Data Mining: Data

Lecture Notes for Chapter 2

Introduction to Data Mining , 2nd Edition

by
Tan, Steinbach, Kumar

01/27/2021 Introduction to Data Mining, 2nd Edition 1

Tan, Steinbach, Karpatne, Kumar
Outline

Attributes and Objects

Types of Data

Data Quality

Similarity and Distance

Data Preprocessing

01/27/2021 Introduction to Data Mining, 2nd Edition 2

Tan, Steinbach, Karpatne, Kumar
What is Data?

Collection of data objects Attributes

and their attributes
An attribute is a property Tid Refund Marital Taxable
or characteristic of an Status Income Cheat

object 1 Yes Single 125K No

– Example: eye color of a 2 No Married 100K No
person.
3 No Single 70K No

Objects
– Attribute is also known as
4 Yes Married 120K No
variable, field, characteristic,
dimension, or feature 5 No Divorced 95K Yes

A collection of attributes 6 No Married 60K No

describe an object 7 Yes Divorced 220K No
– Object is also known as 8 No Single 85K Yes
record, point, case, sample, 9 No Married 75K No
entity, or instance
10 No Single 90K Yes
10
Attribute Values

Attribute values are numbers or symbols

assigned to an attribute for a particular object

Distinction between attributes and attribute values

– Same attribute can be mapped to different attribute
values
◆ Example: height can be measured in feet or meters
– Different attributes can be mapped to the same set of
values
◆ Example: Attribute values for ID and age are integers
– But properties of attribute can be different than the
properties of the values used to represent the
attribute
01/27/2021 Introduction to Data Mining, 2nd Edition 4
Tan, Steinbach, Karpatne, Kumar
Types of Attributes

There are different types of attributes

– Nominal
◆ Examples: ID numbers, eye color, zip codes
– Ordinal
◆ Examples: rankings (e.g., taste of potato chips on a
scale from 1-10), grades, height {tall, medium, short}
– Interval
◆ Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio
◆ Examples: temperature in kelvin, length, counts,
elapsed time (e.g., time to run a race)
01/27/2021 Introduction to Data Mining, 2nd Edition 5
Tan, Steinbach, Karpatne, Kumar
Properties of Attribute Values

The type of an attribute depends on which of the

following properties/operations it possesses:
– Distinctness: = 
– Order: < >
– Differences are + -
meaningful :
– Ratios are * /
meaningful
❑ Nominal attribute: distinctness
❑ Ordinal attribute: distinctness & order
❑ Interval attribute: distinctness, order & meaningful
differences
❑ Ratio attribute: all 4 properties/operations

01/27/2021 Introduction to Data Mining, 2nd Edition 6

Tan, Steinbach, Karpatne, Kumar
Discrete and Continuous Attributes

Discrete Attribute
– Has only a finite or countably infinite set of values
– Examples: zip codes, counts, or the set of words in a
collection of documents
– Often represented as integer variables.
– Note: binary attributes are a special case of discrete
attributes
Continuous Attribute
– Has real numbers as attribute values
– Examples: temperature, height, or weight.
– Practically, real values can only be measured and
represented using a finite number of digits.
– Continuous attributes are typically represented as floating-
point variables.
01/27/2021 Introduction to Data Mining, 2nd Edition 7
Tan, Steinbach, Karpatne, Kumar
Key Messages for Attribute Types

The types of operations you choose should be

“meaningful” for the type of data you have
– Distinctness, order, meaningful intervals, and meaningful
ratios are only four (among many possible) properties of
data

– The data type you see – often numbers or strings – may not
capture all the properties or may suggest properties that are
not present

– Analysis may depend on these other properties of the data

◆ Many statistical analysis depend only on the distribution

– In the end, what is meaningful can be specific to domain

01/27/2021 Introduction to Data Mining, 2nd Edition 8

Tan, Steinbach, Karpatne, Kumar
Types of data sets
Record
– Data Matrix
– Document Data
– Transaction Data
Graph
– World Wide Web
– Molecular Structures
Ordered
– Spatial Data
– Temporal Data
– Sequential Data
– Genetic Sequence Data

01/27/2021 Introduction to Data Mining, 2nd Edition 9

Tan, Steinbach, Karpatne, Kumar
Record Data

Data that consists of a collection of records, each

of which consists of a fixed set of attributes
Tid Refund Marital Taxable
Status Income Cheat

1 Yes Single 125K No

2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10

01/27/2021 Introduction to Data Mining, 2nd Edition 10

Tan, Steinbach, Karpatne, Kumar
Data Matrix

If data objects have the same fixed set of numeric

attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute

Such a data set can be represented by an m by n matrix,

where there are m rows, one for each object, and n
columns, one for each attribute
Projection Projection Distance Load Thickness
of x Load of y load

10.23 5.27 15.22 2.7 1.2

12.65 6.25 16.22 2.2 1.1

01/27/2021 Introduction to Data Mining, 2nd Edition 11

Tan, Steinbach, Karpatne, Kumar
Document Data

Each document becomes a ‘term’ vector

– Each term is a component (attribute) of the vector
– The value of each component is the number of times
the corresponding term occurs in the document.

timeout

season
coach

game
score
play
team

win
ball

lost
Document 1 3 0 5 0 2 6 0 2 0 2

Document 2 0 7 0 2 1 0 0 3 0 0

Document 3 0 1 0 0 1 2 2 0 3 0

01/27/2021 Introduction to Data Mining, 2nd Edition 12

Tan, Steinbach, Karpatne, Kumar
Transaction Data

A special type of data, where

– Each transaction involves a set of items.
– For example, consider a grocery store. The set of products
purchased by a customer during one shopping trip constitute a
transaction, while the individual products that were purchased
are the items.
– Can represent transaction data as record data

TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
01/27/2021 Introduction to Data Mining, 2nd Edition 13
Tan, Steinbach, Karpatne, Kumar
 Graph Data

Examples: Generic graph, a molecule, and webpages

2
5 1
2
5

Benzene Molecule: C6H6

01/27/2021 Introduction to Data Mining, 2nd Edition 14
Tan, Steinbach, Karpatne, Kumar
Ordered Data

Sequences of transactions
Items/Events

An element of
the sequence
01/27/2021 Introduction to Data Mining, 2nd Edition 15
Tan, Steinbach, Karpatne, Kumar
Ordered Data

Genomic sequence data

GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG

01/27/2021 Introduction to Data Mining, 2nd Edition 16

Tan, Steinbach, Karpatne, Kumar
Ordered Data

Spatio-Temporal Data

Average Monthly
Temperature of
land and ocean

01/27/2021 Introduction to Data Mining, 2nd Edition 17

Tan, Steinbach, Karpatne, Kumar
Data Quality

Poor data quality negatively affects many data processing

efforts

Data mining example: a classification model for detecting

people who are loan risks is built using poor data
– Some credit-worthy candidates are denied loans
– More loans are given to individuals that default

01/27/2021 Introduction to Data Mining, 2nd Edition 18

Tan, Steinbach, Karpatne, Kumar
Data Quality …

What kinds of data quality problems?

How can we detect problems with the data?
What can we do about these problems?

Examples of data quality problems:

– Noise and outliers
– Wrong data
– Fake data
– Missing values
– Duplicate data
01/27/2021 Introduction to Data Mining, 2nd Edition 19
Tan, Steinbach, Karpatne, Kumar
Noise

For objects, noise is an extraneous object

For attributes, noise refers to modification of original values
– Examples: distortion of a person’s voice when talking on a poor phone
and “snow” on television screen
– The figures below show two sine waves of the same magnitude and
different frequencies, the waves combined, and the two sine waves with
random noise
◆ The magnitude and shape of the original signal is distorted

01/27/2021 Introduction to Data Mining, 2nd Edition 20

Tan, Steinbach, Karpatne, Kumar
Outliers

Outliers are data objects with characteristics that

are considerably different than most of the other
data objects in the data set
– Case 1: Outliers are
noise that interferes
with data analysis

– Case 2: Outliers are

the goal of our analysis
◆ Credit card fraud
◆ Intrusion detection

01/27/2021 Introduction to Data Mining, 2nd Edition 21

Tan, Steinbach, Karpatne, Kumar
Missing Values

Reasons for missing values

– Information is not collected
(e.g., people decline to give their age and weight)
– Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)

Handling missing values

– Eliminate data objects or variables
– Estimate missing values
◆ Example: time series of temperature
– Ignore the missing value during analysis

01/27/2021 Introduction to Data Mining, 2nd Edition 22

Tan, Steinbach, Karpatne, Kumar
Duplicate Data

Data set may include data objects that are

duplicates, or almost duplicates of one another
– Major issue when merging data from heterogeneous
sources

Examples:
– Same person with multiple email addresses

Data cleaning
– Process of dealing with duplicate data issues

01/27/2021 Introduction to Data Mining, 2nd Edition 23

Tan, Steinbach, Karpatne, Kumar
Similarity and Dissimilarity Measures

Similarity measure
– Numerical measure of how alike two data objects are.
– Is higher when objects are more alike.
– Often falls in the range [0,1]
Dissimilarity measure
– Numerical measure of how different two data objects
are
– Lower when objects are more alike
– Minimum dissimilarity is often 0
– Upper limit varies
Proximity refers to a similarity or dissimilarity
01/27/2021 Introduction to Data Mining, 2nd Edition 24
Tan, Steinbach, Karpatne, Kumar
 Similarity/Dissimilarity for Simple Attributes

The following table shows the similarity and dissimilarity

between two objects, x and y, with respect to a single, simple
attribute.

01/27/2021 Introduction to Data Mining, 2nd Edition 25

Tan, Steinbach, Karpatne, Kumar
Euclidean Distance

Euclidean Distance

where n is the number of dimensions (attributes) and

xk and yk are, respectively, the kth attributes
(components) or data objects x and y.

Standardization is necessary, if scales differ.

01/27/2021 Introduction to Data Mining, 2nd Edition 26

Tan, Steinbach, Karpatne, Kumar
Euclidean Distance

3
point x y
2 p1
p1 0 2
p3 p4
1
p2 2 0
p2 p3 3 1
0 p4 5 1
0 1 2 3 4 5 6

p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
Distance Matrix
01/27/2021 Introduction to Data Mining, 2nd Edition 27
Tan, Steinbach, Karpatne, Kumar
Minkowski Distance

Minkowski Distance is a generalization of Euclidean

Distance

Where r is a parameter, n is the number of dimensions

(attributes) and xk and yk are, respectively, the kth
attributes (components) or data objects x and y.

01/27/2021 Introduction to Data Mining, 2nd Edition 28

Tan, Steinbach, Karpatne, Kumar
Minkowski Distance: Examples

r = 1. City block (Manhattan, taxicab, L1 norm) distance.

– A common example of this for binary vectors is the
Hamming distance, which is just the number of bits that are
different between two binary vectors

r = 2. Euclidean distance

r → . “supremum” (Lmax norm, L norm) distance.

– This is the maximum difference between any component of
the vectors

Do not confuse r with n, i.e., all these distances are

defined for all numbers of dimensions.

01/27/2021 Introduction to Data Mining, 2nd Edition 29

Tan, Steinbach, Karpatne, Kumar
Minkowski Distance

L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0
point x y
p1 0 2 L2 p1 p2 p3 p4
p2 2 0 p1 0 2.828 3.162 5.099
p3 3 1 p2 2.828 0 1.414 3.162
p4 5 1 p3 3.162 1.414 0 2
p4 5.099 3.162 2 0

L p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0

Distance Matrix
01/27/2021 Introduction to Data Mining, 2nd Edition 30
Tan, Steinbach, Karpatne, Kumar
Common Properties of a Distance

Distances, such as the Euclidean distance,

have some well known properties.
1. d(x, y)  0 for all x and y and d(x, y) = 0 if and only
if x = y.
2. d(x, y) = d(y, x) for all x and y. (Symmetry)
3. d(x, z)  d(x, y) + d(y, z) for all points x, y, and z.
(Triangle Inequality)

where d(x, y) is the distance (dissimilarity) between

points (data objects), x and y.

A distance that satisfies these properties is a

metric
01/27/2021 Introduction to Data Mining, 2nd Edition 31
Tan, Steinbach, Karpatne, Kumar
Common Properties of a Similarity

Similarities, also have some well known

properties.

1. s(x, y) = 1 (or maximum similarity) only if x = y.

(does not always hold, e.g., cosine)
2. s(x, y) = s(y, x) for all x and y. (Symmetry)

where s(x, y) is the similarity between points (data

objects), x and y.

01/27/2021 Introduction to Data Mining, 2nd Edition 32

Tan, Steinbach, Karpatne, Kumar
Similarity Between Binary Vectors

Common situation is that objects, x and y, have only

binary attributes

Compute similarities using the following quantities

f01 = the number of attributes where x was 0 and y was 1
f10 = the number of attributes where x was 1 and y was 0
f00 = the number of attributes where x was 0 and y was 0
f11 = the number of attributes where x was 1 and y was 1

Simple Matching and Jaccard Coefficients

SMC = number of matches / number of attributes
= (f11 + f00) / (f01 + f10 + f11 + f00)
Jaccard
J = number of 11 matches / number of non-zero attributes
= (f11) / (f01 + f10 + f11)
01/27/2021 Introduction to Data Mining, 2nd Edition 33
Tan, Steinbach, Karpatne, Kumar
SMC versus Jaccard: Example

x= 1000000000
y= 0000001001

f01 = 2 (the number of attributes where x was 0 and y was 1)

f10 = 1 (the number of attributes where x was 1 and y was 0)
f00 = 7 (the number of attributes where x was 0 and y was 0)
f11 = 0 (the number of attributes where x was 1 and y was 1)

SMC = (f11 + f00) / (f01 + f10 + f11 + f00)

= (0+7) / (2+1+0+7) = 0.7

J = (f11) / (f01 + f10 + f11) = 0 / (2 + 1 + 0) = 0

01/27/2021 Introduction to Data Mining, 2nd Edition 34

Tan, Steinbach, Karpatne, Kumar
Cosine Similarity

If d1 and d2 are two document vectors, then

cos( d1, d2 ) = <d1,d2> / ||d1|| ||d2|| ,
where <d1,d2> indicates inner product or vector dot
product of vectors, d1 and d2, and || d || is the length of
vector d.

Example:
d1 = 3 2 0 5 0 0 0 2 0 0
d2 = 1 0 0 0 0 0 0 1 0 2
<d1, d2> = 3*1 + 2*0 + 0*0 + 5*0 + 0*0 + 0*0 + 0*0 + 2*1 + 0*0 + 0*2 = 5
|| d1 || = (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0)0.5 = (42) 0.5 = 6.481
|| d2 || = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2) 0.5 = (6) 0.5 = 2.449
cos(d1, d2 ) = 0.3150

01/27/2021 Introduction to Data Mining, 2nd Edition 35

Tan, Steinbach, Karpatne, Kumar