terminators require

the addition of a Rho-factor: a
hexamer protein that binds to the
nascent RNA to terminate
transcription by disrupting the RNA-
DNA hybrid
Transcription initiation in eukaryotes
In contrast to bacteria eukaryotic nuclei have three types of
RNA polymerases. These are:

 RNA polymerase I
 RNA polymerase II
 RNA polymerase III

TYPE OF POLYMERASE GENES TRANSCRIBED

RNA polymerase I 5.8S, 18S, and 28S rRNA genes
RNA polymerase II all protein-coding genes, plus
snoRNA genes and some snRNA genes
RNA polymerase III tRNA genes, 5S rRNA genes, some
snRNA genes and genes for other small
RNAs