JHARKHAND COUNCIL OF EDUCATIONAL RESEARCH AND TRAINING, RANCHI

ANNUAL EXAM
Session : 2024-25
MODEL QUESTION PAPER

CLASS – XII SUBJECT : ENGLISH CORE Time:3 hrs Marks-80

General Instructions:-

 All questions are compulsory.

 Candidates should answer in their own words as much as possible.
 Total number of questions is 52.
 Question No. 01 to 30 are multiple choice questions, each question has four options.
Select the most appropriate option. Each question carries 01 mark.
 Question numbers 31 to 38 are very short answer type questions. Out of which it is
mandatory to answer any 6 questions. Each question carries 02 marks.
 Question numbers 39 to 46 are short answer type questions. Out of which it is mandatory
to answer any 6 questions. Each question carries 03 marks.
 Question numbers 47 to 52 are long answer type questions. It is mandatory to answer
any 4 questions. Each question carries 05 marks.

MULTIPLE CHOICE QUESTIONS

1. Notice writing is an example of ?
a. Formal communication b. Non Formal communication c. Informal communication d.
Personal communication

2. What is the primary purpose of a notice?

a) To advertise a product b) To provide detailed information about an event or announcement
c) To write a letter to an individual d) To present a formal essay

3.Which of the following should be included in a letter to the editor?

a) Personal background of the writer
b) A clear and concise opinion on the topic being discussed
c) Advertisements or promotions
d) A formal greeting to the audience

4. What did M. Hamel say was the most valuable thing to preserve in the face of adversity?
a) Money
b) Honour
c) The French language
d) Freedom

5.What is the central theme of Lost Spring?

a) The beauty of childhood
b) The harsh reality of child labour and poverty
c) The importance of education for all
d) The significance of family support

6. In Deep Water, why did William Douglas develop a fear of water?

a) He nearly drowned in a lake
b) He was frightened by a strong swimmer
c) He had a traumatic experience at a swimming pool
d) He fell off a boat and was swept away

7. What does the rat trap symbolize in the story The Rat Trap?
a) A desire for wealth
b) The trap of greed and deception
c) The harshness of life
d) The danger of trusting stranger

8. What was the main reason for the success of the Champaran movement in Indigo?
a) The cooperation of local merchants
b) The intervention of the British government
c) The leadership of Mahatma Gandhi and the support of local peasants
d) The involvement of international organizations

9. In Poets and Pancakes, what does the author describe?

a) A poet’s creative process
b) The humuor and irony of life in the film industry
c) The importance of breakfast in a poet's life
d) The cultural significance of pancakes

10.What is the significance of the third level in The Third Level?

a) It represents the escape into a world of fantasy
b) It symbolizes the passage of time
c) It is a metaphor for economic prosperity
d) It is a dangerous underground railway system

11. What amount of money was stolen from the crofter’s pouch?
a. 30 dollars b. 30 kronors c. 30 rupees d. 40 dollars

12. Why was the Tiger King so determined to kill 100 tigers in The Tiger King?
a) To prove his strength to the British rulers
b) To fulfil a prophecy that he would die at the hands of a tiger
c) To showcase his love for wildlife conservation
d) To avenge the death of his father

13.What was the primary purpose of the author's journey in Journey to the End of the Earth?
a) To study the glaciers and the polar ecosystem
b) To research the impact of climate change on the Arctic
c) To experience life in Antarctica
d) To meet indigenous communities in the South Pole

14.What was the dilemma faced by Dr. Sadao in The Enemy?

a) Whether to save the life of an enemy soldier despite being at war
b) Whether to fight for the Japanese army
c) Whether to escape the war and live peacefully
d) Whether to disclose the enemy’s location to his superiors

15.what is the key theme In On the Face of It?

a) The joy of traveling to new places
b) The emotional and physical challenges faced by people with disabilities
c) The importance of self-confidence
d) The bond between family members

16. What decision does Dr. Sadao make at the end of The Enemy?
a) He decides to inform the authorities about the soldier
b) He chooses to send the soldier back to his country
c) He helps the enemy soldier escape, disregarding the consequences
d) He decides to treat the soldier but turns him in to the police

Read the given extract and answer the question.

"A thing of beauty is a joy forever:
Its loveliness increases;
it will never
Pass into nothingness;
but still will keep
A bower quiet for us and a sleep
Full of sweet dreams and health and quiet breathing."

17. The given extract is taken from the poem-

a. Keeping Quiet
b. My Mother at Sixty-six
c. A Thing of Beauty
d. A Roadside Stand

18. What is described as "a joy forever" in the poem?

a) A beautiful memory
b) A thing of beauty
c) A work of art
d) A quiet sleep

19. What feelings does the poet associate with a thing of beauty?
a) Fear and anxiety
b) Sweet dreams, health, and quiet breathing
c) Anger and frustration
d) Sadness and melancholy

20.What does the poet mean by "keeping quiet"?

A) Staying away from people
B) Engaging in productive work
C) Refraining from speaking and taking time for self-reflection
D) Shouting in anger to be heard

21. What does the speaker suggest about the city people who pass by the roadside stand?
A) They are ignorant of the struggles of rural life
B) They are generous and kind
C) They appreciate the art and work of rural people
D) They stop to admire the beauty of the countryside

22. The speaker’s tone in The Roadside Stand can be best described as:
A) Joyful and hopeful
B) Sarcastic and bitter
C) Calm and serene
D) Confused and uncertain

23. How does Charley describe the people and the atmosphere at the third level?
A) They are futuristic and advanced
B) They are wearing old-fashioned clothes, and the streets look like they are from the 19th
century
C) They are from another planet
D) They seem to be living in a war-torn world

24. How many tigers does the Maharaja need to kill to prove the prophecy wrong in The Tiger
King?
A) 100
B) 50
C) 10
D) 99

25.Who are the two main characters in On the Face of It?

A) Derry and Mr. Lamb
B) Derry and his mother
C) Mr. Lamb and his wife
D) Derry and his doctor

26. What advice does Mr. Lamb give to Derry about life in On the Face of It?
A) He should focus on his physical appearance to be accepted
B) He should ignore the opinions of others and focus on the beauty of life
C) He should stay away from people to avoid rejection
D) He should get surgery to fix his disfigurement

27. What happens to the Maharaja’s legacy after his death in The Tiger King?
A) His son becomes a great ruler
B) His kingdom flourishes and becomes famous for its tigers
C) The tiger population increases and flourishes
D) His kingdom is taken over by the British

28.Why did Zitkala hide herself?

a. To save herself
b. To save herself from a women
c. To save herself from other children
d. To stop people from cutting her hair

29. What had hurt Bama in the society?

a. Politics
b. Class students
c. Road shows
d. Practice of Untouchability
30 What does the story The Tiger King suggest about the relationship between power and
pride?
A) Power should always be used wisely
B) Pride leads to self-destruction when abused
C) Power should be used only for personal gain
D) Pride is the most important trait for a ruler

Read the following passage carefully and answer the questions that follow:

The sun was warm but the sea breeze kept up its cooling effect all along. Soon the s teamer
turned away and anchored its gear a creek by the river. The muddy fringe and the mangrove
vegetation declared the gateway to the Bhitarkanika Wildlife Sanctuary in Odisha. The
steamer could not negotiate these creeks at low tide, so a similar motorboat was hired to ferry
us to the Dangmal forest rest-house in the heart of the mangrove forest. From the motorboat
we had a good look at a large crocodile basking in the sun. The boat moved on, taking us
deeper into the forest. Here we felt as though we had stepped into a time warp. In plumage:
this awesome and mysterious place, birds of extraordinary covering a bir phimage appeared
before us. For the moment we revelled in the magnificence of nature which had us completely
in its thrall. Among the birds, the kingfishers were the stars of the show. Crocodiles, large and
small, slid into the water at our approach. Through the foliage we could see chital deer
delicately browsing on fresh outcrops of leaves. A herd of wild boar was spotted searching for
succulent roots. High above us, open-billed storks stood sentry-like following our progress
through their remarkable kingdom. The evening sun was beginning to paint the tree-lined
horizon crimson and gold and a brooding silence enveloped us all.

Answer any six questions 2x6=12

31. Where was the author going?
32. Where was the forest rest-house?
33. How did the group manage to get there?
34. Which creature did they see first?
35. Who were the stars of the show?
36. What does the author mean by the magnificence of nature?
37. How are the kingfishers and the open-billed storks described?
38. What were the chital deer and the wild boar doing when the motorboat went past them?

Read the following passage carefully and answer any six questions that follow: 6x3=18

Jharkhand, located in the eastern part of India, is a state known for its abundant natural
resources, cultural diversity, and scenic landscapes. It was carved out of Bihar in 2000, with
Ranchi as its capital. The state is blessed with a wealth of minerals, forests, and rivers, making
it one of the richest regions in terms of natural resources in the country. Jharkhand is home to
vast coal mines, iron ore, and other valuable minerals, which play a crucial role in India's
economy.

Beyond its natural resources, Jharkhand is a land of diverse tribes and cultures. Over 30
indigenous communities, including the Santhals, Mundas, and Oraons, form a significant part
of the population. These tribal communities have a rich cultural heritage, with distinct
languages, dances, and traditions. Festivals like Sarhul, Karam, and Makar Sankranti are
celebrated with great enthusiasm, reflecting the vibrant traditions of the tribal people.

The state is also known for its dense forests, which cover a large portion of its land. These
forests are not only home to a wide variety of flora and fauna but also provide livelihood to
many tribal communities who depend on forest products for their daily needs. The presence
of rivers like the Damodar, Subarnarekha and Koel adds to the natural beauty of the state,
offering opportunities for agriculture and irrigation.

Despite its natural wealth, Jharkhand faces challenges in terms of infrastructure development,
education, and healthcare. The state’s economy largely depends on mining and agriculture,
which makes it vulnerable to environmental and economic fluctuations. Over the years, the
government has taken steps to improve the state's development, but much work remains to
be done in ensuring equitable growth for all its residents.

39. On the basis of your reading of the above passage make a note on it. You may use
headings, sub-headings, and abbreviations.
40. Write a summary of the above passage in about 80 words.
41. You are Neha/Nikhil, the head boy/girl of RK +2 High school, Chandwa, Latehar. Your
school is organising a visit to Birsa Munda Museum, Ranchi. Write a notice inviting the
students who are willing to join the group in not more than 50 words.
 42. You are Ankur/Ankita, the Secretary of Cultural Club of Govt.+2 High school, Bundu. Write
a notice for your school notice board inviting students to give their names for a district
level Role Play Competition in not more than 50 words.

43. You are Tarun/Taruna, write a letter to the Editor of „The Express‟, Ranchi complaining
about the frequent breakdown in the supply of electricity in your village.
44. The Eco Club of you school organised a Tree plantation Awareness Program me in the
school campus. Write a report in about 80-100 words for the school magazine describing the
event. Sign as Ani/Aniket of Zila+2 High School, Ranchi.
45. Write an article on “ Importance of Yogabhyas in our daily life” or “Global Warming” in
about 80-100 words.
46. Who was Dr. Sadao? Where was his house situated?

Answer any four questions. 4x5=20

47. How did the General react when Sadao informed him about the prisoner of war?
48. What do the parting words “see you soon Amma” of the poetess and her smile signify?
49. What did Charley claim for in „The Third Level‟?
50. Why do rural people make roadside stands?
51. In what conditions do the bangle makers of Firozabad live? Why can‟t they come out of
the state of poverty?
52. What happened to Gondwana 150 million years ago?
 Answer key
Class 12
Subject: English
1. a. Formal communication
2. b) To provide detailed information about an event or announcement
3. b) A clear and concise opinion on the topic being discussed
4. c) The French language
5. b) The harsh reality of child labor and poverty
6. a) He nearly drowned in a lake
7. b) The trap of greed and deception
8. c) The leadership of Mahatma Gandhi and the support of local peasants
9. b) The humor and irony of life in the film industry
10. a) It represents the escape into a world of fantasy
11. b. 30 kronors
12. b) To fulfill a prophecy that he would die at the hands of a tiger
13. c) To experience life in Antarctica
14. a) Whether to save the life of an enemy soldier despite being at war
15. b) The emotional and physical challenges faced by people with disabilities
16. c) He helps the enemy soldier escape, disregarding the consequences
17. c. A Thing of Beauty
18. b) A thing of beauty
19. b) Sweet dreams, health, and quiet breathing
20. C) Refraining from speaking and taking time for self-reflection
21. A) They are ignorant of the struggles of rural life
22. B) Sarcastic and bitter
23. B) They are wearing old-fashioned clothes, and the streets look like they are from the
19th century
24. A) 100
25. A) Derry and Mr. Lamb
26. B) He should ignore the opinions of others and focus on the beauty of life
27. C) The tiger population increases and flourishes
28. d) To stop people from cutting her hair
29. d)Practice of Untouchability
30. B) Pride leads to self-destruction when abused
 झारखण्ड शै क्षिक अनुसध
ं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड
प्रक्षिदशश प्रश्न पत्र - 2024 - 2025
(कला,वाक्षणज्य एवं क्षवज्ञान संकाय )

किा - 12 क्षवषय : क्षिन्दी - आधार समय : 3 घंटे पूणाां क : 80

सामान्य क्षनदे श
● परीक्षार्थी यर्थासंभव निर्देशािुसार अपिे शब्र्दों में उत्तर र्दें।
● सभी प्रश्न अनिवायय हैं।
● कुल प्रश्नों की संख्या 52 है। जो चार खण्डों ( क,ख.ग,घ ) में नवभक्त हैं ।
● खण्ड ‘क’ में प्रश्न संख्या 1 से 30 तक बहु - नवकल्पीय प्रश्न हैं । प्रत्येक प्रश्न के चार नवकल्प नर्दए गए हैं ।
सही नवकल्प का चयि कीनजये। प्रत्येक प्रश्न का माि 1 अंक निर्ायररत है।
● खण्ड ‘ख’ में प्रश्न संख्या 31 से 38 तक अनत लघु उत्तरीय प्रश्न हैं । नजसमें से नकन्ही 6 प्रश्नों का उत्तर र्देिा
अनिवायय है। प्रत्येक प्रश्न का माि 2 अंक निर्ायररत है ।
● खण्ड ‘ग’ में प्रश्न संख्या 39 से 46 तक लघु उत्तरीय प्रश्न हैं । नजसमें से नकन्ही 6 प्रश्नों का उत्तर र्देिा अनिवायय
है। प्रत्येक प्रश्न का माि 3 अंक निर्ायररत है ।
● खण्ड ‘घ’ में प्रश्न सख्ं या 47 से 52 र्दीघय उत्तरीय प्रश्न हैं। नजसमें से नकन्हीं 4 प्रश्नों का उत्तर र्देिा अनिवायय है ।
प्रत्येक प्रश्न का माि 5 अंक निर्ायररत है ।
खण्ड - क
अपक्षिि बोध
क्षनम्नक्षलक्षखि गद्ांश को ध्यानपूवशक पढ़कर क्षदए गए प्रश्नों के क्षलए सिी उत्तर का चयन करें -
सानहत्य समाज का र्दपयण है । यह ि के वल समाज की वास्तनवकता को प्रनतनबंनबत करता है, बनल्क उसमें
पररवतय ि लािे की शनक्त भी रखता है । सानहत्य का उद्देश्य के वल मिोरंजि करिा िहीं होता, बनल्क पाठकों को सोचिे
पर मजबूर करिा, उन्हें सही और गलत का भाि करािा और समाज में सकारात्मक बर्दलाव लािा होता है । कई

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 1 of 11
सानहत्यकारों िे अपिे लेखि के माध्यम से समाज में व्याप्त कुरीनतयों, अंर्नवश्वासों और अन्याय को उजागर नकया है ।
प्रेमचंर्द िे अपिी कहानियों में नकसािों की र्दुर्दयशा का मानमयक नचत्रण नकया, जबनक महार्देवी वमाय िे िारी के
आत्मसम्माि और संघर्य की कहानियों को शब्र्द नर्दए । सानहत्य का प्रभाव तभी सार्थयक होता है, जब वह पाठक के
हृर्दय में संवेर्दिाओ ं को जागृत करे और उसे समाज के प्रनत अपिे कतय व्यों का बोर् कराए ।
1.साक्षित्य का प्रमुख उद्देश्य क्या िोिा िै?
(A) के वल मिोरंजि करिा (B) समाज की वास्तनवकता नर्दखािा और पररवतय ि लािा
(C) इनतहास को सहेजिा (D) के वल ज्ञाि र्देिा
2. प्रे मचंद की किाक्षनयों का मुख्य क्षवषय क्या था?
(A) अंर्नवश्वास (B) िारी स्वतंत्रता
(C) नकसािों की र्दुर्दयशा (D) समाज के अन्याय
3. मिादे वी वमाश ने अपने साक्षित्य में क्षकनके संघषश को क्षचक्षत्रि क्षकया िै?
(A) नकसािों का (B) मनहलाओ ं का
(C) मजर्दूरों का (D) बच्चों का
4. गद्ांश के अनुसार, साक्षित्य को समाज का दपश ण क्यों किा गया िै?
(A) क्योंनक यह समाज की कुरीनतयों को बढावा र्देता है
(B) क्योंनक यह समाज की वास्तनवकता को प्रनतनबनं बत करता है
(C) क्योंनक यह पाठकों को भ्रनमत करता है
(D) क्योंनक यह के वल मिोरंजि का सार्ि है
क्षनम्नक्षलक्षखि पद्ांश को ध्यानपूवशक पढ़कर क्षदए गए प्रश्नों के क्षलए सिी उत्तर का चयन करें -

यह र्रा, यह गगि, यह बनगया हरी,

यह हवा, यह निजा, यह िर्दी की लहर।
सबका जीवि, सबका यह संसार है,
िहीं नकसी का के वल यह अनर्कार है।

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 2 of 11
 पर मािव भूल कर यह गवय करता,
संसार पर अपिा राज समझता।
संसार के संसार्ि जो िष्ट नकए,
तो प्रकृनत िे भी अपिे क्रोर् व्यक्त नकए।

अब समय है, चे त जाएं सब लोग,

िष्ट करें ि यह सुंर्दर र्रती का योग।
प्रकृनत का माि करें , संतुलि बिाए रखें,
तभी यह जीवि, यह र्रा सजीव रह सके

5.पद्ांश के अनुसार, संसार पर अक्षधकार क्षकसका िै?

(A) के वल मिुष्य का (B) सभी जीवों का
(C) प्रकृनत का (D) राजा का
6.पद्ांश में मनुष्य की क्षकस भूल का उल्ले ख क्षकया गया िै?
(A) संतुलि बिाए रखिा (B) संसार पर अनर्कार जतािा
(C) प्रकृनत का सम्माि करिा (D) र्दूसरों की मर्दर्द करिा
7.पद्ांश में प्रकृक्षि के क्रोध का क्या कारण बिाया गया िै?
(A) मिुष्य का सहयोग करिा (B) संसार्िों का िष्ट करिा
(C) सतं ु लि बिाए रखिा (D) प्रकृनत का माि बढािा
8.पद्ांश के अनुसार, धरिी को सजीव रखने के क्षलए क्या करना चाक्षिए?
(A) प्रकृनत का माि करिा और सतं ु लि बिाए रखिा (B) ससं ार्िों को िष्ट करिा
(C) के वल मिुष्य का अनर्कार बिािा (D) र्रती का उपयोग ि करिा

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 3 of 11
 अक्षभव्यक्षि और माध्यम
क्षनम्नक्षलक्षखि प्रश्नों के सिी क्षवकल्प का चयन कीक्षजए -
9. अक्षधसूचना का प्रकाशन किााँ िोिा िै?

(A) सोशल मीनडया पर (B) तार पत्र

(C) समाचार पत्र (D) राजपत्र (गजट)
10. क्षनबन्ध का अक्षं िम भाग क्या किलािा िै ?

(A) पररचय (B) निष्कर्य

(C) नवर्य - नवस्तार (D) प्रस्ताविा
11. पी.टी. आई. क्या िै ?
(A) समाचार एजेंसी (B) गुप्तचर नवभाग
(C) पुनलस (D) सानहनत्यक मंच
12. भारि का पिला छापाखाना किााँ पर लगाया गया ?
(A) नर्दल्ली में (B) कोलकाता में
(C) गोवा में (D) कािपुर में
13. संचार प्रक्षक्रया में आई बाधाओ ं को क्या कििे िैं -

(A) शोर (B) सन्र्देश

(C) माध्यम (D) प्राप्तकत्ताय
14. उल्टा क्षपराक्षमड शै ली का प्रयोग क्षकस ले खन में िोिा िै ?

(A) पत्र (B) निबन्र्

(C) समाचार वाचि (D) समाचार लेखि
15. अखबार की आवाज क्षकसे माना जािा िै ?

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 4 of 11
(A) आलेख (B) िीचर
(C) सपं ार्दकीय (D) पत्र लेखि
16. आले ख के क्षलए अंग्रेजी में कौन सा शब्द प्रयुि िोिा िै ?

(A) िीचर (B) आनटय कल

(C) ररपोटय (D) िोनटस
पाि्यपुस्िक
क्षनम्नक्षलक्षखि गद्ांश को ध्यानपूवशक पढ़कर क्षदए गए प्रश्नों के क्षलए सिी उत्तर का चयन करें -
भनक्ति अच्छी है, यह कहिा कनठि होगा, क्योंनक उसमें र्दुगुयणों का अभाव िहीं । वह सत्यवार्दी हररश्चंद्र िहीं
बि सकती; पर ‘िरो वा कुंजरो वा’ कहिे में भी नवश्वास िहीं करती । मेरे इर्र-उर्र पडे पैसे-रुपये, भंडार-घर की नकसी
मटकी में कै से अंतरनहत हो जाते हैं, यह रहस्य भी भनक्ति जािती है । पर, उस संबंर् में नकसी के संकेत करते ही वह
उसे शास्त्रार्थय के नलए चुिौती र्दे डालती है, नजसको स्वीकार कर लेिा नकसी तकय -नशरोमनण के नलए सभं व िहीं यह
उसका अपिा घर ठहरा, पैसा-रुपया जो इर्र-उर्र पडा र्देखा, सँभालकर रख नलया । यह क्या चोरी है! उसके जीवि
का परम कतय व्य मुझे प्रसन्ि रखिा है-नजस बात से मुझे क्रोर् आ सकता है, उसे बर्दलकर इर्र-उर्र करके बतािा, क्या
झठू है! इतिी चोरी और इतिा झठू तो र्मयराज महाराज में भी होगा।िहीं तो वे भगवाि जी को कै से प्रसन्ि रख सकते
और संसार को कै से चला सकते !
शास्त्र का प्रश्न भी भनक्ति अपिी सुनवर्ा के अिुसार सुलझा लेती है । मुझे नस्त्रयों का नसर घुटािा अच्छा िहीं
लगता, अतः मैंिे भनक्ति को रोका । उसिे अकुंनठत भाव से उत्तर नर्दया नक शास्त्र में नलखा है । कुतूहलवश मैं पूछ ही
बैठी-‘क्या नलखा है?’ तुरंत उत्तर नमला-‘तीरर्थ गए मुँडाए नसद्ध ।’ कौि-से शास्त्र का यह रहस्यमय सूत्र है, यह जाि
लेिा मेरे नलए संभव ही िहीं र्था । अतः मैं हारकर मौि हो रही और भनक्ति का चूडाकमय हर बहृ स्पनतवार को, एक र्दररद्र
िानपत के गंगाजल से र्ुले उस्तरे द्वारा यर्थानवनर् निष्पन्ि होता रहा ।

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 5 of 11
17. उपयशु ि अनुच्छे द क्षकसके बारे में िैं?

(A) लेनखका (B) भनक्ति

(C) तकय -नशरोमनण (D) शास्त्र
18.भक्षिन क्षकस रिस्य के बारे में पूछे जाने पर वि शास्त्राथश की चुनौिी दे डालिी िैं?
(A) उसे खािा बिािा आता है, इसके बारे में पूछे जािे पर
(B) वह अपिी मिमािी क्यों करती है, इसके बारे में पछ
ू े जािे पर
(C) चोरी के पैसे कहाँ और कै से रखती है, इसके बारे में पूछे जािे पर
(D) पढाई-नलखाई के बारे में पूछे जािे पर
19. इधर-उधर क्षबखरे रुपये -पै सों का भक्षिन जो कुछ करिी िैं, िम उसे चोरी मानें गे। क्यों?
(A) वह घर में सेनवका है। उसका अनर्कार घर की नकसी वस्तु पर िहीं है
(B) पैसे या अन्य सामाि नमलिे पर उसका र्दानयत्व यह है नक वह उि चीजों को घर के मानलक को र्दे
(C) घर की नकसी वस्तु पर सेवक / सेनवका का स्वानमत्व िहीं होता
(D) उपयुयक्त सभी
20. भक्षिन का परम किशव्य क्या था?
(A) लेनखका को हर प्रकार से खुश रखिा (B) लेनखका को अच्छा खािा बिा कर नखलािा
(C) लेनखका के सभी कायय करिा (D) लेनखका को सुबह जल्र्दी उठािा

क्षनम्नक्षलक्षखि पद्ांश को ध्यानपूवशक पढ़कर क्षदए गए प्रश्नों के क्षलए सिी उत्तर का चयन करें -
मैं जग-जीवि का भार नलए निरता हँ,
निर भी जीवि में प्यार नलए निरता हँ!
कर नर्दया नकसी िे झंकृत नजिको छूकर
मैं साँसों के र्दो तार नलए निरता हँ!
मैं स्िेह-सुरा का पाि नकया करता ह,ँ

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 6 of 11
 मैं कभी ि जग का ध्याि नकया करता हँ,
जग पूछ रहा उिको, जो जग की गाते ,
मैं अपिे मि का गाि नकया करता हँ!
21. ‘मैं जग-जीवन का भार क्षलए क्षिरिा ि’ाँ पंक्षि से कक्षव का क्या िात्पयश िै?
(A) जीवि में भरी भरकम काम करिा (B) जीवि में नजम्मेर्दाररयों का बोझ उठािा
(C) सम्पूणय संसार की कनठिाइयों को उठािा (D) जीवि का कष्टों से नघरा होिा
22. अपनी क्षजम्मे दाररयों के बोझ को उिािे िएु भी कक्षव क्या कर ले िा िै?

(A) सभी से अच्छे से बात कर लेता है (B) सभी को अपिे सार्थ नलए निरता है
(C) अपिे जीवि से प्रेम करता है (D) अपिे जीवि की नजम्मेर्दाररयों से प्रेम करता है
23. स्ने ि-सुरा में कौन सा अलंकार िै?
(A) रूपक अलक
ं ार (B) अिप्रु ास अलक
ं ार
(C) उत्प्रेक्षा अलक
ं ार (D) मािवीकरण अलक
ं ार
24. ‘जग पूछ रिा उनको, जो जग की गािे’ से कक्षव क्या किना चाििे िैं?

(A) संसार उि लोगों की स्तुनत करता है जो संसार के अिुसार चलते हैं

(B) संसार का गुणगाि करिे से आर्ी समस्याएँ समाप्त हो जाती है
(C) संसार के लोग संसार का ही गुणगाि करते हैं
(D) ससं ार में रहकर ससं ार की स्तुनत करिा आवश्यक हो जाता है
क्षनम्नक्षलक्षखि प्रश्नों के सिी क्षवकल्प का चयन कीक्षजए -
25. भक्षिन मिादे वी वमाश से क्षकिने वषश बड़ी थी ?
(A) 20 (B) 25
(C) 27 (D) 30

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 7 of 11
26. क्षकसकी गमी बाजार से अक्षधक सामान खरीदने पर क्षववश करिी िै?

(A) मौसम की (B) नर्दमाग की

(C) पत्िी की (D) पैसे की
27. ‘बििु नीला शंख जै से’ में कौन सा अलंकार िै?
(A) अिुप्रास (B) रूपक
(C) उपमा (D) श्ले र्
28. बादल राग कक्षविा में कक्षव बादल का आह्वान क्षकस रूप में करिा िै ?

(A) वर्ाय (B) क्रांनत

(C) शांनत (D) मजबूरी
29. ‘जूझ’ पाि के ले खक कौन िै ?

(A) आिंर्द गुप्ता (B) आिंर्द यार्दव

(C) आिंर्द नसंह (D) आिंर्द श्रीवास्तव
30. ऐन फ्रैंक की बड़ी बिन का क्या नाम था ?

(A) नकट्टी (B) नबट्टी

(C) मागोट (D) बेप
खण्ड - ख
( अक्षि लघु उत्तरीय प्रश्न )
क्षनम्नक्षलक्षखि में से क्षकन्िी छि प्रश्नों के उत्तर दें - 2 x 6 = 12

31. कस्टम अनर्कारी िे सनिया की बात सुिकर क्या नकया ?

32. कानलर्दास को लेखक िे क्या कहा है ?

33. र्मयवीर भारती अर्थवा सूययकांत नत्रपाठी निराला की र्दो रचिाओ ं के िाम नलखें ?

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 8 of 11
34. बच्चे नकस बात की आशा से िीडों से झांक रहे होंगे ?

35. कनव के अिुसार कनवता क्या है ?

36. बच्चा कब नखलनखला कर हँस पडता है ?

37. यशोर्र बाबू िे नकस स्कूल से मैनिक की परीक्षा पास की र्थी ?

38. ऐि फ्रैंक का पररवार कहाँ छुपिे वाला र्था ?

खण्ड - ग
( लघु उत्तरीय प्रश्न )
क्षनम्नक्षलक्षखि में से क्षकन्िी छि प्रश्नों के उत्तर दें - 3 x 6 = 18

39. लेखक के मत से र्दासता की व्यापक पररभार्ा क्या है ?

40. ढोलक की आवाज का पुरे गाँव पर क्या असर होता र्था ?

41. भनक्ति के आ जािे से महार्देवी अनर्क र्देहाती कै से हो गई ?

42. शोकग्रस्त माहौल में हिुमाि के अवतरण को करुण रस के बीच वीर रस का आनवभायव क्यों कहा गया है ?

43. कनवता के नकि उपमािों को र्देखकर यह कहा जा सकता है नक उर्ा कनवता गाँव की सुबह का गनतशील शब्र्द
नचत्र है ?

44. कै मरे में बंर्द अपानहज करुणा के मुखौटे में नछपी कूरता कनवता है - नवचार कीनजए I

45. नसंर्ु सभ्यता सार्ि संपन्ि र्थी, पर उसमें भव्यता का आडंबर िहीं र्था I कै से ?

46. स्वयं कनवता रच लेिे का आत्मनवश्वाश लेखक के मि में कै से पैर्दा हुआ ?

खण्ड - घ
( दीघश उत्तरीय प्रश्न )
क्षनम्नक्षलक्षखि में से क्षकन्िी िीन प्रश्नों के उत्तर दें - 5 x 4 = 20

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 9 of 11
47. ‘लोकित्रं में मीक्षडया की भक्षू मका’ अर्थवा ‘नारी सशक्षिकरण’ नवर्य पर एक निबन्र् नलखें

48. आपके शहर में मनहलाओ ं के सार्थ बढते अपरार्ों के कारण मनहलाओ ं की सुरक्षा एक बडी नचंता बि गई है।
आप समाचार पत्र के सपं ार्दक को पत्र नलखकर इस समस्या के समार्ाि के नलए सरकार से सख्त काििू और ठोस
कर्दम उठािे की अपील करें ।

49. प्रनतवेर्दि नलखते समय नकि बातों का ध्याि रखा जािा चानहए ?

50. जिसंचार के प्रमुख कायय कौि से हैं ?

51. समाचार को पररभानर्त करते हुए उसके तत्वों पर प्रकाश डालें ?

क्षनम्नक्षलक्षखि में से क्षकसी एक का काव्य सौन्दयश क्षलक्षखए -
52.

(क ) सचमचु मझु े र्दडं र्दो नक भल

ू ँू मैं भल
ू ँू मैं
तुम्हें भूल जािे की
र्दनक्षण ध्रुवी अंर्कार-अमावस्या
शरीर पर, चे हरे पर, अंतर में पा लूँ मैं
झेलँू मैं, उसी में िहा लँू मैं
इसनलए नक तुमसे ही पररवेनष्टत आच्छानर्दत
रहिे का रमणीय यह उजेला अब
सहा िहीं जाता हैं।
िहीं सहा जाता है।

(ख ) र्ूत कहौ, अवर्ूत कहौ, राजपूत कहौ, जोलहा कहौ कोऊ।

काह की बेटी सों बेटा ि ब्याहब, काह की जानत नबगार ि सोऊ।।
तुलसी सरिाम गुलामु हैं राम को, जाको रुचै सो कहै कछु ओऊ।
माँनग कै खैबो, मसीत को सोइबो, लैबोको एकु ि र्दैबको र्दोऊ।।

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 10 of 11
 झारखण्ड शै क्षिक अनुसध
ं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड

प्रक्षिदशश प्रश्न पत्र - 2024 - 2025

उत्तर - कुंजी

किा : 12 क्षवषय : क्षिंदी - आधार खण्ड - क (बिु - क्षवकल्पीय)

प्रश्न संख्या उत्तर प्रश्न संख्या उत्तर

1 B 16 B
2 C 17 B
3 B 18 C
4 B 19 D
5 B 20 A
6 B 21 B
7 B 22 C
8 A 23 A
9 D 24 A
10 B 25 B
11 A 26 D
12 C 27 C
13 A 28 B
14 D 29 B
15 C 30 C

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 11 of 11
 झारखण्ड शै क्षिक अनुसध
ं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड
प्रक्षिदशश प्रश्न पत्र - 2024 - 2025
(कला,वाक्षणज्य एवं क्षवज्ञान संकाय )
किा : 12 क्षवषय : क्षिन्दी - ऐक्षछिक समय : 3 घंटे पूणाां क : 80

सामान्य क्षनदे श
● परीक्षार्थी यर्थासंभव निर्देशािुसार अपिे शब्र्दों में उत्तर र्दें।
● सभी प्रश्न अनिवायय हैं।
● कुल प्रश्नों की संख्या 52 है। जो चार खण्डों ( क, ख, ग,घ ) में नवभक्त हैं ।
● खण्ड ‘क’ में प्रश्न 1 से 30 तक बहु - नवकल्पीय प्रश्न हैं। प्रत्येक प्रश्न के चार नवकल्प नर्दए गए हैं। सही
नवकल्प का चयि कीनजये। प्रत्येक प्रश्न का माि 1 अंक निर्ायररत है।
● खण्ड ‘ख’ में प्रश्न सख्ं या 31 से 38 तक अनत लघु उत्तरीय प्रश्न हैं। नजसमें से नकन्ही 6 प्रश्नों का उत्तर र्देिा
अनिवायय है। प्रत्येक प्रश्न का माि 2 अंक निर्ायररत है।
● खण्ड ‘ग’ में प्रश्न संख्या 39 से 46 तक लघु उत्तरीय प्रश्न है। नजसमें से नकन्ही 6 प्रश्नों का उत्तर र्देिा अनिवायय
है। प्रत्येक प्रश्न का माि 3 अक
ं निर्ायररत है।
● खण्ड ‘घ’ में प्रश्न संख्या 47 से 52 र्दीघय उत्तरीय प्रश्न है। नजसमें से नकन्हीं 4 प्रश्नों का उत्तर र्देिा अनिवायय है।
प्रत्येक प्रश्न का माि 5 अंक निर्ायररत है।

खण्ड - क
अपक्षिि बोध
क्षनम्नक्षलक्षखि गद्ांश को ध्यानपूवशक पढ़कर क्षदए गए प्रश्नों के क्षलए सिी उत्तर का चयन करें -

प्रकृनत हमारे जीवि का आर्ार है, लेनकि वतय माि समय में इसका अत्यनर्क र्दोहि हो रहा है। पेड़-पौर्ों की अंर्ार्ुंर्
कटाई, जल और वायु प्रर्दूषण, तर्था औद्योनगक नवकास िे पयायवरण को गंभीर क्षनत पहुंचाई है। इसका र्दुष्पररणाम ि
के वल वतय माि पीढी बनल्क आिे वाली पीनढयों को भी भुगतिा पड़ेगा।
हमारी नजम्मेर्दारी है नक हम प्रकृनत के सार्थ सामंजस्य स्र्थानपत करें और संसार्िों का नववेकपूणय उपयोग करें ।

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 1 of 11
हमें यह समझिा होगा नक प्रकृनत का संतुलि बिाए रखिा ि के वल हमारे स्वास््य बनल्क पूरे पाररनस्र्थनतकी तंत्र के
नलए अनिवायय है।

1. प्रकृक्षि का अत्यक्षधक दोिन क्षकसके कारण िो रिा िै?

(A) तकिीकी प्रगनत और औद्योनगक नवकास (B) नशक्षा का अभाव

(C) कृनष का नवकास (D) वैज्ञानिक अिुसंर्ाि

2. पयाश वरण को नुकसान क्षकस प्रकार पिच
ाँ रिा िै?

(A) संसार्िों का नववेकपूणय उपयोग करके (B) जल और वायु प्रर्दूषण से

(C) अनर्क पौर्ारोपण करके (D) सामूनहक प्रयासों से

3. प्रकृक्षि के संरिण का मुख्य उद्देश्य क्या िै?

(A) आनर्थयक लाभ प्राप्त करिा

(B) पाररनस्र्थनतकी तंत्र का संतुलि बिाए रखिा

(C) वैज्ञानिक शोर् को बढावा र्देिा

(D) प्राकृनतक ससं ार्िों का र्दोहि करिा

4. पयाश वरण सिं ल

ु न बनाए रखने के क्षलए मनुष्य को क्या करना चाक्षिए?

(A) विों की कटाई को बढावा र्देिा

(B) औद्योनगक नवकास को प्रोत्सानहत करिा

(C) प्रकृनत के सार्थ सामंजस्य स्र्थानपत करिा

(D) प्राकृनतक संसार्िों का असीनमत उपयोग करिा

क्षनम्नक्षलक्षखि पद्ांश को ध्यानपूवशक पढ़कर क्षदए गए प्रश्नों के क्षलए सिी उत्तर का चयन करें -

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 2 of 11
 प्ृ वी पर मािव का जीवि,
है प्रकृनत की अिुपम र्देि।
वक्षृ , िर्दी, पवयत, सागर,
सबमें बसता सनृ ि का जति।

यनर्द करें गे हम इिका र्दोहि,

खो र्देंगे सब स्वाभानवक र्ि।
सोच समझ कर कर्दम उठाएं,
तभी बचे गी र्रती जि जि।

5. पद्ांश के अनुसार, पृथ्वी पर मानव का जीवन क्षकसकी दे न िै?

(A) तकिीकी नवकास (B) प्रकृनत की अिुपम र्देि

(C) मािव की मेहित (D) नवज्ञाि का योगर्दाि

6. पद्ांश में क्षकसे सक्षृ ि का जिन बिाया गया िै?

(A) तकिीक और नवज्ञाि (B) वक्षृ , िर्दी, पवयत और सागर

(C) नशक्षा और ज्ञाि (D) समाज और पररवार

7. पद्ांश के अनुसार, यक्षद प्रकृक्षि का दोिन क्षकया गया िो क्या िोगा?

(A) प्ृ वी का स्वाभानवक र्ि खो जाएगा (B) नवज्ञाि का नवकास रुक जाएगा

(C) समाज में खुशहाली आएगी (D) मिुष्य का स्वास््य सुर्रे गा

8. धरिी को बचाने के क्षलए पद्ांश में क्या सुझाव क्षदया गया िै?

(A) सोच-समझकर कर्दम उठािे का (B) औद्योनगक नवकास बढािे का

(C) नवज्ञाि पर अनर्क निभयर रहिे का (D) प्राकृनतक संसार्िों का अनर्क उपयोग करिे का

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 3 of 11
 अक्षिव्यक्षि और माध्यम

क्षनम्नक्षलक्षखि प्रश्नों के सिी क्षवकल्प का चयन कीक्षजए -

9 . व्यक्षिगि पत्र क्षकस प्रकार का पत्र िै?

(A) औपचाररक (B) अिौपचाररक

(C) व्यावसानयक (D) सामानजक

10. रचनात्मक ले खन में सबसे मित्वपूणश गुण क्या िै?

(A) शब्र्दों का सही उच्चारण (B) कल्पिाशीलता और सजृ िात्मकता

(C) त्यात्मकता (D) लेखि की गनत

11. मुक्षिि माध्यम का सबसे मित्वपूणश ित्व क्या िै?

(A) संवार्द (B) दृश्य

(C) लेखि (D) ध्वनि

12. इले क्रॉक्षनक माध्यम में कौन सा प्रमुख उपकरण आिा िै?

(A) पस्ु तक (B) रे नडयो

(C) पोस्टर (D) समाचार पत्र

13 . 'सामूक्षिक संचार' का मुख्य उद्देश्य क्या िै?

(A) नशक्षा प्रर्दाि करिा (B) मिोरंजि करिा

(C) सूचिा र्देिा (D) उपरोक्त सभी

14 . इंटरने ट क्षकस प्रकार का संचार माध्यम िै?

(A) पारंपररक माध्यम (B) नडनजटल माध्यम

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 4 of 11
 (C) दृश्य माध्यम (D) मुनित माध्यम
15. टीवी पर समाचार क्षकस माध्यम का उदािरण िै?

(A) मनु ित (B) श्रव्य

(C) दृश्य-श्रव्य (D) नडनजटल

16. समाचार पत्र का सबसे बडा लाि क्या िै?

(A) सस्ता होिा (B) हमेशा उपलब्र् रहिा

(C) नवस्तृत जािकारी र्देिा (D) सभी सही हैं

पाि्यपुस्िक
क्षनम्नक्षलक्षखि गद्ांश को ध्यानपूवशक पढ़कर क्षदए गए प्रश्नों के क्षलए सिी उत्तर का चयन करें -

"कुटज क्या के वल जी रहा है । वह र्दूसरे के द्वार पर भीख मााँगिे िहीं जाता, कोई निकट आ गया तो भय के
मारे अर्मरा िहीं हो जाता, िीनत और र्मय का उपर्देश िहीं र्देता निरता, अपिी उन्िनत के नलए अिसरों का जूता िहीं
चाटता निरता, र्दसू रों को अवमानित करिे के नलए ग्रहों की खश ु ामर्द िहीं करता । आत्मोन्िनत हेतु िीलम िहीं र्ारण
करता, अाँगूनठयों की लड़ी िहीं पहिता, र्दााँत िहीं निपोरता, बगलें िहीं झााँकता । जीता है और शाि से जीता है-काहे
वास्ते नकस उद्देश्य से? कोई िहीं जािता । मगर कुछ बड़ी बात है । स्वार्थय के र्दायरे से बाहर की बात है । भीष्म नपतामह
की भााँनत अवर्ूत की भाषा में कह रहा है-‘चाहे सुख हो या र्दुःु ख, नप्रय हो या अनप्रय’ जो नमल जाए उसे शाि के सार्थ,
हृर्दय से नबल्कुल अपरानजत होकर, सोल्लास ग्रहण करो । हार मत मािो ।"

17. कुटज के बारे में ले खक ने क्या बिाया िै?

(A) कुटज अपिी उन्िनत के नलए र्दूसरों से मर्दर्द मांगता है

(B) कुटज शाि से जीता है और अपिे कतय व्यों को निभाता है

(C) कुटज नकसी के द्वार पर भीख मांगता है

(D) कुटज के वल खश
ु ामर्द करता है

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 5 of 11
18. ले खक के अनुसार कुटज क्षकस िरि से जीिा िै?

(A) वह अिसरों का जूता चाटता है

(B) वह र्दसू रों को अवमानित करता है

(C) वह शाि से और नबिा नकसी स्वार्थय के जीता है

(D) वह ग्रहों की खुशामर्द करता है

19. गद्ांश में कुटज का जीवन क्षकस प्रकार के क्षसद्ांिों से प्रे ररि िै?

(A) स्वार्थय और अपमाि के नसद्ांत (B) िीनत, र्मय और शाि के नसद्ांत

(C) र्दूसरों को िीचा नर्दखािे के नसद्ांत (D) भव्यता और महत्त्वाकांक्षा के नसद्ांत

20. ले खक ने िीष्म क्षपिामि और अवधूि की िाषा में क्या संदेश क्षदया िै?

(A) के वल सुख और नप्रय को ही स्वीकार करिा चानहए

(B) सुख या र्दुुःख, नप्रय या अनप्रय जो भी नमले, उसे शाि से स्वीकार करिा चानहए

(C) जीवि में के वल सिलता को स्वीकार करिा चानहए

(D) के वल अपिी उन्िनत के नलए जीिा चानहए

क्षनम्नक्षलक्षखि पद्ांस को ध्यानपूवशक पढ़कर क्षदए गए प्रश्नों के क्षलए सिी उत्तर का चयन करें -

श्रनमत स्वप्ि की मर्ुमाया में,

गहि-नवनपि की तरु-छाया में,
पनर्थक उिींर्दी श्रुनत में नकसिे- यह नवहाग की ताि उठाई ।
लगी सतृष्ण र्दीठ र्थी सबकी, रही बचाए निरती कबकी ।
मेरी आशा आह! बावली, तूिे खो र्दी सकल कमाई ।

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 6 of 11
21. "श्रक्षमि स्वप्न की मधुमाया" का क्या अर्श िै?

(A) सपिा जो सच्चा होता है (B) सपिा जो भ्रम और उलझि में बर्दल जाता है

(C) सपिा जो के वल खनु शयों का प्रतीक होता है (D) सपिा जो कनठिाई से बाहर निकलता है
22. "मे री आशा आि! बावली, िूने खो दी सकल कमाई" पंक्षि में कक्षव क्षकसकी आलोचना कर रिे िैं?

(A) अपिी मेहित की (B) अपिी सिलता की

(C) अपिी आशा की (D) अपिी असिलता की

23. "गिन-क्षवक्षपन की िरु-िाया में " का क्या अर्श िै?

(A) अंर्ेरे में नघरी हुई कनठिाइयााँ (B) सुख-सुनवर्ाओ ं से भरी जगह

(C) जीवि की उज्जवलता (D) र्दरू वती सुख

24. प्रस्िुि पद्ांश क्षकस पाि से क्षलया गया िै ?

(A) कािेनलया का गीत (B) र्देवसेिा का गीत

(C) बिारस (D) बसंत आया

क्षनम्नक्षलक्षखि प्रश्नों के सिी क्षवकल्प का चयन कीक्षजए -

25. मुि िंद के प्रविशक कक्षव कौन माने गए िैं ?

(A) सूययकांत नत्रपाठी निराला (B) सुनमत्रािंर्दि पंत

(C) महार्देवी वमाय (D) जयशक

ं र प्रसार्द

26. क्षकस शिर में वसिं अचानक आिा िै?

(A) पटिा (B) गुजरात

(C) हैर्दराबार्द (D) बिारस

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 7 of 11
27. ‘प्रे मघन की िाया स्मक्षृ ि’ क्षनबन्ध क्षकस शै ली में क्षलखा गया िै?

(A) नवचारात्मक (B) आलोचिात्मक

(C) सस्ं मरणात्मक (D) नववरणात्मक

28. िरगोक्षबन और बडी बिररया क्षजस गााँव में रििे र्े उसका क्या नाम र्ा?

(A) जलालगढ (B) कनटहार

(C) बरौिी (D) खगनड़या

29. ‘सूरदास की झोंपडी’ क्षकस उपन्यास का अंश िै?

(A) कमयभूनम (B) गबि

(C) रंगभूनम (D) सेवासर्दि

30. ‘क्षबस्कोिर की माटी’ पाि के ले खक कौन िैं ?

(A) नवष्णु शमाय (B) के शवर्दास

(C) नवश्विार्थ नत्रपाठी (D) प्रभाष जोशी

खण्ड - ख
( अक्षि लघु उत्तरीय प्रश्न )

क्षनम्नक्षलक्षखि में से क्षकन्िी िि प्रश्नों के उत्तर दें - 2 x 6 = 12

31. स्कंर्दगुप्त नकसका सपिा र्देखते र्थे?

32. ‘गीत गािे र्दो मुझे’ कनवता की भाषा क्या है?

33. नहमालय नकर्र है यह प्रश्न नकसिे नकससे पूछा?

34. ‘कच्चा नचट्टा’ पाठ में गााँव वालों िे उपवास क्यों रखा?

35. भीष्म साहिी की पंनडत िेहरू जी से भेंट कहााँ हुई र्थी?

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 8 of 11
36. ब्यालू का क्या अर्थय होता हैं ?

37. जगर्र ते ल की नमठाई को क्या कहकर बेचता है?

38. रघवु ीर सहाय अर्थवा प्रभाष जोशी की नकन्ही र्दो रचिाओ ं के िाम बताएं?
खण्ड - ग
( लघु उत्तरीय प्रश्न )

क्षनम्नक्षलक्षखि में से क्षकन्िी िि प्रश्नों के उत्तर दें - 3 x 6 = 18

39. कािेनलया का गीत में नकसका मािवीकरण नकया गया है?

40. कनव िे अपिी पुत्री का तपयण नकस प्रकार नकया?

41. “सागर’ और ‘बूाँर्द’ से कनव का क्या आशय है?

42. बड़ी हवेली से बुलावा आिे पर हरगोनबि के मि में नकस प्रकार की आशंका हुई ?

43. आर्ुनिक भारत के ‘िए शरणार्थी’ नकन्हें कहा गया है?

44. कश्मीर के लोगों िे िेहरू जी का स्वागत नकस प्रकार नकया?

45. शेर के महंु और रोजगार के र्दफ्तर के बीच क्या अतं र है?

46. झोंपड़ी में लगी आग में सब कुछ जलकर राख हो गया र्था लेनकि निर भी सूरर्दास राख में रुपए क्यों खोजता है?
खण्ड - घ
( दीघश उत्तरीय प्रश्न )

क्षनम्नक्षलक्षखि में से क्षकन्िी चार प्रश्नों के उत्तर दें - 5 x 4 = 20

47. ‘झारखण्ड की संस्कृक्षि’ अर्थवा ‘क्षवज्ञान अक्षिशाप या वरदान’ पर एक निबंर् नलनखए ।

48. नकसी र्दैनिक समाचार पत्र के संपार्दक को पत्र नलखकर अपिे क्षेत्र में नबजली नवतरण की कुव्यवस्र्था की ओर

नबजली अनर्काररयों का ध्याि आकनषयत कीनजए ।

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 9 of 11
49. प्रर्ािाध्यापक को नवद्यालय में खेल सामग्री की व्यवस्र्था हेतु एक आवेर्दि पत्र नलनखए ।

50. जिसंचार के प्रमुख कायय कौि - कौि से हैं ?

51. नवद्यालय में सम्पन्ि वानषयकोत्सव पर एक प्रनतवेर्दि तै यार करें ?

क्षनम्नक्षलक्षखि में से क्षकसी एक का काव्य - सौन्दयश क्षलक्षखए -

52.
(क) जििी निरखनत बाि र्िुनहयााँ।

बार-बार उर िैिनि लावनत प्रभुजू की लनलत पिनहयााँ ॥

कबहुाँ प्रर्थम ज्यों जाइ जगावनत कनह नप्रय बचि सवारे ।

“उठहु तात! बनल मातु बर्दि पर, अिुज सखा सब द्वारे ॥”

(ख) तब तो छनब पीवत जीवत है, अब सोचि लोचि जात जरे ।

नहत-तोष के तोष सु प्राि पले, नवललात महा र्दुुःख र्दोष भरे ।

घिआिाँर्द मीत सुजाि नबिा, सब ही सुख-साज-समाज टरे ।

तब हार पहार से लागत हे, अब आनि के बीच पहार परे ॥

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 10 of 11
 झारखण्ड शै क्षिक अनुसध ं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड
प्रक्षिदशश प्रश्न पत्र - 2024 - 2025
उत्तर - कुंजी
किा : 12 क्षवषय : क्षिंदी - ऐक्षछिक खण्ड : क (बि - क्षवकल्पीय प्रश्न )

प्रश्न संख्या उत्तर प्रश्न संख्या उत्तर

1 A 16 D
2 B 17 B
3 B 18 C
4 C 19 B
5 B 20 B
6 B 21 B
7 A 22 C
8 A 23 A
9 A 24 B
10 A 25 A
11 C 26 D
12 B 27 C
13 D 28 A
14 B 29 C
15 C 30 C

झारखण्ड शैक्षिक अनुसधं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 – 2025 Page 11 of 11
 झारखण्ड शै क्षिक अनुसध
ं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड
प्रक्षिदशश प्रश्न पत्र - 2024 - 2025
(कला,वाक्षणज्य एवं क्षवज्ञान संकाय )

किा : 12 क्षवषय : क्षिन्दी - बी समय : 1 घंटा 30 क्षमनट पूणाां क : 40

सामान्य क्षनदे श
● परीक्षार्थी यर्थासंभव निर्देशािुसार अपिे शब्र्दों में उत्तर र्दें ।
● सभी प्रश्न अनिवायय हैं ।
● प्रश्नपत्र के र्दो खण्ड हैं - खण्ड - ‘क’ एवं खण्ड - ‘ख’
● खण्ड ‘क’ में 15 अंक के बहु - नवकल्पीय प्रश्न हैं।
● खण्ड ‘ख’ में 25 अंक के नवषयनिष्ठ प्रश्न हैं।

खण्ड – ‘क’
बिु - क्षवकल्पीय
1. क्षनम्नक्षलक्षखि प्रश्नों के सिी क्षवकल्प का चयन कीक्षिए -

(क) गोक्षपयों को छोड़कर कृष्ण किााँ चले गए थे ?

(A) वन्ृ र्दावि (B) मर्थुरा

(C) ब्रज (D) द्वारका

(ख) राम - लक्ष्मण - परशुराम संवाद पाठ के रचक्षयिा िैं -

(A) कबीरर्दास (B) तुलसीर्दास

झारखण्ड शैक्षिक अनस

ु धं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 - 2025 Page 1 of 6
 (C) सूरर्दास (D) कुम्भिर्दास

(ग) प्राि: काल िोने पर बालक रूपी बसंि को कौन िगािा िै ?

(A) कौवा (B) मोर

(C) तोता (D) गुलाब

(घ) उत्साि कक्षविा में कक्षव ने क्षकसको संबोक्षधि क्षकया िै ?

(A) नबजली को (B) धरती को

(C) आकाश को (D) बार्दल को

(ङ) कक्षव के अनुसार कौन सााँस ले िा िै िो घर भर िािा िै ?

(A) कनव (B) लेखक

(C) फागुि (D) धरती

(च) फसल क्षकसका गुणधमश िै ?

(A) नमट्टी का (B) पािी का

(C) नकसाि का (D) हार्थ का

(छ) चााँदनी क्षकसका प्रिीक िै ?

(A) प्रकाश का (B) ज्ञाि का

(C) शांनत का (D) सुख की घनियों का

झारखण्ड शैक्षिक अनस

ु धं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 - 2025 Page 2 of 6
 (ि) मूक्षिश को प्रक्षिक्षदन चश्मा कौन पिनािा था ?

(A) िगरपानलका (B) हालर्दार साहब

(C) कै प्टे ि चश्मेवाला (D) मोतीलाल

(झ) बालगोक्षबन भगि की उम्र क्षकिनी थी ?

(A) 50 के पार (B) 60 के पार

(C) 70 के पार (D) 40 के पर

(ञ) ‘लखनवी अंदाि’ पाठ के ले खक कौन िैं?

(A) प्रेमचंर्द (B) यशपाल

(C) निराला (D) िागाजुयि

(ट) ‘सैक्षनक’ शब्द का क्षनमाश ण क्षकस प्रत्यय से िआ

ु िै?

(A) इक (B) ता

(C) ई (D) वाि

(ठ) ‘आाँखों’ का िारा’ का सिी अथश क्या िै?

(A) आंखों की रोशिी (B) बहुत नप्रय होिा

(C) आंखों का आभूषण (D) चमकर्दार चीज़

(ड) ‘नीलकंठ’ में कौन-सा समास िै?

झारखण्ड शैक्षिक अनस

ु धं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 - 2025 Page 3 of 6
 (A) द्वंद्व (B) कमयधारय

(C) तत्पुरुष (D) बहुव्रीनह

(ढ) ‘यि लाल रंग का फूल िै।’इस वाक्य में ‘लाल’ क्षकस प्रकार का क्षवशे षण िै?

(A) संख्यावाचक (B) गुणवाचक

(C) पररमाणवाचक (D) सबं धं वाचक

(ण) ‘सुंदरिा’ क्षकस प्रकार की संज्ञा िै?

(A) जानतवाचक संज्ञा (B) भाववाचक संज्ञा

(C) व्यनिवाचक संज्ञा (D) समूहवाचक संज्ञा

खण्ड – ‘ख’
क्षवषयक्षनष्ठ प्रश्न
2. क्षनम्नक्षलक्षखि में से क्षकन्िी छि प्रश्नों के उत्तर दें :-
(क) संज्ञा नकतिे प्रकार की होती है?
(ख) वह शब्र्द जो निया की नवशेषता बताता है, क्या कहलाता है?
(ग) ‘चरण’ का अर्थय क्या है?
(घ) सनं ध नकतिे प्रकार की होती है?
(ङ) ‘राम-लक्ष्मण’ में कौि-सा समास है?
(च) वह वाक्य जो के वल एक नवचार प्रकट करता है, क्या कहलाता है?
(छ) ‘गुण’ का नवपरीत क्या है?
(ज) उपसगय नकसे कहते हैं ।
3. क्षनम्नक्षलक्षखि में से क्षकन्िीं िीन प्रश्नों के उत्तर दें :-
(क) परशुराम के िोध करिे पर लक्ष्मण िे धिुष के टूट जािे के नलए कौि कौि से तकय नर्दए ?

झारखण्ड शैक्षिक अनस

ु धं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 - 2025 Page 4 of 6
 (ख) भगत की पुत्र वधु उन्हें अके ले क्यों िहीं छोििा चाहती र्थी ?
(ग) लेखक िे फार्दर बुल्के को ‘मािवीय करुणा की नर्दव्य चमक’ क्यों कहा है ?
(घ) नबनममल्ल्ह खाि को बचपि में शहिाई सीखिे में नकसिे प्रेररत नकया ?
4. क्षनम्नक्षलक्षखि में से क्षकन्िीं दो प्रश्नों के उत्तर दें :-
(क) लेखक यशपाल का सनं क्षप्त पररचय र्दें ?
(ख) निया के प्रकारों को उर्दाहरण सनहत मपष्ट कीनजए ।
(ग) कन्यार्दाि कनवता में मााँ िे बेटी को क्या - क्या सीख र्दी ?
(घ) निम्िनलनखत अवतरण का संक्षेपण करें :-
नवज्ञाि िे मािव जीवि को सुखर्द और सरल बिा नर्दया है । नवज्ञाि िे नचनकत्सा, संचार,
पररवहि और नशक्षा के क्षेत्र में कई महाि आनवष्कार नकए हैं, नजससे मािवता को लाभ हुआ है ।
पहले जहां इलाज के नलए लोगों को लंबी यात्रा करिी पिती र्थी, वहीं अब नचनकत्सा के क्षेत्र में
नवकास िे इलाज को सरल और समता बिा नर्दया है । संचार के साधिों में भी बिा पररवतय ि आया
है, नजससे लोग एक-र्दूसरे से र्दूर होते हुए भी आसािी से संपकय कर सकते हैं । नवज्ञाि िे आज हर
क्षेत्र में प्रगनत की है और यह मािव जीवि की गुणवत्ता को बेहतर बिािे में मर्दर्द कर रहा है ।

झारखण्ड शैक्षिक अनस

ु धं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 - 2025 Page 5 of 6
 झारखण्ड शै क्षिक अनुसध
ं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड
प्रक्षिदशश प्रश्न पत्र - 2024 - 2025
उत्तर - कुंिी

किा : 12 क्षवषय : क्षिन्दी - बी खण्ड ‘क’ : बिु - क्षवकल्पीय प्रश्न

प्रश्न सख्
ं या उत्तर
क B
ख B
ग D
घ D
ङ C
च A
छ D
ि C
झ B
ञ B
ट A
ठ B
ड D
ढ B
ण B

झारखण्ड शैक्षिक अनस

ु धं ान एवं प्रक्षशिण पररषद् , रााँची, झारखण्ड प्रक्षिदशश प्रश्न पत्र - 2024 - 2025 Page 6 of 6
‫‪JHARKHAND COUNCIL EDUCATIONAL AND RESEARCH TRAINING,‬‬
‫‪RANCHI‬‬
‫‪MODEL QUESTION PAPER 2024-25‬‬
‫‪CLASS: XII‬‬ ‫باوہںیامجعت‬
‫ل‬
‫)‪URDU (ELECTIVE‬‬ ‫اردو۔اتتیتکتٹتیو‬
‫‪Time: 3 Hours‬‬ ‫وقت۔‪۳‬ہٹنھگ‬ ‫‪MM: 80 Marks‬‬ ‫لکربمنات ۔ ‪۸۰‬‬
‫اعمدہابات‬
‫‪ .1‬اسوسالباےمںیمدوےصحںیہ۔ہصح‪A‬اورہصح‪-B‬‬
‫‪ .2‬ہصح ‪A‬ںیم‪30‬رعمویضوساالتںیہوجدریساورریغدریساابتقساوروسالیکوصرتںیمںیہ۔ہروسال‪1‬ربمناکےہ۔ ت‬
‫‪ .3‬ہصح‪B‬وکنیتوصحںںیمبااٹنایگےہ۔ہصح(افل‪،‬باورج)یھبسےکےیلرضوریدہاباتانوساولںےکاسےنمدرجںیہ۔‬
‫‪ SECTION – A‬ت‬
‫ت]‪[1×5=5‬‬ ‫‪ ‬ہیایتریغدریسرثنیاابتقسےہسجںیمباچنوسالںیہ۔یھبساکوجابدانیرضوریےہ۔ہروسالایتربمناکےہ۔‬
‫“اھبرت رساکر ےن ذعموری اٹکی ‪ 1955‬ںیم وظنمر ایک ۔ ہی اقونن ایبن رکبا ےہ ہک ذعموروں ےک یھب اسکیں وقحق ںیہ ۔‬
‫وکحمامسجںیمانےکےیلامتموہسںیتلفرامہرکےیگ۔وکحماےسیذعموروچبںوکتفممیلعتایہمرکاےئیگاورانوکوقیمداھرے‬
‫ےس وجڑے یگ ۔ ہی اقونن ہی یھب ایبن رکبا ےہ ہک امتم وعایم وہگجں (ےسیج اوکسل‪ ،‬امعروتں وریغہ) ںیم ذعموروں ےک ےیل رپمی‬
‫(‪)Ramp‬انبرکاںیھنےنچنہپےکاقبانبےئاجںیئ۔” ت‬

‫اھبرترساکرےنذعموریاٹکیبکوظنمرایک؟‬ ‫‪1‬تـــ‬
‫ت(د)‪ 1855‬ت‬ ‫ت‬ ‫ت(ج)‪1955‬‬ ‫ت‬ ‫ت‬ ‫ت(ب)‪2000‬‬ ‫ت‬ ‫(افل)‪2005‬‬
‫وکناساقوننذعموروںےکےیلیھباسکیںوقحقیکباترکباےہ؟‬ ‫‪2‬تـــ‬
‫ت(ب)ذعموریاٹکی‪ 1955‬ت ت‬ ‫ت‬ ‫(افل)ذعموریاٹکی‪ 1900‬ت‬
‫ت(د)ذعموریاٹکی‪ 2000‬ت‬ ‫ت‬ ‫(ج)ذعموریاٹکی‪ 1990‬ت‬
‫وکحمذعموروچبںوکیسیکمیلعتایہمرکاےئیگ؟‬ ‫‪3‬تـــ‬
‫ت‬ ‫ت(ب)خریلیچمیلعت‬ ‫ت‬ ‫ت‬ ‫ت‬ ‫(افل)تفممیلعت ت‬
‫ت(د)روگیرلمیلعت ت‬ ‫ت‬ ‫ت‬ ‫ت‬ ‫(ج)افالصیتمیلعت ت‬
‫ذعموروںوکوعایموہگجںرپاجےنےکےیلوکحمےنایکانبےنیکباتیکےہ؟‬ ‫‪4‬تـــ‬
‫ت(د)انںیمیھبس ت‬ ‫(ج)رپمی(‪)Ramp‬‬ ‫ت(ب)رھگ ت‬ ‫ت‬ ‫(افل)ڑیسیھ‬
‫وکحمامسجںیمسکےکےیلامتموہسںیتلفرامہرکےیگ؟‬ ‫‪5‬تـــ‬
‫ت(ب)وٹیبںےکےیل ت‬ ‫ت‬ ‫(افل)وچبںےکےیلت‬
‫ت(د)ذعموروںےکےیل ت‬ ‫ت‬ ‫(ج)وبڑوھںےکےیلت‬

‫‪Page 1 of 5‬‬
 ‫ت]‪[1×5=5‬‬ ‫‪ ‬ہیایتریغدریسرعشیاابتقسےہسجںیمباچنوسالںیہ۔یھبساکوجابدانیرضوریےہ۔ہروسالایتربمناکےہ۔‬
‫‪‬‬
‫تااسحنوتسکرپدرھباےہ‬ ‫ت‬ ‫ت‬ ‫رگوقمیکخدمرکباےہ‬
‫تویکںوخفےکامرےرمباےہ‬ ‫ت‬ ‫ت‬ ‫ویکںریغوںاکدمرھبباےہ‬
‫اھٹبادنھرمکایکڈرباےہ!‬
‫رھپدھکیخداایکرکباےہ‬
‫توہ آخروکاتھچپےئاگ‬ ‫ت‬ ‫ت‬ ‫وجرمعںیتفمونگاےئاگ‬
‫توجڈوھندےاگوہباےئاگ‬ ‫ت‬ ‫ھچکےھٹیباہھتہنآےئاگت‬
‫تہیوقیھبآخراجےئاگ‬ ‫ت‬ ‫وتبکیدیراگلےئاگت‬
‫اھٹبادنھرمکایکڈرباےہ!‬
‫رھپدھکیخداایکرکباےہ ت‬
‫ایکوقمیکخدمااسحنےہ؟‬ ‫‪6‬تـــ‬
‫ت(د)انںیمےسوکیئںیہن‬ ‫ت‬ ‫ت(ج)ولعممںیہن‬ ‫ت‬ ‫ت‬ ‫ت(ب)ںیہن‬ ‫ت‬ ‫(افل)اہں‬
‫وجرمعںیــــــــــــــــــــــــــــــــــــــــونگاےئاگ۔ ت‬ ‫‪7‬تـــ‬
‫ت(د)امنترک‬ ‫ت(ج)اداھرت‬ ‫ت‬ ‫ت(ب)دقن ت‬ ‫ت‬ ‫(افل)تفم‬
‫وجرمعںیتفمونگاےئاگوہآخرںیمایکرکباےہ؟‬ ‫‪8‬تـــ‬
‫ت(د)اتھچپباےہ‬ ‫ت‬ ‫ت(ج)الچباےہ‬ ‫(افل)وخشوہباےہ ت(ب)دیھکوہباےہ ت‬
‫شارعاےنھٹےکدعبایکرکےنوکہہکراہےہ؟‬ ‫‪9‬تـــ‬
‫ت(ب)ھچکںیہنرکےنوکہہکراہےہ‬ ‫ت‬ ‫(افل)رمکبادنےنھوکہہکراہےہ ت‬
‫ت(د)وشراچمےنوکہہکراہےہ۔‬ ‫ت‬ ‫ت‬ ‫ت‬ ‫(ج)وساجےنوکہکراہےہ‬
‫رھپدھکیخداایکرکباےہ"ےسشارعایکانہکاچاتہےہ؟‬ ‫‪10‬تـــ‬
‫ت(ب)یسکاکمںیمدوشاریںیہنوہیگ‬ ‫ت‬ ‫(افل)ہراکمآاسنوہاجےئاگ ت‬
‫ت(د)انںیمیھبس ت‬ ‫ت‬ ‫(ج)ڑگبےاکمیھبنباجںیئےگت‬

‫ت]‪[1×5=5‬‬ ‫‪ ‬ہیایتدریسرثنیاابتقسےہسجںیمباچنوسالںیہ۔یھبساکوجابدانیرضوریےہ۔ہروسالایتربمناکےہ۔‬
‫"اکیشےکآرہیدنمرںیمڈنپتارمباھتیکرقتیروہریہےہ۔بارظنیوحسمرےھٹیبوہےئںیہ۔رپورسیفدانباھتےنآےگکسھک‬
‫رکاےنپدوسباوبارمتراےئےکاکنںیماہک"ریٹوہیئرقتیرےہ۔"ارمتراےئاجیٹسستںیموحمےھت۔اساکوجابہندبا۔دانباھت‬
‫ےنرھپاہک"اصفریٹوہیئرقت تیرےہ۔اہیںانھٹیبوضفلےہ‪،‬سنیٹاکوقالکناجراہےہ۔"‬
‫اکیشوکنکنکباومںےساجبااجباےہ؟‬ ‫‪11‬تـــ‬
‫ت(د)انںیمیھبس‬ ‫ت‬ ‫ت(ج)انبرس‬ ‫ت‬ ‫ت‬ ‫ت(ب)وارایسن‬ ‫ت‬ ‫)افل)اکیش‬
‫ڈنپتارمباھتیکرقتیراہکںوہریہیھت؟‬ ‫‪12‬تـــ‬
‫‪Page 2 of 5‬‬
 ‫ت(ج)اکیشےکآرہیدنمرںیم(د)انںیموکیئںیہن ت‬ ‫ت‬ ‫ت‬ ‫ت(ب)ہنٹپںیم‬ ‫ت‬ ‫(افل)دیلںیم‬
‫رپورسیفدانباھتےناےنپدوسےکاکنںیمایکاہک؟‬ ‫‪13‬تـــ‬
‫ت(ب)ریٹوہیئرقتیرےہ‬ ‫ت‬ ‫(افل)ہیرقتیرباربارینسےہ ت‬
‫ت(ج)تہبدمعہرقتیرےہ‬ ‫ت‬ ‫ت‬ ‫(ج)وکباسرقتیرےہت‬
‫دانباھتےکاطمقبسکاکوقتالکناجراہاھت؟‬ ‫‪14‬تـــ‬
‫ت(د)رکٹک‬ ‫ت(ج)سنیٹت‬ ‫ت‬ ‫ت‬ ‫ت(ب)ڈبکی‬ ‫(افل)وبکیربازی ت‬
‫ہیاابتقسرپمیدنچےکسکباولےسایلایگےہ؟‬ ‫‪15‬تـــ‬
‫ت(د)انںیمیھبس ت‬ ‫ت(ج)نفک ت‬ ‫ت‬ ‫ت‬ ‫ت(ب)جحاربک‬ ‫ت‬ ‫(افل)ویبه‬

‫ت]‪[1×5=5‬‬ ‫‪ ‬ہیایتدریسرعشیاابتقسےہ۔سجںیمباچنوسالںیہ۔یھبساکوجابدانیرضوریےہ۔ہروسالایتربمناکےہ۔‬
‫ھچکیرسےلہپوسیرےھنمادنریھے ت‬
‫اکاہپڑیرپچنہپاجےتےھتمہ ت‬
‫ایتاکےلتخسےیکتےسااھٹرکاانپرس ت‬
‫ادھ اگجوسرجارھبرکدھکیاتیلاھتںیمہ ت‬
‫مہرحسزیخوں ےسرشامرکاکھجاتیلاھترس ت‬
‫داتعفًاسےکوبلںےسوھپٹڑپیتیھتیسنہ ت‬
‫اہھتوہمہےسالمبااھتہبدصنسحاپتک ت‬
‫مسجواجںںیملیھپاجیتیھتہتفگشبازیگ ت‬

‫ھچکیرسےلہپشارعاہکںچنہپاجبااھت؟‬ ‫‪16‬تـــ‬
‫ت(د)درخترپ‬ ‫ت‬ ‫ت(ج)اکمنرپ‬ ‫ت‬ ‫ت‬ ‫ت(ب)دنیرپ‬ ‫ت‬ ‫(افل)اہپڑیرپ‬
‫شارعسجہیکتاکاامعتسلرکباےہوہاسیکےہ؟‬ ‫‪17‬تـــ‬
‫ت(د)انںیموکیئںیہن‬ ‫ت‬ ‫وٹباوہا‬
‫ت(ج) ت‬ ‫ت‬ ‫ت(ب)اکالاورتخس ت‬ ‫(افل)رنموالممی ت‬

‫سکرطحاکوسرجارھبرکدھکیاتیلاھت؟‬ ‫‪18‬تـــ‬
‫ت(ج)ادھاگجوسرج ت(د)انںیمیھبس‬ ‫(افل)الکنوہاوسرج ت(ب)ڈوباوہاوسرج ت‬
‫وسرجوکسکبامےساجےتنںیہ؟‬ ‫‪19‬تـــ‬
‫ت(د)انںیمیھبس‬ ‫ت(ج)اچدن ت‬ ‫ت‬ ‫ت‬ ‫ت(ب)اتہمب‬ ‫ت‬ ‫(اف)آاتفب‬
‫ہتفگشبازیگاہکںلیھپاجیتیھت؟‬ ‫‪20‬تـــ‬
‫ت(د)مسجواجںںیم ت‬ ‫ت‬ ‫ت(ج)اکنںیم‬ ‫ت‬ ‫ت‬ ‫ت(ب)دامغںیم‬ ‫ت‬ ‫(افل)وخنںیم‬

‫‪Page 3 of 5‬‬
 ‫ت]‪[1×10=10‬‬ ‫‪ ‬اسےصحںیملک‪10‬وسالںیہیھبسےکوجابالزیمںیہ۔ہروسالایتربمناکےہ۔‬
‫اردوسکزباناکظفلےہ؟‬ ‫‪21‬تـــ‬
‫ت(د)یریک‬ ‫ت(ج)دنہیت‬ ‫ت‬ ‫ت‬ ‫ت(ب)رعیب‬ ‫ت‬ ‫(افل)افریس‬
‫اردوزباناکرمسطخایکےہ؟‬ ‫‪22‬تـــ‬
‫ت(د)انںیموکیئںیہن‬ ‫ت(ج)دنہیرمسطخ ت‬ ‫ت‬ ‫(افل)افریسرمسطخت(ب)دویبارگیرمسطخ‬
‫آپےکاصنبںیمااشتحمنیسحاکوکناسومضمنشالمےہ؟‬ ‫‪23‬تـــ‬
‫ت(د)وخیج۔ایتاطمہعل‬ ‫ت‬ ‫ت(ج)روانشیئ‬ ‫ت(ب)ارماؤاجنادا ت‬ ‫رگافر ت‬
‫(افل)وفوٹ ت‬
‫ولبنتھگنساکوکناسااسفہنآپےکاصنبںیمشالمےہ؟‬ ‫‪24‬تـــ‬
‫ت(د)ےحمل‬ ‫ت‬ ‫ت(ج)آرگہبازار‬ ‫ت‬ ‫(افل)وکسنیکدنین ت(ب)نفکت‬
‫"اسآبادخراےبںیم"اکقلعتسکفنصےسےہ؟‬ ‫‪25‬تـــ‬
‫ت(د)انںیمیھبس‬ ‫ت(ج)زغلت‬ ‫ت‬ ‫ت(ب)مظنت‬ ‫ت‬ ‫(افل)آپیتیب‬
‫ترھپاکشہنمھتںیکسےگریمے‬ ‫صر ت‬
‫رودادرفسہنڑیھچبا ت‬ ‫‪26‬تـــ‬
‫اسرعشےکشارعوکنںیہ؟‬
‫قر‬
‫ت(د)ذو ت‬ ‫ت‬ ‫ت(ج)باصراکیمظ‬ ‫ت‬ ‫ت(ب)افرینت‬ ‫ت‬ ‫لر‬
‫(افل)اغ ت‬
‫احیلاکوپرابامایکےہ؟‬ ‫‪27‬تـــ‬
‫ت(د)وخاہجااطلفنیسحاحریل‬ ‫ت‬ ‫ت(ج)اابقلاحریل‬ ‫ت‬ ‫ت(ب)اتشمقاحریل ت‬ ‫ت‬ ‫(افل)افرین‬
‫امس کسےےتہکںیہ؟‬ ‫‪28‬تـــ‬
‫ت(د)اخدنانوک ت‬ ‫ت(ج)اکموکت‬ ‫ت‬ ‫ت‬ ‫ت(ب)شاموک‬ ‫ت‬ ‫(افل)باموک‬
‫آگیکوپاجرکےنواےلوکایکےتہکںیہ؟‬ ‫‪29‬تـــ‬
‫ت(د)انںیمیھبس‬ ‫ت(ج)آشترپست ت‬ ‫ت‬ ‫ت‬ ‫(افل)دولتدنم ت(ب)رغن‬

‫اہھتےلیپرکبااکینعموہاگ‪:‬‬ ‫‪30‬تـــ‬
‫ت(د)انںیموکیئںیہن ت‬ ‫ت‬ ‫ت(ج)دلہیانسیپ‬ ‫ت‬ ‫ت‬ ‫رکبا‬
‫ت(ب)شادی ت‬ ‫اگلبا‬
‫(افل)زمخرپدلہی ت‬
‫‪ SECTION – B‬ت‬
‫اسےصحوکنیتذیلیوصحںںیممیسقتایکایگےہ۔سجںیملک‪22‬وساالتںیہ۔رضوریدہاباتانےکاسےنمدرجںیہ۔‬
‫ہصح(افل)‬
‫]‪ [2×6=12‬ت‬ ‫‪( ‬وسالربمن‪31‬ےس‪38‬یرصتخم تیرنیوساالتںیہ۔انںیمےسلکھچوساولںےکیہوجابدےنیںیہ۔)‬
‫رمزااغلاکوپرابامںیھکل۔‬ ‫‪31‬تـــ‬
‫یشنمہروگبالہتفتےکبامسکےنطخاھکلاھت؟‬ ‫‪32‬تـــ‬
‫احریلبکاوراہکںدیپاوہےئ؟‬ ‫‪33‬تـــ‬

‫‪Page 4 of 5‬‬
 ‫وخاہجنسحاظنیماکوکناساناہیئآپےکاصنبںیمشالمےہ؟‬ ‫‪34‬تـــ‬
‫مظن"زدنیگےسڈرےتوہ"ےکشارعوکنںیہ؟‬ ‫‪35‬تـــ‬
‫اابقلاکااقتنلبکوہا؟‬ ‫‪36‬تـــ‬
‫وفوٹرگافرسکاکااسفہنےہ؟‬ ‫‪37‬تـــ‬
‫آپےکاصنبںیمشالموطلیمظن"وقاکیراہن"ےکشارعوکنںیہ؟‬ ‫‪38‬تـــ‬
‫ہصح(ب)‬
‫‪ ‬وسالربمن‪39‬ےس‪46‬یرصتخموساالتںیہ۔انںیمےسلکھچوساولںےکیہوجابرقتابی‪150‬اافلظدےنیںیہ۔ ]‪[3×6=18‬‬
‫رمزااغلیکوطخطاگنریرپونٹںیھکل۔‬ ‫‪39‬تـــ‬
‫ڈوھنایل تایکیراےہوجہیاوفاہاڑادیاجےئ‬
‫مہےناناونںےکدھکدرداکلح د‬ ‫‪40‬تـــ‬
‫تاسرعشیکرشتحیےیجیک۔‬ ‫ت‬
‫فنصزغلرپایترصتخمونٹںیھکل۔‬ ‫‪41‬تـــ‬
‫رپمیدنچیکایحتوخدامترپرصتخمونٹرحت تیررکںی۔‬ ‫‪42‬تـــ‬
‫اےنپااتسدوکاینپونرکیےنگلیکوخیشےکومعقرپایتطخںیھکل‬ ‫‪43‬تـــ‬
‫مظنوگررغابیںاکالخہصاینپزبانںیمرکںی۔‬ ‫‪44‬تـــ‬
‫اابقلیکایحتوخدامتاکاجیرہرکںی۔‬ ‫‪45‬تـــ‬
‫ااسفہن"ےحمل"اکالخہصںیھکل۔‬ ‫‪46‬تـــ‬
‫ہصح(ج)‬
‫‪ ‬وسالربمن‪47‬ےس‪52‬یوطلیوساالتںیہ۔انںیمےسلکاچروساولںےکیہوجابدےنیںیہ۔ہیوجابرقت ت‬
‫ابیً‪250‬اافلظےک‬
‫]‪[5×4=20‬‬ ‫وہں۔‬
‫‪47‬تـــ فرۃانیعلدیحراکااسفہن"وفوٹرگافر"اکالخہصںیھکل۔‬
‫‪48‬تـــ امسیکرعتفیوااسقموکاثملےکاسھتںیھکل۔‬
‫‪49‬تـــ رسدیسرحتیتبایلعگرھرحتیترپونٹںیھکل‬
‫‪50‬تـــ امہراضمنبادیعیکلیصفتایبنرکںی۔ ت‬
‫‪51‬تـــ ارتخاالامینیکآپیتیب"اسآبادخراےبںیم"رپدیقنتیونٹںیھکل۔‬
‫‪52‬تـــ نسحلیلعتاورحیملتیکرعتفیاثمولںےکاسھتںیھکل۔‬

‫‪Page 5 of 5‬‬
‫‪Answer key .‬‬ ‫جوابات‬
‫‪Class 12th‬‬ ‫بارہویں جماعت‬

‫‪01- 4.‬‬ ‫‪16- 1‬‬

‫‪02- 2.‬‬ ‫‪17- 2‬‬
‫‪03- 1.‬‬ ‫‪18- 3‬‬
‫‪04- 3.‬‬ ‫‪19- 1‬‬
‫‪05- 4.‬‬ ‫‪20- 4‬‬
‫‪06- 2.‬‬ ‫‪21- 4‬‬
‫‪07- 1.‬‬ ‫‪22- 1‬‬
‫‪08- 4.‬‬ ‫‪23- 4‬‬
‫‪09- 1.‬‬ ‫‪24- 4‬‬
‫‪10- 4.‬‬ ‫‪25- 1‬‬
‫‪11- 4.‬‬ ‫‪26- 3‬‬
‫‪12- 3.‬‬ ‫‪27- 4‬‬
‫‪13- 2.‬‬ ‫‪28- 1‬‬
‫‪14- 3.‬‬ ‫‪29- 3‬‬
‫‪15- 1‬‬ ‫‪30- 2‬‬
 झारखण्ड शै क्षिक अनु संधान एवं प्रक्षशिण पररषद, रााँ ची , झारखण्ड
वाक्षषिक परीिा (Annual Examination)
2024-2025
मॉडल प्रश्न पत्र
किा – XII क्षवषय – लेखाशास्त्र समय – 3 घण्टा 15 क्षमनट पू णाांक – 80

Class-XII Subject- ACCOUNTANCY Time- 3 Hour 15 Minute Marks - 80

(Compulsory)
General Instructions / lkekU; funsZ'k :
1- This Question Booklet has two Parts & Part-A and Part-B.
bl ç'u&iqfLrdk esa nks Hkkx Hkkx&A rFkk Hkkx&B gSaA
2- Part-A is of MCQ Type having 30 marks and Part-B is of Subjective Type having 50
marks.
Hkkx&A esa 30 vad ds cgqfodYih; ç'u rFkk Hkkx&B esa 50 vad ds fo"k;fu"B ç'u gSaA
3- The candidate has to answer in the Answer Booklet which will be provided separately.
ijh{kkFkhZ dks vyx ls miyC/k djkbZ xbZ mÙkj&iqfLrdk esa mÙkj nsuk gSA
4- In Part-A There are 30 Multiple Choice Questions having four (4) options (A, B, C & D).
The candidate has to write the correct option in the Answer Booklet. All questions are
compulsory. Each question carries 1 mark- There is no negative marking for wrong answer.
Hkkx&A esa 30 cgqfodYih; ç'u gSa ftuds 4 fodYi ¼ A] B] C rFkk D½ gSaA ijh{kkFkhZ dks
mÙkj&iqfLrdk esa lgh mÙkj fy[kuk gSA lHkh ç'u vfuok;Z gSaA çR;sd ç'u 1 vad dk gSA
xyr mÙkj ds fy, dksbZ vad dkVk ugha tk,xkA
5- In Part-B There are three sections: Section-A, B & C.
This part is of Subjective Type having Very Short Answer, Short Answer & Long Answer
Type questions- Total number of questions is 22.

Section-A Question, Nos. 31-38 are Very Short Answer Type- Answer any 6 questions.
Each question carries 2 marks- Answer the questions in one sentence each.
Section-B Question Nos. 39-46 are Short Answer Type. Answer any 6 questions. Each
question carries 3 marks. Answer the questions in maximum 150 words each.
Section-C Question Nos. 47-52 are Long Answer Type. Answer any 4 questions. Each
question carries 5 marks. Answer the questions in maximum 250 words each.
Hkkx&B esa rhu [k.M [k.M&A] B rFkk C gSaA bl Hkkx esa vfr y?kq mÙkjh;] y?kq mÙkjh; rFkk
nh?kZ mÙkjh; çdkj ds fo"k;fu"B ç'u gSaA dqy ç'uksa dh la[;k 22 gSA
[k.M&A ç'u la[;k 31&38 vfr y?kq mÙkjh; gSaA fdUgha 6 ç'uksa ds mÙkj nsaA çR;sd
ç'u 2 vad dk gSA çR;sd ç'u dk mÙkj ,d okD; esa nhft,A
[k.M&B ç'u la[;k 39&46 y?kq mÙkjh; gSaA fdUgha 6 ç'uksa ds mÙkj nsaA çR;sd ç'u
3 vad dk gSA çR;sd ç'u dk mÙkj vf/kdre 150 'kCnksa esa nsaA
[k.M&C ç'u la[;k 47&52 nh?kZ mÙkjh; gSaA fdUgha 4 ç'uksa ds mÙkj nsaA çR;sd ç'u
5 vad dk gSA çR;sd ç'u dk mÙkj vf/kdre 250 'kCnksa esa nsaA
6- Candidates are required to answer in their own words as far as practicable.
ijh{kkFkhZ ;FkklaHko vius 'kCnksa esa gh mÙkj nsaA
Part – A ¼Hkkx &A½
(Multiple choice Type Questions)
¼cgqfodYih; iz’ u½
Question Nos. 1 to 30 are Multiple Choice Type. Each question has four options. Select the
correct option and write it in the Answer sheet- Each question carries I marks
ç'u la[;k 1 ls 30 rd cgqfodYih; çdkj gSA çR;sd ç'u ds pkj fodYi gSaA lgh
fodYi pqudj mÙkj iqfLrdk esa fy[ksaA çR;sd ç’u 1 vad dk gSA
Q1. lk>snkjh lays[k ds vHkko esa lk>snkj dks mlds }kjk QeZ dks nh xbZ vfxze jkf'k ij
C;kt fn;k tk,xkA
¼In the absence of a partnership deed, the allowable rate of interest on amount advanced by
the partner to the firm will be :)
¼A½ 5% okf"kZd dh nj ls ¼ at the rate of 5% p.a.½
¼B½ 6%- okf"kZd dh nj ls ¼ at the rate of 6% p.a.½
¼C½ 9% okf"kZd dh nj ls ¼at the hate of 9% p.a.½
¼D½ 12% okf"kZd dh nj ls ¼ at the late of 12% p.a-½
Q.2 lk>snkj dk QeZ ls lEcU/k gksrk gS
The relation of partner with the firm is that of:
¼A½ Lokeh dk ¼ An Owner½
¼B½ ,tsUV dk ¼ An Agent½
¼C½ Lokeh ,oZ ,tsUV dk ¼ Anowner and an Agent½
¼D½ çcU/kd dk ¼Manager½
Q.3 ;fn lk>snkjksa ds vkkgj.k dh frfFk u nh gqbZ gks rks fdrus le; dk C;kt yxk;k tkrk
gS:
¼If date of drawings of the partner's is not given in the question, interest is charged for how
much time½
¼A½ 1 ekg dk ¼ 1 month½ ¼B½ 6-5 ekg dk ¼6.5 month)
¼C½ 6 ekg dk ¼ 6 months½ ¼D½ 12 ekg dk ¼12 months½
Q.4 R;kx vuqikr ¼ Sacrificing Ratio½:
¼A½ New Ratio-old Ratio u;k vuqikr iqjkuk vuqikr
¼B½ Old Ratio - New Ratio iqjkuk vuqikr & u;k vuqikr
¼C½ Old Ratio-Gaining Ratio iqjkuk vuqikr & ykHk&çkfIr vuqikr
¼D½ Gaining Ratio &Old Ratio ykHk&çkfIr vuqikr&iqjkuk vuqikr
Q.5 O;olk; dh çflf) ds ekSfæd ewY; dks dgrs gSa
¼The monetary value of reputation of the business is called ½
¼A½ [;kfr ¼ goodwill½ ¼B½ cpr ¼Surplus½
¼C½ gkfu ¼Loss½ ¼D½ vk; ¼Income½
Q.6 u, lk>snkj ds }kjk [;kfr dh jkf'k nh tkrh gS
¼The amount of goodwill is paid by the new partner½:
¼A½ iwath ds Hkqxrku ds fy, ¼ for the payment of Capital½
¼B½ ykHk esa fgLlk ikus ds fy, ¼ For sharing the profit½
¼C½ lEiwfä Øe dls] ds fy, ¼ For purchase of assets½
¼D½ buesa ls dksbZ ugha ¼None of these½-
Q.7 iqueZwY;kadu [kkrk vFkok ykHk&gkfu lek;kstu [kkrk gS:
¼Revaluation Account or Profit and loss Adjustment A/C is a½
¼A½ okLrfod [kkrk ¼ Real Account½
¼B½ O;fäxr [kkrk ¼Personal Account½
¼C½ Hkkeek= [kkrk ¼ Nominal Account½
¼D½ buesa dksbZ ugha ¼ None of these½
Q.8 lk>snkj dh e`R;q ij vfUre Hkqxrku gksrk gS
¼On the death of a partner in a firm payment are made from½
¼A½ iw¡th [kkrs ls ¼ Capital A/c½
¼B½ pkyq [kkrs ls ¼ Current A/c½
¼C½ ç_.k [kkrs ls ¼Loan A/c½
¼D½ mÙkjkf/kdkfj;ksa ds [kkrksa ls ¼Executor's Ac½
Q.9 X] Y vkSj Z ] vkSj ds vuqikr esa ykHkksa dk foHkktu djrs gSaA Z dh e`R;q

gks tkrh gSA X vkSj Y dk u;k vuqikr gksxk ¼ X, Y and & share profits in the ratio of ]

and . Z die, New ratio of X and Y will be :½

¼A½ 3%2 ¼B½ 2:3

¼C½ 2:1 ¼D½ 1:2
Q.10 ykHk&çkfIr vuqikr dh xq.kuk dh tkrh gS ¼Gaining Ratio is calculated:½
¼A½ ços'k ds le; ¼ At the time of admission½
¼B½ vodk'k xzgu ds le; ¼ At the time of retirement½
¼C½ fo?kVu ds le; ¼ At the time of dissolution½
¼D½ buesa ls dksbZ ugha ¼ None of these½-

Q.11 lk>snkjh QeZ ds fo?kVu ij [kkrk [kksuk vkrk gS % ¼An account is opened at the time of
dissolution of Partnership Firm.½
¼A½ olwyh [kkrk ¼ Realisation A/c½
¼B½ iquewZY;kadu [kkrk ¼Revaluation A/c½
¼C½ ykHk&gkfu fu;kstu [kkrk ¼ P/L Appropriation A/c½
¼D½ buesa dksbZ ugha ¼ None of these½
Q.12 QeZ ds fo?kVu ij] lk>snkj ds _.k [kkrs dks gLrkUrfjr fd;k tkrk gS ¼ On
dissolution of a firm, Partner's Loan Account is transferred to ½%
¼A½ olwyh [kkrs esa ¼ Realisation A/c)
¼B½ lk>snkj ds iw¡th [kkrs esa ¼Partner's Capital A/c½
¼C½ jksdM+ [kkrs esa ¼ Cash A/c½
¼D½ buesa dksbZ ugha ¼ None of these½
Q.13 - la;qä iw¡th dEiuh gS ¼ A Joint Stock Company is½:
¼A½ cS/kkfud —f=e O;fä ¼An artificial legal person½
¼B½ çk—frd O;fä ¼A natural person½
¼C½ lkekU; O;fä ¼ A general person½
¼D½ xSj&fuoklh Hkkjrh; ¼ None Resident Indian½
Q.14 Hkkjrh; dEiuh vf/kfu;e] 2013 ds vuqlkj dEiuh dk vkfFkZd fpV~ Bk cuk;k tkrk
gS
¼According to Indian Companies Act 2013] Balance Sheet of a company is prepared as per ½:
¼A½ vuqlwph Ⅲ dk Hkkx 2 ¼Part Ⅱ of Schedule III½
¼B½ vuqlwph Ⅲ dk Hkkx 1 ¼Part I of Schedule III½
¼C½ vuqlwph IV dk Hkkx 2 ¼ Part II of Schedule VI½
¼D½ vuqlwph VI dk ekx 1 ¼ Part I of Schedule IV)
Q.15 vnÙk ;kpuk ij vf/kdre C;kt ft;k vk ldrk gS:
¼Interest on calls in arrears can be charged maximum at½:
¼A½ 6%pa ¼B½ 10%pa. ¼C½ 5% pa. ¼D½ 12% pa.
Q.16 lafpr iw¡th dk vFkZ gS ¼ Reserve Capital means½:
¼A½ iw¡th lap; dk Hkkx ¼ The part of Capital Reserve½
¼B½ lafpr ykHk ¼ Accumulated Profit½
¼C½ iwath 'kks/ku lap; dk Hkkx ¼ The part of Capital Redemption Reserve½
¼D½ vHkkfpr iwath dk çkfFkZr Hkkx ¼ The part of Subscribed uncalled up Capital½

Q.17 - dEiuh esa fuf'pr nj ls ykHkka'k fdldks fn;k tkrk gS\

¼To whom dividend is given at a fixed rate in a company?½:
¼A½ lerk va'k/kkfj;ksa dks ¼To Equity shareholders½
¼B½ iwokZf/kdkj va'k/kkfj;ksa dks ¼ To Preference shareholders½
¼Š½ lerk rFkk iwokZf/kdkj nksuksa va'k&/kkfj;ksa dks ¼ Borth Equity and Preference Shacholders½
¼D½ _.ki=/kkfj;ksa dks ¼ To Debentureholder½
Q.18 ,d futh dEiuh esa lnL;ksa dh vf/kdre la[;k gksrh gS
¼Maximum number of members in a private Company is½:
¼ A½ 7 ¼B½ 50 ¼C½ 200 ¼D½ 20
Q.19 _.ki= gS ¼ Debentius is½ :
¼A½ v_.k dk çek.k&i= ¼ Loan Certificate½ ¼B½ udn dk çek.k&i= ¼ Cash Certificate½
¼C½ lk[k dk çek.k&i= ¼ Credit Certificate½ ¼D½ iw¡th dk çek.k&i= ¼ Capital Certificati½
Q.20 _.k i=/kkjh gksrs gS ¼ Debenture holders are½:
¼A½ dEiuh ds Lokeh ¼Owners of the Company½
¼B½ dEiuh ds xzkgd ¼ Customers of the Company½
¼C½ dEiuh ds çorZd ¼ Promoters of the Company½
¼D½ dEiuh ds ysulj ¼ Creditors of the Company½
Q.21 u, SEBI fn'kk&funsZ'kksa ds vuqlkj _.ki= 'kks/ku ls iwoZ _.ki= fuxZeu ds-------------
ds cjkcj jkf'k dks ^_.ki= 'kks/ku lap ;* esa gLrkarj.k djuk vfuok;Z gS
¼As per new SEBI Guide Lines an amount equal to...................of the debenture issue- must be
transferred to Debenture Redemption Reserve before redemption begins.)
¼A½ 50% ¼B½ 80% ¼C½ 25% ¼D½ buesa dksbZ ugha ¼ None of these½
Q.22 foÙkh; fooj.k çnf'kZr djrs gSa
¼Financial Statement disclose½:
¼A½ xq.kkRed lwpuk ¼Qualitative Information½
¼B½ ekSfæd lwpuk ¼ Monetary Information½
¼C½ vekSfæd lwpuk ¼ Non-Monelary Information½
¼D½ buesa dksbZ ugha ¼None of these½
Q.23 foÙkh; fo'ys"k.k ds fy, vf/kdka'kr: ç;ksx fd, tkus okus midj.k gS
¼The most commonly used tools for financial analysis are ½:
¼A½ rqyukRed fooj.k ¼ Comparative Statement½
¼B½ leku vkdkj ds fooj.k ¼ Common Size Statement½
¼C½ ys[kkadu vuqikr ¼ Accounting Ratios½
¼D½ mi;Zqä lHkh ¼All of the above½
Q.24 vkn'kZ 'kh?kz vuqikr gS ¼ Ideal Quick Ratio is½:
¼A½ 1:1 ¼B½ 1:2 ¼C½ 1:3 ¼D½ 2:1
Q.25 fuEufyf[kr esa ls dkSu lh rjy laifÙk gS\ (Which of the following is liquid assets)?
¼A½ Hkwfe ¼Land½ ¼B½ Hkou ¼Building½
¼C½ jgfr;k ¼Stock½ ¼D½ nsunkj ¼Debtors½
Q.26 LVkWd vkorZ vuqikr gS ¼ Stock turnover Ratio is½:
¼A½ rjyrk vuqikr ¼Liquidity Ratio½ ¼B½ ykHkiznkrk vuqikr ¼Profitability Ratio½
¼C½ fu”iknu vuqikr ¼Activity Ratio½ ¼D½ pkyw vuqikr ¼Current Ratio½
Q.27 jksdM+&çokg fooj.k lacaf/kr gS
¼Cash Flow Statement is related to):
¼4½ AS&3 ¼B½ AS&6 ¼ C½ AS&9 ¼D½ AS&12

Q.28 fuEufyf[kr esa ls dkSu&lk en jksdM+ rqY; gS\

¼which of the following- item is considered as Cash Equivalents\½
¼A½ cSad vf/kfud"kZ ¼ Bank Overdraft½ ¼B½ nsunkj ¼Debtors½
¼C½ O;kikfjd i= ¼ Commercial lapais½ ¼D½ fofue; i= ¼ Bills of Exchange½
Q.29 fuEu esa ls lapkyu laca/kh fØ;kvksa ls jksdM+ çokg dk mnkgj.k dkSu&lk gS \-
¼Which of the following is an example of cash flow from Operating Activities\½
¼A½ va'kksa dk fuxZeu ¼ Issue of shares½ ¼B½ e'khujh dk Øe ¼ Purchase of Machinery½
¼C½ fofu;ksxksa dk Øe ¼ Purchase of Investment½
¼D½ LVkWd dk udn Øe ¼ Purchase of Inventory for Cash½
Q.30 udn fcØh gS ¼ Cash Sales is a½:
¼A½ ifjpkyu fØ;k,¡ ¼ Operating Activities½
¼B½ fofu;kstu fØ;k,¡ ¼ Investing Activities½
¼C½ foÙkh; fØ;k,¡ ¼ financing Activities½
¼D½ buesa ls dksbZ ugha ¼ None of these½-
PART-B ¼Hkkx&c½
¼ Subjective Type ½ ¼fo"k;fu"B ç'u½
Section-A ¼[k.M&A½
¼ Very short answer type questions ½
¼vfr y?kq mÙkjh; ç'u½
Answer any Six questions- Answer the questions in one sentence each-
fdUgh N% ç'uksa ds mÙkj nsaA çR;sd ç'u dk mÙkj ,d okD; esa nhft,A
Q.31 ykHk&gkfu fofu;kstu [kkrk D;k gS\
What is Profit and Loss Appropriation Account\
Q.32 vf/kykHk dk lw= nsaA
Give the formula of Super Profit.
Q.33 iquewZY;kadu [kkrk D;k gS\
What is Revaluation Account\
Q.34 dksbZ ,d ifjfLFkfr crkb;s ftuds vUrxZr lk>snkjh QeZ dks fo?kfVr gqvk ekuk
tkrk gSA
State any one circumstance under which, partners tics is deemed to have been disserved.
Q.35 va'k rFkk gS\
What do you mean by Share?
Q.36 _.k&i=ksa ds 'kks/ku ls D;k vk'k; gS\
What is mean by Redemption of Debentures\
Q.37 pkyw vuqikr dk lw= nhft,A
Give the formula of Current Ratio.
Q.38 What is meant by Cash Equivalents\
jksdM+ lerqY; ls D;k vk'k; gS\
Section B
¼[k.M -B ½ ¼ Short answer type questions)
¼y?kq mÙkjh; ç'u½
Answer any Six questions- Answer the questions in maximum 150 words each.
fdUgh N% iz’uksa ds mÙkj nsaA çR;sd ç'u dk mÙkj vf/kdre 150 'kCnksa esa nsaA
Q.39 R;kx vuqikr vkSj çkfIr ykHk vuqikr esa dksbZ rhu varj crk,¡A
Tell any three distractions between Sacrificing Ratio and Gaining Ratio.
Q.40 va'kksa ds gj.k rFkk iqu% fuxZeu ij dkSu&lh çfof"V;k¡ dh tkrh gS \
what entries are passed in case of forfeiting and re-issue of shares\
Q.41 ,d QeZ dh [;kfr fiNys ik¡p o"kksZa ds vkSlr ykHk ds rhu o"khZ; Øe ds vk/kkj ij
ewY;kafdr dh tkrh gSA 31 ekpZ dks lekIr gksus okys o"kksZa ds uke fuEu çdkj gS%
Goodwill of a firm is valued at three year's purchase of the average profits of the last five
years. The profit of each year ending 31st March are as under;
2020 ₹10]000 Profit ¼ykHk½
2021& ₹15]000 Profit ¼ykHk½
2022 ₹4]000 Profit ¼ykHk½
2023 ₹ 5]000 Loss ¼gkfu½
2024& ₹ 6]000 Profit ¼ykHk½
Calculate the value of goodwill
[;kfr dk ewY; Kkr djsaA
Q.42 A] B, vkSj C ] rFkk esa ykHk ck¡Vrs gq, lk>snkj gSA D dks Hkkx ds fy, u,
lk>sokj ds :i esa QeZ esa ços'k fn;k x;kA lk>snkjksa ds u, ykHk&foHkktu vuqikr Kkr
dhft,A
B and C are partners in proportion of , and respectively. D the firm as a new- partner I
was admitted in with 6 th Share- Calculate the new profit sharing ratio of the partners.
Q.43 X fy- us 100#- okys 4]000] 8%] _.ki= 10% çhfe;e ij fuxZfer fd;s ftu
ij 20:- vkosnu ij ,oa 'ks"k çhfe;e lfgr vkcaVu ij ns; FksA 500 #- _.k ds
fuxZeu ij O;; gq,A dEiuh dh iqLrdksa esa tuZy ds vko';d ys[ks djsaA
X Ltd. issued 4,000, 8% debentures of ₹100 each at a premium of 10%- payable 20 on
application and the balance with premium on allotment- Expenses on issue of debentures
were ₹500 Pass necessary Journal entries in the books of X Ltd. Company.
Q.44 fuEu fyf[kr lwpuk ls leku vkdkj dk ykHk&gkfu fooj.k cukb,%
From the following information] prepare a Common - size Statement of Profit & loss:
Note No. 31-3-2023 31-3-2023

Revenue from 20]00]000 30]00]000

Operation
¼lapkyu ls vk;½
17]00]000 25]00]000
Expenses ¼O;;½
Other Incomes
¼vU; vk;½ 2]00]000 4]00]000
Income Tax
¼vk;dj½ 35% 40%
Interest on drawings is to be charged @ 15% p.a. Calculate interest on partner's drawings.
Q.45 fuEu fn, x, vk¡dM+ksa ls LVkWd vkorZ vuqikr dh x.kuk dhft,!
Calculate inventory turnover ratio from the data given below :-
₹
Inventory at the beginning of the year ¼o"kZ ds çkjaHk esa jgfr;k½ 20]000
Inventory at the end of the year ¼o"kZ ds var esa jgfr;k½ 10]000
Purchases ¼Ø;½ 50]000
Carriage Inwards ¼xkM+h HkkM+k½ 5]000
Revenue from Operations ¼or Sale½ lapkyu ls vk; ¼;k foØ;½ 100,000

Q.46 A] B] vkSj C ,d QeZ esa lk>snkj gSaA vkidks lwfpr fd;k tkrk gS fd :

A, B, and C are partners in a firm- You are informed that:

¼i½ A us QeZ ls çR;sd ekg ds çkjaHk esa 2000#- fudkys A

A draws ₹ 2000 form the firm in the beginning of every month.

¼ii½ B us QeZ ls çR;sd ekg ds vUr esa 2000 # fudkysA

B draws 2000 from the firm at the end of every month.

¼iii½ C us QeZ ls çR;sd ekg ds e/; esa 2000 # fudkysA

C draws ₹ 2000 from the firm at the middle of every month.

vkgj.k ij 15% okf"kZd nj ls C;kt yxk;k tkrk gSA lk>snkjksa ds vkgj.k ij C;kt Kkr
dhft,A-

Section-C ¼[k.M& C½
¼ Long answer type questions ½
¼nh?kZ mÙkjh; ç'u½
Answer any four questions. Answer the questions in maximum 250 words.
fdUgh pkj ç'uksa dk mÙkj nsaA çR;sd ç'u dk mÙkj vf/kdre 250 'kCnksa esa nsaA

Q.47 31 ekpZ] 2024 dks A] B rFkk C dk fuEukafdr fpV~B k Fkk ykHk gkfu vuqikr 3:2:
FkkA
The following was the Balance Sheet of A, B and C who share profits and losses as 3:2:1 as
at 31st March’ 2024:
Liabilities ¼nf;Ro½ # Assets ¼lEifÙk½ #

Bills Payable ¼ns; foi=½ 24-000 Building ¼Hkou½ 68]000

Creditors ¼ysunkj½ 20]000 Plant ¼la;a=½ 36]000
General Reserve ¼lkekU; lap;½ 8]000 Stork ¼jgfr;k½ 48]000
Capital ¼iw¡th½: 1]20]000 Debtors ¼nsunkj½ 16]000
A; 60]000 1]72]000 Cash ¼jksdM+½ & 4-000
B: 40]000 172]000
C: 20]000
bl frfFk ij A fuEu 'krksaZ ij vodk'k xzg.k djrk gS:
A retires on that date on the following terms:
¼i½ QeZ dh [;kfr dk ewY;kadu 12]000 # fd;k tk,A
The goodwill of the firm is to be valued at 12]000&
¼ii½ LVkWd rFkk Hkou esa 4% o`f) djuh gSA
Stock and Building are to be appreciated by 7%
¼iii½ la;a= dks 10% ºzkflr fd;k tkuk gSA
Plant to be depreciated by 10%
vkidh ¼a½ iquewZY;kadu [kkrk rFkk ¼ b½ lk>snkjksa ds iw¡th [kkrs rS;kj djus gSA
You are required to prepare (a) Revaluation A/c and (b) Partner's Capital A/c.
Q.48 X fy- us 10# okys 30]000 va'k tkjh fd;s ftudk Hkqxrku fuEu çdkj gksuk gS:
X Ltd. issued 30,000 shares of ₹ 10 each payable as under;
vkosnu ij ¼On Application½ ₹3
vkcaVu ij ¼On Allotment½ ₹3
çFke ;kpuk ij ¼ On first call) ₹2
vafre ;kpuk ij ¼ On Final call½ ₹2
v'kksd] ftldks 500 va'k vkoafVr fd, x, Fks] og nksuksa ;kpukvksa dh jkf'k nsus esa vleFkZ
jgkA mlds va'kksa dk gj.k dj fy;k x;k vkSj ckn esa gfj dks 9 : çfr va'k ij] iw.kZnÙk
esa iqu% fuxZeu dj fn;kA dEiuh ds tuZy esa vko';d çfof"V;k¡¡ cukb,A
Ashok, who had been allotted 500 shares failed to pay both Calls. His shares were forfeited
and re-issued at 9 per share to Hari, as fully paid-up. Make necessary entries in the books of
company.
Q.49 Z fy- us 1 vçSy] 2020 dks 100 # okys 42]000] 7% _.ki= 10% çhfe;e
ij fuxZfer fd, ftudk 'kks/ku 31 ekpZ] 2024 dks 100 okys lerk va'kksa esa 5%
çhfe;e ij ifjorZu djds gksuk gSA _.ki=ksa ds fuxZeu rFkk 'kks/ku dh çfof"V;k¡ dhft,A
X Ltd. issued 42,000, 7% debentures of ₹100 each at a premium of 10% on 1st April 2020
redeemable by conversion of debentures into shares of 10 each at a premium of 5%. On 31st
March 2024. Record necessary entries for issue and redemption of debentures.
Q.50 [;kfr D;k gS\ [;kfr ds ewY;kadu dh fdUgh nks fof/k;ksa dk o.kZu djsaA
What is Goodwill ? Explain any two methods of valuation of goodwill.
Q. 51 A] B vkSj C lk>snkj gS tks ykHk&gkfu dks cjkcj&cjkcj ck¡Vrs gSaA mUgksaus 31 March
2024 dh QeZ dks fo?kfVr fd;k ftl rkjh[k dks mudh fLFkfr&fooj.k fuEu Fkk\
A, B and C are partners sharing- profits and losses equally. They dissolved the firm on 31st
March 2024 on which date their Balance Sheet was as under:-
Liabilities ¼nkf;Ro½ # Assets ¼lEifÙk½ #
iw¡th [kkrk ¼ Capital A/c½ vpy lEifÙk;ksa ¼ Fixed Assets½ 100]000
A: 30]000 pkyw lEifÙk;k¡ ¼ Current Assets½ 40]000
B: 30]000 90]000 jksdM+ ¼Cash½ 10]000
C: 30]000 60]000
Creditors ¼ysunkj½ 150]000 150]000
lHkh lEifÙk;ksa ls iqLrdh; ewY; ls 10% de çkIr gq,A ysunkjksa dks iw.kZ Hkqxrku dj
fn;k x;k] olwyh ds O;; 500 #- gq, rFkk ,d lEHkkO; nkf;Ro ftlds fy, çko/kku ugha
fd;k x;k Fkk] 500 #- pqdk;k x;kA QeZ dh iqLrdksa esa olwyh [kkrk cukb;sA
All the assets realised 10% less than book value. Creditors were paid in full. Expenses of
realisation amounted to 500₹ and a contingent liability for which no provision was made paid
at: 500- Prepare Realisation Account in the books firm.

Q-52 nks o"kksaZ ds fy, ÛX Ltd. ds fpV~Bs fuEufyf[kr gSA jksdM+ çokg forj.k rS;kj dhft,%&
Following are the Balance Sheets of X Ltd. for two years. Prepare Cash Flow Statement:
Particulars ¼forj.k½ 31st March 2023 31st March 2024
i- Equity and Liabilities ¼lerk ₹ ₹
rFkk ns;rk,¡½
Share Capital ¼va'k iw¡th½ 200]000 250]000
10]000 25]000
Statement of P/L ¼ykHk&gkfu fooj.k½
70]000 45]000
Trade Payables ¼O;kikfjd nsurk,¡½¡
2]80]000 3]18]000
50-000 66]000
ii- Assets ¼lEifÙk;k¡½ 80000 90]000
Land ¼Hkwfe½ 120]000 1]15]000
Stock ¼LVkWd ½ 30]000 47]000
Trade receivables ¼O;kikfjd çkI;rk,¡½ 2]80]000 3]18]000
Cash ¼jksd M+½
 झारखण्ड शै क्षिक अनु संधान एवं प्रक्षशिण पररषद, रााँ ची , झारखण्ड
वाक्षषिक परीिा (Annual Examination)
2024-2025
मॉडल प्रश्न पत्र
किा – XII क्षवषय- व्यावसाक्षयक अध्ययन समय – 3 घण्टा पूणाां क – 80
Class-XII ( Sub- Business Studies) Time- 3 Hour Marks - 80
General Instructions / lkekU; funsZ'k :
1- This Question Booklet has two Parts & Part-A and Part-B.
bl ç'u&iqfLrdk esa nks Hkkx Hkkx&A rFkk Hkkx&B gSaA
2- Part-A is of MCQ Type having 30 marks and Part-B is of Subjective Type having 50 marks.
Hkkx&A esa 30 vad ds cgqfodYih; ç'u rFkk Hkkx&B esa 50 vad ds fo"k;fu"B ç'u gSaA
3- The candidate has to answer in the Answer Booklet which will be provided separately.
ijh{kkFkhZ dks vyx ls miyC/k djkbZ xbZ mÙkj&iqfLrdk esa mÙkj nsuk gSA
4- In Part-A There are 30 Multiple Choice Questions having four (4) options (A, B, C & D). The
candidate has to write the correct option in the Answer Booklet. All questions are compulsory. Each
question carries 1 mark- There is no negative marking for wrong answer.
Hkkx&A esa 30 cgqfodYih; ç'u gSa ftuds 4 fodYi ¼ A] B] C rFkk D½ gSaA ijh{kkFkhZ dks
mÙkj&iqfLrdk esa lgh mÙkj fy[kuk gSA lHkh ç'u vfuok;Z gSaA çR;sd ç'u 1 vad dk gSA xyr
mÙkj ds fy, dksbZ vad dkVk ugha tk,xkA
5- In Part-B There are three sections: Section-A, B & C.
This part is of Subjective Type having Very Short Answer, Short Answer & Long Answer Type
questions- Total number of questions is 22.

Section-A Question, Nos. 31-38 are Very Short Answer Type- Answer any 6 questions. Each
question carries 2 marks- Answer the questions in one sentence each.
Section-B Question Nos. 39-46 are Short Answer Type. Answer any 6 questions. Each question
carries 3 marks. Answer the questions in maximum 150 words each.
Section-C Question Nos. 47-52 are Long Answer Type. Answer any 4 questions. Each question
carries 5 marks. Answer the questions in maximum 250 words each.
Hkkx&B esa rhu [k.M [k.M&A] B rFkk C gSaA bl Hkkx esa vfr y?kq mÙkjh;] y?kq mÙkjh; rFkk nh?kZ
mÙkjh; çdkj ds fo"k;fu"B ç'u gSaA dqy ç'uksa dh la[;k 22 gSA
[k.M&A ç'u la[;k 31&38 vfr y?kq mÙkjh; gSaA fdUgha 6 ç'uksa ds mÙkj nsaA çR;sd ç'u
2 vad dk gSA çR;sd ç'u dk mÙkj ,d okD; esa nhft,A
[k.M&B ç'u la[;k 39&46 y?kq mÙkjh; gSaA fdUgha 6 ç'uksa ds mÙkj nsaA çR;sd ç'u 3
vad dk gSA çR;sd ç'u dk mÙkj vf/kdre 150 'kCnksa esa nsaA
[k.M&C ç'u la[;k 47&52 nh?kZ mÙkjh; gSaA fdUgha 4 ç'uksa ds mÙkj nsaA çR;sd ç'u 5
vad dk gSA çR;sd ç'u dk mÙkj vf/kdre 250 'kCnksa esa nsaA
6- Candidates are required to answer in their own words as far as practicable.
ijh{kkFkhZ ;FkklaHko vius 'kCnksa esa gh mÙkj nsaA

बहु -विकल्पीय प्रश्न (Multiple Choice Questions) :-

1. प्रबंध है (management is) -

(a) कला (art) (b) क्षवज्ञान (science)

(c) कला और क्षवज्ञान दोनों (art and science both) (d) इनमें से कोई नही ं (None of these)

2. हे नरी फेयोल के द्वारा क्षदए गए प्रबंध के क्षसद्ांतों की सं ख्या है (Number of management principles
given by Henry Fayol is)-

(a) 10 (b) 12

(C) 14 (d) 15

3. मानक्षसक क्ांक्षत मू लाधार है (Mental revolution is the essence of) –

(a) वैज्ञाक्षनक प्रबंध का (Scientific management) (b) सं योजन का (Combination)

(C) क्षववेकीकरण का (Rationalisation) (d) इनमें से सभी (All of these)

4. "प्रबन्ध एक पे श ा है ।" यह कथन क्षकसका है ? (“Management is a profession." This statement is

of) -
(a) जॉजि आर. टे री (George R. Terry)
(b) अमे ररकन प्रबन्ध एसोक्षसएशन (American Management Association)
(c) हे नरी फेयोल (Henry Fayol)
(d) उपयुिक्त में से कोई नही ं (None of these)

5.उपभोक्ता क्षववाद क्षनवारण एजेंस ी है (consumer dispute settlement agencies are)

(a) क्षजला मं च (District forum) (b) राज्य आयोग (State commission)

(c ) राष्ट्र ीय आयोग (National commission) (d) इनमें से सभी (All of these)

6. क्षनयंत्रण सं बंक्षधत है (Control is related to) -

(a) पररणाम (results) (b) कायि (functions)
(c) प्रयास (efforts) (d) इनमें से कोई नही ं (none of these)
7. एक अच्छी योजना होती है (A good plan is)
(a) खचीली (expensive) (b) समय लेने वाली (time consuming)
(c) लोचदार (flexible) (d) कठोर (rigid)

8. बडे आकार वाले उपक्म में भारापि ण होता है (In a large sized enterprise
(a) स्वैच्छच्छक (voluntary) (b) आवश्यक (necessary)
(c) अक्षनवायि (compulsory) (d) इनमें से कोई नही ं (none of these)

9. पयिवेिक कडी है (Supervisor is the link between) :

(a) उच्च एवं मध्यम प्रबन्ध के बीच (top and middle management)
(b) कमि चारी एवं मध्यम प्रबन्ध के बीच (workers and middle management)
(c) कमि चारी एवं क्षनम्न प्रबन्ध के बीच (workers and lower management)
(d) कमि चारी एवं सं चालक के बीच (workers and directors)

10. प्रक्षश िण में बल क्षदया जाता है (Training gives emphasis on ) -

(a) सै द् ाच्छिक ज्ञान पर (Theoretical knowledge)
(b) सवाांगीण ज्ञान पर (All round knowledge)
(c) सामान्य ज्ञान पर (General knowledge)
(d) व्यावहाररक ज्ञान पर (Practical knowledge)

11. क्षनम्न में कौन-सा सं गठन सं रचना का प्रकार नही ं है ? (Which of the following is not a type
of organisation structure ?)
(a) रे खीय सं गठन (Line organisation)
(b) कायाित्मक सं गठन (Functional organisation)
(c) रे खीय और स्टाफ सं गठन (Line and staff organisation)
(d) लोचपू णि सं गठन (Flexible organisation)

12. रोजगार कायािलय भती का स्रोत है (Employment exchange is the source of recruitment)
-
(a) आिररक (internal)
(b) बाहरी (external)
(c) आिररक और बाहरी (internal and external)
(d) इनमें से कोई नही ं (none of these)

13. एक अच्छे ने ता के गुण हैं (Qualities of a good leader are) :

(a) शारीररक िमता (Physical capacity) (b) बौच्छद् क योग्यता (Intelligence)
(c) क्षनणि य शच्छक्त (Decisiveness) (d) इनमें से सभी (All of these)
14. क्षनम्न में से कौन-सा सं देश वाहन अफवाहें फैलाता है ? (Which of the following
communications spreads quickly?)
(a) औपचाररक (Formal) (b) अनौपचाररक (Informal)
(c) क्षलच्छखत (Written) (d) इनमें से सभी (All of these)

15. क्षकसका अथि है 'एक योजना, एक बॉस' ? (What means 'one plan, one
boss' ?)
(a) आदे श की एकता (Unity of command) (b) क्षदशा की एकता (Unity of direction)
(c) गैंग प्लैंक (Gang plank) (d) केंद्रीकरण (Centralisation)

16. बजट का अथि है (Budget refers to)-

(a) क्षनष्पादन का क्षनयोक्षजत लक्ष्य (Planned target of performance)
(b) भक्षवष्य के कायिकलाप का प्रयोग (Use of future activities)
(c) सं साधनों का सही क्षवतरण (Systematic action and allocation of resources)
(d) अपे क्षित पररणाम का अंकों में क्षववरण (Statement of expected results expressed in
numerical terms)

17. सबसे अक्षधक व्यापक िेत्र है (Maximum wide scope is of) -

(a) ब्राण्ड (brand) (b) पै केक्षजंग (packaging)
(c) लेबक्षलंग (labelling) (d) व्यापार माकि (trademark)

18. व्यवसाय के क्षलए क्षवपणन है (For business marketing is)—

(a) अक्षनवायि (compulsory) (b) क्षवलाक्षसता (luxury)
(c) आवश्यक (necessary) (d) अनावश्यक (unnecessary)

19. उपभोक्ता के दाक्षयत्व हैं (Responsibilities of consumer are) -

(a) क्य में जल्दबाजी न करें (Do not make hurry in buying)
(b) झूठे एवं भ्रामक क्षवज्ञापन से बचें (Beware of false and misleading advertise)
(c) अक्षधकारों के प्रक्षत सजगता (Awareness towards rights)
(d) उपयुिक्त सभी (All the above)

20. प्रबंध का स्वतः क्षवस्तार होता है (Management itself expands)-

(a ) भारापणि द्वारा (through delegation )

(b ) केन्द्रीकरण द्वारा (through Centralisation )

(c ) क्षवकेन्द्रीकरण द्वारा (through decentralisation )

(d ) सभी के द्वारा (through all )

21. ने ता होता है (The leader is)

(a) जन्म (by birth )

(b) बनाया जाता है (made )

(c) जन्म से एवं बनाया जाता दोनों (by birth and made both)

(d) इनमें से कोई नही ं (none of these )

22. 'अंगूरीलता' सं चार है :('Grapevine' communication is type of)-

(a) औपचाररक सं चार का प्रकार (Formal Communication)

(b) अनौपचाररक सं चार का प्रकार (Informal Communication)

(c) लम्बवत् सं चार का प्रकार (Vertical Communication)

(d) इनमें से कोई नही ं (None of these)

23. जहाजी क्षबल्टी क्षनगित की जाती है (Bill of Lading is issued by)-

(a) जहाजी कम्पनी द्वारा (Shipping company)

(b) आयातक के अक्षभकर्त्ाि द्वारा (Agent of the importer)

(c) जहाज के कप्तान द्वारा (Captain of the ship)

(d) सीमाशु ल्क अक्षधकारी द्वारा (Custom officer)

24. क्षनम्नक्षलच्छखत में से क्षकसका सम्बन्ध पूाँ जी बजक्षटंग से है ? (Which one of the following is related to
Capital budgeting?)

(a) तरल अनु पात (Liquid Ratio)

(b) शु द् वति मान मू ल्य क्षवक्षध (Net Present Value method)

(c) सम-क्षवच्छे द क्षबन्दु क्षवश्लेषण (Break-even Point Analysis)

(d) इनमें से कोई नही ं (None of these)

25.प्रभावी सं देश वाहन के क्षलए आवश्यक है (For effective communication is necessary)

(a) स्पष्ट्ता (Clarity) (b) क्षश ष्ट्ता (Courtesy)

 (c )क्षनरिरता (Continuity) (d) इनमें से सभी (All of these)

26. राज्य आयोग क्षववादों का क्षनपटारा कर सकता है (State Commission can settle disputes) -
(a) ₹20 लाख तक (Upto ₹20 lakh) (b) ₹50 लाख तक (Upto ₹50 lakh)
(c) ₹1 करोड तक (Upto ₹ 1 crore) (d) ₹1 करोड से अक्षधक (Above ₹1 crore)

27. क्षनयंत्रण की तकनीक नही ं है (Out of the following which is not a technique of control) -
(a) अपवाद द्वारा क्षनयंत्रण (Exceptional control) (b) बजट क्षनयंत्रण (Budgetary control)
(c) लागत द्वारा क्षनयंत्रण (Cost control) (d) दण्डात्मक क्षनयंत्रण (Punishable control)

28. क्षनयोजन है (Planning is ) -

(a) लक्ष्य-अक्षभमु ख ी (goal-oriented) (b) उद्देश्य - अक्षभमु ख ी (objective-oriented)
(c) मानक्षसक प्रक्षक्या (mental process) (d) उपयुिक्त सभी (all of the above)

29. क्षवक्य सं वद्ि न के उद्देश्य हैं (Objective(s) of sales promotion is/are)

(a) नई वस्तु से अवगत कराना मात्र (to introduce with new product only)
(b) नए ग्राहक आकक्षषित करने हे तु मात्र (to attract new customers only)
(c) प्रक्षतस्पद्ाि का सामना करने हे तु मात्र (to counter competitior only)
(d) इनमें से सभी (all of these)

30.भारत में उपभोक्ता सं रिण अक्षधक्षनयम प्रभावी है (Consumer Protection Act is effective in India
from)
(a) 15 अप्रै ल, 1986 से (15th April, 1986)
(b) 15 अप्रै ल, 1987 से (15th April, 1987)
(c) 15 अप्रै ल, 1988 से (15th April, 1988)
(d) इनमें से कोई नही ं (None of these)

PART-B ¼Hkkx&c½
¼ Subjective Type ½ ¼fo"k;fu"B ç'u½
Section-A ¼[k.M&A½

अति लघु उत्तरीय प्रश्न (Very short answer type questions)

Answer any Six questions- Answer the questions in one sentence each-
fdUgh N% ç'uksa ds mÙkj nsaA çR;sd ç'u dk mÙkj ,d okD; esa nhft,A
31. प्रबंध की पररभाषा दीक्षजयेI (Define management.)
32. क्षकस प्रकार के सं देश वाहन में अफवाह तथा गलतफहक्षमयों की सम्भावना रहती है ? (Rumours and

distortions take place in which type of communication?)

33. राज्य आयोग क्षकतने रुपए तक के क्षववादों का समाधान करता है ? (State commission redresses the

grievances upto what amount?)

34. उपभोक्ता से क्या आशय है ? (What is meant by consumer?)

35. प्रे रणाओं के मु ख्य प्रकार क्षलखें I (Write the main types of Incentives.)

36. राष्ट्र ीय उपभोक्ता क्षदवस कब मनाया जाता है ? (When is National Consumer Day celebrated?)

37. प्रबंध का अंक्षतम कायि कौन सा है ? (What is the last function of management?)

38. क्षनयन्त्रण से आप क्या समझते हैं ? (What do you mean by Controlling?)

Section B
¼[k.M -B ½ ¼ Short answer type questions)
¼y?kq mÙkjh; ç'u½
Answer any Six questions- Answer the questions in maximum 150 words each.
fdUgh N% iz’uksa ds mÙkj nsaA çR;sd ç'u dk mÙkj vf/kdre 150 'kCnksa esa nsaA
39. आदशि योजना की कोई दो क्षवशे षताएाँ सं िेप में समझाइए। (Explain in brief any two
characteristics of an ideal plan.)

40.अनौपचाररक सम्प्रे षण को पररभाक्षषत करें I (Define Informal Communication.)

41. अपने क्षहतों की सु रिा हे तु उपभोक्ताओं के क्षकन्ी ं छ: उर्त्रदाक्षयत्वों की सं िेप में व्याख्या
कीक्षजए।(Explain, in brief, any six responsibilities of consumer to safeguard their interest.)

42. उत्पादकों तथा समाज के क्षलए क्षवज्ञापन के लाभों का सं क्षिप्त वणि न कीक्षजए।(Explain briefly the
benefits of advertising to manufacturers and society.)

43.'क्षनदे श न' तथा पयिवेिण' में अिभेद कीक्षजए।(Distinguish between 'Direction' and
'Supervision'.)
44. पै केक्षजंग के कायों को क्षलखें । (Write the functions of packaging.)
45. उपभोक्ता के क्षनम्नक्षलच्छख त अक्षधकारों को समझाइए | (Explain the following rights of a
consumer)-
(i) सु रिा का अक्षधकार (Right to safety)
(ii) उपभोक्ता क्षश िा का अक्षधकार (Right to Consumer Education)

46. बजटीय क्षनयंत्रण के क्या लाभ हैं ? (What are the advantages of Budgetary Control?)

Section-C ¼[k.M& C½
¼ Long answer type questions ½
¼nh?kZ mÙkjh; ç'u½
Answer any four questions. Answer the questions in maximum 250 words.
fdUgh pkj ç'uksa dk mÙkj nsaA çR;sd ç'u dk mÙkj vf/kdre 250 'kCnksa esa nsaA
47. "समन्वय प्रबन्ध का सार है ।" क्या आप इससे सहमत हैं ? कारण बताइए। (“Co-ordination is the
essence of Management.” Do you agree with this? Give reasons.)

48. 'क्षवज्ञापन करना लाभदायक है ।," क्या आप इस कथन से सहमत हैं ? अपने उर्त्र के समथिन में कारण
बताइए।" (It pays to advertise." Do you agree with this statement? Give reasons in support
of your answer.)

49. क्षवपणन क्षमश्रण के तत्वों का वणि न करें I (Describe the elements of marketing mix.)

50. प्रभावशाली ने तृत्व के क्षलए एक प्रबंधक में कौन-कौन से गुण होने चाक्षहए?( What are the qualities a
manager should have for effective leadership?)

51. वैश्वीकरण से क्या आशय है ? वैश्वीकरण की मु ख्य क्षवशे षताओं का वणि न कीक्षजए। (What is meant by
Globalisation ? Describe the main features of globalisation.)

52. प्रभावशाली सं देश वाहन की क्षवक्षभन्न बाधाओं का वणि न कीक्षजए।(Explain various barriers to effective
communication.)
 ं ान एवं प्रक्षशिण पररषद् ,रााँची
झारखण्ड शैक्षिक अनुसध
Jharkhand Council of Educational Research and Training, Ranchi

MODEL QUESTION PAPER

Session: 2024-25 ( - )

Class – 12 F. M. – 80 Time – 3 Hours

Subject – BMT

INSTRUCTIONS / निर्दे श :
1. Examinee are required to answer in their own words as far as practicable.
ijh{kkFkhZ ;FkklaHko vius 'kCnksa esa gh mÙkj nsAa
2. This question papers have four sections: A, B, C and D. Total number of
questions are 52.
bl iz’ui= esa pkj [k.M & A, B, C ,oa D gSaA dqy iz'uksa dh la[;k gSA
3. There are 30 Multiple Choice Questions in the Section A. Four options are given
for each question, choose one of the correct options.
A esa dqy 30 cgqfodYih; ç'u gSa A izR;sd iz'u ds pkj fodYi fn, x, gSa]
buesa ls ,d lgh fodYi dk p;u dhft,A
4. Section B – Question numbers 31 – 38 are very short answer type. Answer
any six of these questions. Each question carries 2 marks.
B esa iz'u la[;k gSaA buesa ls fdUgh Ng
iz'uksa ds mÙkj nhft,A izR;sd iz'u dk eku vad fu/kkZfjr gSA
5. Section C – Question numbers 39 – 46 are short answer type. Answer any six
of these questions. Each question carries 3 marks.
Cesa iz' u la[;k gSa A buesa ls fdUgh Ng iz' uksa
ds mÙkj nhft,A izR;sd iz'u dk eku vad fu/kkZfjr gSA
6. Section D – Question numbers 47 – 52 are long answer type. Answer any four
of these questions. Each question carries 5 marks.
D esa iz'u la[;k gSaA buesa ls fdUgh pkj
iz'uksa ds mÙkj nhft,A izR;sd iz'u dk eku vad fu/kkZfjr gSA

Page 1 of 7
 Section-A - (𝟏 × 𝟑𝟎 = 𝟑𝟎)
1. Which is the 27th term of the sequence 5, 14, 23, ………….?
vuqdze 5] 14] 23]---------------- dk 27okW in fuEukafdr esa dkSu gS \
(a) 239 (b) 100 (c) 101 (d) 900
2. In an A.P. first term is 1 and last term is 11. If the sum of n terms is 36, the value of
n will be :
,d lkekarj Js<h es igyk in 1 gS vkSj vfUre in 11 gS A ;fn n inksa dk ;ksx 36 gks rks n dk eku
gksxk %
(a) 10 (b) 7 (c) 6 (d) 5
3. The third term in G.P. is 4. The product of first 5 term is :
,d xq.kksŸkj Js<h esa rhljk ib 4 gSA blds izFke 5 inksa dk xq.kuQy gS &
(a) 256 (b) 2,048 (c) 512 (d) 1,024
4. If 15pr = 2,730 then the value of r will be :
;fn 15pr = 2,730 gks rks r dk eku gksxk &
(a) 3 (b) 4 (c) 5 (d) 6
5. If n c12 = n c8 then n is equal to :
;fn n c12 = n c8 rc n cjkcj gS %
(a) 20 (b) 12 (c) 6 (d) 30
6. How many different word of 2 letters can be formed out of the letter of the word
CAT ?
CAT “kCn ds v{kjksa ls 2&2 v{kjksa ds fdrus “kCn cu ldrs gSa \
(a) 8 (b) 6 (c) 3 (d) 2
7. If n P3 =60 then the value of n is :
;fn n P3 =60 ] rks n dk eku gS&
(a) 3 (b) 5 (c) 9 (d) 20

X2 X
8. The value of 5x 5
(a)0 (b) 1 (c) 5 (d) 25
9. In a row matrix, the no. of row is :
iafDr vkO;wg esa iafDr;ksa dh la[;k gksrh gS )-
(a) 1 (b) 2 (c) 3 (d) None of these (buesa ls dksbZ ugha)

3 1 4 7
10. If A = [ ],B=[ ], then A + B :
7 6 5 2

Page 2 of 7
 3 1 4 7
;fn A = [ ], B =[ ], rks A + B : -
7 6 5 2

12 7 7 8 −1 −6 3 7
(a) [ ] (b) [ ] (c) [ ] (d) [ ]
35 12 12 8 −2 4 5 6

11. (If A= {a, b, c, d}, B= {b, d, e, f} then the value of A ∩ B will be) : If uniVersel set
x = {1.2.3…20}
यदि A= {a, b, c, d.}, B= {b, d, e, f,} rks A ∩ B
(a) {a, b, c, d, e.f) (b) {b, d} (c) {d, e,f} (d) {c, d, e}
12. If A= {p, q, r, s}, B= {q, s, t}, C = {m, q, n},then the value of C – (A∩ B)
यदि A = {p,q,r, s}, B= {q, s, t,}, C = {m, q, n}, rks C-(A∩B) dk eku gksxk

(a) {m, n} (b) {p, q} (c) (r, s} (d) {p, r}

13. The differential coefficient of 3x4 w.r.t. x will be:
x ds lkis{k 3x4 dk vodyu xq.kkad gksxk %
(a) 16x (b) 16x2 (c) 12x2 (d) 4x3
𝑑𝑦
14. If y = 2 log 𝑥 then is equal to:
𝑑𝑥
𝑑𝑦
;fn y = 2 log 𝑥 rks cjkcj gS%
𝑑𝑥
(a) X (b) 2 (c) 0 (d) 2/x
15. ∫(2𝑥 + 3)5 𝑑𝑥 = ?
(2𝑥+3)6
(a) +C
6
(2𝑥+3)4
(b) +C
8
(2𝑥+3)6
(c) +C
12

(d) N0ne of these (buesa ls dksbZ ugha)

16. The best measure to central tendency is A.M is it true ?
dseUnzh; izo`fr dk loksÙZ ke eki lekUrj ek/; gSA D;k ;g lR; gS \
(a) yes (b) No
17. Mean of 5, 8, 11, 16, 15 is:
5] 8] 11] 16] 15 dk ek/; gS%
(a) 10 (b) 11 (c) 12 (d) 13
18. Median of 80, 100, 90, 170, 60, 50, 40.
80, 100, 90, 170, 60, 50, 40 dk ekf/;dk gS &
(a) 80 (b) 170 (c) 90 (d) 60

Page 3 of 7
19. Median is:
ekf/;dk gS%
(a) Most frequent value, lcls vf/kd ckj vkus okyk eku
(b) Least frequent value, lcls de ckj vkus okyk eku
(c) Center of gravity, x:Ro dsUnz
(d) Middle most value, chp dk eku
20. Mode is:
cgqyd gS%
(a) Most frequent value, lcls vf/kd ckj vkus okyk eku
(b) Least frequent value, lcls de ckj vkus okyk eku
(c) Middle most value, chp dk eku
(d) Representing majority out of total frequency, dqy ckjEckj es lokZf/kd dk fu:fir djus
okyk
21. Which of the following is true?
fuEukafdr esa dkSu&lk lR; gS\
(a) Mean= 3 Median – 2 Mode, ek/; =3 ekf/;dk & 2 cgqyd
(b) Median = 3 Mode – 2 Mean, ekf/;dk = 3 cgqyd & 2 ek/;
(c) Mode = 3 Median – 2 mean, cgqyd = 3 ekf/;dk & 2 ek/;
(d) Mode = Mean + Median , cgqyd = ek/; $ ekf/;dk
22. Which of the following relationship is correct?
fuEu es ls dkSu&ls lacU/k lgh gS\
(a) A.M. = √𝐺. 𝑀 × 𝐻. 𝑀. (b) H.M. = √𝐴. 𝑀.× 𝐺. 𝑀 (c) G.M. = √𝐺. 𝑀.× 𝐻. 𝑀.
𝐴.𝑀+𝐻.𝑀.
(d ) G.M. =
2

23. The geometric mean of two number 8 and 18 shall be:

nks vadks 8 vkSj 18 dk xq.kksÙkj ek/; gksxk%
(a) 12 (b) 13 (c) 15 (d) 11.09
24. Least square method is used for calculating trend:
U;wure oxZ jhfr dk iz;ksx miufr Kkr djus ds fy, fd;k tkrk gS%
(a) True, lgh (b) false, xyr (c) Both (d) None of these
25. The most important factor causing seasonal variations are:
ekSleh forj.kksa dks mRiUu djus okys lcls egRoiw.kZ dkjd gS%
(a) growth of population, tula[;k c`f)
(b) change in fashion QS” ku esa ifjorZu
(c) weather and social customs ekSle vkSj lkekfrd jhfrfjokt
(d) technological improvement rduhfd lq/kkj

Page 4 of 7
26. The probability of drawing a red ball from a bag containing 4 red and 5 white balls
is:
4 yky rFkk 5 lQsn xsnksa okys ,d FkSys esa ls ,d yky xsan fudkyus dh izkf;drk gS%
(a) 4/5 (b)3/5 (c) 1/5 (d) 4/9

27. The probability of 53 Sundays in randomly chosen leap year is:

,d ;kn`PN;k pqus x, vf/k&o’kZ esa 53 jfookj gksus izkf;drk gS%
(a) 3/7 (b) 1/7 (c) 2/3 (d) 2/7
28. In a single throw of two dice the probability of getting a total greater than 8 is:
nks ik¡ls ,d ckj Qsd
a us ij 8 ls vf/kd ;ksx izkIr gksus dh izkf;drk gS%
(a) 8/36 (b) 12/36 (c) 5/8 (d) 4/16
29. At the time of interpolation continuous series is not cumulated under:
vkUrjx.ku djrs le; lrr~ Js.kh dks ---- lap;h ugha cuk;k tkrk gS%
(a) Binomial expansion method f}in foLrkj jhfr esa
(b) Netwon’s method U;wVu jhfr esa
(c) Lagrange’s method ySaxjst jhfr esa
(d) All the above mi;qZDr lHkh esa
30. Binomial expansion method is based on:
f}in foLrkj jhfr vk/kkfjr gS%
(a) Multiplication theorem xq.ku izes; ij
(b) Additive theorem ;ksx izes; ij
(c) Binomial theorem f}in izes; ij
(d) None of these buesa ls dksbZ ugha

Section-B - (𝟐 × 𝟔 = 𝟏𝟐)

31. यदि n C4 = 5 x n P3 तो n का मान ज्ञात करें ।

If n C4 = 5 x n P3, find n.
32. मान दनकादिये (Evaluate)
5 10 8
4 3 2
7 9 8
33. समाकिन करें (Integrate)

ʃ 𝑑𝑥
25 − 𝑥2
(x<5)

34. 52 पत्ोों वािे ताश की एक गड्डी से एक रानी के खीोंचे जाने की प्रदयकता क्या है ?
What is the probability of drawing a Queen in a draw from a pack of 52 cards?
Page 5 of 7
 35. एक छात्र द्वारा अोंग्रेजी, गदित एवों अर्थ शास्त्र में प्राप्ाों क क्रमशः 75, 92 तर्ा 49 है तो उसका औसत प्राप्ाों क
दनकािें ।
The marks obtained by a student in English, Mathematics and Economics are
75, 92, and 49. Find its Average score.
2 13
36. यदि (If) A = [ ] तो 𝐴𝐼 ज्ञात करें । (then find 𝐴𝐼 ).
4 −32
37. यदि (If) A = { 3,5,7,9} , B = { 6,8,10} तो (then find) A U B ज्ञात करें ।
38. If 𝐴 and 𝐵 are two events such that 𝑃(𝐴) = 1/4, 𝑃(𝐵) = 1/2 and 𝑃(𝐴 ∩ 𝐵) =
1/8, then find 𝑃(not 𝐴 and not 𝐵).
1 1
;fn 𝐴 vkSj 𝐵 nks ,slh ?kVuk,¡ gS fd 𝑃(𝐴) = , 𝑃(𝐵) = vkSj 𝑃(𝐴 ∩ 𝐵) = 4 2
1/8 rks 𝑃( 𝐴-ugha vkSj 𝐵-ugha) Kkr dhft,A

Section-C - (𝟑 × 𝟔 = 𝟏𝟖)

39. यदि दकसी समान्तर श्रे िी का 8 वॉ और 25 वॉ पि क्रमशः 15 और 49 है तो पहिा पि और पिान्तर ज्ञात कीदजए।
If 8th and 25th term of an A.P are 15 and 49 respectively then find its first term and
common difference.
2 6
40. मैदरि क्स []का व्युत्क्रम ज्ञात करें ।
3 5
2 6
Find the inverse of Matrix [ ].
3 5
41. 520 व्यक्तियोों के समूह में 360 केवि दहन्दी तर्ा 130 केवि अोंग्रजी बोि सकते हैं । दकतने व्यक्ति दहन्दी और अोंग्रजी िोनोों
बोि सकते हैं ?
In a group of 520 persons, 360 can speak only Hindi and 130 only English. How many
persons can speak both Hindi and English?
42. x के सापेक्ष अवकिन कीदजए (Differentiate with respect to x).
(𝑥 − 3)(𝑥 + 2)
𝑥
43. मान दनकािें (Evaluate).

ʃ 𝑒 𝑛 (𝑛−1)
𝑥2
dx
44. एक व्यक्ति 4 में से 3 दनशानें सही िगाता है और िू सरा व्यक्ति 3 में से 2 दनशानें सही िगाता है । यदि िोनोों ही व्यक्ति एक
सार् प्रयत्न करें तो िक्ष्य के भे ि प्रदयकता ज्ञात कीदजए।
A person is known to hit the target in 3 out of 4 shots, whereas another person is
known to hit 2 out of 3 shots. Find the probability of the target being hit at all when
they both try.
Page 6 of 7
45. यदि िो सों ख्याओों का समान्तर माध्य 10 है और उनका गुिोत्र माध्य 8 है तो उनका हरात्मक माध्य ज्ञात कीदजए।

If Arithmetic mean and Geometric mean of two numbers are 10 and 8 respectively,
find its Harmonic mean.
46. 8 और 11 और का गुणोत्तर माध्य निकालें ।
Find the G. P. of 8 and 11.

Section-D - (𝟓 × 𝟒 = 𝟐𝟎)

47. दनम्न आँ कड़ोों से माक्तध्य का ज्ञात कीदजएः

Calculate median from the following data:
प्राप्ाोंक (Marks) : 5-10 10-15 15-20 20-25 25-30 30-35 35-40 40-45

छात्रोों की सोंख्या 6 5 18 10 5 4 2 2
(Number of students)

48. काि श्रे िी क्या है ? काि श्रे िी दवश्लेषि का महत्व की व्याख्या करें ।
What is a time series? Explain the importance of Time Series Analysis.
49. दनम्न तादिका में तत्काि जीवन की वादषथकी 100 रू0 चुकाने के दिए दिखाया गया है ः
The following table shows the value of an immediate life annuity for Rs. 100 paid:
उम्र वषों में 40 50 60 70
(Age in years)
वादषथ की (Annuity) 6.2 7.2 9.1 12.0

42 वषथ की आयु के दिए वादषथ की ज्ञात कीदजए।

Interpolate the annuity for the age of 42.
50. समाकिन करें (Integrate)
(i). ∫ log 𝑥 𝑑𝑥 (ii). ʃ x √ 𝑥 − 1 dx

51. 5+55+555+…………………….. n पिोों तक का योगफि ज्ञात करें ।

Find the Sum to the n terms
5+55+555+…………………….. n
𝑥2 +1
52. Find the differential coefficient of function .
𝑥2

Page 7 of 7
 ENTREPRENEURSHIP
CLASS XII (2024-25) MODEL
QUESTION PAPER

TIME: 3 HOURS M.M. – 70

GENERAL INSTRUCTIONS:
(i) परीक्षार्थी यथासंभव अपने शब्दों में उत्तर दें। / Candidates should answer in their own
words as much as possible.
(ii) सभी प्रश्न अनिवार्य हैं। / All questions are compulsory.
(iii) कुल प्रश्नों की संख्या 48 है। / Total number of questions is 48.
(iv) प्रश्न संख्या 1 से 25 तक बहुविकल्पीय प्रश्न हैं। प्रत्येक प्रश्न के चार विकल्प दिए गए हैं। सही
विकल्प का चयन करें। प्रत्येक प्रश्न के लिए 01 अंक निर्धारित है। / Question numbers 1
to 25 are multiple-choice questions. Each question has four options. Select
the correct option. Each question carries 01 mark.
(v) प्रश्न संख्या 26 से 34 तक अति लघु उत्तरीय प्रश्न हैं। इनमें से किन्हीं 7 प्रश्नों का उत्तर देना
अनिवार्य है। प्रत्येक प्रश्न के लिए 01 अंक निर्धारित है। / Question numbers 26 to 34 are
very short answer questions. Out of these, it is mandatory to answer any 7
questions. Each question carries 01 mark.
(vi) प्रश्न संख्या 35 से 42 तक लघु उत्तरीय प्रश्न हैं। इनमें से किन्हीं 6 प्रश्नों का उत्तर देना
अनिवार्य है। प्रत्येक प्रश्न के लिए 03 अंक निर्धारित हैं। / Question numbers 35 to 42 are
short answer questions. Out of these, it is mandatory to answer any 6
questions. Each question carries 03 marks.
(vii) प्रश्न संख्या 43 से 48 तक दीर्घ उत्तरीय प्रश्न हैं। इनमें से किन्हीं 4 प्रश्नों का उत्तर देना
अनिवार्य है। प्रत्येक प्रश्न के लिए 05 अंक निर्धारित हैं। / Question numbers 43 to 48
are long answer questions. Out of these, it is mandatory to answer any 4
questions. Each question carries 05 marks.

Q.N. QUESTIONS

MCQ

1.
“In a partnership form of business, each partner can bind the firm and other
partners by his/her acts.” In the context of this statement, identify the essential
feature of a partnership business organisation referred to and choose the
correct option: / "साझेदारी व्यवसाय में, प्रत्येक साझेदार अपने कार्यों द्वारा फर्म और अन्य
साझेदारों को बाध्य कर सकता है।" इस कथन के संदर्भ में साझेदारी व्यवसाय संगठन की उस
आवश्यक विशेषता की पहचान करें और सही विकल्प का चयन करें:

(a)Implied authority / निहित अधिकार

(b)Utmost good faith / परम सद्भावना

(c)Mutual agency / परस्पर एजेंसी
(d)Separate legal entity / पृथक कानूनी अस्तित्व
 2. Sudha Dairy Farms have been in the business of processing pure ghee using
the ‘Bilona technique’. The cost per kilo of ghee comes out to be ₹ 2000. The
owners have estimated that a reasonable profit margin will be 25%. So, they
have decided to sell the product at ₹ 2500 per kilo. / निर्मला डेयरी फार्म ‘बिलोना
तकनीक’ का उपयोग करके शुद्ध घी का प्रसंस्करण कर रहे हैं। घी का प्रति किलो लागत मूल्य ₹
2000 आता है। मालिकों ने यह अनुमान लगाया है कि 25% लाभ मार्जि न उपयुक्त रहेगा। इसलिए
उन्होंने इसे ₹ 2500 प्रति किलो बेचने का निर्णय लिया है।
Which of the following is a drawback of this pricing strategy? / निम्नलिखित में से
कौन सी इस मूल्य निर्धारण रणनीति की एक कमी है?
(a) It attracts only the bargain hunters who switch to other brands if the price
rises./ यह केवल उन ग्राहकों को आकर्षि त करता है जो सौदेबाजी पसंद करते हैं और कीमत
बढ़ने पर अन्य ब्रांडों की ओर चले जाते हैं।
(b) Is not a viable option if there are strict legal and government regulations./
यदि सख्त कानूनी और सरकारी नियम लागू हों तो यह एक व्यावहारिक विकल्प नहीं है।
(c) It does not take into account the competitor's pricing and actions./ यह
प्रतिस्पर्धि यों के मूल्य निर्धारण और उनके कदमों को ध्यान में नहीं रखता।
(d) It leads to a series of counteroffers that sometimes result in no sale./ यह
कई प्रतिप्रस्तावों की स्थिति उत्पन्न करता है, जो कभी-कभी बिक्री में विफल हो जाते हैं।
3.
Which of the following plans helps organize work to clearly form an idea about
the plan layout? / निम्नलिखित में से कौन-सी योजना काम को इस तरह से व्यवस्थित
करने में मदद करती है कि कोई स्पष्ट रूप से योजना ले आउट के बारे में विचार बना सके?
(a) Operational / परिचालन
(b) Production / उत्पादन
(c) Marketing / विपणन
(d) Financial / वित्तीय

Codes / कोड:
a) Only 1 / केवल 1
b) 2 and 3 / 2 और 3
c) 1 and 4 / 1 और 4
d) Only 4 / केवल 4

4. Under this franchising model, the manufacturer authorizes the store owner to
distribute goods produced under their brand name. / इस फ्रैंचाइजिं ग मॉडल के तहत,
निर्माता स्टोर मालिक को उनके ब्रांड नाम के तहत निर्मि त माल वितरित करने का अधिकार देता है।
(a) Product franchise business opportunity / उत्पाद फ्रैंचाइज़ व्यवसाय का अवसर
(b) Manufacturing franchise opportunity / विनिर्माण फ्रैंचाइज़ अवसर
(c) Business franchise venture / व्यवसाय फ्रैंचाइज़ उद्यम
(d) Business format franchise opportunity / व्यवसाय प्रारूप फ्रैंचाइज़ अवसर
5.
Sam, an MBA student at Quantum University, reads about a principle stating that
80% of a business's profit comes from 20% of customers. Help Sam identify this
principle. / सैम, जो क्वांटम यूनिवर्सि टी में एमबीए का छात्र है, एक सिद्धांत के बारे में पढ़ता है
जिसमें कहा गया है कि किसी व्यवसाय का 80% लाभ 20% ग्राहकों से आता है। सैम की मदद करें
और इस सिद्धांत की पहचान करें।
(a) Profit principle / लाभ सिद्धांत
(b) Pareto’s principle / पेरटे ो का सिद्धांत
(c) Harley’s principle / हार्ले का सिद्धांत
(d) Smith’s principle / स्मिथ का सिद्धांत

Codes / कोड:
a) Only 2 / केवल 2
b) 1 and 2 / 1 और 2
c) Only 3 / केवल 3
d) All of these / ये सभी

6. Routing is an element of which component of a business plan? / रूटिंग व्यवसाय

योजना के किस घटक का एक तत्व है?
(a) Production / उत्पादन
(b) Operational plan / परिचालन योजना
(c) Organizational plan / संगठनात्मक योजना
(d) Financial plan / वित्तीय योजना
7. Which of the following is not a component of a financial plan? / निम्नलिखित में से
कौन-सा वित्तीय योजना का घटक नहीं है?
(a) Economic and social variables / आर्थि क और सामाजिक चर
(b) Follow-up / अनुवर्ती
(c) Break-even analysis / ब्रेक-ईवन विश्ले षण
(d) Proforma investment decisions / प्रोफार्मा निवेश निर्णय

8. Alia, running a homemade papad business in Pune, struggles to introduce new

flavors due to limited financial resources. Which characteristic of her business
does this highlight? / आलिया, जो पुणे में घर का बना पापड़ व्यवसाय चला रही है, सीमित वित्तीय
संसाधनों के कारण नए फ्ले वर पेश करने में संघर्ष करती है। यह स्थिति उसके व्यवसाय की कौन-सी
विशेषता को दर्शाती है?
(a) Individual management and control / व्यक्तिगत प्रबंधन और नियंत्रण
(b) Easy formation and closure / आसान गठन और समापन
(c) Limited area of operation / सीमित संचालन क्षेत्र
(d) Unlimited liability / असीमित देयता
9.
From the given data, calculate the economic order quantity (EOQ) for the
company. / दी गई जानकारी के आधार पर, कंपनी के लिए आर्थि क आदेश मात्रा (EOQ) की
गणना करें।

● Cost of product = 12000 units at ₹1000/unit / उत्पाद की लागत = 12000 यूनिट प्रति
यूनिट ₹1000
● Cost of ordering = ₹500 per order / ऑर्डर लागत = ₹500 प्रति ऑर्डर
● Holding cost = ₹300 per annum / रखरखाव लागत = ₹300 प्रति वर्ष

Options / विकल्प:
(a) 400
(b) 250
(c) 300
(d) 200

10.
Hargold Company continuously improves its bread range and introduces new
variants like atta bread and garlic bread. What is the source of their idea in the
market? / हर्गोल्ड कंपनी लगातार अपनी ब्रेड रेंज में सुधार कर रही है और आटा ब्रेड और लहसुन ब्रेड
जैसे नए वेरिएं ट पेश कर रही है। बाजार में उनके विचार का स्रोत क्या है?
(a) Market driven / बाजार प्रेरित
(b) Creative efforts / रचनात्मक प्रयास
(c) Service driven / सेवा प्रेरित
(d) Natural resources / प्राकृतिक संसाधन

Codes / कोड:
a) 1 and 2 / 1 और 2
b) Only 2 / केवल 2
c) Only 3 / केवल 3
d) 3 and 4 / 3 और 4

11.
Hargold Bakers produce 50 cakes daily and sold 49 cakes on Monday with a
gross profit of ₹1200 per unit. What were the fixed expenses of the bakery? /
हर्गोल्ड बेकर्स प्रतिदिन 50 केक बनाते हैं और सोमवार को 49 केक बेचकर प्रति यूनिट ₹1200 का
सकल लाभ अर्जि त करते हैं। बेकरी के निश्चित खर्च क्या थे?

Options / विकल्प:
(a) ₹57000
(b) ₹24480
(c) ₹58800
(d) ₹59000
12. The element of the financial plan that describes how the enterprise funds will be
allocated to different assets so that the enterprise can earn the highest possible
return is known as: / वित्तीय योजना का वह तत्व जो वर्णन करता है कि कैसे उद्यम के धन को
विभिन्न परिसंपत्तियों में आवंटित किया जाएगा ताकि उद्यम अधिकतम संभव लाभ कमा सके, उसे
कहा जाता है:
(a) Investment decision / निवेश निर्णय
(b) Financing decision / वित्तपोषण निर्णय
(c) Income statements / आय विवरण
(d) Cash flow statement / नकदी प्रवाह विवरण
13. ........... indicates the percentage of return on total capital employed in the
business. / .......... व्यवसाय में कुल निवेश पूंजी पर प्रतिशत वापसी को इं गित करता है।
(a) Unit cost / यूनिट लागत
(b) Return on equity / इक्विटी पर वापसी
(c) Average cost / औसत लागत
(d) Return on investment / निवेश पर वापसी

14. Which of the following is an advantage of issuing shares through a ‘Rights issue’?
/ 'राइट्स इश्यू' के माध्यम से शेयर जारी करने का निम्नलिखित में से कौन सा लाभ है?
(a) It is an inexpensive method of issuing shares. / यह शेयर जारी करने की सस्ती विधि
है।
(b) It leads to higher employee motivation and lower labor turnover. / यह उच्च
कर्मचारी प्रेरणा और कम श्रम पलायन दर का कारण बनता है।
(c) It results in higher valuations of companies and better prestige. / यह कंपनियों
के उच्च मूल्यांकन और बेहतर प्रतिष्ठा का कारण बनता है।
(d) This method helps in maintaining confidentiality. / यह विधि गोपनीयता बनाए
रखने में मदद करती है।
15.
Given below are assumptions made by an entrepreneur in the breakeven-point
analysis for a multi-product business. Identify the correct pair of assumptions: /
नीचे बहु-उत्पाद व्यवसाय के लिए ब्रेक-ईवन बिं दु विश्ले षण में एक उद्यमी द्वारा की गई धारणाएं दी
गई हैं। सही जोड़ी की पहचान करें:

(i) The proportion of the sales mix must be predetermined. / बिक्री मिश्रण का
अनुपात पूर्वनिर्धारित होना चाहिए।
(ii) The sales mix must change within the relevant period. / बिक्री मिश्रण को
प्रासंगिक अवधि के भीतर बदलना चाहिए।
(iii) All costs can be categorized as variable or fixed. / सभी लागतों को परिवर्ती
या स्थिर के रूप में वर्गीकृत किया जा सकता है।
(iv) Sales price per unit, variable cost per unit, and total fixed cost are
calculated as per the forces of demand and supply. / प्रति इकाई बिक्री मूल्य,
प्रति इकाई परिवर्ती लागत, और कुल स्थिर लागत मांग और आपूर्ति की ताकतों के अनुसार
 गणना की जाती है।
(v) All units produced are not sold. / सभी उत्पादित इकाइयों की बिक्री नहीं होती है।

Choose the correct pair of assumptions: / सही जोड़ी चुनें:

(a) (i) and (iii)
(b) (ii) and (iii)
(c) (iv) and (v)
(d) (i) and (iv)

16. Identify which of the following is NOT a current asset for a furniture manufacturing
unit: / पहचानें कि निम्नलिखित में से कौन फर्नीचर निर्माण इकाई के लिए चालू परिसंपत्ति नहीं है:
(a) Debtors / देनदार
(b) Outstanding expenses / बकाया व्यय
(c) Stock of tables and chairs / टे बल और कुर्सि यों का स्टॉक
(d) Short-term investment / अल्पकालिक निवेश
17. In .......... acquisition, the purchasing company becomes a subsidiary of the
purchased company. / .......... अधिग्रहण में, खरीदार कंपनी खरीदी गई कंपनी की सहायक
कंपनी बन जाती है।
(a) Friendly / मैत्रीपूर्ण
(b) Reverse / उल्टा
(c) Backflip / बैकफ्लिप
(d) Hostile / शत्रुतापूर्ण
18. Firefun Limited is an electrical appliance manufacturer and has introduced a
new induction cooker that minimizes electricity consumption and can also run
on backup battery power. The production team has begun manufacturing, and
selected customers will soon receive samples to assess the product's reliability
and quality. / फायरफन लिमिटे ड एक विद्युत उपकरण निर्माता है और उसने एक नया इं डक्शन
कुकर पेश किया है जो बिजली की खपत को कम करता है और बैटरी बैकअप पर भी चल सकता
है। उत्पादन टीम ने निर्माण शुरू कर दिया है और जल्द ही चुने गए ग्राहकों को उत्पाद की
विश्वसनीयता और गुणवत्ता का आकलन करने के लिए नमूने दिए जाएं गे।
Which idea generation field is highlighted in the scenario? / इस परिदृश्य में कौन सा
विचार उत्पत्ति क्षेत्र उजागर हुआ है?
(a) Service-related / सेवा-संबंधित
(b) Market driven / बाजार प्रेरित
(c) Natural resources / प्राकृतिक संसाधन
(d) Creative efforts / रचनात्मक प्रयास
19. Tina is a young entrepreneur who started selling handmade hair extensions
online in 2010 after identifying a market gap. She observed that many girls
faced hair fall problems and discovered the high cost of hair extensions. She
started her own venture using real hair and sold them at affordable prices. /
टीना एक युवा उद्यमी है जिसने 2010 में ऑनलाइन हस्तनिर्मि त बाल एक्सटें शन बेचने का काम
शुरू किया। उसने देखा कि कई लड़कियों को बाल झड़ने की समस्या का सामना करना पड़ता है
और पाया कि बाल एक्सटें शन बहुत महंगे होते हैं। इसलिए उसने असली बालों से एक्सटें शन
बनाकर उन्हें सस्ती कीमतों पर बेचना शुरू किया।
Which aspect of environmental scanning did Tina utilize? / टीना ने पर्यावरण
स्कैनिं ग के किस पहलू का उपयोग किया?
(a) Better performance / बेहतर प्रदर्शन
(b) Grabbing opportunities from the market / बाजार से अवसरों को पकड़ना
(c) Resource allocation / संसाधन आवंटन
(d) All of the above / उपरोक्त सभी
20. Marshall Company, a skincare product manufacturer in India, plans to expand
to the UK. To fund this expansion, they secured investments through a television
show where entrepreneurs invest in innovative ideas. / मार्शल कंपनी, जो भारत में
त्वचा देखभाल उत्पाद बनाती है, यूके में विस्तार करने की योजना बना रही है। इस विस्तार के लिए,
उन्होंने एक टे लीविजन शो के माध्यम से निवेश प्राप्त किया, जहां उद्यमी नए और नवाचारी विचारों
में निवेश करते हैं।
Which type of funding did Marshall Company utilize? / मार्शल कंपनी ने किस प्रकार
की फंडिं ग का उपयोग किया?
(a) Public issue / सार्वजनिक इश्यू
(b) Venture capital / उद्यम पूंजी
(c) Borrowing / उधार ले ना
(d) Angel investors / एं जल निवेशक
21. Identify, which of the following is an advantage of issuing shares through a
‘Rights issue’? / 'राइट्स इश्यू' के माध्यम से शेयर जारी करने का निम्नलिखित में से कौन सा
लाभ है?
(a) It is an inexpensive method of issuing shares. / यह शेयर जारी करने की सस्ती
विधि है।
(b) It leads to higher employee motivation and lower labor turnover. / यह उच्च
कर्मचारी प्रेरणा और कम श्रम पलायन दर का कारण बनता है।
(c) It results in higher valuations of companies and better prestige. / यह कंपनियों
के उच्च मूल्यांकन और बेहतर प्रतिष्ठा का कारण बनता है।
(d) This method helps in maintaining confidentiality. / यह विधि गोपनीयता बनाए
रखने में मदद करती है।
22. Pizza and soft drinks like Pepsi are not the same products but cater to the same
industry. To expand its soft drink reach, Pepsi merged with Pizza Hut by making
it a subsidiary. The above is an example of: / पिज़्ज़ा और पेप्सी जैसे सॉफ्ट ड्रिंक्स
समान उत्पाद नहीं हैं ले किन एक ही उद्योग की सेवा करते हैं। अपने सॉफ्ट ड्रिंक व्यवसाय का
विस्तार करने के लिए, पेप्सी ने पिज़्ज़ा हट को अपनी सहायक कंपनी बनाकर विलय कर लिया।
उपरोक्त किसका उदाहरण है?
(a) Product Extension Merger / उत्पाद विस्तार विलय
(b) Vertical Merger / ऊर्ध्वाधर विलय
(c) Horizontal Merger / क्षैतिज विलय
(d) Market Extension Merger / बाजार विस्तार विलय
23. What creates perfection in the market and increases the volume of sales and
profit? / बाजार में उत्कृष्टता पैदा करता है और बिक्री और लाभ की मात्रा बढ़ाता है:
(a) Marketing / विपणन
(b) Flotation / फ्लोटे शन
(c) Innovation / नवाचार
(d) Location / स्थान
24.
The characteristics of a company include: / एक कंपनी की विशेषताओ ं में शामिल हैं:
(1) Common seal / कॉमन सील
(2) Perpetual succession / सतत उत्तराधिकार
(3) Limited liability / सीमित देयता

Choose the correct option:

(a) Only (1) / केवल (1)
(b) Both (1) and (2) / (1) और (2) दोनों
(c) Only (2) / केवल (2)
(d) All (1), (2), and (3) / सभी (1), (2), और (3)

25.
Which of the following is an element of sensing opportunities? / निम्नलिखित में से
कौन अवसरों को पहचानने का एक तत्व है?
(i) Insight into the change / परिवर्तन की समझ
(ii) Knowledge of competitors / प्रतिस्पर्धि यों का ज्ञान
(iii) Ability to perceive / समझने की क्षमता
(iv) Laziness of entrepreneurs / उद्यमियों की आलस्यताChoose the correct option:
(a) Only (i) / केवल (i)
(b) Only (iv) / केवल (iv)
(c) (i), (ii), and (iii) / (i), (ii), और (iii)
(d) (ii) and (iii) / (ii) और (iii)

अति लघु उत्तरीय प्रश्न

26.
What is the importance of environmental scanning for a business? / किसी
व्यवसाय के लिए पर्यावरण स्कैनिं ग का महत्व क्या है?

27. Define "idea fields" in entrepreneurship. / उद्यमिता में "आइडिया फील्ड्स" को परिभाषित
करें।
28. What is the purpose of a financial plan in a business plan? / व्यवसाय योजना में
वित्तीय योजना का उद्देश्य क्या है?

29. State one advantage of franchising for the franchisee. / फ्रैंचाइजीधारी के लिए
फ्रैंचाइजिं ग का एक लाभ बताएं ।

30. Mention any one method of issue in the primary market. / प्राथमिक बाजार में शेयर
जारी करने की एक विधि बताएं ।
31. What is meant by "Return on Investment (ROI)"? / "निवेश पर वापसी (ROI)" का क्या
अर्थ है?

32. Define the term "merger." / "विलय" शब्द को परिभाषित करें।

33. What is meant by branding? / ब्रांडिंग का क्या मतलब है?

34. State one key difference between public and private companies. / सार्वजनिक और
निजी कंपनियों के बीच एक मुख्य अंतर बताएं ।

Short Answer Type Questions

35. Explain the concept of opportunity and market assessment with an example. /
अवसर और बाजार मूल्यांकन की अवधारणा को एक उदाहरण के साथ समझाएं ।

36. What are the advantages of a sole proprietorship as a form of business? /

व्यवसाय के रूप में एकमात्र स्वामित्व के लाभ क्या हैं?

37. Discuss the importance of a marketing plan for a business. / किसी व्यवसाय के लिए
विपणन योजना का महत्व चर्चा करें।

38. What are the advantages and disadvantages of venture capital? / वेंचर कैपिटल
के लाभ और हानि क्या हैं?
39. How does inventory control affect the profitability of a business? / इन्वेंटरी नियंत्रण
व्यवसाय की लाभप्रदता को कैसे प्रभावित करता है?

40. Differentiate between "angel investors" and "venture capitalists." / "एं जल निवेशकों"
और "वेंचर पूंजीपतियों" में अंतर करें।
41. Discuss the role of promotional strategies in enterprise marketing. / उद्यम विपणन
 में प्रचार रणनीतियों की भूमिका पर चर्चा करें।
42. Explain how mergers and acquisitions help in enterprise growth. / विलय और
अधिग्रहण उद्यम वृद्धि में कैसे मदद करते हैं?
Long Answer Type Questions

Explain the steps involved in sensing and evaluating entrepreneurial opportunities. /

43.
उद्यमशील अवसरों को पहचानने और मूल्यांकन करने की प्रक्रिया के चरणों की व्याख्या करें।

Describe the various components of a business plan. / व्यवसाय योजना के विभिन्न घटकों का
44.
वर्णन करें।
Elaborate on the concept of break-even analysis with a numerical example. / ब्रेक-ईवन
45.
विश्ले षण की अवधारणा को एक संख्यात्मक उदाहरण के साथ विस्तार से समझाएं ।
Discuss the various marketing strategies involved in enterprise marketing. / उद्यम विपणन में
46.
शामिल विभिन्न विपणन रणनीतियों पर चर्चा करें।
Explain the concept and types of franchising, along with advantages and limitations. /
47.
फ्रैंचाइजिं ग की अवधारणा और प्रकारों को उसके लाभ और सीमाओ ं के साथ समझाएं ।
Discuss the features of Angel Investors and Venture Capital as sources of finance for a
48.
new enterprise. / नए उद्यम के लिए वित्त के स्रोत के रूप में एं जल निवेशकों और वेंचर पूंजी के विशेषताओ ं
पर चर्चा करें।
Answer
1. (c) Mutual agency / परस्पर एजेंसी
2. (c) It does not take into account the competitor's pricing and actions. / यह
प्रतिस्पर्धि यों के मूल्य निर्धारण और उनके कदमों को ध्यान में नहीं रखता।
3. (c) 1 and 4 / केवल 1 और 4
4. (a) Product franchise business opportunity / उत्पाद फ्रैंचाइज़ व्यवसाय का अवसर
5. (b) 1 and 2 / 1 और 2
6. (b) Operational plan / परिचालन योजना
7. (b) Follow-up / अनुवर्ती
8. (c) Limited area of operation / सीमित संचालन क्षेत्र
9. (a) 400
10. (a)1 and 2 / 1 और 2
11. (b) ₹24480
12. (b) Financing decision / वित्तपोषण निर्णय
13. (d) Return on investment / निवेश पर वापसी
14. (d) This method helps in maintaining confidentiality. / यह विधि गोपनीयता बनाए रखने
में मदद करती है।
15. (d) (i) and (iv)
16. (d) Short-term investment / अल्पकालिक निवेश
17. (b) Reverse / उल्टा
18. (b) Market driven / बाजार प्रेरित
19. (b) Grabbing opportunities from the market / बाजार से अवसरों को पकड़ना
20. (b) Venture capital / उद्यम पूंजी
21. (a) It is an inexpensive method of issuing shares. / यह शेयर जारी करने की सस्ती विधि है।
 झारखण्ड शैक्षिक अनुस ंधान एवं प्रक्षशिण पररषद् ,रााँच ी
Jharkhand Council of Educational Research and Training, Ranchi

MODEL QUESTION PAPER

Session: 2024-25 ( - )

Class – 12 Subject – Physics F. M. – 70 Time – 3 Hours

भौक्षिकी

INSTRUCTIONS /निर्दे श :
1. Examinee are required to answer in their own words as far as practicable.
ijh{kkFkhZ ;FkklaHko vius 'kCnksa esa gh mÙkj nsAa
2. This question papers have four sections: A, B, C and D. Total number of
questions are 48.
bl iz'u i= esa pkj [k.M& A, B, C ,oa D gSA dqy iz'uksa dh la[;k gSA
3. There are 25 Multiple Choice Questions in the Section A. Four options are given
for each question, choose one of the correct options.
A esa dqy 25 cgqfodYih; iz' u gSaA izR;sd iz' u ds pkj fodYi fn, x, gSa]
buesa ls ,d lgh fodYi dk p;u dhft,A
4. Section B – Question numbers 26–34 are very short answer type. Answer any
seven of these questions. Each question carries 1 marks.
B esa iz' u la[;k gSa A buesa ls fdUgha साि
iz'uksa ds mÙkj nhft,A izR;sd iz'u dk eku vad fu/kkZfjr gSA
5. Section C – Question numbers 35 – 42 are short answer type.Answer any six
of these questions. Each question carries 3 marks.
C esa iz'u la[;k gSaA buesa ls fdUgh Ng iz' uksa
ds mÙkj nhft,A izR;sd iz'u dk eku vad fu/kkZfjr gSA
6. Section D – Question numbers 43 – 48 are long answer type.Answer any four
of these questions. Each question carries 5 marks.
D esa iz'u la[;k gSa A buesa ls fdUgh pkj iz' uksa
ds mÙkj nhft,A izR;sd iz'u dk eku vad fu/kkZfjr gSA

Page 1 of 12
1. When an electric dipole is placed in uniform electric field it experiences
(a) a net force
(b) a torque
(c) both a net force and torque
(d) Neither a net force nor a torque
1. जब एक क्षवद्युि क्षिध्रुव को एकसमान क्षवद्युि िेत्र में रखा जािा है िो यह अनुभव करिा है

(a) एक शुद्ध बल

(b) एक बल आघुणण

(c) एक शुद्ध बल और बल आघुणण

(d) न िो एक शुद्ध बल और न ही बल आघुणण

2. Two charged spheres are separated by a distance d, exert a force F on each other. If
charges are doubled and distance between them is doubled then the force is
(a) F
(b) F/2
(c) F/4
(d) 4F
2. दो आवेश वाले गोले एक दूसरे पर d दूरी पर एक दूसरे पर F बल लगािे हैं। यदद आवेशों को दोगुना कर ददया जाए
और उनके बीच की दूरी दोगुनी कर दी जाए िो बल होगा

(a) F
(b) F/2
(c) F/4
(d) 4F
3. The electrostatic potential on the perpendicular bisector due to an electric dipole is _____
(a) zero (b) 1
(c) Infinite (d) Negative
3. क्षवद्युि क्षिध्रुव के कारण लम्ब समक्षिभाजक पर क्षथिर वैद्युि क्षवभव ___ होिा है।

(a) शून्य (b) 1

(c) अनंि (d) ऋणात्मक

4. The capacity of the parallel plate capacitor increases when

(a) area of the plate is decreased
(b) area of the plate is increased
(c) distance between the plates increases
Page 2 of 12
 (d) None of the option
4. समांिर पट्टीका संधाररत्र की िमिा िब बढ़ जािी है जब

(a) पट्टीका का िेत्रफल कम हो जािा है

(b) पट्टीका का िेत्रफल बढ़ जािा है

(c) पट्टीका के बीच की दूरी बढ़ जािी है

(d) कोई क्षवकल्प नहीं

5. Kirchhoff’s junction rule is based on conservation of

(a) Mass (b) Charge
(c) Energy (d) None of these
5. दकरचॉफ का संक्षध क्षनयम दकसके संरिण पर आधाररि है

(a)द्रव्यमान (b)आवेश

(c) ऊजाण (d) इनमें से कोई नहीं

6. The resistivity of material of a conductor depends on

(a) Length
(b) Area of cross section
(c) Temperature
(d) None of these
6. दकसी चालक के पदािण की प्रक्षिरोधकिा क्षनभणर करिी है

(a) लंबाई

(b) अनुप्रथि काट

(c) िापमान

(d) इनमें से कोई नहीं

7. A moving charge produces:

(a) Only electric field
(b) Only magnetic field
(c) Electric and magnetic field both
(d) None of these
एक गक्षिमान चाजण उत्पन्न करिा है:

(a) के वल क्षवद्युि िेत्र

(b) के वल चुंबकीय िेत्र

Page 3 of 12
 (c) क्षवद्युि और चुंबकीय िेत्र दोनों

(d) इनमें से कोई नहीं

8. Magnetic effect of electric current was discovered by:

(a) Fleming (b) Oersted
(c) Faraday (d) Ampere
8. क्षवद्युि धारा के चुंबकीय प्रभाव की खोज दकसने की:

(a) फ्लेममंग (b) ओथटैंड

(c) फै राडे (d) एम्पीयर

9. A magnetic needle is kept in a non-uniform magnetic field. It experiences

(a) a torque but not a force
(b) Neither a force nor a torque
(c) a force and a torque
(d) a force but not a torque
9. एक चुंबकीय सुई को असमान चुंबकीय िेत्र में रखा गया है। यह अनुभव करिा है

(a) एक बल आघूणण लेदकन बल नहीं।

(b)न िो कोई बल और न ही कोई बल आघूणण।

(c) एक बल और एक बल आघूणण।

(d) एक बल लेदकन एक बल आघूणण नहीं।

10. For which of the following is magnetic susceptibility negative?

(a) Paramagnetic and Ferromagnetic materials
(b) Paramagnetic Materials only
(c) Ferromagnetic Materials only
(d) Diamagnetic Materials
10. क्षनम्नक्षलक्षखि में से दकसके क्षलए चुंबकीय सुग्राक्षहिा (magnetic susceptibility) ऋणात्मक है?

(a) अनुचुम्बकीय और लौह चुम्बकीय पदािण

(b) के वल अनुचुम्बकीय पदािण

(c) लौह चुम्बकीय पदािण

(d) प्रक्षिचुम्बकीय पदािण

11. Lenz's law is in accordance with:

(a) Law of conservation of charge

Page 4 of 12
 (b) Law of conservation of energy
(c) Law of conservation of mass
(d) Law of conservation of momentum.
11: लेंज का क्षनयम क्षनम्नक्षलक्षखि के अनुसार होिा है:

(a) आवेश संरिण का क्षनयम

(b) ऊजाण संरिण का क्षनयम

(c) द्रव्यमान संरिण का क्षनयम

(d) संवेग संरिण का क्षनयम

12. Unit of self inductance is :

(a) ampere (b) faraday
(c) henry (d) weber.
थवप्रेरण की इकाई है:

(a) एम्पीयर (b) फै राडे

(c) हेनरी (d) वेबर।

13. What is the reactance of a capacitor in a D.C circuit ?

(a) 0 (b) Infinity
(c) 1 (d) None of these
D.C. पररपि में संधाररत्र की प्रक्षिघाि क्या है?

(a) 0 (b) अनन्ि

(c) 1 (d) इनमें से कोई नहीं।

14. The transformation ratio of step up transformer is:

(a) Equal to 1 (b) Less than 1
(c) more than 1 (d) Not certain.
14. थटेप अप ट्ांसफॉमणर का पररविणन अनुपाि है:

(a) 1 के बराबर (b) 1 से कम

(c) 1 से अक्षधक (d) क्षनक्षिि नहीं है।

15. Suitable for disinfecting water -

(a) infrared (b) microwave
(c) ultraviolet rays (d) yellow light

15. जल को कीटाणु रक्षहि करने के क्षलए उपयुक्त है –

Page 5 of 12
 (a)अवरक्त दकरणें (b)सूक्ष्म िरं ग

(c) पराबैंगनी दकरणें (d)पीली रोशनी

16. Which of the following waves has minimum wavelength?

(a)infrared rays (b)ultraviolet rays
(c) x-rays (d)gamma rays
16. क्षनम्नक्षलक्षखि में से दकस िरं ग की िरं गदै र्धयण न्यूनिम होिी है-

(a) अवरक्त दकरणें (b)पराबैंगनी दकरणें

(c)एक्स-रे (d)गामा दकरणें

17. The image formed by a simple microscope is-

(a) imaginary and erect
(b) imaginary and inverted
(c) real and erect
(d) real and inverted
17. एक सरल सूक्ष्मदशी से बना हुआ प्रक्षिक्षबम्ब होिा है-

(a) कल्पक्षनक व सीधा

(b) काल्पक्षनक व उल्टा

(c) वाथिक्षवक व सीधा

(d) वाथिक्षवक व उल्टा ।

18. The focal lengths of the objective and the eyepiece of a telescope are F and f respectively.
The magnifying power of the telescope is-
(a) F+f (b) F-f
(c) F/f (d) f/F
18. दकसी दूरदशी के अक्षभदृश्यक ििा नेक्षत्रका की फोकस दूररयााँ क्रमशः F ििा f हैं। दूरदशी की आवधणन िमिा है-

(a) F+f (b) F-f

(c) F/f (d)f/F
19. The size of the obstacle for the diffraction of light-
(a) be much larger than the wavelength of light.
(b) be much smaller than the wavelength of light.
(c) be of the order of wavelength of light.
(d) anything can happen.
19.प्रकाश के क्षवविणन के क्षलए अवरोधक का आकार-

Page 6 of 12
 (a) प्रकाश की िरं गदै धयण से बहुि बडा होना चाक्षहए।

(b) प्रकाश की िरं गदै धयण से बहुि छोटा होना चाक्षहए।

(c) प्रकाश की िरं गदै धयण की कोरट का होना चाक्षहए।

(d) कु छ भी हो सकिा है।

20. The phenomenon by which the nature of light waves is transverse-

(a) Interference (b) Diffraction
(c) Polarization (d) Refraction.
20. वह पररघटना क्षजससे प्रकाश िरं गों की प्रकृ क्षि अनुप्रथि होिी है-

(a) व्यक्षिकरण (b) क्षवविणन

(c) ध्रुवण (d) अपविणन ।

21. The dimension of Planck's constant is -

(a) force x time
(b) force x distance
(c) force x distance x time
(d) force x distance/time
21. पलांक क्षनयिांक की क्षवमा है -

(a) बल x समय

(b) बल x दूरी

(c) बल x दूरी x समय

(d) बल x दूरी/समय

22. Nucleus of an atom consists of

(a) Protons (b) Protons and Neutrons
(c) Alpha particles (d) Protons and Electrons
22.परमाणु के नाक्षभक में होिे हैं

(a) प्रोटान (b) प्रोटॉन और न्यूट्ॉन

(c) अल्फा कण (d) प्रोटॉन और इलेक्ट्ॉन

23. If a radioactive Atom emits gamma radiation its atomic number

(a) Increases by one unit
(b) Decreases by one unit
(c) Decreases by two units

Page 7 of 12
 (d) Remains unchanged
23.यदद कोई रे क्षडयोधमी परमाणु गामा क्षवदकरण उत्सर्जणि करिा है िो उसका परमाणु क्रमांक

(a). एक इकाई से बढ़िा है

(b) एक इकाई से घट जािी है

(c) दो इकाइयों से घट जािी है

(d) नहीं बदलिा है

24. In p-type semiconductor what kind of impurity is found

(a) with valency of three (b) with valency of five
(c) with valency of two (d) with valency of one
24. p -टाइप अधणचालक में कै सी अशुक्षद्ध क्षमली होिी है

(a)संयोजकिा िीन की (b) संयोजकिा पांच की

(c) संयोजकिा दो की (d) संयोजकिा एक की

25. The depletion layer of p-n junction diode consists of

(a) electrons only
(b) holes only
(c) both electron and holes
(d) neither electron nor holes
25. p-n संक्षध डायोड के हासी परि में होिे हैं

(a) के वल इलेक्ट्ान

(b) के वल ररक्षक्तयााँ

(c) इलेक्ट्ान और ररक्षक्तयााँ दोनों

(d) न इलेक्ट्ॉन न ररदक् िया

26. If the radius of the Gaussian surface enclosing a charge is halved, how does the electric
flux through the Gaussian surface change ?
26. यदद दकसी आवेश को घेरने वाली गाऊसी सिह की क्षत्रज्या आधी कर दी जाए, िो गाऊसी सिह से होकर गुजरने
वाला क्षवद्युि फ्लक्स कै से बदल जाएगा?

27. Why do the electric field lines never cross each other.
27. क्षवद्युि िेत्र रे खाएाँ कभी एक दूसरे को काटिी क्यों नहीं है?

28. What is electromagnetic induction?

28. क्षवद्युि चुम्बकीय प्रेरण क्या है?

29. Write some property of electromagnetic waves?

Page 8 of 12
29. क्षवद्युि चुम्बकीय िरं गों के कु छ गुण क्षलक्षखए?

30. What are coherent sources of light?

30. प्रकाश के सुसंगि स्रोि क्या हैं?

31. Explain the principle of superposition?

31. अर्धयारोपण का क्षसद्धांि समझाइए?

32. Two particles have equal momenta. What is the ratio of their de-Broglie wavelength?
32. दो कणों का संवेग बराबर होिा है।उनके डी-ब्रॉग्ली िरं ग दै र्धयण का अनुपाि क्या है?

33. A difference of 2.3eV separates two energy levels in an atom. What is the frequency of
radiation emitted when the atom makes a transition from the upper to the lower level?
33. 2.3 eV का अंिर एक परमाणु में दो ऊजाण थिरों को अलग करिा है। जब परमाणु ऊपरी से क्षनचले थिर में संक्रमण
करिा है िो उत्सर्जणि क्षवदकरण की आवृक्षि क्या होिी है?

34. Differentiate n-type and p-type Semiconductors.

34. n-टाइप और p-टाइप सेमीकं डक्टर में अंिर करें ।

35. Distinguish between Conductors, Insulators and Semiconductors with the help of energy
band diagram.
35. ऊजाण बैंड आरे ख की सहायिा से कं डक्टर, इन्सुलेटर और अधणचालक के बीच अंिर बिाइए।

36. What is drift velocity? Establish Ohm’s law for conductors using idea of drift velocity.
36. बहाव वेग क्या है? बहाव वेग के क्षवचार का उपयोग करके कं डक्टरों के क्षलए ओम का क्षनयम थिाक्षपि करें ।

37. What are magnetic field lines? Give their main characterstics.
37. चुम्बकीय िेत्र रे खाएाँ क्या हैं? उनकी प्रमुख क्षवशेषिाएाँ दीक्षजए

38. What is photoelectric effect? Define threshold frequency and stopping potential.
38. फोटोइलेक्षक्ट्क प्रभाव क्या है? थ्रेशोल्ड फ्रीक्वेंसी और थटॉमपंग पोटेंक्षशयल को पररभाक्षषि करें ।

39. What are matter waves?

39. पदािण िरं गों से क्या अक्षभप्राय है?

40. Find out the binding energy of the Nitrogen nucleus (7𝑁14 ) in MeV.
40. MeV में नाइट्ोजन नाक्षभक (7𝑁14 ) की बंधन ऊजाण का पिा लगाए

41. Mention the postulates of Bohr’s model of an atom. What are the limitations of Bohr’s
model.
41. बोर के परमाणु मॉडल की अक्षभधारणाओं का उल्लेख करें । बोर मॉडल की सीमाएं क्या हैं?

42. Derive an expression for the energy stored in a charged capacitor.

42. एक आवेक्षशि संधाररत्र में संग्रक्षहि ऊजाण के क्षलए एक व्यंजक व्युत्पन्न करें

Page 9 of 12
43. Determine the intensity of electric field by Gauss law, due to a uniformly charged shell at a
point
1. Outside the shell
2. On the surface of shell
3. Inside the shell.
Draw a graph showing the variation of electric field with the distance from the center.
43. गॉस के क्षनयम िारा दकसी मबंदु पर समान रूप से आवेक्षशि गोलीय खोल के कारण क्षवद्युि िेत्र की िीव्रिा ज्ञाि
कीक्षजए।

1. खोल के बाहर

2. खोल की सिह पर

3. खोल के अंदर ।

कें द्र से दूरी के साि क्षवद्युि िेत्र के पररविणन को दशाणने वाला एक ग्राफ खीक्षाँ चए

44. What is Wheatstone Bridge. Derive the balanced condition of Wheatstone Bridge.
44. व्हीटथटोन ब्रीज क्या है। व्हीटथटोन ब्रीज की संिुलन क्षथिक्षि प्राप्त करें । ।

45. Establish the formula n/v-1/u=(n-1)/R for refraction of light on a spherical surface (convex or
concave).
45. दकसी गोलीय पृष्ठ (उिल अिवा अविल पर प्रकाश के अपविणन के क्षलए सूत्र n / v - 1 / u = (n - 1) / R थिाक्षपि
कीक्षजए।

46. Describe the principle, construction and working of a transformer. Why is the core of the
transformer laminated?
46. दकसी ट्ॉसफॉमणर के क्षसद्धान्ि, बनावट ििा कायणप्रणाली का वणणन कीक्षजए। ट्ांसफॉमेर की क्रोड को पटक्षलि क्यों
दकया जािा है?

47. Define wavefront and secondary wavelet. Establish the law of refraction of light on the basis
of Huygen’s principle.
47. िरं गाग्र और मार्धयक्षमक िरं क्षगका को पररभाक्षषि करें । हाइगेन के क्षसद्धांि के आधार पर प्रकाश के अपविणन का

क्षनयम थिाक्षपि करें ।

48. Describe the principle, construction and working of an A.C. generator with the help of a
labelled diagram.
48. नामांदकि आरे ख की सहायिा से प्रत्याविी धारा जक्षनत्र के क्षसद्धांि, संरचना और कायणप्रणाली का वणणन कीक्षजए।

Page 10 of 12
Question Answer
1 B
2 A
3 A
4 B
5 B
6 C
7 C
8 B
9 C
10 D
11 B
12 C
13 B
14 C
15 C
16 D
17 A
18 C
19 C
20 C
21 C
22 B
23 D
24 A
25 D

Page 11 of 12
Page 12 of 12
 झारखण्ड शै क्षिक अनु संधान एवं प्रक्षशिण पररषद, रााँ ची , झारखण्ड
वाक्षषिक परीिा (Annual Examination)
2024-2025
मॉडल प्रश्न पत्र
किा – XII क्षवषय – रसायनशास्त्र समय – 3 घण्टा पू णाांक – 70
Class-XII Subject- Chemistry Time- 3 Hour Marks - 70
सामान्य निर्दे श (General Instruction)

 परीिार्थी यर्थासं भव अपने शब्दं में उत्तर दें । (Examinee write answer in their own
words as far as practicable.)
 कुल प्रश्नदं की सं ख्या 48 है । (The total number of questions are 48)
 प्रश्न पत्र कद चार खं डदं में क्षवभाक्षित क्षकया गया है । प्रत्येक खं ड से क्षनदे श ानु सार उत्तर दे ना
अक्षनवायि है ।(The question paper is divided into four sections. It is mandatory to
answer each section as per the instructions.)
 खं ड –A में प्रश्न सं ख्या 01 से 25 तक बहुक्षवकल्पीय प्रश्न हैं । प्रत्येक प्रश्न के क्षलए 1 अंक
क्षनधािररत है | प्रत्येक प्रश्न के चार क्षवकल्प क्षदये गए हैं | सही क्षवकल्प का चयन कीक्षिये | गलत
उत्तर के क्षलए कदई अंक नही ं काटे िाएं गे | (Question numbers 01 to 25 in section-A
are multiple choice questions. Each question carries 1 mark. Four options are
given for each question. Choose the correct option. No marks will be
deducted for the wrong answer.)
 खं ड –B में प्रश्न सं ख्या 26 से प्रश्न सं ख्या 34 तक अक्षतलघूत्तरीय प्रश्न हैं । इनमें से क्षकन्ी ं सात
प्रश्नदं के उत्तर अक्षधकतम एक वाक्य में दीक्षिए। प्रत्येक प्रश्न का मान 1 अंक क्षनधािररत है ।
(Section-B contains very short answer questions from question number 26 to
question number 34. Answer any seven of these questions in maximum one
sentence. Each question carries 1 mark.)
 खं ड –C में प्रश्न सं ख्या 35 से प्रश्न सं ख्या 42 तक लघूउत्तरीय प्रश्न हैं । इनमें से क्षकन्ी ं 6 प्रश्नदं के
उत्तर अक्षधकतम 150 शब्दं में दीक्षिए। प्रत्येक प्रश्न का मान 3 अंक क्षनधािररत है । (Section-C
contains short answer questions from question number 35 to question
number 42. Answer any 6 of these questions in maximum 150 words. Each
question carries 3 marks.)
 खं ड –D में प्रश्न सं ख्या 43 से प्रश्न 48 तक दीघिउत्तरीय प्रश्न हैं । इनमें से क्षकन्ी ं चार प्रश्नदं के
उत्तर अक्षधकतम 250 शब्दं में दीक्षिए। प्रत्येक प्रश्न का मान 5 अंक क्षनधािररत है । (Section-D
contains long answer questions from question number 43 to question number
48. Answer any four of these questions in maximum 250 words. Each question
carries 5 marks.)

1
 Section – A (खंड –A)

1 Molarity of an aqueous solution 1 40g NaOH , 2 क्षलटर िलीय क्षवलयन में उपस्थित
containing 40g of NaOH in two litre of है , क्षवलयन की मदलरता हदगी :
solution is
(A) 0.5 (B) 1.0
(A) 0.5 (B) 1.0 (C) 1.5 (D) 0.75
(C) 1.5 (D) 0.75

2 2CH3Br + 2Na CH3 -CH3 + 2 2CH3Br + 2Na CH3 -CH3 +

2NaBr. 2NaBr.
The reaction is : यह अक्षभक्षिया है :

(A) Friedel crafts reaction (A) फ्रीडे ल िाफ्ट अक्षभक्षिया

(B) Wurtz reaction (B) वु टटिि अक्षभक्षिया
(C) Fittig reaction (C) क्षिक्षिग अक्षभक्षिया
(D) Wurtz Fittig reaction (D) वु टटिि क्षिक्षिग अक्षभक्षिया

3 When aqueous solution of NaCl is 3 NaCl के िलीय क्षवलयन के वै दटयुत अपघटन से

electrolysed the product obtained at कैर्थदड पर प्राप्त हदता है :
cathode is
(A) हाइडर दिन (B) सदक्षडयम धातु
(A) Hydrogen (B) Sodium metal (C) ऑक्सीिन (D) क्लदरीन
(C) Oxygen (D) Chlorine

4 Which of the following is not a transition 4 इनमें से कौन सं िमण तत्व नहीं है ?
element ?

(A) Fe (B) Mn (A) Fe (B) Mn

(C) Cr (D) Zn (C) Cr (D) Zn

5 CH3-CH2-Br + KOH (alc)  ‘A’ . Here ‘A’ is 5 CH3-CH2-Br + KOH (alc)  ‘A’ . यहााँ ‘A’ है

(A) CH 2=CH2 (B) CH 3-CH2-OH (A) CH 2=CH2 (B) CH3-CH2-OH

(C) CH2=CH-Br (D) CH 3-CH3 (C) CH 2=CH-Br (D) CH3-CH3

6 Osmotic pressure of the solution can be 6 क्षवलयन का परासरण दाब बढ़ाया िा सकता है :
increased by

(A) increasing temperature of the solution (A) क्षवलयन का तापमान बढ़ा कर

(B) decreasing temperature of the (B) क्षवलयन का तापमान कम कर
solution (C) पात्र का आयतन बढ़ा कर
(C) increasing volume of the vessel (D) क्षवलयन की सां द्रता कम कर
(D) diluting the solution

2
7 The molar conductivity of an electrolyte
Increases as : 7 वै दटयुतअपघट्य क्षवलयन की मदलर चालकता में
वृ स्थि हदती है िब :
(A) dilution increases
(B) temperature increases (A) तनुता में वृ स्थि हदती है
(C) dilution decreases (B) तापमान में वृ स्थि हदती है
(D) none of the above is correct (C) तनुता में कमी हदती है
(D) उपरदक्त कदई भी सही नहीं है |
8 Aqueous solution of which of the
following ions is colourless ? 8 इनमें से क्षकस आयन का िलीय क्षवलयन रं गहीन
हदगा ?
(A) Ti 3+ (B) V3+
(C) Cr3+ (D) Sc3+ (A) Ti 3+ (B) V3+
(C) Cr3+ (D) Sc3+
9 The relative lowering of vapour pressure
in case of a solution of non-volatile 9 अवाष्पशील क्षवले य रखने वाले क्षवलयन के वाष्प
solute is equal to the mole fraction of दाब में आपेक्षिक अवनमन क्षवले य के मदल–अंश के
solute. The statement is based on : समानुपाती हदता है | यह तथ्य क्षकस क्षनयम के
अनुसार है ?
(A) Henary’s law (B) Arrhenius law
(C) Raoult’s law (D) Ostwald’s law (A) हे नरी का क्षनयम
(B) आरहे क्षनयस का क्षनयम
(C) राउल्ट का क्षनयम
(D) ओस्टवाल्ड का क्षनयम
10 EMF of a cell with nickel and copper
electrode will be : 10 क्षनकेल तर्था कॉपर इले क्ट्रदड वाले से ल का E.M.F.
Given : E oNi2+/ Ni = -0.25V ; हदगा :
E oCu2+/ Cu = +0.34V क्षदया है :
EoNi2+/ Ni = -0.25V ; EoCu2+/ Cu = +0.34V
(A) 0.59 V (B) 0.09 V
(C) -0.59 V (D) -0.09 V (A) 0.59 V (B) 0.09 V
(C) -0.59 V (D) -0.09 V
11 Electronic configuration of Cu2+ is
11 Cu2+ आयन का इले क्ट्रदक्षनक क्षवन्यास है :
(A) [Ar] 3d8 4s1 (B) [Ar] 3d9 4s0
(C) [Ar] 3d7 4s2 (D) [Ar] 3d8 4s0 (A) [Ar] 3d8 4s1 (B) [Ar] 3d9 4s0
(C) [Ar] 3d7 4s2 (D) [Ar] 3d8 4s0
12 Colligative properties of the solutions
depend on : 12 क्षवलयन के अणुसंख्य गुणधमि वे गुण हदते हैं िद
क्षनभि र करते हैं :
(A) size of the particle
(B) nature of the solvent (A) कणदं के आकार पर
(C) number of the particles (B) क्षवलायक की प्रकृक्षत पर
(D) nature of the particle (C) कणदं की सं ख्या पर
(D) कणदं की प्रकृक्षत पर
13 For the half cell reaction
Ag+(aq) + e- ------→ Ag(S) 13 298 K ताप पर क्षदए गए समीकरण हे तु ( अधि से ल

3
 electrode potential at 298 K will be : अक्षभक्षिया ) अपचयन क्षवभव हदगा :
Given : [Ag+] = 0.1 M and E o = +0.80 V Ag+(aq) + e- ------→ Ag(S)
क्षदया है : [Ag+] = 0.1 M and E o = +0.80 V
(A) 0.741 V (B) 0.859 V
(C) -0.741 V (D) 0.209 V (A) 0.741 V (B) 0.859 V
(C) -0.741 V (D) 0.209 V
14 Butan-2-ol is a:
14 ब्यूटेन-2-ऑल है :
(A) 10 Alcohol
(B) 20 Alcohol (A) 10 एल्कदहल
(C) 30 Alcohol (B) 20 एल्कदहल
(D) dihydric Alcohol (C) 30 एल्कदहल
(D) डाईहाइक्षडरक एल्कदहल

(A) C2H5-O- C2H5 (B) C6H5-O- C2H5 (A) C2H5-O- C2H5 (B) C6H5-O- C2H5
(C) C6H5-O- C6H5 (D) C6H5-I (C) C6H5-O- C6H5 (D) C6H5-I

16. If the rate constant for a reaction is 16. यक्षद क्षकसी अक्षभक्षिया का वे ग स्थिरांक
k=1.5×10−3 s−1, what is the order of the
k=1.5×10−3 s−1 है , तद अक्षभक्षिया की कदक्षट क्या है ?
reaction?
(A) Zero order (A) शून्य कदक्षट
(B) First order (B) प्रर्थम कदक्षट
(C) Second order (C) क्षितीय कदक्षट
(D) Third order (D) तृतीय कदक्षट

17. Which of the following ions shows the 17. क्षनम्नक्षलस्थखत में से कौन सा आयन सबसे अक्षधक
highest magnetic moment? चु म्बकीय आघूणि क्षदखाता है ?
(A) Fe 2+ (A) Fe 2+
(B) Cr3+ (B) Cr3+
(C) Mn2+ (C) Mn2+
(D) Co2+ (D) Co2+

18. The coordination number and oxidation 18. [Co(en) 2Cl2] + में कदबाल्ट की उपसहसंयदिन संख्या
state of cobalt in [Co(en) 2 Cl2]+: और ऑक्सीकरण अविा क्या है ?
(A) 6 and +2 (A) 6 और +2
(B) 6 and +3 (B) 6 और +3
(C) 4 and +2 (C) 4 और +2
(D) 4 and +3 (D) 4 और +3

19. क्षनम्नक्षलस्थखत में से कौन सा यौक्षगक ध्रुवण समावयवता

19. Which of the following complexes shows
दशािता है ?
optical isomerism? (A) [Co(NH3) 6]3+
(A) [Co(NH3) 6]3+

4
(B) [Co(en) 3]3+ (B) [Co(en) 3]3+
(C) [Ni(CN) 4]2− (C) [Ni(CN) 4]2−
(D) [PtCl 4]2− (D) [PtCl 4 ]2−

20. The compound formed as a result of 20. KMnO4 के िारा इर्थाइल बेन्िीन के ऑक्सीकरण के
oxidation of ethylbenzene by KMnO4 is : िलस्वरूप बनने वाला यौक्षगक है :
(A) benzyl alcohol (A) बेंिाइल एल्कदहल
(B) benzophenone (B ) बेंिदिेनदन
(C) acetophenone (C) एसीटदफ़ेनदन
(D) benzoic acid (D ) बेंिदइक अम्ल
21. Among the following which is strongest
acid ? 21. क्षनम्नांक्षकत में प्रबलतम अम्ल है :
(A) CH 3COOH (A) CH 3COOH
(B) HCOOH (B) HCOOH
(C) (CH 3) 2CHCOOH (C) (CH 3) 2CHCOOH
(D) CH 3CH2COOH (D) CH 3CH2COOH

22. Which one of the following is reduced 22. क्षनम्नांक्षकत में कौन Zn/HCl से अवकरण पर
with Zn/HCl to give hydrocarbon ? हाइडर दकाबिन का क्षनमािण करे गा ?
(A) ethyl acetate (A) इर्थाइल एसीटे ट
(B) acetic acid (B ) एसीक्षटक अम्ल
(C) acetamide (C) एक्षसटामाइड
(D) butan-2-one (D ) ब्यूटेन-1-ओन

23. The strongest base in aqueous solution 23. क्षनम्नांक्षकत में कौन सा एमीन िलीय क्षवलयन में प्रबलतम
among the following amines is : िार है ?
(A) N,N-diethylethanamine (A) N,N-डाईइर्थाइलइर्थेनामाइन
(B) N-ethylethanamine (B) N-इर्थाइलइर्थेनामाइन
(C) N-methylethanamine (C) N-क्षमर्थाइलइर्थेनामाइन
(D) ethanamine (D) इर्थेनामाइन

24. Which of the following amines cannot be 24. क्षनम्नांक्षकत में कौन सा एमीन गैक्षिएल संश्लेषण िारा नही ं
prepared by Gabriel’s synthesis : बनाया िा सकता है ?
(A) butylamine (A) ब्यूटाइलएमीन
(B) isopropylamine (B) आइसदप्रदपाइलएमीन
(C) 2-phenylethylamine (C) 2-िीनाइलइर्थाइलएमीन
(D) N-methylbenzylamine (D) N-क्षमर्थाइलबेंिाइलएमीन

25. Glucose when reduced with HI/P gives : 25. HI/P के िारा अवकरण करने पर ग्लूकदि क्षनक्षमित
करता है :
(A) n-hexane (A) n-हे क्सेन
(B) n-heptane (B) n-हे प्टेन
(C) n-pentane (C) n-पें टेन
(D) n-octane (D) n-ऑक्ट्े न

5
 Section B (खंड –B)
Very Short Answer Type question
vfr y?kq mÙkjh; iz’u
26- Define Molality.
eksyyrk dks ifjHkkf"kr dhft,A
27- Predict the ordes of the reaction in the given profile.

t1/2

[R0]

fn, x;s vkys[k esa vfHkfØ;k dks dksfV Kkr dhft,A

t1/2

[R0]

28. Which two series of elements are present in f- Block

f- CykWd es dkSu ls rRoksa dh Js.kh mifLFkr gSa\

29- What type of isomerism is shown by the complex [Co(NH3 )6 ][Cr(CN)6 ] ?

[Co(NH3 )6 ][Cr(CN)6 ] ladqy }kjk fdl rjg dh leko;ork n’kkZ;h tkrh gS\

30- Write the name of the reaction in which Alkyl Iodides are prepared by the reaction of
Alkyl Chlorides/ Bromides with NaI in dry Acetone.

ml vfHkfØ;k dk uke fy[ks] ftlesa ,fYdy vk;skMkbMksa dk fojpu izk;% ,sfYdy DyksjkbMks@ czksekbMksa dh
‘kq”d ,lhVksu essa NaI ds lkFk vfHkfØ;k ls gksrk gSA

31- Which test is performed to distinguish between Primary, Secondary and Tertiary alcohols ?

çkFkfed] f}rh;d vkSj r`rh;d vYdksgy ds chp varj djus ds fy, dkSu lk ijh{k.k fd;k tkrk gS \

32- What happens when Aniline is treated with bromine water ?

,uhyhu tc czksehu ty ls vfHkfØ;k djrk gS rks D;k gksrk gS \

33- Which Harmone maintains blood glucose level ?

dkSu lk gkeksZu jDr esa Xywdksl dh ek=k fu;af=r djrk gS\

6
34- What happens when glucose is treated with bromine water?

D;k gksrk gS tc Xywdksl dh czksehu ty ds lkFk vfHkfØ;k djrs gS \

Section C (खंड –C)

Short Answer Type question
y?kq mÙkjh; iz’u
Answer any Six question. Answer the question in maximum 150 word each.
fdUgh N% iz’uksa ds mrj nsa A izR;sd iz’uksa dk mrj vf/kdre 150 ‘kCnksa esa nsA [ 3 X 6 = 18 ]
35- Write the reactions of fuel cell
bZa/ku lsy dh vfHkfØ;k fy[ksaA
36- Calculate the Magnetic Moment of
(a) Fe3+ (z = 26) (b) Zn2+(z=30) (c) Cu2+(z = 29)
pqcadh; vk?wk.kZ dh x.kuk dhft,A
(a) Fe3+ (z = 26) (b) Zn2+(z=30) (c) Cu2+(z = 29)
37. Zn,Cd and Hg are not considered as Transition elements, explain giving reason.

dkj.k nsrs gq, le>kb;s Zn, Cd and Hg dks ladze.k rRo D;ksa ugh ekuk tkrkA

38- Using IUPAC norms write the IUPAC name of

(a) [Mn(H2 O)6 ]2+

(b) [Cu(NO 2 )(Cl) (NH3 )4 ]

(c) K 3 [Fe(CN)6 ]

IUPAC fu;e ds vuqlkj fuEufyf[kr ds uke fy[ksa%

(a) [Mn(H2 O)6 ]2+

(b) [Cu(NO 2 )(Cl) (NH3 )4 ]

(c) K 3 [Fe(CN)6 ]

39. Complete the following:-

[a] Br + Mg

[b] CH3CONH2 + Br2+4NaOH

Fe/HCl
[c] C6H5NO2

fuEufyf[kr dks iwjk djsaA

7
[a] Br + Mg

[b] CH3CONH2 + Br2+4NaOH

Fe/HCl
[c] C6H5NO2

40. How will you bring about the following conversion.

(a) Ethanamide to Ethanoic Acid

(b) Cyclohexanol to Cyclohexanone

(c) Benzene to Acetophenone

fuEufyf[kr ifjorZu vki dSls djsxsAa

(a) bFksukekbM ls bFksukWbd vEy

(b) lkbDyksgsDlkuksy ls lkbDyksgsDlkuksu

(c) csUthu ls ,lhVksQhuksu

41. Write the IUPAC name of following compound.

(a) PhCoPh

(b) (CH3 )3 CNH2

(c) m-BrC6 H5 NH2

fuEufyf[kr ;kSfxdksa ds IUPAC uke fy[ksa %&

(a) PhCoPh

(b) (CH3 )3 CNH2

(c) m-BrC6 H5 NH2

42. What are essential and non-essential amino acid? Give examplees.

vko';d rFkk vuko’;d ,ehuks vEy D;k gksrs gS\ mnkgj.k nhft,A

Section – D (खंड –D)

Long Answer Type question
nh?kZ mÙkjh; iz’u
Answer any Four questions. Answer the questions in maximum 250 words each.
fdUgh pkj iz’uksa ds mrj nsaA izR;sd iz’uksa dk mrj vf/kdre 250 ‘kCnksa esa nsA

8
43. A 5% solution (by mass) of cane sugar in water has freezing point of 271 K. Calculate the
freezing point 5% glucose in water if freezing point of pure water is 273.15K.
‘kDdj ds 5% ¼nzO;eku½ tyh; foy;u dk fgekad 271 K gSA ;fn ‘kq} ty dk fgekad 273.15K.
gS rks Xywdksl ds 5% tyh; foy;u ds fgekad dh x.kuk dhft,A
44. Write the Nernst equation and calculate emf of the following cell at 298 K.
Mg(s) I Mg2+(0.001M) II Cu2+(0.0001M)ICu(s)
(Given E0 Mg2+/Mg =-2.36V E0 Cu2+/Cu = +0.80V)
fuEufyf[kr lsy dk uuZLV lehdj.k ,oa EMF dh x.kuk fy[ksaA
Mg(s) I Mg2+(0.001M) II Cu2+(0.0001M)ICu(s)
(fn;k x;k E0 Mg2+/Mg =-2.36V E0 Cu2+/Cu = +0.80V)
45. A reaction is first order in A and second order in B
(i) Write the differential rate equation.
(ii) How is the rate affected on increasing the concentration of B three times.
(iii) How is the rate affected when concentration of both A and B are doubled.
,d vfHkfØ;k A esa çFke dksfV rFkk B esa f}rh; dksfV dh gksrh gSA
(i) foHksnd osx lehdj.k fyf[k,A
(ii) B dh lkaærk rhu xqu k c<+kus ij osx ij D;k çHkko iM+rk gSA
(iii) A rFkk B nksu ksa dh lkaærk nksxu
q h djus ij osx ij D;k çHkko iM+rk gSA
46. On the basis of valance bond theory discuss the geometric and magnetic property of
K 4 [Fe(CN)6 ]
la;kstdrk vkca/k fl}kar ds vk/kkj ij K4 [Fe(CN)6 ] ds T;kferh; rFkk pqcadh; xq.k/keksZa dh foospuk
dhft,A
47. Draw the structure of the following
(a) 1-Ethoxy propane 1&bFkkWDlh izksisu
(b) o- Toluidine o& VkWY;wMhu
(c) Ethylene glycol bFkkbyhu Xykbdksy
(d) 3- Bromo-4-phenyl pentanoic acid 3&czkseks&4&QhukbZy iSuVsukWbd vEy
(e) o-Cresole o-dzslksy
48. Write short Notes on

(a) Cannizaro Reaction

(b) Reimer Tiemann Reaction
(c) Aldol Condensation

fuEufyf[kr ij y?kq fVIi.kh fy[ksa

(a) dSuhtkjks vfHkfØ;k

(b) jkbZej & VkbZeSu vfHkfØ;k
(c) ,YMksy la?kuu

9
 ANSWER

1 A
2 B
3 A
4 D
5 A
6 A
7 A
8 D
9 C
10 A
11 B
12 C
13 A
14 B
15 B
16 B
17 C
18 B
19 B
20 D
21 B
22 D
23 B
24 D
25 A

10
 झारखण्ड शैक्षिक अनुसंधान एवं प्रशिक्षण परिषद, राँची
वार्षि क इं टरमीडिएट परीक्षा (2024- 2025)
प्रतिदर्श प्रश्न पत्र /Model Question Paper

कक्षा- 12 विषय- जीव विज्ञान समय- 3 घंटा पूर्णांक- 70

Instructions / निर्देश:
1. All questions are compulsory. Candidates must answer questions in their own
words wherever possible. / सभी प्रश्न अनिवार्य हैं। परीक्षार्थी यथासंभव अपने शब्दों में उत्तर दें।
2. The question paper is divided into four sections: Group-A, Group-B, Group-C, and
Group-D. / प्रश्न पत्र चार समूहों में विभाजित है: समूह-अ, समूह- ब, समूह- स, और समूह- द।
3. The total number of questions is 48. / कुल प्रश्नों की संख्या 48 है।
4. Marking Scheme / अंक योजना:
I. Group-A: 25 objective questions, each carrying 1 mark. No negative marking
for wrong answers. / समूह-अ: 25 वस्तुनिष्ठ प्रश्न, प्रत्येक 1 अंक के हैं। गलत उत्तर के लिए
कोई नकारात्मक अंकन नहीं होगा।
II. Group-B: 9 questions, each carrying 1 mark. Answer any 7 questions. / समूह- ब:
9 प्रश्न, प्रत्येक 1 अंक का है। 7 प्रश्नों के उत्तर देने हैं।
III. Group-C: 8 questions, each carrying 3 marks. Answer any 6 questions. / समूह-
स: 8 प्रश्न, प्रत्येक 3 अंक के हैं। 6 प्रश्नों के उत्तर देने हैं।
IV. Group-D: 6 questions, each carrying 5 marks. Answer any 4 questions. / समूह-
द: 6 प्रश्न, प्रत्येक 5 अंक के हैं। 4 प्रश्नों के उत्तर देने हैं।
5. If there is any discrepancy in the Hindi translation of the questions, the English
version will prevail. / यदि प्रश्नों के हिं दी अनुवाद में कोई विसंगति हो तो अंग्रेजी संस्करण मान्य होगा।

GROUP - A ( समूह-अ)
Objective Type Question ( वस्तुनिष्ठ प्रश्न)

1. In angiosperms, male gametes are formed by the division of / आवृतबीज पौधों में नर
युग्मक का निर्माण किसके विभाजन से होता है?
(a) Microspore mother cell / माइक्रोस्पोर मदर सेल
(b) Microspore / माइक्रोस्पोर
(c) Generative cell / जनरेटिव सेल
(d) Vegetative cell / वेजिटे टिव सेल

2. Seminal plasma, the fluid part of semen, is contributed by / वीर्य का तरल भाग,
सेमिनल प्लाज्मा, का योगदान किससे होता है?
(i) Seminal vesicle / सेमिनल वेसिकल
(ii) Prostate gland / प्रोस्टे ट ग्रंथि
(iii) Urethra / मूत्रमार्ग
(iv) Bulbourethral gland / बल्बोयूरथ्र े ल ग्रंथि

(a) (i) and (ii) / (i) और (ii)

(b) (i), (ii) and (iv) / (i), (ii) और (iv)
 (c) (ii), (iii) and (iv) / (ii), (iii) और (iv)
d) (i) and (iv) / (i) और (iv)

3. In Mendel’s experiments with garden pea, round seed shape (RR) was dominant
over wrinkled seeds (rr), yellow cotyledon (YY) was dominant over green
cotyledon (yy). What are the expected phenotypes in the F2 generation of the
cross RRYY × rryy? / मेंडल के मटर के पौधे पर किए गए प्रयोगों में गोल बीज का आकार (RR)
सिकुड़े हुए बीज (rr) पर प्रभावी था, और पीले बीजपत्र (YY) हरे बीजपत्र (yy) पर प्रभावी थे। क्रॉस
RRYY × rryy की F2 पीढ़ी में अपेक्षित गुणसूत्र प्रकार क्या होंगे?
(a) Round seeds with yellow cotyledons, and wrinkled seeds with yellow
cotyledons. / गोल बीज पीले बीजपत्र के साथ और सिकुड़े हुए बीज पीले बीजपत्र के साथ।
(b) Only round seeds with green cotyledons. / केवल गोल बीज हरे बीजपत्र के साथ।
(c) Only wrinkled seeds with yellow cotyledons. / केवल सिकुड़े हुए बीज पीले बीजपत्र
के साथ।
(d) Only wrinkled seeds with green cotyledons. / केवल सिकुड़े हुए बीज हरे बीजपत्र
के साथ।

4. Emergency contraceptives are effective if used within / आपातकालीन गर्भनिरोधक

प्रभावी होते हैं यदि इनका उपयोग किस अवधि के भीतर किया जाए?
(a) 72 hrs of coitus / सहवास के 72 घंटे के भीतर
(b) 72 hrs of ovulation / डिं बोत्सर्जन के 72 घंटे के भीतर
(c) 72 hrs of menstruation / मासिक धर्म के 72 घंटे के भीतर
(d) 72 hrs of implantation / आरोपण के 72 घंटे के भीतर

5. Choose the correct statement regarding the ZIFT procedure. / ZIFT प्रक्रिया के बारे में
सही कथन चुनें।
(a) Ova collected from a female donor are transferred to the fallopian tube to
facilitate zygote formation. / महिला दाता से संग्रहित डिं ब को फेलोपियन ट्यूब में
स्थानांतरित किया जाता है ताकि युग्मज का निर्माण हो सके।
(b) Zygote is collected from a female donor and transferred to the fallopian
tube / युग्मज को महिला दाता से संग्रहित कर फेलोपियन ट्यूब में स्थानांतरित किया जाता
है।
(c) Zygote is collected from a female donor and transferred to the uterus /
युग्मज को महिला दाता से संग्रहित कर गर्भाशय में स्थानांतरित किया जाता है।
(d) Ova collected from a female donor and transferred to the uterus / महिला
दाता से संग्रहित डिं ब को गर्भाशय में स्थानांतरित किया जाता है।

6. Conditions of a karyotype 2n + 1, 2n – 1 and 2n + 2, 2n – 2 are called / कैरियोटाइप की

स्थितियां 2n + 1, 2n – 1 और 2n + 2, 2n – 2 को क्या कहते हैं?
(a) Aneuploidy / ऐन्यूप्लॉइडी
(b) Polyploidy / पॉलिप्लॉइडी
(c) Allopolyploidy / एलोपॉलीप्लॉइडी
(d) Monosomy / मोनोसोमी

7. In a dihybrid cross, if you get 9:3:3:1 ratio it denotes that / द्विलक्षणी संकरण में, यदि
9:3:3:1 अनुपात प्राप्त होता है तो यह दर्शाता है कि:
 (a) The alleles of two genes are interacting with each other / दो जीन के एलील
एक दूसरे के साथ परस्पर क्रिया कर रहे हैं।
(b) It is a multigenic inheritance / यह बहुजीनिक वंशानुक्रम है।
(c) It is a case of multiple allelism / यह एकाधिक एलीलिज़्म का मामला है।
(d) The alleles of two genes are segregating independently / दो जीन के एलील
स्वतंत्र रूप से विभाजित हो रहे हैं।

8. In the F2 generation of a Mendelian dihybrid cross, the number of phenotypes and

genotypes are / मेंडलीय द्विलक्षणी संकरण की F2 पीढ़ी में, फीनोटाइप और जीनोटाइप की संख्या
क्या है?
(a) Phenotypes - 4; Genotypes - 16 / फीनोटाइप - 4; जीनोटाइप - 16
(b) Phenotypes - 9; Genotypes - 4 / फीनोटाइप - 9; जीनोटाइप - 4
(c) Phenotypes - 4; Genotypes - 8 / फीनोटाइप - 4; जीनोटाइप - 8
(d) Phenotypes - 4; Genotypes - 9 / फीनोटाइप - 4; जीनोटाइप - 9

9. DNA is a polymer of nucleotides which are linked to each other by 3′→ 5′

phosphodiester bond. To prevent polymerisation of nucleotides, which of the
following modifications would you choose? / डीएनए न्यूक्लियोटाइड्स का एक बहुलक है
जो एक दूसरे से 3′→ 5′ फॉस्फोडायस्टर बंध द्वारा जुड़े होते हैं। न्यूक्लियोटाइड्स के बहुलकीकरण को
रोकने के लिए आप निम्नलिखित में से कौन सा संशोधन चुनेंगे?
(a) Replace purine with pyrimidines / प्यूरिन को पिरिमिडिन से बदलें ।
(b) Remove/replace 3' OH group in deoxyribose / डिऑक्सीराइबोज में 3' OH समूह
को हटाएं /बदलें ।
(c) Remove/replace 2' OH group with some other group in deoxyribose /
डिऑक्सीराइबोज में 2' OH समूह को किसी अन्य समूह से बदलें ।
(d) Both ‘b’ and ‘c’ / 'b' और 'c' दोनों।

10. While analysing the DNA of an organism, a total number of 5386 nucleotides were
found, out of which the proportion of different bases was: Adenine = 29%, Guanine
= 17%, Cytosine = 32%, Thymine = 17%. Considering the Chargaff’s rule, it can be
concluded that / एक जीव के डीएनए का विश्ले षण करते समय कुल 5386 न्यूक्लियोटाइड पाए
गए, जिनमें से विभिन्न आधारों का अनुपात था: एडेनिन = 29%, गुआनिन = 17%, साइटोसिन = 32%,
थाइमिन = 17%। चार्गफ के नियम को ध्यान में रखते हुए, यह निष्कर्ष निकाला जा सकता है कि:
(a) It is a double-stranded circular DNA / यह डबल-स्ट्रैं डेड गोलाकार डीएनए है।
(b) It is single-stranded DNA / यह एकल-स्ट्रैं डेड डीएनए है।
(c) It is a double-stranded linear DNA / यह डबल-स्ट्रैं डेड रैखिक डीएनए है।
(d) No conclusion can be drawn / कोई निष्कर्ष नहीं निकाला जा सकता।

11. If Meselson and Stahl's experiment is continued for four generations in bacteria,
the ratio of N15/N15: N15/N14: N14/N14 containing DNA in the fourth generation
would be / यदि मेसेलसन और स्टाल का प्रयोग बैक्टीरिया में चार पीढ़ियों तक जारी रखा जाता है,
तो N15/N15: N15/N14: N14/N14 डीएनए का अनुपात चौथी पीढ़ी में क्या होगा?
(a) 1:2:1 / 1:2:1
(b) 1:3:1 / 1:3:1
(c) 1:1:2 / 1:1:2
(d) 1:1:3 / 1:1:3
12. The most important feature in a plasmid to be used as a vector is / प्लाज्मिड में सबसे
महत्वपूर्ण विशेषता, जिसे एक वेक्टर के रूप में उपयोग किया जाता है, है:
(a) origin of replication (ori) / उत्पत्ति का प्रतिकृति (ori)
(b) presence of a selectable marker / चयन करने योग्य चिह्न की उपस्थिति
(c) presence of sites for restriction endonuclease / प्रतिबंध एं डोन्यूक्लीएज के स्थलों
की उपस्थिति
(d) its size / इसका आकार

13. C-peptide of human insulin is / मानव इं सुलिन का C-पेप्टाइड है:

(a) a part of mature insulin molecule / परिपक्व इं सुलिन अणु का एक हिस्सा
(b) responsible for formation of disulphide bridges / डिसल्फाइड ब्रिज के निर्माण के
लिए जिम्मेदार
(c) removed during maturation of proinsulin to insulin / प्रोइं सुलिन से इं सुलिन में
परिपक्वता के दौरान हटाया जाता है
(d) responsible for its biological activity / इसके जैविक कार्य के लिए जिम्मेदार

14. According to Allen’s Rule, the mammals from colder climates have / एले न के नियम
के अनुसार, ठं डे जलवायु के स्तनधारियों में होते हैं:
(a) shorter ears and longer limbs / छोटे कान और लं बे अंग
(b) longer ears and shorter limbs / लं बे कान और छोटे अंग
(c) longer ears and longer limbs / लं बे कान और लं बे अंग
(d) shorter ears and shorter limbs / छोटे कान और छोटे अंग

15. Pyramid of numbers is / संख्या का पिरामिड है:

(a) always upright / हमेशा सीधा
(b) always inverted / हमेशा उल्टा
(c) either upright or inverted / या तो सीधा या उल्टा
(d) neither upright nor inverted / न तो सीधा और न ही उल्टा

16. HIV that causes AIDS, first starts destroying / एड्स का कारण बनने वाला एचआईवी सबसे
पहले नष्ट करता है:
(a) helper T-lymphocytes / सहायक टी-लिंफोसाइट्स
(b) B-lymphocytes / बी-लिंफोसाइट्स
(c) leucocytes / ल्यूकोसाइट्स

17. Which of the following is an example of hormone-releasing IUDs? / निम्नलिखित में से

कौन हार्मोन-उत्सर्जक आईयूडी का उदाहरण है?
(a) CuT and Multilobed 375 / कॉपर-टी और मल्टीलोब्ड 375
(b) LNG-20 and Progestasert / एलएनजी-20 और प्रोजेस्टासर्ट
(c) Lippes loop / लिप्स लू प
(d) Both (b) and / (b) और (c) दोनों
18.
Match the following list of bioactive substances and their roles / जैव सक्रिय पदार्थों
और उनकी भूमिकाओ ं की निम्नलिखित सूची का मिलान करें:

Bioactive Substance / Role / भूमिका

जैव सक्रिय पदार्थ

A. Statin / स्टे टिन (i) Removal of oil stains / तेल के धब्बों को हटाना

B. Cyclosporin A / (ii) Removal of clots from blood vessels / रक्त वाहिकाओ ं

साइक्लोस्पोरिन A से थक्कों को हटाना

C. Streptokinase / (iii) Lowering of blood cholesterol / रक्त कोले स्ट्रॉल को

स्ट्रे प्टोकिनेज़ कम करना

D. Lipase / लाइपेज़ (iv) Immuno-suppressive agent / प्रतिरक्षा-दमनकारी

एजेंट

Choose the correct match. / सही मिलान चुनें:

(a) A-(ii), B-(iii), C-(i), D-(iv)
(b) A-(iv), B-(ii), C-(i), D-(iii)
(c) A-(iv), B-(i), C-(ii), D-(iii)
(d) A-(iii), B-(iv), C-(ii), D-(i)

19. In a certain taxon of insects, some have 17 chromosomes and the others have 18
chromosomes. The 17 and 18 chromosome-bearing organisms are / कीड़ों के एक
निश्चित वर्ग में, कुछ में 17 गुणसूत्र होते हैं और अन्य में 18 गुणसूत्र होते हैं। 17 और 18 गुणसूत्रों वाले जीव
हैं:
(a) males and females, respectively / क्रमशः नर और मादा
(b) females and males, respectively / क्रमशः मादा और नर
(c) all males / सभी नर
(d) all females / सभी मादा

20 Which of the following steps are catalysed by Taq DNA polymerase in a PCR
. reaction? / निम्नलिखित में से कौन से चरण Taq DNA पॉलिमरेज़ द्वारा PCR अभिक्रिया में
उत्प्रेरित किए जाते हैं?
(a) Denaturation of template DNA / टे म्पले ट डीएनए का डीनैचुरश
े न
(b) Annealing of primers to template DNA / टे म्पले ट डीएनए पर प्राइमर्स का एनीलिंग
(c) Extension of primer end on the template DNA / टे म्पले ट डीएनए पर प्राइमर छोर
का विस्तार
(d) All of the above / उपरोक्त सभी

21. Which one of the following is not a major characteristic feature of biodiversity hot
spots? / निम्नलिखित में से कौन जैव विविधता हॉट स्पॉट की प्रमुख विशेषताओ ं में से नहीं है?
(a) Large number of species / प्रजातियों की बड़ी संख्या
(b) Abundance of endemic species / स्थानिक प्रजातियों की प्रचुरता
(c) Mostly located in the tropics / मुख्य रूप से उष्णकटिबंधीय में स्थित
(d) Mostly located in the polar regions / मुख्य रूप से ध्रुवीय क्षेत्रों में स्थित
22. Match the scientists listed under column ‘I’ with ideas listed in column ‘II’ / स्तंभ 'I' में
सूचीबद्ध वैज्ञानिकों को स्तंभ 'II' में दिए गए विचारों से मिलाएं ।

Column I / स्तंभ I Column II / स्तंभ II

A. Darwin (i) Abiogenesis / अबायोजेनेसिस

B. Oparin (ii) Use and disuse of organs / अंगों का उपयोग और त्याग

C. Lamarck (iii) Continental drift theory / महाद्वीपीय विस्थापन सिद्धांत

D. Wagner (iv) Evolution by natural selection / प्राकृतिक चयन द्वारा

विकास

Options / विकल्प:
(a) A-(i); B-(iv); C-(ii); D-(iii)
(b) A-(iv); B-(i); C-(ii); D-(iii)
(c) A-(ii); B-(iv); C-(iii); D-(i)
(d) A-(iv); B-(iii); C-(ii); D-(i)

23. Viviparity is considered to be more evolved because / जीवजनन को अधिक विकसित

माना जाता है क्योंकि:
(a) The young ones are left on their own / युवा को अपने हाल पर छोड़ दिया जाता है।
(b) The young ones are protected by a thick shell / युवा को एक मोटे खोल द्वारा
संरक्षित किया जाता है।
(c) The young ones are protected inside the mother’s body and are looked
after after they are born, leading to more chances of survival / युवा को माँ के
शरीर के अंदर संरक्षित किया जाता है और उनके जन्म के बाद उनकी देखभाल की जाती है,
जिससे उनके जीवित रहने की संभावना बढ़ जाती है।
(d) The embryo takes a long time to develop / भ्रूण को विकसित होने में अधिक समय
लगता है।

24 In malignant tumors, the cells proliferate, grow rapidly, and move to other parts of
. the body to form new tumors. This stage of disease is called / घातक ट्यूमर में,
कोशिकाएं तेजी से बढ़ती हैं और शरीर के अन्य भागों में जाकर नए ट्यूमर बनाती हैं। इस बीमारी की
अवस्था को कहा जाता है:
(a) Metagenesis / मेटाजेनेसिस
(b) Metastasis / मेटास्टे सिस
(c) Teratogenesis / टे राटोजेनेसिस
(d) Mitosis / माइटोसिस

25. Match the following list of bacteria and their commercially important products /
बैक्टीरिया और उनके व्यावसायिक रूप से महत्वपूर्ण उत्पादों की सूची का मिलान करें:
Bacterium / बैक्टीरिया Product / उत्पाद

A. Aspergillus niger (i) Lactic acid / लै क्टिक अम्ल

B. Acetobacter aceti (ii) Butyric acid / ब्युटिरिक अम्ल

 C. Clostridium butylicum (iii) Acetic acid / एसिटिक अम्ल

D. Lactobacillus (iv) Citric acid / साइट्रिक अम्ल

Choose the correct match / सही मिलान चुनें:

(a) A-(ii), B-(iii), C-(iv), D-(i)
(b) A-(ii), B-(iv), C-(iii), D-(i)
(c) A-(iv), B-(iii), C-(ii), D-(i)
(d) A-(iv), B-(i), C-(iii), D-(ii)

GROUP -B ( समुह- ब)
अति लघु उत्तरीय प्रश्न (VERY SHORT ANSWER TYPE QUESTION)

26. Draw a diagram of a matured microspore of an angiosperm. Label its cellular

components only. / एं जियोस्पर्म के परिपक्व सूक्ष्मबीजाणु का एक चित्र बनाएं । केवल इसके
कोशिकीय घटकों को ले बल करें।

27. Given below are the stages in human reproduction. Write them in correct
sequential order. / मानव प्रजनन के चरण नीचे दिए गए हैं। इन्हें सही अनुक्रम में लिखें।
Insemination, Gametogenesis, Fertilisation, Parturition, Gestation,
Implantation / अंतःस्रवण, युग्मकजनन, निषेचन, प्रसव, गर्भकाल, आरोपण।

28. State a difference between a gene and an allele. / जीन और एलील में एक अंतर बताएं ।

29. When and why do some animals go into hibernation? / कुछ जानवर कब और क्यों
शीतनिद्रा में चले जाते हैं?

30 How does haemozoin affect the human body when released in blood during
. malarial infection? / मले रिया संक्रमण के दौरान रक्त में हीमोजोइन रिलीज होने पर यह मानव
शरीर को कैसे प्रभावित करता है?

31. BOD of waste water is estimated by measuring the amount of / अपशिष्ट जल का

बीओडी मापने के लिए किस मात्रा का अनुमान लगाया जाता है?

32. What is the difference between endemic and exotic species? / स्थानिक और विदेशी
प्रजातियों में क्या अंतर है?

33. Name the type of biodiversity represented by the following: / निम्नलिखित द्वारा दर्शाई
गई जैव विविधता के प्रकार का नाम बताएं :
(i) 1000 varieties of mangoes in India. / भारत में आम की 1000 किस्में।
(ii) Variations in potency and concentration of reserpine in Rauwolfia
vomitoria growing in different regions of the Himalayas. / हिमालय के विभिन्न
क्षेत्रों में उगने वाले राउवोल्फिया वॉमिटोरिया में रेसरपीन की क्षमता और एकाग्रता में
भिन्नताएं ।

34
. What are biodiversity hot spots? / जैव विविधता हॉटस्पॉट क्या हैं?
 Group C (समुह- स)
लघु उत्तरीय प्रश्न (Short Answer Type Question)

35 Differentiate between geitonogamy and xenogamy in plants. Which one between

. the two will lead to inbreeding depression and why? / पौधों में गाइटनोगैमी और ज़ेनोगैमी
में अंतर करें। इन दोनों में से कौन सा इनब्रिडिं ग डिप्रेशन का कारण बनेगा और क्यों?

36 (i) Draw a sectional view of the seminiferous tubule of a human. Label the
. following cells in the seminiferous tubule: / मानव के वृषण नलिका का खंडीय दृश्य बनाएं ।
वृषण नलिका में निम्नलिखित कोशिकाओ ं को ले बल करें:
(a) Cells that divide by mitosis to increase their number. / कोशिकाएं जो अपनी
संख्या बढ़ाने के लिए मिटोसिस द्वारा विभाजित होती हैं।
(b) Cells that undergo Meiosis I. / कोशिकाएं जो मीओसिस I से गुजरती हैं।
(c) Cells that undergo Meiosis II. / कोशिकाएं जो मीओसिस II से गुजरती हैं।
(d) Cells that help in the process of spermiogenesis. / कोशिकाएं जो
स्पर्मि ओजेनेसिस की प्रक्रिया में सहायता करती हैं।
(ii) Mention the role of Leydig cells. / ले यडिग कोशिकाओ ं की भूमिका का उल्ले ख करें।

37. A cross was carried out between two pea plants showing the contrasting traits of
the height of the plant. The result of the cross showed 50% of parental characters.
/ दो मटर के पौधों के बीच एक क्रॉस किया गया, जिसमें पौधे की ऊँचाई के विपरीत लक्षण प्रदर्शि त हो
रहे थे। क्रॉस के परिणाम में 50% पैतृक लक्षण दिखे।

(i) Work out the cross with the help of a Punnett square. / पुनेट स्क्वायर की सहायता से
क्रॉस का निर्धारण करें।
(ii) Name the type of the cross carried out. / किए गए क्रॉस के प्रकार का नाम बताएं ।

38 Define: / परिभाषित करें:

. (a) Metastasis / मेटास्टे सिस
(b) Vaccination / टीकाकरण

39 If the sequence of one strand of DNA is written as follows: / यदि डीएनए के एक स्ट्रैं ड का
. अनुक्रम निम्नलिखित रूप में लिखा गया है:
5′—ATGCATGCATGCATGCATGCATGCATGC—3′
Write down the sequence of complementary strand in 5′→3′ direction. / पूरक स्ट्रैं ड
का अनुक्रम 5′→3′ दिशा में लिखें।

40 Draw a schematic representation of dinucleotide. Label the following: /

. डायन्यूक्लियोटाइड का योजनात्मक चित्रण बनाएं । निम्नलिखित को ले बल करें:
(i) The components of a nucleotide / न्यूक्लियोटाइड के घटक
(ii) 5′ end / 5′ सिरा
(iii) N-glycosidic linkage / N-ग्लाइकोसिडिक बंध
(iv) Phosphodiester linkage / फॉस्फोडाइएस्टर बंध

41. Define algal bloom. How does it affect an ecosystem? / शैवाल प्रस्फुटन को परिभाषित
करें। यह एक पारितंत्र को कैसे प्रभावित करता है?
42 What is DNA fingerprinting? Mention its application. / डीएनए फिंगरप्रिं टिंग क्या है? इसके
. अनुप्रयोगों का उल्ले ख करें।

Group - D (समूह- द)
दीर्घ उत्तरीय प्रश्न (Long Answer Type Question)

43 (a) What is the trophic level of an ecosystem? What is ‘standing crop’ with
. reference to it? / किसी पारिस्थितिकी तंत्र में पोषण स्तर (ट्रॉफिक ले वल) क्या होता है? इसके
संदर्भ में 'स्थायी फसल' (स्टैं डिंग क्रॉप) क्या है?
(b) Explain the role of the ‘first trophic level’ in an ecosystem. / किसी पारिस्थितिकी
तंत्र में 'पहले पोषण स्तर' (फर्स्ट ट्रॉफिक ले वल) की भूमिका को समझाइए।
(c) How is the detritus food chain connected with the grazing food chain in a
natural ecosystem? / प्राकृतिक पारिस्थितिकी तंत्र में मलबा खाद्य श्रृंखला (डिट्रिटस फूड चेन)
चराई खाद्य श्रृंखला (ग्रेजिंग फूड चेन) से कैसे जुड़ी होती है?

44 (a) Name the specific type of gene that is incorporated in a cotton plant to protect
. the plant against cotton bollworm infestation. / उस विशिष्ट जीन का नाम बताएं जिसे
कपास के पौधे में कपास की बॉल वर्म संक्रमण से बचाने के लिए डाला जाता है।
(b)State a method of cellular defense which works in all eukaryotic organisms. /
एक कोशिकीय सुरक्षा विधि बताएं जो सभी यूकैरियोटिक जीवों में कार्य करती है।
(c)What is the significance of the process of RNA interference (RNAi) in eukaryotic
organisms? / यूकैरियोटिक जीवों में RNA हस्तक्षेप (RNAi) की प्रक्रिया का महत्व क्या है?
(d)Mention the chemical change that proinsulin undergoes to be able to act as
mature insulin. / उस रासायनिक परिवर्तन का उल्ले ख करें जो प्रोसुलिन में होता है ताकि वह
परिपक्व इं सुलिन के रूप में कार्य कर सके।
(e)State the role of transposons in silencing of mRNA in eukaryotic cells. /
यूकैरियोटिक कोशिकाओ ं में mRNA की शांति में ट्रांसपोसॉन्स की भूमिका बताएं ।

45 (a)Which main technique and instrument is used to isolate DNA from any plant
. cell? / किसी भी पौधे की कोशिका से DNA अलग करने के लिए कौन-सी मुख्य तकनीक और
उपकरण का उपयोग किया जाता है?
(b)What is the cell that receives a recombinant gene called? / उस कोशिका को क्या
कहा जाता है जो पुनः संयोजित जीन प्राप्त करती है?
(c)Why is a thermostable DNA polymerase needed in amplification (genetic
engineering)? / प्रवर्धन (आनुवंशिक इं जीनियरिं ग) में थर्मोस्टे बल DNA पोलीमरेज़ की
आवश्यकता क्यों होती है?
(d)Identify the reason for the selection of DNA polymerase from Thermus
aquaticus for Polymerase Chain Reaction. / पोलीमरेज़ चेन रिएक्शन के लिए Thermus
aquaticus से DNA पोलीमरेज़ के चयन का कारण बताएं ।
(e)How is repetitive/satellite DNA separated from bulk genomic DNA for various
genetic experiments? / विभिन्न आनुवंशिक प्रयोगों के लिए रिपिटिटिव/सैटेलाइट DNA को
थोक जीनोमिक DNA से कैसे अलग किया जाता है?

46 (a) Draw a diagram of an enlarged view of T.S. of one microsporangium of an

. angiosperm and label the following parts: / एक सपुष्पक के एक माइक्रोस्पोरेंगियम के
टी.एस. का विस्तृत दृश्य का आरेख बनाएं और निम्नलिखित भागों को चिह्नित करें:
(i) Tapetum / टे पेटम
 (ii) Middle layer / मध्य परत
(iii) Endothecium / एन्डोथीसियम
(iv) Microspore mother cells / माइक्रोस्पोर जनक कोशिकाएं
(b) Mention the characteristic features and function of tapetum. / टे पेटम की
विशेषताओ ं और कार्य का उल्ले ख करें।
(c) Explain the following giving reasons: / निम्नलिखित को कारण सहित समझाइए:
(i) Pollen grains are well preserved as fossils. / पराग कण जीवाश्म के रूप में अच्छी
तरह संरक्षित रहते हैं।
(ii) Pollen tablets are in use by people these days. / इन दिनों लोग पराग टै बले ट
का उपयोग कर रहे हैं।

47. (a) Draw a schematic representation of the structure of a transcription unit and
show the following in it: / एक ट्रांसक्रिप्शन यूनिट की संरचना का आरेख बनाएं और इसमें
निम्नलिखित दिखाएं :
(i) ट्रांसक्रिप्शन की दिशा
(ii) शामिल दो स्ट्रैं ड की ध्रुवता
(iii) टे म्पले ट स्ट्रैं ड
(iv) टर्मि नेटर जीन
(b) Mention the function of promoter gene in transcription. / ट्रांसक्रिप्शन में प्रॉमोटर
जीन का कार्य बताएं ।

48
.

Study the population growth curves in the graph given below and answer the
questions that follow: / नीचे दिए गए ग्राफ में जनसंख्या वृद्धि वक्रों का अध्ययन करें और नीचे
पूछे गए प्रश्नों का उत्तर दें:

(i) पहचानें कि वक्र 'a' और 'b' कौन से हैं।

(ii) इनमें से कौन सा अधिक यथार्थवादी माना जाता है और क्यों?
(iii) यदि dt/dN = rN(K - N)/K है तो लॉजिस्टिक वृद्धि वक्र में K का क्या अर्थ है?
(iv) N द्वारा क्या प्रतीकित किया जाता है?
(v)What will happen to an ecosystem if / यदि किसी पारिस्थितिकी तंत्र को क्या होगा
यदि:
(a) सभी उत्पादक हटा दिए जाएं ।
(b) सभी घास-खरतनाशक स्तर के जीवों को हटा दिया जाए।
(c) सभी शीर्ष शिकारी जनसंख्या हटा दी जाए।
 Answer
1. In angiosperms, male gametes are formed by the division of: Answer: (c)
Generative cell / जनरेटिव सेल
2. Seminal plasma, the fluid part of semen, is contributed by: Answer: (b) (i), (ii)
and (iv) / (i), (ii) और (iv)
3. In Mendel’s experiments with the garden pea, what are the expected
phenotypes in the F2 generation of the cross RRYY × rryy?
Answer: (a) Round seeds with yellow cotyledons, and wrinkled seeds with yellow
cotyledons / गोल बीज पीले बीजपत्र के साथ और सिकुड़े हुए बीज पीले बीजपत्र के साथ।
4. Emergency contraceptives are effective if used within: Answer: (a) 72 hrs of
coitus / सहवास के 72 घंटे के भीतर
5. Choose the correct statement regarding the ZIFT procedure: Answer: (b)
Zygote is collected from a female donor and transferred to the fallopian tube /
युग्मज को महिला दाता से संग्रहित कर फेलोपियन ट्यूब में स्थानांतरित किया जाता है।
6. Conditions of a karyotype 2n + 1, 2n – 1 and 2n + 2, 2n – 2 are called: Answer: (a)
Aneuploidy / ऐन्यूप्लॉइडी
7. In a dihybrid cross, if you get 9:3:3:1 ratio it denotes that: Answer: (d) The
alleles of two genes are segregating independently / दो जीन के एलील स्वतंत्र रूप से
विभाजित हो रहे हैं।
8. In the F2 generation of a Mendelian dihybrid cross, the number of phenotypes
and genotypes are: Answer: (a) Phenotypes - 4; Genotypes - 16 / फीनोटाइप - 4;
जीनोटाइप - 16
9. To prevent polymerisation of nucleotides in DNA, which of the following
modifications would you choose? Answer: (d) Both ‘b’ and ‘c’ / 'b' और 'c' दोनों।
10. Considering the Chargaff’s rule, it can be concluded that: Answer: (b) It is
single-stranded DNA / यह एकल-स्ट्रैं डेड डीएनए है।
11. If Meselson and Stahl's experiment is continued for four generations in
bacteria, the ratio of N15/N15: N15/N14: N14/N14 containing DNA in the fourth
generation would be
Answer: (d) 1:1:3
12. The most important feature in a plasmid to be used as a vector is
Answer: (a) origin of replication (ori)
13. C-peptide of human insulin is
Answer: (c) removed during maturation of proinsulin to insulin
14. According to Allen’s Rule, the mammals from colder climates have
Answer: (d) shorter ears and shorter limbs
15. Pyramid of numbers is
Answer: (c) either upright or inverted
16. HIV that causes AIDS, first starts destroying
Answer: (a) helper T-lymphocytes
17. Which of the following is an example of hormone-releasing IUDs?
Answer: (b) LNG-20 and Progestasert
18. Match the following list of bioactive substances and their roles
 Answer: (d) A-(iii), B-(iv), C-(ii), D-(i)
19. In a certain taxon of insects, some have 17 chromosomes and the others have
18 chromosomes. The 17 and 18 chromosome-bearing organisms are
Answer: (a) males and females, respectively
20. Which of the following steps are catalysed by Taq DNA polymerase in a PCR
reaction?
Answer: (c) Extension of primer end on the template DNA
21. Which one of the following is not a major characteristic feature of biodiversity
hot spots?
Answer: (d) Mostly located in the polar regions / मुख्य रूप से ध्रुवीय क्षेत्रों में स्थित
22. Match the scientists listed under column ‘I’ with ideas listed in column ‘II’:
Answer: (b) A-(iv); B-(i); C-(ii); D-(iii)
23. Viviparity is considered to be more evolved because:
Answer: (c) The young ones are protected inside the mother’s body and are
looked after after they are born, leading to more chances of survival / युवा को माँ
के शरीर के अंदर संरक्षित किया जाता है और उनके जन्म के बाद उनकी देखभाल की जाती है,
जिससे उनके जीवित रहने की संभावना बढ़ जाती है।
24. In malignant tumors, the cells proliferate, grow rapidly, and move to other
parts of the body to form new tumors. This stage of disease is called:
Answer: (b) Metastasis / मेटास्टे सिस
25. Match the following list of bacteria and their commercially important products:
Answer: (c) A-(iv), B-(iii), C-(ii), D-(i)
 झारखण्ड शैक्षिक अनुसध
ं ान एवं प्रशशिण पररषद् ,रााँची
Jharkhand Council of Educational Research and Training, Ranchi

MODEL QUESTION PAPER

Session: 2024-25 ( - )

Class – 12 Subject – Mathematics F. M. – 80 Time – 3 Hours

INSTRUCTIONS / निर्दे श :
1. Examinee are required to answer in their own words as far as practicable.
ijh{kkFkhZ ;FkklaHko vius 'kCnksa esa gh mÙkj nsAa
2. This question paper has four sections: A, B, C and D. Total number of questions
are 52.
bl iz’ui= esa pkj [k.M & A, B, C ,oa D gSA dqy iz'uksa dh la[;k gSA
3. There are 30 Multiple Choice Questions in the Section A. Four options are given
for each question, choose one of the correct options.
A esa dqy 30 cgqfodYih; iz’u gSaA izR;sd iz'u ds pkj fodYi fn, x, gSa]
buesa ls ,d lgh fodYi dk p;u dhft,A
4. Section B – Question numbers 31 – 38 are very short answer type. Answer
any six of these questions. Each question carries 2 marks.
B esa iz'u la[;k gSaA buesa ls fdUgh Ng
iz'uksa ds mÙkj nhft,A izR;sd iz'u dk eku vad fu/kkZfjr gSA
5. Section C – Question numbers 39 – 46 are short answer type. Answer any six
of these questions. Each question carries 3 marks.
Cesa iz' u la[;k gSa A buesa ls fdUgh Ng iz' uksa
ds mÙkj nhft,A izR;sd iz'u dk eku vad fu/kkZfjr gSA
6. Section D – Question numbers 47 – 52 are long answer type. Answer any four
of these questions. Each question carries 5 marks.
D esa iz'u la[;k gSaA buesa ls fdUgh pkj
iz'uksa ds mÙkj nhft,A izR;sd iz'u dk eku vad fu/kkZfjr gSA

Page 1 of 9
 Section-A - (𝟏 × 𝟑𝟎 = 𝟑𝟎)
1. A relation 𝑅 on set {1, 2, 3} is given by 𝑅 = {(1, 1), (2, 2), (1, 2), (3, 3), (2, 3)}. Then
the relation 𝑅 is
(a) reflexive (b) symmetric
(c) transitive (d) symmetric and transitive
,d laca/k 𝑅 leqPp; {1, 2, 3} ij 𝑅 = {(1, 1), (2, 2), (1, 2), (3, 3), (2, 3)} }kjk ifjHkkf"kr
gS] rks laca/k 𝑅 gS
(a) LorqY; (b) Lkefer
(c) LkaØked (d) Lkefer vkSj LkaØked
2. Let 𝑓: 𝑅 → 𝑅 be defined as 𝑓(𝑥 ) = 3𝑥. Choose the correct answer.
(a) 𝑓 is one-one onto (b) 𝑓 is many-one onto
(c) 𝑓 is one-one but not onto (d) 𝑓 is neither one-one nor onto
Ekku fyft, fd 𝑓(𝑥) = 3𝑥 )kjk ifjHkkf"kr Qyu 𝑓: 𝑅 → 𝑅 gSA lgh mÙkj pqfu,
(a) 𝑓 ,dSdh vkPNknd gS (b) 𝑓 cgq,d vkPNknd gS
(c) 𝑓 ,dSdh gS fdarq vkPNknd ugha gS (d) 𝑓 u rks ,dSdh gS vkSj u vkPNknd gSA
3. If 𝑓(𝑥) = 𝑥 2 + 𝑥 + 7 then 𝑓𝑜𝑓(0) is
(a) 7 (b) 63 (c) 49 (d) 21
;fn 𝑓(𝑥) = 𝑥 2 + 𝑥 + 7 rks 𝑓𝑜𝑓(0) =
(a) 7 (b) 63 (c) 49 (d) 21

4. Principal value of tan−1 (−1) is

(a) 𝜋/4 (b) −𝜋/4 (c) 3𝜋/4 (d) −3𝜋/4
tan−1 (−1) dk eq[; eku gS
(a) 𝜋/4 (b) −𝜋/4 (c) 3𝜋/4 (d) −3𝜋/4
2𝑥 + 𝑦 4𝑥 7 5𝑦 − 7
5. If [ ]= [ ], then the value of 𝑥, 𝑦 are respectively
5𝑥 − 7 4𝑥 𝑦 𝑥+6
2𝑥 + 𝑦 4𝑥 7 5𝑦 − 7
;fn [ ]= [
𝑦 𝑥+6
] rks 𝑥, 𝑦 ds eku Øe’k% gS
5𝑥 − 7 4𝑥
(a) 3, 1 (b) 2, 3 (c) 2, 4 (d) 3, 3
6. If 𝐴 be any square matrix, then (𝐴 + 𝐴′) is
(a) identity matrix (b) symmetric matrix
(c) skew-symmetric matrix (d) none of these
;fn 𝐴 dksbZ oxZ vkO;wg gS] rks (𝐴 + 𝐴′) gS
(a) rRled vkO;wg (b) lefer vkO;wg
(c) fo"ke lefer vkO;wg (d) buesa ls dksbZ ugha
Page 2 of 9
7. If 𝐴 = [ −1 2 3 ], then order of matrix 𝐴 is
(a) 1 × 3 (b) 3 × 1 (c) 1 × 1 (d) none of these
;fn 𝐴 = [ −1 2 3 ], rks vkO;wg 𝐴 dh dksfV gS
(a) 1 × 3 (b) 3 × 1 (c) 1 × 1 (d) buesa ls dksbZ ugha
1 2
8. If 𝐴 = [ ], then |2𝐴| is equal to
4 2
;fn 𝐴 = [ 1 2 ] rks |2𝐴| dk eku gS
4 2
(a) 2|𝐴| (b) |𝐴| (c) 4|𝐴| (d) 8|𝐴|
9. The number of all possible matrices of order 3 × 3 with each entry 0 or 1 is
3 × 3 dksfV ds ,sls vkO;wgksa dh dqy fdruh la[;k gksxh ftudh izR;sd izfof"V 0 ;k 1 gS?
(a) 27 (b) 18 (c) 81 (d) 512

2 3 𝑥 3
10. If | |=| |, then 𝑥 is
4 5 2𝑥 5
(a) 2 (b) -2 (c)0 (d) none of these

;fn |2 3| = | 𝑥 3
| , rks 𝑥 gS
4 5 2𝑥 5
(a) 2 (b) -2 (c)0 (d) buesa ls dksbZ ugha
𝑑𝑦
11. If 𝑦 = log(log𝑥 ) , 𝑥 > 1 then is
𝑑𝑥
𝑑𝑦
;fn 𝑦 = log(log𝑥 ) , 𝑥 > 1 rks gS
𝑑𝑥
1 𝑥 1 −1
(a) (b) (c) (d)
log𝑥 log𝑥 𝑥 log𝑥 𝑥 log𝑥

𝑑𝑦
12. If (;fn) √𝑥 + √𝑦 = √𝑎 , then (rks) =?
𝑑𝑥
√𝑥 1 √𝑦 √𝑦
(a) − (b) − (c) − (d) 0
√𝑦 2 √𝑥 √𝑥
𝑑 2𝑦
13. If (;fn) 𝑦 = 5cos𝑥 − 3sin𝑥, then (rks) =
𝑑𝑥2
(a) 0 (b) 𝑦 (c) −𝑦 (d) 𝑥

14. The rate of change of the area of a circle with respect to its radius 𝑟 at 𝑟 = 5cm is
o`r dh {ks=Qy esa ifjorZu dh nj blds f=T;k ds lkis{k D;k gksxh tc f=T;k 5 cm gks\
(a) 10𝜋 cm2 /cm (b) 20𝜋 cm2 /cm
22
(c) cm2 /cm (d) 110𝜋 cm2 /cm
7
Page 3 of 9
 𝑑𝑥
15. ∫ is equal to ¼cjkcj gS½
𝑒 𝑥 +𝑒 −𝑥

(a) tan−1 (𝑒𝑥 ) + 𝑐 (b) tan−1(𝑒 −𝑥 ) + 𝑐

(c) log(𝑒 𝑥 − 𝑒−𝑥 ) + 𝑐 (d) log (𝑒 𝑥 + 𝑒 −𝑥 ) + 𝑐

sec 2 𝑥
16. ∫ 𝑑𝑥 is equal to ¼cjkcj gS½
cosec 2 𝑥

(a) tan 𝑥 + 𝑥 + 𝑐 (b) 𝑥 − tan 𝑥 + 𝑐

(c) tan 𝑥 − 𝑥 + 𝑐 (d) tan 𝑥 + 𝑐
𝜋/2
17. ∫−𝜋/2 sin7 𝑥 𝑑𝑥 is equal to ¼cjkcj gS½

(a) 𝜋/2 (b) −𝜋/2 (c) 𝜋 (d) 0

1 1
18. ∫0 𝑑𝑥 =
1+𝑥2

(a) 𝜋/2 (b) 𝜋/3 (c) 𝜋/4 (d) 𝜋/6

𝑑2 𝑦 𝑑𝑦 2
19. Sum of the order and degree of the differential equation = √1 + ( ) is
𝑑𝑥2 𝑑𝑥

𝑑2 𝑦 𝑑𝑦 2
vody lehdj.k 𝑑𝑥2
= √1 + ( ) dh dksfV rFkk ?kkr dk ;ksxQy gS
𝑑𝑥

(a) 1 (b) 2 (c) 3 (d) 4

20. What is the integrating factor of the differential equation

𝑑𝑦
+ 𝑦 sec 𝑥 = tan 𝑥?
𝑑𝑥
𝑑𝑦
vody lehdj.k + 𝑦 sec 𝑥 = tan 𝑥 dk lekdyu xq.kkad D;k gS\
𝑑𝑥

(a) sec 𝑥 + tan 𝑥 (b) log (sec 𝑥 + tan 𝑥 )

(c) 𝑒sec 𝑥 (d) sec 𝑥

21. If the vectors 𝑎𝑖̂ + 3𝑗̂ − 2𝑘̂ and 3𝑖̂ − 4𝑗̂ + 𝑏𝑘̂ are collinear, then (𝑎, 𝑏) =
;fn lfn’k 𝑎𝑖̂ + 3𝑗̂ − 2𝑘̂ rFkk 3𝑖̂ − 4𝑗̂ + 𝑏𝑘̂ lajs[k gSa] rks (𝑎, 𝑏) =
9 8 9 8 9 8 9 8
(a) ( , ) (b) ( − , ) (c) ( , − ) (d) ( − , − )
4 3 4 3 4 3 4 3

22. The value of 𝑖̂ ∙ (𝑗̂ × 𝑘̂) + 𝑗̂ ∙ (𝑖̂ × 𝑘̂) + 𝑘̂ ∙ (𝑖̂ × 𝑗̂) is

𝑖̂ ∙ (𝑗̂ × 𝑘̂) + 𝑗̂ ∙ (𝑖̂ × 𝑘̂) + 𝑘̂ ∙ (𝑖̂ × 𝑗̂) dk eku gS
(a) 0 (b) −1 (c) 1 (d) 3
Page 4 of 9
23. ⃗⃗⃗ = 5 𝑖̂ + 𝑗̂ − 3 𝑘̂ and ⃗⃗⃗
If 𝑎 𝑏 = 3 𝑖̂ − 4 𝑗̂ + 7 𝑘̂, the 𝑎⃗⃗⃗ ∙ ⃗⃗⃗
𝑏 is
;fn 𝑎 ⃗⃗⃗ = 5 𝑖̂ + 𝑗̂ − 3 𝑘̂ vkSj 𝑏
⃗⃗⃗ = 3 𝑖̂ − 4 𝑗̂ + 7 𝑘̂, rks 𝑎 ⃗⃗⃗ gksxk
⃗⃗⃗ ∙ 𝑏
(a) 15 (b) -15 (c) 10 (d) -10

24. If | 𝑎⃗⃗⃗ | ≠ 0, | ⃗⃗⃗

𝑏 | ≠ 0 and 𝑎 ⃗⃗⃗ × ⃗⃗⃗ 𝑏 = ⃗⃗⃗
0 , then
;fn | 𝑎 ⃗⃗⃗ | ≠ 0, | ⃗⃗⃗
𝑏 | ≠ 0 vkSj 𝑎 ⃗⃗⃗ × ⃗⃗⃗
𝑏 = ⃗⃗⃗ 0 gks] rks
(a) 𝑎⃗⃗⃗ = 𝑏 ⃗⃗⃗ (b) 𝑎
⃗⃗⃗ ⊥ 𝑏 ⃗⃗⃗ (c) 𝑎 ⃗⃗⃗
⃗⃗⃗ ∥ 𝑏 (d) 𝑎 ⃗⃗⃗ = 𝑎
⃗⃗⃗ ∙ 𝑏 ⃗⃗⃗
⃗⃗⃗ × 𝑏

25. The direction cosines of the vector 𝑖̂ + 2 𝑗̂ + 2 𝑘̂ are

Lkfn’k 𝑖̂ + 2 𝑗̂ + 2 𝑘̂ dk fnd~&dkslkbu gksxk
1 2 2 1 2 2 1 2 2
(a) 1, 2, 2 (b) , , (c) , , (d) , ,
9 9 9 √3 √3 √3 3 3 3

26. The vector equation of 𝑥-axis is

𝑥-v{k dk lfn’k lehdj.k gS
(a) ⃗⃗𝑟 = 𝑖̂ (b) 𝑟⃗⃗ = 𝑗̂ + 𝑘̂ (c) 𝑟⃗⃗ = 𝜆𝑖̂ (d) 𝑟⃗⃗ = 𝜆𝑗̂
𝑥−5 𝑦−2 𝑧+4
27. If the cartesian equation of a line 𝑙 is = =
3 2 −8 , then the vector
equation of that line 𝑙 is
𝑥−5 𝑦−2 𝑧+4
;fn ,d js[kk 𝑙 dk dkrhZ; lehdj.k = = gS] rks mlh js[kk 𝑙 dk
3 2 −8
lfn’k lehdj.k gksxk
(a) ⃗⃗𝑟 = (5 𝑖̂ + 2 𝑗̂ + 4 𝑘̂) + 𝜆(3 𝑖̂ + 2 𝑗̂ − 8 𝑘̂)
(b) ⃗⃗𝑟 = (3 𝑖̂ + 2 𝑗̂ − 8 𝑘̂) + 𝜆(5 𝑖̂ + 2 𝑗̂ − 4 𝑘̂)
(c) ⃗⃗𝑟 = (5 𝑖̂ + 2 𝑗̂ − 4𝑘̂) + 𝜆(3 𝑖̂ + 2 𝑗̂ − 8𝑘̂)
(d) ⃗⃗𝑟 = (5 𝑖̂ + 2 𝑗̂ − 4𝑘̂) + (3 𝑖̂ + 2 𝑗̂ − 8𝑘̂)
𝑥−1 𝑦−1 𝑧−6 𝑥−1 𝑦−2 𝑧−3
28. If lines = = and = = are perpendicular,
3𝑘 2 1 1 2𝑘 −7
then the value of 𝑘 is
𝑥−1 𝑦−1 𝑧−6 𝑥−1 𝑦−2 𝑧−3
;fn js[kk,¡ = = rFkk = = ijLij yEcor gSa]
3𝑘 2 1 1 2𝑘 −7
rks 𝑘 dk eku gS
(a) -1 (b) 1 (c) 0 (d) 7
29. If 𝑃(𝐴̅ ) = 0.2, 𝑃(𝐵) = 0.5 and 𝑃(𝐵/𝐴) = 0.4, then 𝑃(𝐴/𝐵) = ________
;fn 𝑃(𝐴̅ ) = 0.2, 𝑃(𝐵) = 0.5 rFkk (𝐵/𝐴) = 0.4] rks 𝑃(𝐴/𝐵) = ________
Page 5 of 9
 (a) 0.32 (b) 0.64 (c) 0.16 (d) 0.25

30. If 𝐴 and 𝐵 are independent events, then which is not true

;fn 𝐴 vkSj 𝐵 nks Lora= ?kVuk,¡ gSa, rks dkSu lR; ugha gS
(a) 𝑃(𝐴 ∩ 𝐵) = 𝑃(𝐴)𝑃(𝐵) (b) 𝑃(𝐴 ∩ 𝐵̅) = 𝑃(𝐴)𝑃(𝐵̅)
(c) 𝑃(𝐴 ∪ 𝐵) = 1 − 𝑃(𝐴̅)𝑃(𝐵̅) (d) 𝑃(𝐴 ∪ 𝐵) = 𝑃(𝐴) + 𝑃(𝐵)

Section-B - (𝟐 × 𝟔 = 𝟏𝟐)

31. Let 𝑓: 𝑹 → 𝑹 be given by 𝑓(𝑥 ) = 𝑥 2 − 5𝑥 + 4, then find the value of 𝑓𝑜𝑓(1).

;fn 𝑓: 𝑹 → 𝑹, 𝑓(𝑥 ) = 𝑥 2 − 5𝑥 + 4 }kjk ÁnŸk gS] rks 𝑓𝑜𝑓(1) dk eku Kkr dhft,A
32. Write all one-one functions from set 𝐴 = {1, 2, 3} to itself.
leqPp; 𝐴 = {1, 2, 3} ls Lo;a rd lHkh ,dSdh Qyu dks fy[ksAa
2 3 17
33. Prove that (fl} dhft, fd): tan−1 + sin−1 = tan−1
3 5 6
34. Find minor and cofactor of elements 6 in the following determinant
fuEufyf[kr lkjf.kd esa vo;o 6 dk milkjf.kd vkSj lg[k.M Kkr dhft,
1 2 2
∆= |4 5 6|
7 8 9
𝑑𝑦
35. If 𝑥 = 𝑎(𝜃 − sin 𝜃 ), 𝑦 = 𝑎(1 − cos 𝜃 ), then find .
𝑑𝑥
𝑑𝑦
;fn 𝑥 = 𝑎(𝜃 − sin 𝜃 ), 𝑦 = 𝑎(1 − cos 𝜃 ), rks Kkr djsAa
𝑑𝑥
𝑑𝑥
36. Evaluate (Kkr djsa): ∫
√1 − cos 𝑥
37. Find the integrating factor of the following differential equation
fuEufyf[kr vody lehdj.k dk lekdyu xq.kd Kkr dhft,
𝑑𝑦
𝑥 + 2𝑦 = 𝑥 2 (𝑥 ≠ 0)
𝑑𝑥
38. If 𝐴 and 𝐵 are two events such that 𝑃(𝐴) = 1/4, 𝑃(𝐵) = 1/2 and 𝑃(𝐴 ∩ 𝐵) = 1/
8, then find 𝑃(not 𝐴 and not 𝐵).
;fn 𝐴 vkSj 𝐵 nks ,slh ?kVuk,¡ gS fd 𝑃(𝐴) = 1/4, 𝑃(𝐵) = 1/2 vkSj 𝑃 (𝐴 ∩ 𝐵) = 1/8
rks 𝑃( 𝐴-ugha vkSj 𝐵-ugha) Kkr dhft,A
Page 6 of 9
 Section-C - (𝟑 × 𝟔 = 𝟏𝟖)
𝑥
𝑖𝑓 𝑥 ≠ 0
39. Prove that the function 𝑓(𝑥 ) = { 𝑥|
| is not continuous at point 𝑥 = 0.
−1 𝑖𝑓 𝑥 = 0
𝑥
𝑖𝑓 𝑥 ≠ 0
fl} djsa fd Qyu 𝑓(𝑥 ) = { |𝑥| fcUnq 𝑥 = 0 ij larr ugh gSA
−1 𝑖𝑓 𝑥 = 0

40. If area of triangle is 35 sq units with vertices (2, −6), (5, 4) and (𝑘, 4), then find
value of 𝑘.

;fn 'kh"kZ (2, −6), (5, 4) vkSj (𝑘, 4) okys f=Hkqt dk {ks=Qy 35 oXkZ bdkbZ gS rks 𝑘 dk
eku Kkr djsAa
41. Find the interval in which the function 𝑓(𝑥 ) = 2𝑥3 − 3𝑥 2 − 36𝑥 + 7 is
(a) increasing, (b) decreasing.

varjky Kkr dhft, ftuesa Qyu 𝑓(𝑥 ) = 2𝑥 3 − 3𝑥 2 − 36𝑥 + 7

(a) o/kZeku (b) gzkleku gSA
𝑑𝑦
42. Find if 𝑦 = 𝑥 sin 𝑥 + (sin 𝑥 )cos 𝑥
𝑑𝑥
𝑑𝑦
Kkr dhft, ;fn 𝑦 = 𝑥 sin 𝑥 + (sin 𝑥 )cos 𝑥
𝑑𝑥
𝑥+2
43. Evaluate (eku fudkysa): ∫ 𝑑𝑥
√𝑥 2 + 2𝑥 + 3
4
√𝑥
44. Evaluate (eku fudkysa): ∫ 𝑑𝑥
0 √4 − 𝑥 + √𝑥

⃗⃗⃗ = 3 𝑖̂ + 𝑗̂ + 4 𝑘̂ and ⃗⃗⃗

45. If 𝑎 𝑏 = 3 𝑖̂ − 𝑗̂ + 5 𝑘̂, then find

⃗⃗⃗ = 3 𝑖̂ + 𝑗̂ + 4 𝑘̂ rFkk ⃗⃗⃗

;fn 𝑎 𝑏 = 3 𝑖̂ − 𝑗̂ + 5 𝑘̂, rks Kkr dhft,
(i) |𝑎 ⃗⃗⃗ |
⃗⃗⃗ | + |𝑏 ⃗⃗⃗ × ⃗⃗⃗
(ii) 𝑎 𝑏 ⃗⃗⃗ ∙ ⃗⃗⃗
(iii) 𝑎 𝑏
46. If the vertices 𝐴, 𝐵, 𝐶 of a triangle 𝐴𝐵𝐶 have position vectors
(1, 2, 3), (−1, 0, 0) and (0, 1, 2) respectively, then find ∠𝐴𝐵𝐶.

;fn fdlh f=Hkqt 𝐴𝐵𝐶 ds 'kh"kZ 𝐴, 𝐵, 𝐶 Øe'k% (1, 2, 3), (−1, 0, 0) rFkk (0, 1, 2) gSa
rks ∠𝐴𝐵𝐶 Kkr dhft,A

Page 7 of 9
 Section-D - (𝟓 × 𝟒 = 𝟐𝟎)

47. Solve the following system of equations by matrix method

fuEufyf[kr lehdj.k fudk; dks vkC;wg fof/k ls gy djsa
5𝑥 + 3𝑦 + 𝑧 = 16
2𝑥 + 𝑦 + 3𝑧 = 19
𝑥 + 2𝑦 + 4𝑧 = 25
48. Find the maximum and minimum value of 𝑥 3 − 3𝑥 + 3

𝑥 3 − 3𝑥 + 3 dk egÙke rFkk U;wure eku Kkr djsAa

49. Find the shortest distance between the following pair of lines
fuEufyf[kr js[kk&;qXeksa ds chp dh U;wure nwjh Kkr djsa
⃗⃗𝑟 = (𝑖̂ + 2 𝑗̂ + 𝑘̂) + 𝜇(𝑖̂ − 𝑗̂ + 𝑘̂) and 𝑟⃗⃗ = (2 𝑖̂ − 𝑗̂ − 𝑘̂) + 𝜆(2 𝑖̂ + 𝑗̂ + 2 𝑘̂)

50. A card from a pack of 52 cards is lost. From the remaining cards of the pack,
two cards are drawn and are found to be both diamonds. What is the
probability of the lost card being a diamond?
52 rk’ksa dh xÏh ls ,d iÙkk [kks tkrk gSA 'ks"k iÙkksa esa ls nks iÙks fudkys tkrs gSa tks
bZV ds iÙks gSaA [kks x, iÙks ds bZV gksus dh izkf;drk D;k gS?

51. Solve the following L.P.P. by graphical method:

Minimize 𝑧 = 20𝑥 + 10𝑦
Subject to 𝑥 + 2𝑦 ≤ 40
3𝑥 + 𝑦 ≥ 30
4𝑥 + 3𝑦 ≥ 60 and 𝑥, 𝑦 ≥ 0.

fuEufyf[kr jSf[kd izksxzkeu leL;k dks vkys[kh; fof/k ls gy djsa :

U;wurehdj.k djsa 𝑧 = 20𝑥 + 10𝑦
tcfd 𝑥 + 2𝑦 ≤ 40
3𝑥 + 𝑦 ≥ 30
4𝑥 + 3𝑦 ≥ 60 and 𝑥, 𝑦 ≥ 0.

52. Using integration find the area of the region bounded by the parabola 𝑦 2 = 16𝑥
and the line 𝑥 = 4.
lekdyu dk iz;ksx dj ijoy; 𝑦 2 = 16𝑥 rFkk ljy js[kk 𝑥 = 4 ls f?kjs {ks= dk
{ks=Qy Kkr djsAa

Page 8 of 9
 Answer – Key

Q.N. 1 2 3 4 5 6 7 8 9 10
Key A a b b b b a c d a
Q.N. 11 12 13 14 15 16 17 18 19 20
Key c c c a a c d c d a
Q.N. 21 22 23 24 25 26 27 28 29 30
Key b c d c d c c b b d

Page 9 of 9
 झारखण्ड शैक्षणिक अनस
ु ंधान एवं प्रणशक्षि पररषद रााँची , झारखण्ड
वाणषि क परीक्षा (Annual Examination)
2024-2025
मॉडल प्रश्न पत्र
कक्षा – XII णवषय – कं प्यूटर विज्ञान समय – 3 घण्टा पूिाांक – 70

Class-XII Subject- Computer Science Time- 3 Hour Full Marks - 70

सामान्य निर्देश (General Instruction)

 परीक्षार्थी यर्थासंभव अपने शब्दों में उत्तर दें। (Examinee write answer in their own words as far as
practicable.)
 कुल प्रश्नों की संख्या 48 है। (The total number of questions are 48)
 प्रश्न पत्र को चार खंडों में णवभाणित णकया गया है। प्रत्येक खंड से णनदेशानस ु ार उत्तर देना अणनवायि है।(The question
paper is divided into four sections. It is mandatory to answer each section as per the
instructions.)
 खंड –A में प्रश्न संख्या 01 से 25 तक बहुणवकल्पीय प्रश्न हैं। प्रत्येक प्रश्न के णलए 1 अंक णनधाि ररत है | प्रत्येक प्रश्न के
चार णवकल्प णदये गए हैं | सही णवकल्प का चयन कीणिये | गलत उत्तर के णलए कोई अंक नहीं काटे िाएंगे | (Question
numbers 01 to 25 in section-A are multiple choice questions. Each question carries 1 mark.
Four options are given for each question. Choose the correct option. No marks will be deducted
for the wrong answer.)
 खंड –B में प्रश्न संख्या 1 से प्रश्न संख्या 9 तक अणतलघूत्तरीय प्रश्न हैं। इनमें से णकन्हीं सात प्रश्नों के उत्तर अणधकतम
एक वाक्य में दीणिए। प्रत्येक प्रश्न का मान 1 अंक णनधाि ररत है। (Section-B contains very short answer
questions from question number 1 to question number 9. Answer any seven of these questions
in maximum one sentence. Each question carries 1 mark.)
 खंड –C में प्रश्न संख्या 1 से प्रश्न संख्या 8 तक लघूउत्तरीय प्रश्न हैं। इनमें से णकन्हीं 6 प्रश्नों के उत्तर अणधकतम 50
शब्दों में दीणिए। प्रत्येक प्रश्न का मान 3 अंक णनधाि ररत है।(Section-C contains short answer questions from
question number 1 to question number 8. Answer any 6 of these questions in maximum 50
words. Each question carries 3 marks.)
 खंड –D में प्रश्न संख्या 1 से प्रश्न 6 तक दीघि उत्तरीय प्रश्न हैं। इनमें से णकन्हीं चार प्रश्नों के उत्तर अणधकतम 100 शब्दों
में दीणिए। प्रत्येक प्रश्न का मान 5 अंक णनधाि ररत है।(Section-D contains long answer questions from
question number 1 to question number 6. Answer any four of these questions in maximum 100
words. Each question carries 5 marks.)
खंड –A
(Section-A)
1 C++ is developed by 1 C++ वकसके द्वारा विकवसत वकया गया है?

A Dennis Ritchie A डेवनस ररची

B Ken Thompson B के न थॉम्पसन
C Martin Richard C मावटि न ररचडि
D Bjarne Stroustrup D बज़्ने स्ट्रॉस्ट्रुप
2 String Terminator character is 2 वस्ट्रंग टवमि नेटर िर्ि है

A ‘|o’ A ‘|o’
B ‘|n’ B ‘|n’
C ‘|b’ C ‘|b’
D None of these D इनमें से कोई नहीं

3 DBMS Stands for 3 डीबीएमएस का मतलब है

A Database Management System A डेटाबेस प्रबंधन प्रर्ाली

B Database Manual System B डेटाबेस मैनअ ु ल वसस्ट्टम
C Define Management Solution C प्रबंधन समाधान पररभावित करें
D None of these D इनमें से कोई नहीं

4 The smallest individual unit in 4 सबसे छोटी व्यविगत इकाई

A Semicolon A अधि विराम

B Data type B डेटा प्रकार
C Token C टोकन
D Keyword D कीिडि

5 The process of finding the location of the particular 5 सारर्ी में विशेि तत्ि का स्ट्थान ढूंढने की प्रविया को कहा
element in the array is called जाता है

A Traversal A रैिसि ल
B Searching B खोज
C Sorting C सॉवटिं ग
D None of these D इनमें से कोई नहीं

6 The Boolean expression A.(B+C)=AB + AC is 6 बूवलयन अवभव्यवि A.(B+C)=AB + AC है

A Associative law A साहचयि कानून

B Commutative law B विवनमेय कानून
C Absorption law C अिशोिर् कानून
D Distributive law D वितरर् कानून

7 Destructor name is preceded by 7 विध्िंसक नाम के पहले आता है

A ! A !
B # B #
C $ C $
D ~ D ~
8 The term ‘attribute’ refers to a 8 शब्द 'विशेिता' से तात्पयि है

A Table A तावलका
B Row B पंवि
C Column C स्ट्तंभ
D Relation D संबंध

9 Main is a /an 9 मख्ु य एक / एक है

A Object A ऑब्जेक्ट
B Function B फं क्शन
C Literal C वलटरल
D None of these D इनमें से कोई नहीं

10 F stream class is used for 10 एफ स्ट्रीम क्लास का उपयोग वकसके वलए वकया जाता है?

A Input operation A इनपटु ऑपरेशन

B Output operation B आउटपटु ऑपरेशन
C Input /Output operation C इनपटु /आउटपटु ऑपरेशन
D None of these D इनमें से कोई नहीं

11 A set of logical operator is 11 तावकिक ऑपरेटर का एक सेट है

A +-*/% A +-*/%
B ?: B ?:
C ><>=<= C ><>=<=
D None of these D None of these

12 Pointer is a 12 सूचक एक है

A variable that holds address of other variable A िह िेररएबल जो दसू रे िेररएबल का पता रखता है
B Pointer name is preceded by * B पॉइंटर नाम के पहले * आता है
C void pointer is a pointer which can hold the address of C void पॉइंटर एक पॉइंटर है जो वकसी भी डेटा टाइप का पता
any data type रख सकता है
D All of these. D ये सभी।

13 STACK follows 13 STACK इस प्रकार है

A GIGO Technique A GIGO तकनीक

B FIFO Technique B FIFO तकनीक
C LIFO Technique C LIFO तकनीक
D None of these D इनमें से कोई नहीं
14 When several classes inherit the properties of same 14 जब कई क्लास एक ही कॉमन क्लास के गर्ु ग्रहर् करते हैं तो
common class is called. उसे क्या कहते हैं?

A Single inheritance A एकल उत्तरावधकार

B Multiple inheritance B एकावधक उत्तरावधकार
C Hierarchical inheritance C पदानि ु वमत उत्तरावधकार
D None of these D इनमें से कोई नहीं

15 People standing in a line is an example of 15 पंवि में खडे लोग इसका उदाहरर् हैं

A STACK A स्ट्टैक
B QUEUE B कतार
C ARRAY C सरर्ी
D Linked list D वलंक्ड सूची

16 ……………….is a Browser 16 ……………….एक ब्राउज़र है

A C++ A सी++
B Firefox B फायरफॉक्स
C Telnet C टेलनेट
D Cookies D कुकीज़

17 A set of conditional / ternary operator(s) is / are 17 सशति / विगर्ु ऑपरेटर का एक सेट है / हैं

A +,-,*,/,% A +,-,*,/,%
B >,<,>=,<=,==.!= B >,<,>=,<=,==.!=
C &&,||,! C &&,||,!
D ?: D ?:

18 Which operator has the lowest precedence? 18 वकस ऑपरेटर की प्राथवमकता सबसे कम है?

A Sizeof A Sizeof
B Unary B यूनरी
C Assignment C असाइनमेंट
D Comma D कॉमा
19 19 C++ प्रोग्रावमंग में strlen() फं क्शन का उपयोग वकसके वलए
In C++ programming strlen() function is used for
वकया जाता है

A Count length of string A वस्ट्रंग की लंबाई वगनना

B Copy two strings B दो वस्ट्रंग की प्रवतवलवप बनाना
C Compare two strings C दो वस्ट्रंग की तल ु ना करना
D Concatenate two strings D दो वस्ट्रंग को जोडना

20 In C++ programming array index is always starts from 20 C++ प्रोग्रावमंग में ऐरे इंडेक्स हमेशा से शरू
ु होता है

A 0 A 0
B 1 B 1
C 2 C 2
D 3 D 3

21 Which loop checks the condition on 21 कौन सा लूप वस्ट्थवत की जााँच करता है

A Top A ऊपर
B Bottom B नीचे
C Middle C बीच
D none of these D इनमें से कोई नहीं

22 Which of the following is the symbol for AND operator? 22 इनमें से कौन सा AND ऑपरेटर का प्रतीक है?

A || A ||
B && B &&
C & C &
D none of these D इनमें से कोई नहीं

23 What will be the output of the following condition 23 वनम्नवलवखत शति कथन A = 15>15 का आउटपटु क्या
statement A = 15>15?15:16 होगा?15:16

A 16 A 16
B 15 B 15
C 31 C 31
D none of these D
इनमें से कोई नहीं
24 If an array is declared as intarr [5] [5], how many 24 यवद वकसी सरर्ी को int arr [5] [5] के रूप में घोवित वकया
elements can it store? जाता है, तो िह वकतने तत्िों को संग्रहीत कर सकती है?

A 0 A 0
B 5 B 5
C 10 C 10
D 25 D 25

25 In C++ programming ‘/v’ is used for 25 C++ प्रोग्रावमंग में ‘/v’ का उपयोग वकसके वलए वकया जाता है

A Form feed A फॉमि फीड

B Line brake B लाइन ब्रेक
C Vertical tab C िवटि कल टैब
D Alarm D अलामि

खंड –B
(Section-B)
1 Write the difference between Data and Information.
डेटा और सूचना के बीच अंतर वलखें।
2 What is Token? What are the names of different types of Token?
टोकन क्या है? विवभन्न प्रकार के टोकन के नाम क्या हैं?
3 Write the differences between Unary operator and Ternary operator.
यूनरी ऑपरेटर और टनि री ऑपरेटर के बीच अंतर वलखें।
4 Give the output of the following
#
void main()
{
int x;
for (x=1;x<=12;x*=2)
cout<<x<<endl;
}
वनम्नवलवखत का आउटपटु दें
#
void main()
{
int x;
for (x=1;x<=12;x*=2)
cout<<x<<endl;
}
5 What is function? Write the types of function.
फं क्शन क्या है? फं क्शन के प्रकार वलवखए।
6 Explain the concept of Encapsulation.
एनकै प्सल
ु ेशन की अिधारर्ा को समझाइये।

7 Explain the concepts of minterm and and maxterm.

वमनटमि और मैक्सटमि की अिधारर्ाओं को समझाइए।
8 Define
a. Hub b. Repeater.
पररभावित करें
a. हब b. ररपीटर.

9 What is Inheritance?
इनहेरीटेन्स क्या है?

खंड –C
(Section-C)

1 Write a program in C++ to find the sum of any five odd numbers.
वकसी भी पााँच वििम संख्याओं का योग ज्ञात करने के वलए C++ में प्रोग्राम वलखें।
2 What is Inline function? Write its advantages and disadvantages.
इनलाइन फं क्शन क्या है? इसके लाभ और हावनयााँ वलवखए।
3 Define Data types, Explain different types of datatype with examples.
डेटा प्रकारों को पररभावित करें, उदाहरर्ों के साथ विवभन्न प्रकार के डेटाटाइप की व्याख्या करें।
4 What an algorithm of Bubble sort of Binary search.
यह कै सा बबल प्रकार का बाइनरी सचि का एल्गोररथ्म है।
5 What is array in C++? Explain its types.
C++ में array क्या है? इसके प्रकार समझाइए।

6 Draw the circuit diagram and truth table of X + x̅ Y.3.

X + x̅ Y.3 का पररपथ आरेख और सत्य सारर्ी बनाइये।
7 Define single inheritance and explain with suitable example.
एकल िंशानि
ु म को पररभावित करें तथा उपयि
ु उदाहरर् सवहत समझाएाँ।
8 What is guided media? Explain.
वनदेवशत मीवडया क्या है? समझाइए।
 खंड –D
(Section-D)
1 What is an operator overloading and operator overriding? Explain it with a suitable example
ऑपरेटर ओिरलोवडंग और ऑपरेटर ओिरराइवडंग क्या है? इसे उपयि
ु उदाहरर् से समझाएाँ
2 What is an inheritance? What are the different types of inheritance supported in C++? Explain all
inheritance supported in C++.
इनहेररटेंस क्या है? C++ में समवथि त इनहेररटेंस के विवभन्न प्रकार क्या हैं? C++ में समवथि त सभी इनहेररटेंस के बारे में बताएाँ।
3 Write a program in C++ to find the sum of any five numbers using constructor member functions.
कन्स्ट्रक्टर सदस्ट्य फं क्शन का उपयोग करके वकसी भी पााँच संख्याओं का योग ज्ञात करने के वलए C++ में एक प्रोग्राम वलखें ।
4 Obtain postfix notation for the following infix notation manually.
वनम्नवलवखत इनवफक्स नोटेशन के वलए पोस्ट्टवफक्स नोटेशन मैन्यअ
ु ल रूप से प्राप्त करें।
5 What is logic gate? Explain fundamental logic gates with circuit diagram and truth table.
लॉवजक गेट क्या है? सवकिट डायग्राम और सत्य तावलका के साथ मौवलक लॉवजक गेट्स की व्याख्या करें।
6 Write short notes on the following.
a. DDL b. DBMS
c. Tautology d. Server
वनम्नवलवखत पर संविप्त वटप्पवर्यााँ वलखें।
a. DDL b. DBMS
c. टॉटोलॉजी d. सिि र
 ANSWER
1 D 11 A 21 A
2 D 12 D 22 B
3 A 13 C 23 B
4 C 14 A 24 D
5 B 15 A 25 C
6 D 16 B
7 D 17 D
8 D 18 D
9 B 19 A
10 C 20 A
 झारखण्ड शैक्षिक अनुसंधान एवं प्रक्षशिण पररषद्,
रााँची, झारखण्ड
वार्षिक परीक्षा-2024
HISTORY MODEL QUESTION
कक्षा -12 र्वषय – इर्िहास पूर्ाांक – 80 समय – 3 घंटा
CLASS-12 SUBJECT-HISTORY Full Marks-80 TIME- 3 HOUR

सामान्य क्षनदेश - :
 परीक्षार्थी यर्थासंभव अपने शब्दों में उत्तर दें।
 Candidate should answer in their own words.
 सभी प्रश्न अर्नवायि हैं।
 All Questions are compulsory.
 कुल प्रश्नों की संख्या-52 है।
 Total number of question is 52.
 प्रश्न 1 से 30 िक बहुर्वकल्पीय प्रश्न हैं। प्रत्येक प्रश्न के चार र्वकल्प र्दए गए हैं। सही र्वकल्प का चयन कीर्िये। प्रत्येक
प्रश्न के र्लए 01 अंक र्नर्ाि ररि है|
 Question No. 01 to 30 are multiple choice questions, each question has four options. Select
the correct option. Each question carries 01 mark.
 प्रश्न संख्या-31 से 38 िक अर्ि लघु उत्तरीय प्रश्न हैं। र्िसमें से र्कन्हीं 6 प्रश्नों का उत्तर देना अर्नवायि है। प्रत्येक प्रश्न
का मान 2 अंक र्नर्ाि ररि है।
 Question numbers 31 to 38 are very short answer questions. It is mandatory to answer any 6
questions. Each question carries 02 marks.
 प्रश्न संख्या 39 से 46 िक लघु उत्तरीय प्रश्न हैं। र्िसमें से र्कन्हीं 6 प्रश्नों का उत्तर देना अर्नवायि है। प्रत्येक प्रश्न का
मान 3 अंक र्नर्ाि ररि हैं।
 Question numbers 39 to 46 are short answer questions. It is mandatory to answer any 6
questions. Each question carries 03 marks.
 प्रश्न संख्या 47 से 52 दीघि उत्तरीय प्रश्न हैं। र्कन्हीं 4 प्रश्नों का उत्तर देना अर्नवायि है। प्रत्येक प्रश्न का मान 5 अंक
र्नर्ाि ररि है।
 Question numbers 47 to 52 are long answer questions. It is mandatory to answer any 4
questions. Each question carries 05 marks.

खंड –A
(Section-A)

1. भारिीय परु ाित्व का र्पिा र्कसे कहा िािा है ? Who is called the father of Indian Archaeology ?
a) अलेक्िेंडर कर्नंघम a) Alexander Cunningham
b) दयाराम साहनी b) Dayaram Sahni
c) राखाल दास बनिी c) Rakhal Das Banerjee
d) एस आर राव d) S R Rao
2. बौद्ध और िैन ग्रर्थं में र्किने महािनपद का उल्लेख है ? How many Mahajanapadas are mentioned in Buddhist and Jain texts ?
a) 10 a) 10
b) 12 b) 12
c) 14 c) 14
 d) 16 d) 16

3. अपने स्वयं के खचे से सदु शिन झील की मरम्मि र्कसने कराई ? Who got the Sudarshan lake repaired at his own expense ?
a) अशोक a) Ashoka
b) रुद्रदामन b) Rudradaman
c) कर्नष्क c) Kanishka
d) स्कंद गप्तु d) Skanda Gupta
4. मानव के सम्पूर्ि िीवन को र्किने भागों में बाटं ा गया ? The whole life of a human being is divided into how many parts?
a) 5 a) 5
b) 4 b) 4
c) 3 c) 3
d) 9 d) 9

5. गौिम बद्धु ने अपना पहला उपदेश र्कस स्र्थान पर र्दया र्था ? At which place did Gautam Buddha gave his first sermon?
a) कुशीनगर a) Kushinagar
b) सारनार्थ b) Sarnath
c) लुंर्बनी c) Lumbini
d) गया d) Gaya
6. ईब्नबिूिा ने र्कस पस्ु िक की रचना की र्थी Which book was written by Ibn Battuta?
a) र्किाब उल र्हदं a) Kitab ul hind
b) ररहला b) Rihla
c) आईने अकबरी c) Ain-e-Akbari
d) अकबरनामा d) Akbarnama
7. पद्मावि र्कसकी रचना है ? Who authored Padmavat?
a) कबीर a) Kabir
b) िलु सीदास b) Tulsidas
c) अमीर खस ु रो c) Ameer Khusro
d) मर्लक मोहम्मद िायसी d) Malik Mohammed Jaysi

8. िार्लकोटा का युद्ध कब हुआ ? When did the battle of Talikota take place?
a) 1526 ई a) 1526 AD
b) 1556 ई b) 1556 AD
c) 1565 ई c) 1565 AD
d) 1575 ई d) 1575 AD

9. र्वियनगर का र्कस राज्य के सार्थ हमेशा सघं षि चलिा रहा ? Vijayanagara always had conflicts with which Kingdom?
a) कालीकट से a) from Calicut
b) चोलो से b) From Cholas
c) पाण्ड्य से c) from Pandyas
d) बहमनी से d) from Bahamani
10. मुगलकालीन ऐर्िहार्सक स्रोिों में शार्मल र्थी ? Which one was included in The Mughal period historical sources?
a) ऐर्िहार्सक ग्रर्थं a) Historical texts
b) सरकारी िर्था गैर सरकारी दस्िावेज़ b) Government and non-government documents
c) उस कालाशं मे बनी इमारिें एव ं स्मारक c) Buildings and monuments built during that period
d) इनमें से सभी d) all of which

11. अकबर ने िीर्थि यात्रा कर को कब समाप्त र्कया र्था ? When did Akbar abolish the pilgrimage tax?
a) 1562 a) 1562
b) 1563 b) 1563
c) 1564 c) 1564
d) 1565 d) 1565
12. सर्थं ाल र्वद्रोह कब हुआ र्था ? When did the Santhal rebellion take place?
a) 1857 a) 1857
b) 1858 b) 1858
 c) 1859 c) 1859
d) 1860 d) 1860

13. 1857 के र्वद्रोह में र्बहार का नेित्ृ व र्कसने र्कया र्था ? Who led the revolt of 1857 in Bihar?
a) नाना सार्हब a) Nana sahib
b) वीर कुुँवर र्सहं b) Veer Kunwar Singh
c) रानी लक्ष्मीबाई c) rani laxmibai
d) र्दलीप र्सहं d) Dilip Singh
14. सहायक सर्ं र् की व्यवस्र्था र्कसने की ? Who introduced the Subsidiary Alliance system?
a) लॉडि क्लाइव a) lord clive
b) वारने हर्े स्टगं b) Warren Hastings
c) लॉडि हेर्स्टंग c) Lord Hastings
d) लॉडि वेलेिली d) Lord wellesley
15. सर्ं वर्ान सभा की सचं ालन सर्मर्ि के अध्यक्ष कौन र्थे ? Who was the chairman of the steering committee of the constituent
a) रािेंद्र प्रसाद assembly?
b) िवाहर लाल नेहरू a) Rajendra Prasad
c) भीम राव अबं ेडकर b) Jawaharlal Nehru
d) सरदार पटेल c) Bhim Rao Ambedkar
d) Sardar Patel
16. कलकत्ता में सवोच्च न्यायालय की स्र्थापना कब की गई र्थी ? When was the Supreme Court established in Calcutta?
a) 1771 ई a) 1771 AD
b) 1772 ई b) 1772 AD
c) 1773 ई c) 1773 AD
d) 1770 ई d) 1770 AD
17. सर्वनय अवज्ञा आदं ोलन का प्रारभं र्कसने र्कया ? Who started the Civil Disobedience Movement?
a) गार्ं ी िी a) Gandhiji
b) िवाहर लाल नेहरू b) Jawaharlal Nehru
c) अबलु कलाम आिाद c) Abul Kalam Azad
d) सभु ाष चद्रं बोस d) Subhash Chandra Bose

18. कैर्बनेट र्मशन भारि कब आया ? When did the Cabinet Mission come to India?
a) माचि 1946 a) March 1946
b) अप्रैल 1945 b) April 1945
c) िून 1942 c) June 1942
d) मई 1945 d) May 1945
19. मर्ु स्लम लीग की स्र्थापना कब और कहा ुँ की गई ? When and where was the Muslim League founded?
a) 1905 लखनऊ a) 1905 Lucknow
b) 1906 ढाका b) 1906 Dhaka
c) 1907 सूरि c) 1907 appearance
d) 1909 कलकत्ता d) 1909 Calcutta

20. भारि में र्किनी ररयासिें र्थी ? How many princely states were there in India?
a) 562 a) 562
b) 563 b) 563
c) 564 c) 564
d) 654 d) 654

21. गरुु नानक का िन्म कब हुआ ? When was Guru Nanak born ?
a) 1469 ई a) 1469 AD
b) 1478 ई b) 1478 AD
c) 1479 ई c) 1479 AD
 d) 1468 ई d) 1468 AD
22. र्कस यात्री को मध्यकालीन यार्त्रयों का सरिाि कहा िािा है ? Which traveller is called the king of medieval travellers?
a) टेवर्नयर a) Tavernier
b) इब्नबिूिा b) Ibn Battuta
c) माको पोलो c) marco polo
d) अलबरूनी d) Alberuni

23. परु ार्ों की सख्ं या र्किनी है ? How many Puranas are there?
a) 16 a) 16
b) 18 b) 18
c) 19 c) 19
d) 12 d) 12

24. महाभारि के फारसी अनुवाद का नाम क्या है ? Persian translation of Mahabharata is known as?
a) रज्म्नामा a) Razmnama
b) महाभारि b) Mahabharata
c) ग्रर्थं नामा c) Granthnama
d) इनमे से कोई नहीं d) none of these

25. हड़प्पा र्कस नदी के र्कनारे र्स्र्थि है ? Harappa is situated on the bank of which river?
a) रावी a) Ravi
b) र्सर्ं ु b) Indus
c) भोगवा c) Bhogawa
d) सरस्विी d) Saraswati

26. पीर का अर्थि है – The meaning of Peer -

a) ईश्वर a) God
b) गरुु b) Teacher
c) उलमा c) Ulama
d) मौलवी d) Maulvi

27. बारबोसा कहा ुँ के यात्री र्थे ? Barbosa was a traveller from?

a) इटली a) Italy
b) पिु गि ाल b) Portugal
c) रूस c) Russia
d) फ़्ासं d) France

28. पाचं वी ररपोटि र्िर्टश ससं द में कब पेश की गई र्थी ? When was the fifth report presented to the British Parliament?
a) 1800 a) 1800
b) 1812 b) 1812
c) 1813 c) 1813
d) 1850 d) 1850

29. हड़प नीर्ि र्कसने लागू की र्थी ? Who implemented the policy of annexation?
a) लॉडि डलहौिी a) lord dalhousie
b) लॉडि क्लाइव b) lord clive
c) लॉडि कििन c) Lord Curzon
d) वारने हर्े स्टगं d) Warren Hastings

30. कोटि सेंट िॉिि की स्र्थापना कहा ं की गई र्थी ? Where was Court St Georges established ?
a) कलकत्ता a) Calcutta
b) मद्रास b) Madras
c) बॉम्बे c) Bombay
 d) र्दल्ली d) Delhi

खंड –B
(Section-B)

अक्षि लघु उत्तरीय प्रश्न

Very Short Answer Type Questions

31. हड़प्पा सभ्यिा कहा ं कहा ं क्षवकक्षसि हईु थी ?

Where did the Harappan civilization develop?
32. शक संवि का आर ंभ क्षकसने क्षकया ?
Who started the Shaka era?
33. नाट्य शास्त्र के लेखक का नाम क्षलक्षखएI
Write the name of the author of Natyashastra
34. साचं ी के स्िपू की खोज क्षकसने की ?
Who discovered the Sanchi Stupa?
35. “ट्रवल्स इन द मग़ु ल एपं ायर” पस्ु िक की रचना क्षकसने की?
Who wrote the book “Travels in the Mughal Empire” ?
36. सवव प्रथम भक्षि आंदोलन को शुरू करने वाले कोन थे ?
Who was the first person to start the Bhakti movement ?
37. बहमनी राजाओ ं की राजधानी कहा ं थी ?
Where was the capital of the Bahamani kings ?
38. भारि के अक्षं िम वाइसरॉय कौन थे ?
Who was the last Viceroy of India ?

खंड –C
(Section-C)

लघु उत्तरीय प्रश्न

Short Answer Type Questions

39. स्थायी बंदोबस्ि से आप क्या समझिे हैं ? इसकी प्रमख ु क्षवशेषिाए ाँ क्षलखें ?
What do you understand by permanent settlement? Write its main features?
40. क्षखलाफि आंदोलन से आप क्या समझिे हैं ?
What do you understand by Khilafat Movement?
41. अक्षभलेख से आप क्या समझिे हैं ? इनका क्या महत्व है ?
What do you understand by record? What are their importance?
42. कृक्षष उत्पादन में मक्षहलाओ ं की भूक्षमका का वणव न कीक्षजएI
Describe the role of women in agricultural production.
43. संक्षवधान सभा की प्रमख ु सक्षमक्षियों का वणव न करेंI
Describe the important committees of the Constituent Assembly.
44. क्षकिाब उल क्षहंद पर एक लेख क्षलखेंI
Write an essay on Kitab ul Hind.
45. महाभारि के महत्व पर प्रकाश डाक्षलएI
Throw light on the importance of Mahabharata.
46. आम लोग क्षवभाजन की क्षकस िरह देखिे थे ?
How do the common people think about Partition ?
 खंड –D
(Section-D)

दीघव उत्तरीय प्रश्न

Long Answer Type Questions
क्षकन्हीं चार प्रश्नों का उत्तर दें:
Answer any four questions.

47. इब्नबिूिाद्वारा वक्षणवि डाक व्यवस्था का वणव न कीक्षजएI

Describe the postal system described byIbn Battuta.
48. अकबर की धाक्षमवक नीक्षि का वणव न करेंI
Describe the religious policy of Akbar.
49. मगध साम्राज्य के शक्षिशाली होने के क्या कारण थे ?
What were the reasons for the Magadha Empire becoming powerful ?
50. मोहनजोदडो की कुछ क्षवशेषिाओ ं का वणव न कीक्षजएI
Describe some features of Mohenjodaro.
51. 1857 के क्षवद्रोह की क्षवफलिा के कारणों का उल्लेख करें I
Mention the reasons for the failure of the revolt of 1857.
52. असहयोग आंदोलन के बारे में आप क्या जानिे हैंI वणव न करेंI
What do mean by non-cooperation movement? Describe it.
 ANSWER
1 A 21 A
2 D 22 C
3 B 23 B
4 B 24 A
5 B 25 A
6 B 26 B
7 D 27 B
8 C 28 C
9 D 29 A
10 D 30 B
11 B
12 C
13 B
14 D
15 A
16 C
17 A
18 A
19 B
20 A
 वार्षिक परीक्षा (2024-25)

झारखण्ड शैक्षिक अनस

ु ंधान एवं प्रशशिण पररषद्, रााँची
मॉडल प्रश्न पत्र (वस्तनु नष्ठ) सेट – 1

किा- 12 ववषय- भू गोल समय- 1.5 घंटा पण

ू ाांक- 25

सामान्य ननर्दे श:-

⮚ कुल 25 प्रश्न हैं।

⮚ सभी प्रश्नों के उत्तर अननवायय हैं।
⮚ प्रत्येक प्रश्न के शलए 1 अंक ननधायररत है ।
⮚ प्रत्येक प्रश्न के चार ववकल्प दर्दए गए हैं। सही ववकल्प का चयन कीजिये।
⮚ गलत उत्तर के शलए कोई अंक नहीं काटे िाएंगे।

वस्तु र्िष्ठ प्रश्न

1) संभववाद की अवधारणा में र्कस घटक को ज्यादा महत्वपूणि मािा गया है ?

Which component is considered more important in the concept of possibility?

a. मािवीय घटक (Human Component)

b. प्राकृर्िक घटक (Natural Ingredients)

c. मािवीय एवं प्राकृर्िक घटक दोिों (Both human and natural components)

d. इिमें से कोई िहीं (None of these)

2) मे गा िगर की जिसंख्या र्कििी होिी है ?

What is the population of Mega City?

a. 10 लाख (1 million) b. 50 लाख से अर्धक(More than 5 million)

c. 1 करोड़ (10 million) d. 1 लाख (0.1 million)

3) र्वश्व में सवाि र्धक जिसंख्या केंर्िि है ।

Largest population concentration in the world.

a) पवििीय क्षे त्ों में (In mountain area) b) मै दािों में (In plain)

c) पठार में (In plateau) d) मरुस्थल में (In desert)

4) भारिीय जिगणिा इर्िहास में र्कस वषि को ग्रेट र्िवाइि की संज्ञा दी गई है ?

In the Indian census history, which year has been termed as the Great Divide?

a) 1911 b)1981
 c) 1951 d)1921

5) मािव र्वकास की अवधारणा र्िम्नर्लखखि में से र्कस र्वद्वाि की दे ि है ?

The concept of human development is the gift of which of the following scholars?

a. प्रो. अमर्त्ि सेि (Pro. Amartya Sen) b. िॉ. महबूब उल हक (Dr. Mahbub Ul Haq)

c. ऐलि सी. सेम्पल (Alan C. Sample) d. रे टजे ल (Ratzel)

6) र्िम्न में से र्कस कृर्ष प्रकार का र्वकास यूरोपीय औपर्िवेर्िक समू ह द्वारा र्कया गया?

Which of the following types of agriculture was developed by the European colonial group?

a. कोलखहोज (Kolkhoj) b. पुष्पोत्पादि (floriculture)

c. र्मर्िि कृर्ष (mixed farming) d.रोपण कृर्ष (Planting Cultivation)

7) हॉर्टि कल्चर र्कसके उत्पादि से संबंर्धि है ?

Horticulture is related to the production of?

a. फूल से( (Production of Flowers) b. दाल से (Production of pulse)

c. अन्न से (Production of Grains) d. फल और सब्जी से

8) र्िम्न में से कौि सा रोपण कृर्ष िहीं है ?

Which of the following is not a planation agriculture?

a. कॉफी Coffee b. गन्ना sugarcane

c. गेहं wheat d. रबड़ rubber

9) र्िम्न में से कौि-सी एक अर्ि व्यवस्था में उत्पादि का स्वार्मत्व व्यखिगि होिा है ?

In which of the following economies, production is owned by individuals?

a. पूंजीवादी (capitalist) b. र्मर्िि (mixed)

c. समाजवाद (socialism) d. इिमें से कोई िहीं (None of these)

10) जापाि का िै टरायट र्कसे कहा जािा है ?

Which city is known as the Detroit of Japan?

a. टोक्यो (Tokyo) b. िगोया (Nagoya)

c. िागासाकी (Nagasaki) d. ओसाका (Osaka)

11) िई औद्योर्गक िीर्ि की घोषणा कब की गई?

When was the new industrial policy announced?

a. 1990 b. 1991

c. 1992 d. 1993
12) एक र्वकर्सि अर्ि व्यवस्था में , जिसंख्या का बड़ा अिु पाि र्कस पर र्िभि र करिा है ?

In a developed economy, larger proportion of population depends on?

a. प्रार्र्मक क्षे त् ( Primary sector ) b. र्द्विीयक क्षे त् (Secondary sector)

c. िृिीयक क्षे त् (Tertiary sector) d. चिुर्िक क्षे त् (Quaternary sector)

13) कील िहर कहॉं खस्थि है ?

Where is the Kiel Canal located?

a. र्िटे ि(Britain) b. जमि िी(Germany)

c. बेखियम (Belgium) d. रूस(Russia)

14) जल र्कस प्रकार का संसाधि है ?

What type of resource is water?

a) अिवीकरणीय b) चक्रीय संसाधि

c) जै व संसाधि d) a और b दोिों

15) आिि कृर्ष में र्कििी वार्षि क वषाि आवश्यक है ?

How much annual rainfall is required in wetland agriculture?

a) 25 सेंटीमीटर से कम (Less than 25 cm) b) 25 से 50 सेंटीमीटर (25 to 50 cm)

c) 75 सेंटीमीटर से अर्धक (More than 75 cm) d) इिमें से कोई िहीं (Non of these)

16) अंकले श्वर खर्िज िेल क्षे त् कहॉं खस्थि है ?

Where is Ankleshwar Mineral Oil Field located?

a) गुजराि (Gujarat) b) महाराष्ट्र(Maharashtra)

c) असम (Assam) d) िर्मलिािु (Tamil Nadu)

17) र्वश्व का सबसे व्यस्त समुिी मागि कौि सा है ?

Which is the busiest sea route of the world?

a. उत्तरी अटलां र्टक(North Atlantic) b. प्रिां ि महासागर((Pacific Ocean)

c. र्हन्द महासागर (Indian Ocean) d. दर्क्षण अटलां र्टक (South Atlantic)

18) WTO का मु ख्यालय कहॉं है ?

Where is the headquarters of WTO?

a. जे िेवा (Geneva) b. जकािाि (Jakarta)

c. र्वयािा (Vienna) d. मान्टे वीर्ियो (Montevideo)

19) कोखि पत्ति कहॉं अवखस्थि है ?

 Where is Kochi Port located?

a. किाि टक में (In Karnataka) b. ओर्ििा में (In Odissa)

c. केरल में (In Kerla) d. िर्मलिािु में (In Tamilnadu)

20) र्कस पंचवषीय योजिा में समाजवादी समाज की स्थापिा का प्रर्िरूप प्रस्तु ि र्कया गया?

In which five-year plan was the model of the establishment of a socialist society presented?

a) प्रर्म (first) b) र्द्विीय (second)

c) िृिीय (third) d) चिुर्ि (fourth)

21) र्िम्नर्लखखि में से कौि सा भू -उपयोग संवगि िहीं है ?

Which of the following is not a land use category?

a) परिी भू र्म (Fallow land) b) सीमां ि भू र्म (Marginal land)

c) र्िवल बोया गया क्षे त् (Net sown area) d) कृर्ष योग्य व्यर्ि भूर्म (Arable waste land)

22) जल संसाधिों का संरक्षण क्यों जरूरी है ?

Why is it important to conserve water resources?

a) जल अिु पलब्धिा से बचिे के र्लए (To avoid water unavailability)

b) र्िरं िर बढ़िी मां ग के र्लए (For ever-increasing demand)

c) स्थार्िक और ऋिुवि् असमिािा के कारण (Due to spatial and seasonal disparity)

d) इिमें से सभी (All of these)

23) हजीरा-र्वजयपुर-जगदीिपुर गैस पाइपलाइि र्कस राज्य से होकर िहीं गुजरिी है ?

The Hazira-Vijaipur-Jagdishpur gas pipeline does not pass through which state?

a. महाराष्ट्र (Maharashtra) b. गुजराि (Gujarat)

c. मध्य प्रदे ि (Madhya Pradesh) d. उत्तर प्रदे ि (Uttar Pradesh)

24) र्कस औद्योर्गक िीर्ि में उदारीकरण र्िजीकरण और वैश्वीकरण को बढ़ावा र्दया गया?

In which industrial policy liberalization, privatization and globalization were promoted?

a. 1991 b. 1952

c. 1948 d. 1989

25) ‘द र्लर्मट टू ग्रोर्’ के ले खक कौि है ?

Who is the author of the book 'The Limit to Growth'?

a. एहरर्लच (Ehrlich) b. मीिोज (Meadows)

c. महात्मा गां धी (Mahatma Gandhi) d. फ्रेिररक रे टजे ल (Friedrich Ratzel)

 वार्षिक परीक्षा (2024;25)

झारखण्ड शैक्षिक अनस

ु ंधान एवं प्रशशिण पररषद्, रााँची
मॉडल प्रश्न पत्र (वस्तनु नष्ठ) सेट – 1

Geography Answer Key Class – 12

Q.No Answer
1 a
2 b
3 b
4 d
5 b
6 d
7 d
8 c
9 a
10 b
11 b
12 c
13 b
14 b
15 c
16 a
17 a
18 a
19 c
20 b
21 b
22 d
23 a
24 a
25 b
 वार्षिक परीक्षा (2022-23)

झारखण्ड शैक्षिक अनस

ु ंधान एवं प्रशशिण पररषद्, रााँची
मॉडल प्रश्न पत्र (वस्तनु नष्ठ) सेट – 1

किा- 12 ववषय- भू गोल ( Geography ) समय - 1 घंटा 30 शमनट पण

ू ाांक- 45

सामान्य ननर्दे श (General Instruction)

 परीिार्थी यर्थासंभव अपने शब्र्दों में उत्तर र्दें ।

Examinee write answer in their own words as far as practicable.

 कुल प्रश्नों की संख्या 23 है ।

The total number of questions is 23

 प्रश्न संख्या 1 से प्रश्न संख्या 9 तक अनत लघु उत्तरीय प्रश्न है । इनमें से ककन्ही सात प्रश्नों के उत्तर अधधकतम 50
शब्र्दों में र्दीजिए। प्रत्येक प्रश्न का मान 1 अंक ननधायररत है ।
Question 1 to Question 9 are very short answer type questions, Answer any seven of these questions
in one sentence. Each question carries 1 mark.

 प्रश्न संख्या 10 से प्रश्न संख्या 17 तक लघु उत्तरीय प्रश्न हैं। इनमें से ककन्हीं 6 प्रश्नों के उत्तर अधधकतम 150 शब्र्दों में
र्दीजिए। प्रत्येक प्रश्न का मान 3 अंक ननधायररत है ।
Question 10 to Question 17 are short answer type questions. Answer any six of these questions in at
most 50 words. Each question carries 3 marks.

 प्रश्न संख्या 18 से प्रश्न संख्या 23 तक र्दीघय उत्तरीय प्रश्न हैं। इनमें से ककन्ही 4 प्रश्नों के उत्तर अधधकतम 250 शब्र्दों में
र्दीजिए। प्रत्येक प्रश्न का 5 अंक ननधायररत है ।
Question 15 to Question 19 are long answer type questions. Answer any Three of these questions in
at most 100 words. Each question carries 5 marks.
 अनत लघु उत्तरीय प्रश्न

1. मािव भू गोल को पररभार्षि करें ।

Define Human Geography.

2. मािव र्वकास के िीि बुर्ियादी आयाम कौि से हैं ?

What are the three basic dimensions of human development?

3. चलवासी पिु चारण से आप क्या समझिे हैं ?

What do you understand by nomadic pastoralism?

4. स्वार्मत्व के आधार पर उद्योगों का वगीकरण कीर्जए।

Classify industries on the basis of ownership.

5. िृिीयक र्क्रयाकलाप से आप क्या समझिे है ?

What do you understand by tertiary activity?

6. स्वेज िहर र्कि दो सागरों को जोड़िी हैं ?

Which two seas are connected by the Suez Canal?

7. जिसंख्या वृखि को पररभार्षि करें ?

Define population growth?

8. फसल िस्य गहििा से क्या िात्पयि है ?

What do you mean by crop intensity?

9. भारि के पूवी िट पर खस्थि र्कन्ीं चार पत्तिों के िाम र्लखें ।

Name any four ports on the east coast of India.

लघु उत्तरीय प्रश्न

10. प्रवास के प्रर्िकषि और अपकषि कारक में अंिर स्पष्ट् कीर्जए।

Differentiate between the repulsion and the pull factor of migration.

11. उि प्रौद्योर्गकी उद्योग का वणिि करें ।

Describe the high technology industry.

12. भारि में पाइपलाइि पररवहि के पॉंच लाभ बिाऍं।

Mention five advantages of pipeline transportation in India.

13. अंिराि ष्ट्रीय व्यापार की आवश्यकिा क्यों है ?

Why is International Trade Needed?

14. भारि के जिसंख्या र्विरण प्रर्िरूप का वणिि करें ।

Describe the population distribution pattern of India.

15. भारि की पल्ली और पररर्क्षप्त ग्रामीण बखस्तयों में अंिर स्पष्ट् कीर्जए।

Differentiate between parish and dispersed rural settlements in India.

16. भू िापीय ऊजाि र्कसे कहिे हैं ? इसका क्या महत्व है ?

What is geothermal energy? What is the significance of this?

17. भारि में सड़क िर्ा रे ल पररवहि एक-दू सरे के पूरक हैं स्पष्ट् करें |

Explain that road and rail transport in India are complementary to each other.

र्दीघय उत्तरीय प्रश्न

18. उद्योगों के स्थािीयकरण को प्रभार्वि करिे वाले कौि-कौि से कारक हैं ?

What are the factors affecting the localisation of industries?

19. आप उदारीकरण, र्िजीकरण िर्ा वैश्वीकरण से क्या समझिे हैं ? इन्ोंिे भारि के औद्योर्गक र्वकास में र्कस
प्रकार से योगदाि र्दया है ?

What do you understand by liberalisation, privatisation and globalisation? How have they
contributed to the industrial development of India?

20. भू-र्िम्नीकरण को कम करिे के उपाय सुझाइए।

Suggest measures to reduce land degradation.

21. सेवा सेक्टर मं पयिटि के महत्व को स्पष्ट् कीर्जए िर्ा पयिटि को प्रभार्वि करिे वाले कारकों की व्याख्याा
करें ।

Explain the importance of tourism in the service sector and explain the factors affecting
tourism.

22. भारि में पररवहि के प्रमुख साधि कौि-कौि से हैं ? इिके र्वकास को प्रभार्वि करिे वाले कारकों की
र्ववेचिा करें ।

What are the main modes of transport in India? Discuss the factors influencing their
development.

23. र्दए गए र्वश्व के र्चत् पर र्िम्नां र्कि जगहों को र्चखन्ि करें ।

Mark the following places on the given world diagram.

a. स्वेज िहर (Suez Canal)

b. िीलं का (Sri Lanka)

c. न्यू जीलै ण्ड (New Zealand)

d. बंगाल की खाड़ी (Bay of Bengal)

e. ग्रीिलै ण्ड (Greenland)

 झारखण्ड शैक्षिक अनुसंधान एवं प्रक्षशिण पररषद्, रााँ ची
वाक्षषिक इन्टरमीक्षडएट परीिा – 2024
मॉडल प्रश्न पत्र (MCQ)
समय- 1:30 घंटे
किा- 12 क्षवषय - अर्ि शास्त्र पणू ाां क- 30
Time – 1:30 Hours
Class-12 Sub. - Economics Full Marks- 30

सामान्य क्षनदेश :-
General Instructions: -
 कुल 30 प्रश्न हैं।
Total number of questions is 30.
 सभी प्रश्नों के उत्तर अक्षनवायि हैं।
All questions are mandatory.
 प्रत्येक प्रश्न के क्षलए एक अंक क्षनधाि ररत है।
One mark is assigned to each question.
 प्रत्येक प्रश्न के चार क्षवकल्प क्षदए गए हैं। सही क्षवकल्प का चयन कीक्षिए।
There are four options for each of the questions. Choose the correct option.
 गलत उत्तर के क्षलए कोई अंक नहीं काटे िाएं गे।
There is no negative marking for wrong answer.

1. उत्पादन संभावना का वक्र का ढाल गिरता है -

The slope of the curve of production possibility falls-
(a) बाएं से दाएं (Left to Right)
(b) दाएं से बाएं (Right to left)
(c) नीचे से ऊपर (Bottom to Top)
(d) ऊपर से नीचे (Top to bottom)
2. सीमांत उपयोगिता को ज्ञात ककया जा सकता है-
Marginal utility can be determined as
(a) ΔTU/ ΔQ (b) ΔMU/ ΔQ
(c) ΔQ/ ΔMU (d) ΔQ/ ΔTU
3. नीचे ददए रे खा गचत्र में मांि की लोच है?
What is the elasticity of demand in the line diagram given below?

झारखण्ड शैक्षिक अनुसंधान एवं प्रक्षशिण पररषद, रााँच ी [वाक्षषिक परीिा] [सत्र : 2024- 2025] Page 1 of 10
 कीमत

म िं

(a) अगिक लोचदार (More elastic) (b) इकाई लोचदार (Unit Elastic)
(c) कम लोचदार (Less elastic) (d) पर्
ू ण लोचदार (Full elastic)
4. आित को ननिणत में पररवतणन करने की प्रकक्रया को क्या कहा जाता है ?
The process of converting input into output is called:
(a) उपभोि (consumption) (b) उत्पादन (production)
(c) ननवे श (investment) (d) ववननमय (exchange)
5. ककसी पररवती सािन(L) का औसत उत्पादन ज्ञात करने का सूत्र क्या होता है?
What is the formula for determining the average output of a variable factor (L)?
(a) Q/L (b) L/Q
(c) Q+L (d) a तथा b दोनों
6. पूनतण के ननयम को ननम्नललखखत में कौन-सा फलन प्रदलशणत करता है?
Which of the following functions represents the law of supply?
(a) S=f(p) (b) S=f(1/p)
(c) S=f(Q) (d) इनमें से कोई नह ं( None of these)
7. ननम्नललखखत में ककसने कीमत ननिाणर र् प्रकक्रया में समय तत्व का ववचार प्रस्तुत ककया?
Who among the following proposed the idea of time element in the pricing process?
(a) ररकार्डो(Ricardo)
(b) वालरस(walrus)
(c) माशणल(marshall)
(d) जे .के.मे हता(J.K.Mehta)
8. एकागिकार मूल्य ववभे द की महत्वपूर्ण शतण क्या है?
What is the important condition of monopolistic price differentiation?
(a) बाजार का पृथक होना (Separation of the market)

झारखण्ड शैक्षिक अनुसंधान एवं प्रक्षशिण पररषद, रााँच ी [वाक्षषिक परीिा] [सत्र : 2024- 2025] Page 2 of 10
 (b) क्रय शक्क्त में लभन्नता (Variation in purchasing power)
(c) मांि की लोच में लभन्नता (Variation in elasticity of demand)
(d) उपयुणक्त सभी (All of the above)
9. प्रनतस्पिाण रदहत बाजार में मांि वक्र होता है-
In a non-competitive market, the demand curve is-
(a) सीमांत आिम वक्र (Marginal Revenue Curve)
(b) कु ल आिम वक्र ( Total Revenue Curve)
(c) औसत आिम वक्र (Average Revenue Curve)
(d) उपयुणक्त में से कोई नह ं (None of the above)
10. ‘द जनरल थ्योर ऑफ एंप्ल यमें ट, इंटरे स्ट एंर्ड मनी’ नामक पुस्तक के ले खक कौन हैं ?
Who is the author of the book titled 'The General Theory of Employment, Interest
and Money'?
(a) पीि ू (Pigoo) (b) माल्थस (1 time)
(c) जे . एम. कीन्स (J. M. Keynes) (d) ररकार्डो (Ricardo)
11. ककसी दे श में एक ददए हुए वर्ण में उत्पादन के सािनों के द्वारा उत्पाददत अंनतम वस्तु एवं से वाओं
के बाजार मूल्य को क्या कहा जाता है?
What is the market value of final goods and services produced by the means of
production in a given year in a country called?

(a) सकल घरे लू उत्पाद (GDP) (b) शुद्ि घरे लू उत्पाद (Net Domestic Product)

(c) राष्ट्र य आय (national income) (d) व्यक्क्तित आय (Personal Income)

12. ररजवण बैंक ऑफ इंडर्डया की स्थापना कब हुई?
When was Reserve Bank of India established?
(a) 1947 (b) 1935
(c) 1937 (d) 1945
ं के ननम्न में से कौन से तत्व हैं ?
13. एक खुल अथणव्यवस्था में सामूदहक म ि
Which of the following are the elements of collective demand in an open economy?
(a) उपभोि(consumption) (b) ननवे श(investment)
(c) सरकार व्यय एवं शुद्ि ननयाणत (Government Expenditure & Net Exports)
(d) उपरोक्त सभी (All of the above)
14. ननम्नललखखत में से वास्तववक ननवे श कौन है ?
Which of the following is a real investment?
(a) शे यर खर दना(Buying Shares)

झारखण्ड शैक्षिक अनुसंधान एवं प्रक्षशिण पररषद, रााँच ी [वाक्षषिक परीिा] [सत्र : 2024- 2025] Page 3 of 10
 (b) पुर ानी फै क्र खर दना(Buying an Old Factory)
(c) भवनों का ननमाणर् ( Construction of buildings)
(d) बैंक में जमा खाता खोलना(Opening a deposit account with a bank)
15. भारतीय संवविान के ककस अनुच्छे द का सम्बन्ि बजट से है?
Which article of the Indian Constitution is related to the Budget?
(a) अनुच्छे द – 108 (Article – 108) (b) अनुच्छे द -356 (Article – 356)
(c) अनुच्छे द – 248 (Article – 248) (d) अनुच्छे द – 112 (Article – 112)
16. द घणक ाल में एक पूर्णप्रनतयोिी फमण उत्पादन बंद कर दे िा, यदद
In the long run a firm in perfect competition will stop the production, if
(a) P>MC (b) P>AC
(c) P=AC (d) P<AC
17. प्रत्यक्ष कर के अंतिणत ननम्न में से ककसे शालमल ककया जाता है ?
Which of the following is included under Direct Tax?
(a) उपहार कर (gift tax) (b) आय कर (Income Tax)
(c) बबक्री कर (sales tax) (d) a एवं b दोनों (Both a & b)
18. अन्तराणष्ट्र य मुद्रा कोर् की स्थापना कब हुई?
When was the International Monetary Fund established?
(a)1944 (b) 1951
(c) 1975 (d) 1861
19. ननम्न में से ककस पररक्स्थनत में मुद्रा की पूनतण में कमी हो सकती है?
In which of the following situations can there be a decrease in the supply of money?
(a) बैंक दर में कमी (Bank Rate Reduction)
(b) निद आरक्षक्षत अनुपात में वद्
ृ गि (Increase in Cash Reserve Ratio)
(c) आर.बी.आई के द्वारा प्रनतभूनतयों का क्रय (Purchase of securities by RBI)
(d) इनमें से सभी (All of these)
20. भारत में ववत्तीय वर्ण की कालावगि होती है -
The period of the financial year in India is-
(a) 1 जनवर से 31 ददसम्बर(January 1 to December 31)
(b) 1 जु लाई से 30 ज ून(July 1 to June 30)
(c) 1 अप्रैल से 31 माचण( April 1 to March 31)
(d) 1 अिस्त से 31 जु लाई(August 1 to July 31)
21. पूूँज ीवाद अथणव्यवस्था के संबंि में ननम्नललखखत में से कौन सा कथन सत्य है?
Which of the following statement about capitalist economy?

झारखण्ड शैक्षिक अनुसंधान एवं प्रक्षशिण पररषद, रााँच ी [वाक्षषिक परीिा] [सत्र : 2024- 2025] Page 4 of 10
 (a) उत्पादन के सािनों पर ननजी स्वालमत्व (Private ownership on factors of production)
(b) उत्पादन का उद्दे श् य जन कल्यार् (The objectives of production is human welfare)
(c) सरकार का पर्
ू ण हस्तक्षेप (Total interference of government)
(d) श्रलमकों की से वा का क्रय-ववक्रय संभव नह ं (There is no possibility of trade of services
of labourers)
22. मान ललया जाए एक दे श में 2 लाख व्यक्क्त रोजिार में संलग्न हैं तथा 10 हजार व्यक्क्त कायण करने
को इच्छु क हैं ले ककन उन्हें काम नह ं लमल पा रहा है तो दे श में बे र ोजिार की दर क्या होिी?
Let’s assume that in a country, there are 2 lakh people are employed and 10
thousand people are willing to work but they don’t get any, then what will be the
unemployment rate in the country?
(a) 2% (b) 10%
(c) 5% (d) 20%
23. मुद्रा के स्थैनतक और ित्यात्मक कायों का ववभाजन ककसने ककया?
Who divided the static and dynamic functions of money?
(a) रै ग्नर किश (Ragner Frisch) (b) प ल एक्जंि (Paul Aging)
(c) माशणल (marshall) (d) इनमें से सभी (All of these)
24. आय के वृत्ताकार प्रवाह मार्डल में ववक्रे ता से क्रे ता की ओर वस्तुओ ं एवं से वाओं के प्रवाह को क्या कहा
जाता है?
In a circular flow model of income, the flow of goods and services from the seller
to the buyer is called?
(a) मौदद्रक प्रवाह (Monetary Flows)
(b) वास्तववक प्रवाह (Actual Flow)
(c) वावर्णक प्रवाह (Annual Flow)
(d) स्ट क (stock)
25. मुद्रा ने दरू ककया है-
Currency has eliminated?
(a) सामाक्जक बुर ाइयों को (Social evils)
(b) आगथणक बुर ाइयों को (Economic Evils)
(c) सरकार की समस्याओं को (The problems of the government.)
(d) वस्तु-ववननमय प्रर्ाल की कदिनाइयों को (The difficulties of the barter system)
26. आय के संतुलन स्तर पर-
At the equilibrium level of income-
(a) बचत और ननवे श बराबर होते है (Saving and investing are equal)

झारखण्ड शैक्षिक अनुसंधान एवं प्रक्षशिण पररषद, रााँच ी [वाक्षषिक परीिा] [सत्र : 2024- 2025] Page 5 of 10
 (b) बचत ननवे श से कम होती है (Savings are less than investments)
(c) बचत ननवे श से अगिक होती है (Savings outweigh investments)
(d) बचत का ननवे श से कोई संबंि नह ं है (Savings have nothing to do with investment)
27. ननम्नललखखत में से ववननमय का एक सवणमान्य माध्यम कौन सा है?
Which of the following is the universally accepted medium of exchange?
(a) चेक बुक (Cheque Book) (b) बंिपत्र (Bond-Paper)
(c) डर्डमांर्ड ड्राफ्ट (Demand Draft) (d) मुद्रा (Money)
28. पूर्णप्रनतयोिी बाज़ार में फ़मों की संख्या होती है-
The number of firms in perfectly competitive Market is-
(a) 2 (b) 1
(c) अल्प (Some) (d) अत्यगिक (large number)
29. ननम्न में से समग्र माूँि का एक घटक नह ं है -
Which of the following is not a component of aggregate demand?
(a) उपभोि व्यय (consumption expenditure)
(b) ननवे श व्यय (Investment Expenditure)
(c) ननवल ननयाणत (Net Export)
(d) ववत्तीय पररसंपवत्तयों पर व्यय (Expenditure on financial assets)
30. ववदे शी ववननमय दर क्या है?
What is foreign exchange rate?
(a) वस्तु की वस्तु में कीमत (Price of goods in term of goods)
(b) वस्तु की मुद्रा में कीमत (Price of goods in terms of money)
(c) मुद्रा की वस्तु में कीमत (Price of money in terms of goods)
(d) दे शी मुद्रा की ववदे शी मुद्रा में कीमत (Price of domestic currency in terms of foreign
currency)

झारखण्ड शैक्षिक अनुसंधान एवं प्रक्षशिण पररषद, रााँच ी [वाक्षषिक परीिा] [सत्र : 2024- 2025] Page 6 of 10
 Answer of MCQ

प्रश्न उत्तर प्रश्न उत्तर

1 a 16 d
2 a 17 d
3 b 18 d
4 b 19 a
5 a 20 c
6 a 21 c
7 c 22 a
8 d 23 b
9 c 24 b
10 b 25 d
11 a 26 a
12 b 27 d
13 d 28 d
14 c 29 d
15 d 30 d

झारखण्ड शैक्षिक अनुसंधान एवं प्रक्षशिण पररषद, रााँच ी [वाक्षषिक परीिा] [सत्र : 2024- 2025] Page 7 of 10
 झारखण्ड शक्षै िक अनुसंधान एवं प्रक्षशिण पररषद,् रााँची
वाक्षषिक इन्टरमीक्षडएट परीिा – 2024
मॉडल प्रश्न पत्र (क्षवषयक्षनष्ठ)

समय- 1:30 घंटे

किा- 12 क्षवषय - अर्िशास्त्र पूणाांक- 50
Time – 1:30 Hours
Class-12 Sub. - Economics Full Marks- 50

सामान्य क्षनदे श-:

 परीिार्ी यर्ासं भव अपने शब्दों में उत्तर दीक्षिए।
Candidates are required to answer in their own words as far as possible.
 कुल प्रश्नों की सं ख्या 22 है।
There are 22 questions in total.
 प्रश्न सं ख्या 1 से 8 तक अक्षत लघु-उत्तरीय प्रश्न है। इनमें से क्षकन्हीं छ: प्रश्नों के उत्तर
अक्षधकतम 50 शब्दों में दीक्षिए। प्रत्ये क प्रश्न का मान 2 अं क क्षनधाि ररत है।
Question no. 1 to 8 are very short answer type questions. Out of these, answer any six
questions in maximum 50 words each. Each question carries 2 marks.
 प्रश्न सं ख्या 9 से 16 तक लघु-उत्तरीय प्रश्न है। क्षकन्हीं छ: प्रश्नों का उत्तर अक्षधकतम 150
शब्दों में दीक्षिए। प्रत्ये क प्रश्न का मान 3 अं क क्षनधाि ररत है।
Question no. 9 to 16 are short answer type questions. Out of these, answer any six
questions in maximum 150 words each. Each question carries 3 marks.
 प्रश्न सं ख्या 17 से 22 तक दीघि -उत्तरीय प्रश्न है। इनमें से क्षकन्हीं चार प्रश्नों का उत्तर
अक्षधकतम 250 शब्दों में दीक्षिए। प्रत्ये क प्रश्न का मान 5 अं क क्षनधाि ररत है।
 Question no. 17 to 22 are long answer type questions. Out of these, answer any four
questions in maximum 250 words each. Each question carries 5 marks.

खंर्ड-(A) अनत-लघूत्तर य प्रश्न (2 अंक ीय)

Part-(A) Very short type Question (2 marks)

निम्िलिखित में से किन्हीं छ: प्रश्िों िे उत्तर दहजिए।

Answer any six from the following questions.

1 घदटया या ननम्न कोदट की वस्तु को पररभावर्त करें ।

Define a substandard or inferior article.
2 पूर्ण प्रनतयोगिता में AR वक्र X–अक्ष के समानांतर क्यों होता है?
Why is the AR curve parallel to the x-axis in perfect competition?
झारखण्ड शैक्षिक अनुसंधान एवं प्रक्षशिण पररषद, रााँच ी [वाक्षषिक परीिा] [सत्र : 2024- 2025] Page 8 of 10
 3 तीन ववलभन्न ववगियों की सच
ू ी बनाइए क्जनमें अल्पागिकार फमण व्यवहार कर सकता है।
List three different ways in which oligopoly firms can behave.
4 व्यक्ष्ट्ट और समक्ष्ट्ट अथणशास्त्र में अंतर स्पष्ट्ट करें ।
Differentiate between micro and macro-economics.
5 सीमांत लाित और औसत लाित को पररभावर्त कीक्जए।
Define the terms marginal cost and Average cost.
6 वैिाननक तरलता अनुपात क्या है?
What is the Statutory Liquidity Ratio?
7 उपभोि फलन ककन चरों के बीच संबंि को व्यक्त करता है ?
The consumption function expresses the relationship between which variables?
8 व्यापार शे र् और चालु खाता शे र् में अंतर बताएं।
What is the difference between Trade Balance and Current Account Balance?

खंर्ड-(B) लघूत्तर य प्रश्न (3 अंक ीय)

Part-(B) Short answer type questions (3 marks)

निम्िलिखित में से किन्हीं छ: प्रश्िों िे उत्तर लिखिए।

Answer any six from the following questions.

9 संतुलन को पररभावर्त करें । ककस क्स्थनत में बाजार को संतुलन अवस्था में कहा जाता है?
Define equilibrium. In which case is the market said to be in equilibrium state?
10 घटती सीमांत उपयोगिता के ननयम की व्याख्या करें ।
Explain the law of diminishing marginal utility.
11 बाजार संतुलन से आप क्या समझते हैं ? रे खागचत्र से स्पष्ट्ट कीक्जए।
What do mean by market equilibrium? Illustrate with diagram.
12 सकल घरे लू उत्पाद को पररभावर्त कीक्जए। यह सकल राष्ट्र य उत्पाद से ककस प्रकार संबंगित है?
Define Gross Domestic Product. How it is related to Gross National Product?
13 संतुलन कीमत क्या है? रे खागचत्र बनाइऐं।
What is the equilibrium price? Draw a diagram.
14 बाजार की पररभार्ा द क्जए। उन चार तत्वों को ललखें क्जनके आिार पर ववलभन्न बाजारों को पररभावर्त
ककया जाता है।

झारखण्ड शैक्षिक अनुसंधान एवं प्रक्षशिण पररषद, रााँच ी [वाक्षषिक परीिा] [सत्र : 2024- 2025] Page 9 of 10
 Define the market. Write down the four elements on the basis of which different
markets are defined.
15 पंज
ू ीवाद अथणव्यवस्था की महत्वपर्
ू ण ववशे र्ताएं क्या है?
What are the important features of a capitalist economy?
16 गचत्र के द्वारा वास्तववक प्रवाह तथा मौदद्रक प्रवाह में अंतर बताएं।
Show the difference between actual inflow and monetary flow with the help of
diagram.

खंर्ड-(C) द घणउत्तर य प्रश्न (5 अंक ीय)

Part-(C) Long answer type questions. (5 Marks)

निम्िलिखित में से किन्हीं चार प्रश्िों िे उत्तर दहजिए।

Answer any four from the following questions.

17 अगिमान वक्र से आप क्या समझते हैं ? अगिमान वक्र की ववशे र्ताओं को स्पष्ट्ट करें ।
What do you understand by preference curve? Explain the characteristics of the
preference curve.
18 एक फमण की कु ल क्स्थर लाित, कु ल पररवती लाित तथा कु ल लाित क्या है, वे ककस प्रकार संबंगित
हैं ?
What are total fixed cost, total variable cost and total cost of a firm, how are they
related?
19 बाजार कीमत एवं सामान्य कीमत में अंतर कीक्जए।
Differentiate between the market price and the normal price.
20 GDP से राष्ट्र य आय की िर्ना आप कैसे करें िे? व्याख्या कीक्जए।
How will you calculate national income from GDP? Explain.
21 जब स्वायत्य ननवे श और उपभोि व्यय (A) 50 करोड़ हो और सीमांत बचत प्रववृ त्त (MPC) 0.2
तथा आय का स्तर रू. 4000 हो तो प्रत्यालशत समग्र मांि ज्ञात करें ? यह भी बताएं कक
अथणव्यवस्था संतुलन में है या नह ं?
22 मुद्रा क्या है? मुद्रा के कायों का वर्णन करें ?
What is Mudra? Describe the functions of money?

झारखण्ड शैक्षिक अनुसंधान एवं प्रक्षशिण पररषद, रााँच ी [वाक्षषिक परीिा] [सत्र : 2024- 2025] Page 10 of 10
 झारखण्ड शैक्षणिक अनुसंधान एवं प्रणशक्षि पररषद, रााँची , झारखण्ड
वाणषि क परीक्षा (Annual Examination)
2024-2025
मॉडल प्रश्न पत्र
कक्षा – XII णवषय – संस् कृत ऐणक्षक समय – 3 घण्टा पि
ू ाांक – 80
Class-XII Subject- Sanskrit Elective Time- 3 Hour Marks - 80

सामान्य-निर्देशााः-

● अनममि् प्रश्नपत्रे 30 वमतुनिष्ठप्रश्नााः सनन्त ।

● सवे प्रश्नााः समािाांकााः ।
● सवे प्रश्नााः अनिवायाय ाः ।
● प्रर्दततेष ु नवकल्पेष ु समुनितम् उत्तरां नििुत ।
● अपनितावबोधिम्

अधोनिनित गद्ाांश ां पनित्वा प्रर्दत्तप्रश्नािाम् उत्तरां नवकल्पेष ु नििुत-

अनुच्छे दः

गीतायाः द्वादशे अध्याये भगवान् कृष्िः वदणत - "यः णननदां स्तुणतं च समानतया स्वीकरोणत,
सः भक्तः मम णप्रयः।" 'तुल्यणननदास्तुणतः' इणत शब्दः सामानय इव प्रतीयते परनतु तदनुगुिम्
आचरिं महत् कष्टसाधकम्। णननदावचनानां श्रविेन मानणसकः उद्वेगः जायते ।
स्तुणतशब्दानां श्रविेन मनसः उल्लासः भवणत। णननदकाः, दोषदशि णयतारः च भगवता एव
प्रे ष्यनते । यः णननदकस्य कथनं शाणनतपवू ि कं शि
ृ ोणत णवरोधं न करोणत अणपतु आत्मणनरीक्षिं
करोणत, सः वधि ते। यदा स्तुणतः श्रय
ू ते तदा 'अत्र मम णकमणप वैणशष्ट्यं नाणस्त' इणत णचनतनीयम्।
एतत् सवां मम गुरुजनानां प्रसादः इणत यः स्वीकरोणत सः णवनयी भवणत। अतः
तुल्यणननदास्तुणतत्वम् अभ्यासे नवै णसध्यणत। यः एवम् आचरणत, सः जीवने णनरनतरम्
उननणतन प्राप्नोणत।

प्रश्नाः

1.णननदकाः केन एव प्रे ष्यनते ?

क.पशुना

ख.भगवता

ग.णमत्रे ि

घ. मुणनना

2. गीतायाः कणस्मन् अध्याये णप्रयभक्तस्य लक्षिं भगवता प्रोक्तम् ?

क.द्वादशे

ख. प्रथमे

ग. णद्वतीये

घ. सप्तमे

3. 'जायते ' इणत णियापदस्य कति पृ दं णकम् ?

क.णवनयी

ख.णननदकाः
ग.मम

घ.उद्वेगः

4.’कृपा' इणत अथि णकं पदमत्र प्रयुक्तम् ?

क.णननदा

ख.प्रसादः

ग.भक्तः

घ. णनरनतरम्

5. 'उद्वेगस्य' णकं णवलोमपदमत्र प्रयुक्तम् ?

क.उल्लासः

ख.वैणशष्ट्यम्

ग.णवरोधम्

घ.स्तुणतः

निर्देश: - अधोनिनितां गद्ाांश ां पनित्वा प्रर्दत्तप्रश्नािाम् उत्तरां नवकल्पेष ु नििुत-

गद्ाांशाः

"तममै राज्ञे व्ययार्थं रत्िितुष्टयां र्दामयानम। एतेषाां माहात््यम् एकां रत्िां यद्वमतु ममयय ते
तद्दर्दानत। * नद्वतीयरत्िेि भोजिानर्दकम् अमृततुल्यम् उत्पद्ते। तृतीयरत्िात्
ितरु ङ्गबिां भवनत। ितर्थ
ु ाय र्द् रत्िानर्दनर्दव्याभरणानि जायन्ते। तर्देतानि रत्िानि गहृ ीत्वा
राज्ञो हमते प्रयच्छे नत।"

प्रश्ना:

6. प्रथमे न रत्नेन णकं स्मयि ते ?

क.भोजनाणदकम्

ख.चतुरङ्गबलं

ग.रत्नाणदणदव्याभरिाणन

घ.यद्वस्तु

7. अमत
ृ तुल्यं णकमुत्पद्यते ?

क.रत्नाणद

ख.चतुरङ्गबलं

ग.भोजनाणदकम्

घ. जीवनम्

8.(अहम्) राज्ञे णकं दास्याणम ?

क.भोजनाणदकम्

ख.चतुरङ्गबलं
ग.रत्नचतुष्टयम्

घ.रत्नाणदणदव्याभरिाणन

9.'ददाणत' अस्य कति पृ दं णकम् ?

क.चतुरङ्गबलं

ख.रत्नम्

ग.भोजनाणदकम्

घ.राजा

10. 'आदाय' अस्य कः पयाि यः अत्र प्रयुक्तः ?

क.गहृ ीत्वा

ख.स्मयि ते

ग.दास्याणम

घ.उत्पद्यते

निर्देश: - अधोनिनितां िाट्याांश ां पनित्वा प्रर्दत्तप्रश्नािाम् उत्तरां नवकल्पेष ु नििुत-

कौसल्या - जात! अनमत ते माता ? ममरनस वा तातम् ?

िवाः - िनह।

कौसल्या - तताः कमय त्वम् ?

िवाः - भगवताः सुगहृ ीतिामधेयमय वाल्मीकेाः।

कौसल्या - अनय जात! कर्थनयतव्यां कर्थय।

िवाः - एतावर्देव जािानम। (प्रनवश्य स्रान्तााः)

बटवाः - कुमार ! कुमार ! अश्वोऽश्व इनत कोऽनप भूतनवशेषो जिपर्देष्विुश्रूयते,

सोऽयमधुिाऽममानभाः मवयां प्रत्यक्षीकृताः।"

11.'वाल्मीकेः' अस्य णकं णवशे षिम् ?

क.सुगहृ ीतनामधे यस्य

ख.कुमार

ग.जात

घ.कुमारी

12. अस्माणभः कः भत
ू णवशे षः प्रत्यक्षीकृतः ?

क. अज:
ख. गज:

ग.अश्वः

घ.व्याघ्र:

13. 'अस्माणभः' इणत सवि नामपदं केभ्यः प्रयुक्तम् ?

क. अश्वे भ्य:

ख.पशूभ्य:

ग. वक्ष
ृ ेभ्य:

घ.बटुभ्यः

14. 'इदानीम्' अस्य कः पयाि यः अत्र प्रयुक्तः ?

क.अधुना

ख.भगवतः

ग.कोऽणप

घ.भत
ू णवशे षो

15.'परोक्षीकृतः' अस्य णवलोमपदं णकम् ?

क.प्रणवश्य

ख.प्रत्यक्षीकृत:
ग.एतावदे व

घ.कथणयतव्यं

(व्याकरण -कायय म)्

16. 'वक्तव्यम्' अस्य प्रत्ययं णवयोज्य णलखत ।

(क) वक्तव्यत्

(ख) वद्+ तव्यत्

(ग) व +तव्यत्

(घ) वच+् तव्यत्

17. 'दशि नीयम्' पदे कः प्रत्ययः ?

(क) िीयम्

(ख) करिी

(ग) अनीयर्

(घ) णिणन

18. 'नायकः' इत्यस्य सणनधणवच्छे दं णचनुत ।

(क) ना+यक:

(ख) नाय+क
(ग) ने+ अक:

(घ) नै+ अक:

19. 'अनुणवष्ि'ु अस्य सामाणसकणवग्रहं णचनुत ।

(क) णवष्िोः सह

(ख) णवष्िोः णवना

(ग) णवष्िो पवू ि म्

(घ) णवष्िो: पश्चात्

20. नीलं कमलं अस्य समस्तपदं णलखत ।

(क) नीलकमलम्

(ख) नीलाकमला

(ग) नीलकमलाणन

(घ) नीले कमले

रे िाांनकतां पर्दमाधृत्य प्रश्ननिमाय णां कुरुत -

21. सहसा नवर्दधीत ि नियाम्।

क. केि
ि. काम्

ग. कम्

घ. कनममि्

22. बनु ियुक्तो जहातीह सुकुत-र्दुष्कृते ।

क. केि

ि. काम्

ग. कम्

घ. कनममि्

23. धिेि सवय मनप िभ्यते ।

क. कम्

ि. केि

ग. कममै

घ. कममात्

24. तमयााः र्दाशयनिकैाः सप्तधा नवभागाः कृताः ।

क. केि

ि. कनममि्
ग. कै:

घ. कयोाः

25. पत्रमय अधाय नधकां भागां अश्रुधारा आर्द्ाय करोनत मम।

क. कमप

ि. कीदृशाः

ग. केि

घ. कुत्र

निर्देशाः - निर्देशािुसारम् उत्तरां नििुत -

26. 'बािकौतुकम'् इनत पािाः कमय रििा ?

क. कानिर्दासमय ।

ि. भतय हृ रे ाः

ग. बाणभट्टमय

घ. सुश्रुतमय

27. अन्तारानष्िययोगनर्दवसाः कर्दा समायोज्यते?

क. 19 जूि
ि. 20 जिू
ग. 21 जूि
घ. 22 जूि
28. रघुवांशात् काः पािाः सांकनिताः?
क. रघुकौत्ससांवार्दाः
ि. बािकौतुकम्
ग. सनू क्त-सध ु ा
घ. र्दीिबांधुश्रीिायाराः
29. 'बािकौतुकम'् इनत पािाः कमय रििा ?
क. कानिर्दासमय ।
ि. भतय हृ रे ाः
ग. बाणभट्टमय
घ. सुश्रुतमय
30. 'पाषाणी कन्या' इनत कमय रििा ?
क. िन्र्द्शेिरर्दासवमय णाः
ग. कानिर्दासमय ।
ि. अन्बकार्दत्तव्यासमय
घ. बाणभट्टमय
 उत्तराणि
(Class 12- Sanskrit)

1.ख.भगवता 16.(घ) वच्+ तव्यत्

2.क.द्वादशे 17.(ग) अनीयर्
3.घ.उद्वेगः 18.(घ) नै+ अक:
4.ख.प्रसादः 19.(घ) णवष्िो: पश्चात्
5.क.उल्लासः 20.(क) नीलकमलम्
6.घ.यद्वस्तु 21.ख. काम्
7.ग.भोजनाणदकम् 22.घ. कणस्मन्
8.ग.रत्नचतुष्टयम् 23.ख. केन
9.ख.रत्नम् 24.ग. कै:
10.क.गहृ ीत्वा 25.क. कस्प
11.क.सुगहृ ीतनामधे यस्य 26.ख. भति हृ रे ः
12.ग.अश्वः 27.ग. 21 जून
13.घ.बटुभ्यः 28.क. रघुकौत्ससं वादः
14.क.अधुना 29.ख. भति हृ रे ः
15.ख.प्रत्यक्षीकृत: 30.क. चनरशे खरदासवमि िः
 CLASS -12
SUB- SANSKRIT (ELECTIVE)
SUBJECTIVE TYPE
सामान्यनिर्देशााः-
1 सवेषाां प्रश्नािाम् उत्तरानण सांमकृते एव कतय व्यानि ।
2. प्रश्नािाां सांख्या: 21 सनन्त ।
3. प्रश्नसांख्या 1 ताः 8 पयय न्तम् अनतिघूत्तरीयााः प्रश्नााः सनन्त । अमय कृते 2-2 अांकौ
निधाय ररतौ मताः । केिि षड् प्रश्नाि् उत्तरत ।
4.प्रश्नसांख्या 9 ताः 16पयय न्तम् िघत्त ु रीयााः प्रश्नााः सनन्त । अमय कृते 3- 3 अांका:
निधाय ररतााः । केिि षड् प्रश्नााः समाधेयााः ।
5. प्रश्नसांख्या 17 ताः 22 पयय न्तम् र्दीघोत्तरीयााः प्रश्नााः सनन्त । अमय कृते 5-5 अांकााः
निधाय ररतााः । केिि ितरु ाः प्रश्नाि् उत्तरत ।

िण्ड -क

निर्देश: अधोनिनितम् अिच्ु छे र्द ां पनित्वा प्रर्दत्ताि् प्रश्नाि् निर्देशािस ु ारम् उत्तरत-
नशष्याः गरु ु म् अपच्ृ छत-् “महोर्दय सुिसुनवधयोाः को भेर्दाः ?” गरु ु ाः अवर्दत् “अहम् एकर्दा
एकमय धनििो गहृ े अनतनर्थाः अभवम्। तमय आनतथ्यगहृ ां दृष्ट्वा मिनस अनतव्यनर्थताः
आसम्। तत्र सवय ताः बहुमूल्यानि उपकरणानि आसि,् रमणेऽनप अवधाितायााः
आवश्यकता अभवत,् कर्दानित् नकमनप उपकरणां त्रुनटतां ि मयात्। आसीत् तत्र सवाय
सुिसामग्री परम् आिन्र्दमय ि अवतय त कोऽनप उपभोक्ता। आनतथ्यमर्थािां िासीर्द्
उपवेष्टुां योग्यम्।“ एवमुक्तत्वा गरुु ाः नशष्यां समबोधयत-् “ उपकरणैाः प्राप्यते िैव सुिम्।
तत् तु मिसाः आिन्र्देि एव जायते।“

प्रश्ना:-
. पण ू य वाक्तयेि उत्तरत-
1. नशष्याः कयोाः भेर्दम् अपच्ृ छत् ? 2
2. गरु
ु ाः कमय गहृ े अनतनर्थाः अभवत् ? 2
3. सुिसामग्रयााः आिन्र्दमय काः ि आसीत् ? 2

4. निर्देशािुसारां उत्तरां निित - 1/2*4=2

(i) ‘अभवम’् इनत नियापर्दमय नकां कतय प ृ र्दम् ?

(ii) ‘अिवधािता’ अमय नविोमपर्दां नकम् ?
(iii) ‘दृष्ट्वा’ पर्दे क: प्रत्यय: प्रयुक्त:?
(iv) ‘ बहम ु ल्ू यानि उपकरणानि ‘ अत्र नवशेषणपर्दां नकम् ?

(पनितावबोधिम् )

अधोनिनितां गद्ाांश ां , पद्ां, ि पनित्वा प्रर्दत्तप्रश्नाि् सांमकृतेि उत्तरत-

गद्ाांश:

(ि) गद्ाांशाः

"तममै राज्ञे व्ययार्थं रत्िितुष्टयां र्दामयानम। एतेषाां माहात््यम् एकां रत्िां यद्वमतु ममयय ते
तद्दर्दानत। नद्वतीयरत्िेि भोजिानर्दकम् अमृततुल्यम् उत्पद्ते। तृतीयरत्िात् ितुरङ्गबिां
भवनत। ितुर्थाय र्द् रत्िानर्दनर्दव्याभरणानि जायन्ते। तर्देतानि रत्िानि गहृ ीत्वा राज्ञो हमते
प्रयच्छे नत।"
प्रश्नााः
पण ू य वाक्तयेिोत्तरत-
5. प्रर्थमेि रत्िेि नकां ममयय ते ? 2

6. यर्थानिर्देशमुत्तरत- ½*4=2

(ⅰ) 'र्दर्दानत' अमय कतय प

ृ र्दां नकम् ?
(ii) 'आर्दाय' अमय काः पयाय याः अत्र प्रयुक्ताः ?

(iii)'एतेषाां माहात््यम्' अत्र 'एतेषाम्' इनतपर्दां केभ्याः प्रयुक्तम् ?

(iv) 'नवषम्' अमय नकां नविोमपर्दम् अत्र प्रयुक्तम् ?

पद्म्
"पश्चात्पच्ु छां वहनत नवपिु ां तच्ि धूिोत्यजस्रम,्
र्दीघय ग्रीवाः स भवनत, िरु ामतमय ित्वार एव।
शष्पाण्यनत्त प्रनकरनत शकृनत्पण्डकािाम्रमात्राि्,
नकां व्याख्यािैव्रजनत स पि ु र्दयरू मेयेनह यामाः।"

प्रश्नााः

पण
ू य वाक्तयेिोत्तरत-

7. र्दीघय ग्रीवाः काः भवनत ?

8.यर्थानिर्देशमुत्तरत- 1/2*4=2
(i) 'सततम'् अमय काः पयाय याः?
(ii) 'अग्रे' अमय नविोमपर्दां नकम्?
(iii)’ ित्वार: िरु ा:’ अत्र नवशेष्यपर्दां नकम?्
(iv) ‘र्दीघय ग्रीवाः स भवनत’ अत्र ‘स:’ कममै प्रयुक्तम् ?

िण्ड - ि

9. अधोनिनितमय श्लोकमय अन्वये ररक्तमर्थािपनू तय कुरुत : 3

(अ) ईशावामयनमर्दां सवय यनत्कांि जगत्याां जगत।् तेि त्यक्तेि भञ्ु जीर्था मा गध ृ ाः
कमयनमवर्द् धिम् ।।
अन्वयाः
जगत्याां यत् नकम् ि (i) —-------इर्दम् सवय म् (ii)------- तेि त्यक्तेि भुञ्जीर्थााः, कमयनमवत्
धिां मा (iii)-------।

10. वाक्तयां शि
ु ां कुरुत- 3

क. त्वां पत्रां नििानम ।

ि. मया गहृ ां गच्छनत।

ग. पाांडवा: पञ्ि आसीत् ।

11. उनितरुपैाः ररक्तमर्थािां परू यत- 3

क. —----पत्रां नििनन्त। (छात्र)

ि. —----कानिर्दास: श्रेष्ठ: (कनव)

ग. छात्रााः —-----गच्छनन्त। (नवद्ािय)

12. प्रत्ययां सांयोज्य निित- 3

क. िम् + क्तत्वा=---

ि. दृश ् + तव्यत=् --

ग. कुमार+ ङीप=् —–
13. अधाः सममतपर्दािाां नवग्रहााः र्दत्तााः, तािानश्रत्य सममतपर्दानि रियत - 3

(क) धिाय आर्देश:-

(ि) गण
ु ािाां िुबधााः-

(ग) कमय सु िैपण्ु यम:् -

14. शबर्दार्थं निित--- 3

क. किनवङ्का:-----

ि. शौिम-् ----

ग. जुगप्ु सा -------
15. रे िाङ्ङ्नकतपर्दमय नवभनक्तां तत् कारणञ्ि निित - 3

क. साः कणेि बनधर: ।

ि. नपता पत्र
ु ाय कुप्यनत।
ग. नवद्ाियम् उभयत: वृक्षा: सनन्त।
16. सांनधनवच्छे र्द ां कुरुत- 3

(क) कोऽनप- काः +........

(ि) िानभरुनिव्यय सिां =ि + ……+ व्यसिम्

(ग) िन्र्द्ोज्ज्विााः = ….+.....

िण्ड -'ग'

17. श्लोकमेििां कुरुत 5

'अ' 'आ’
कमय ण्येवानधकारमते यनत्कञ्ि जगत्याां जगत् ।
र्दर्दानत प्रनतगह्ण
ृ ानत मा फिेष ु कर्दािि ।
ईशावामयनमर्दां सवं गह्यु माख्यानत पच्ृ छनत ।
अनमत यद्नप सवय त्र त्वां कमय ज्यायो ह्यकमय ण:।
नियतां कुरु कमय िीरां िीरजरानजतम्।

18. नवद्ाियशल्ु कक्षमापिार्थं मवप्रािायं प्रनत एकां पत्रां निित। 5

19. िाट्यसानहत्यमय वैनशष्ट्यां प्रनतपार्दयत। ि्पक

ू ाव्यमय उर्दाहरणम् अनप निित।5

20.अधोनिनितरििािाां िेिकािाां िामानि निित। (केविां पञ्िािाम)् 1 * 5 = 5

क. रामायणम-्
ि. पाषाणी कन्या-
ग. महाभारतम-्
घ. रघुवांशम्-
ङ. उत्तररामिररतम्-
ि. कार्द्बरी-

21.मांजूषासहायतया नित्रां दृष्ट्वा पञ्ि वाक्तयानि रियत। 5

सायांकािे, वृक्षा:, हररता:, गहृ ानण, तृणानि, सूयय:, आकाश:, वणय ाः
22. अघोनिनितभावार्थय मय ररक्तमर्थािपनू तय मञ्जूषापर्दसहायतया कृत्वा निित। 5
(अ) "असय ू ाय िाम ते िोका अन्धेि तमसावतृ ााः।
ताांमते प्रेत्यानभगच्छनन्त ये के िात्महिो जिााः।।"

भावार्थय ाः

सांसारे मवेच्छया मृत्योाः —--(i)------महत्पापां भवनत। ये जिााः—---(ii)-----भवनन्त ते

मृत्योाः—----(iii)------

याि् िोकाि् प्राप्िुवनन्त तत्र—---- (iv) —----अन्धकाराः भवनत तत्र कीदृशम् अनप —----
- (v) —----ि भवनत अताः आत्मवधो िैव कायय ाः।
मञ्जूषा-

वरणम,् अिन्तरम,् सि
ु म,् एतादृशााः महाि्