0% found this document useful (0 votes)
5 views52 pages

G 100002 Ex 1

Uploaded by

brouuorb
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
5 views52 pages

G 100002 Ex 1

Uploaded by

brouuorb
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 52

b

Europäisches European Office européen


Patentamt Patent Office des brevets

Große Enlarged Grande


Beschwerdekammer Board of Appeal Chambre de recours

Internal distribution code:


(A) [X] Publication in OJ
(B) [ ] To Chairmen and Members
(C) [ ] To Chairmen
(D) [ ] No distribution

Datasheet for the decision


of the Enlarged Board of Appeal
of 30 August 2011

Case Number: G 0002/10

Application Number: 98920015.9

Publication Number: 0981646

IPC: C12Q 1/68

Language of the proceedings: EN

Title of invention:
Enzymatic DNA molecules

Applicant:
THE SCRIPPS RESEARCH INSTITUTE

Headword:
Disclaimer/SCRIPPS

Relevant legal provisions:


EPC Art. 54(2)(3), 56, 61(1)(b), 76(1), 83, 84, 87(1),
123(2)(3)

EPA Form 3030 06.03


C5642.D
b
Europäisches European Office européen
Patentamt Patent Office des brevets

Große Enlarged Grande


Beschwerdekammer Board of Appeal Chambre de recours

Keyword:
"Admissibility of referral (yes)"
"Construction of referred question - term disclaimer -
subject-matter instead of embodiment"
"G 1/03 and G 2/03 relating to disclaimers for disclosed
subject-matter (no)"
"General definition for assessment under Article 123(2) EPC -
applicable to disclaimers for disclosed subject-matter (yes)"
"Point of reference: subject-matter remaining claimed"
"Technical assessment of overall circumstances of the case
required - same test as for positive features"
"Disclaimed subject-matter disclosed as part of the invention
- not relevant"
"Importance of uniform concept of disclosure and uniform
determination of rights derivable therefrom"

Decisions cited:
G 0003/89, G 0011/91, G 0001/93, G 0002/98, G 0001/03,
G 0002/03, G 0001/05, G 0001/06, G 0001/07,
T 0004/80, T 0313/86, T 0170/87, T 0448/93, T 0615/95,
T 0323/97, T 0451/99, T 0507/99, T 1050/99, T 1102/00,
T 1139/00, T 1107/06,

"Napp Pharmaceutical Holdings Ltd v. Ratiopharm GmbH and


Sandoz Ltd", Court of Appeal (England and Wales), [2009] EWCA
Civ 252
"Mundipharma Pharmaceuticals B.V. v. Sandoz B.V.", District
Court of The Hague of 7 April 2010, case no. 340373/09-2029

Headnote:
The question referred to the Enlarged Board of Appeal is
answered as follows:

1a. An amendment to a claim by the introduction of a


disclaimer disclaiming from it subject-matter disclosed in the
application as filed infringes Article 123(2) EPC if the
subject-matter remaining in the claim after the introduction
of the disclaimer is not, be it explicitly or implicitly,
directly and unambiguously disclosed to the skilled person
using common general knowledge, in the application as filed.

1b. Determining whether or not that is the case requires a


technical assessment of the overall technical circumstances of
the individual case under consideration, taking into account
the nature and extent of the disclosure in the application as
filed, the nature and extent of the disclaimed subject-matter
and its relationship with the subject-matter remaining in the
claim after the amendment.
EPA Form 3030 06.03
C5642.D
b
Europäisches European Office européen
Patentamt Patent Office des brevets

Große Enlarged Grande


Beschwerdekammer Board of Appeal Chambre de recours

Case Number: G 0002/10

D E C I S I O N
of the Enlarged Board of Appeal
of 30 August 2011

Appellant: THE SCRIPPS RESEARCH INSTITUTE


10550 North Torrey Pines Road
La Jolla, CA 92037 (US)

Representative: Almond-Martin, Carol


Ernest Gutmann - Yves Plasseraud S.A.S.
88, Boulevard des Belges
F-69452 Lyon Cedex 06 (FR)

Referring Decision: Interlocutory decision of the Technical Board


of Appeal 3.3.08 dated 25 June 2010 in case
T 1068/07.

Composition of the Board:

Chairman: P. Messerli
Members: B. Günzel
A. S. Clelland
U. Oswald
B. Schachenmann
J.-P. Seitz
A. Wirén

C5642.D
- 1 - G 0002/10

Summary of Facts and Submissions

I. The referred question

By interlocutory decision T 1068/07 of 25 June 2010,


Technical Board of Appeal 3.3.08 referred the following
question to the Enlarged Board of Appeal:

Does a disclaimer infringe Article 123(2) EPC if its


subject-matter was disclosed as an embodiment of the
invention in the application as filed?

II. The appealed decision of the examining division

The appeal proceedings before the referring Board


concern the appellant's appeal against the decision of
the examining division of 2 February 2007 refusing
European patent application No. 98 920 015.9. The
examining division decided that both the appellant's
main and (first) auxiliary request did not fulfil the
requirements of Article 123(2) EPC. The application as
filed provided no basis for the disclaimers introduced
in the respective claims 1.

III. The claims underlying the referring decision

The application relates to catalytic (enzymatic) DNA


molecules capable of cleaving other nucleic acid
sequences or molecules, particularly RNA, in a site-
specific manner.

C5642.D
- 2 - G 0002/10

Claim 1 of the main request reads as follows:

"1. A catalytic DNA molecule having site-specific


endonuclease activity specific for a nucleotide
sequence defining a cleavage site in a preselected
substrate nucleic acid sequence,
said catalytic molecule having first and second
substrate binding regions flanking a core region,
said molecule having the formula:

5' (X-R) - GGCTAGCT8ACAACGA - (X) 3'

wherein

each X is any nucleotide sequence,


(X-R) represents said first substrate binding region,
(X) represents said second substrate binding region,
R is a nucleotide capable of forming a base pair with a
pyrimidine in the preselected substrate nucleic acid
sequence,
T8 may be replaced by C or A,

said first substrate binding region having a sequence


capable of binding through complementary base-pairing
to a first portion of said preselected substrate
nucleic acid sequence,
said second substrate binding region having a sequence
capable of binding through complementary base-pairing
to a second portion of said preselected substrate
nucleic acid sequence,

wherein the first substrate binding region does not


have the sequence 5' CTTTGGTTA 3' or 5' CTAGTTA 3',

C5642.D
- 3 - G 0002/10

wherein the second substrate binding region does not


have the sequence 5' TTTTTCC 3'
and wherein the said catalytic DNA molecule does not
show site-specific endonuclease activity for the
sequence:

5' - GGAAAAAGUAACUAGAGAUGGAAG - 3' (SEQ ID NO 135)."


(emphasis added by the Enlarged Board)

As regards claim 1 the appellant's auxiliary request I


reads as the main request, except for the incorporation
into claim 1 of the indication that "R" represents A or
G from claim 2.

As regards their respective claims 1, the appellant's


auxiliary requests II and III, filed before the
referring Board in response to a communication by the
Board, read as the main request, except that the final
portion of claim 1 of the main request reading "wherein
the first substrate binding region does not have the
sequence [...] (SEQ ID No. 135)" is replaced by a
wording which in auxiliary request II reads:

"... with the proviso that said catalytic molecule is


not a molecule in which the first and second binding
regions can bind through complementary base-pairing to
a substrate nucleic acid which is:

5' - GGAAAAAGUAACUAGAGAUGGAAG - 3' (SEQ ID NO 135).";

C5642.D
- 4 - G 0002/10

and in auxiliary request III reads:

"... with the proviso that said catalytic molecule is


not a molecule which shows site-specific intermolecular
catalytic cleavage of the substrate:

5' - GGAAAAAGUAACUAGAGAUGGAAG - 3' (SEQ ID NO 135)

under conditions of 2 mM MgCl2, 150 mM KCl, pH 7.5,


37°C, for a rate of about kcat = 0.01 min-1."

IV. The decision of the examining division

The examining division had rejected the main and first


auxiliary requests filed before it by the applicant
(appellant) on the grounds that the disclaimer
contained therein was not disclosed as such in the
application as filed and that furthermore, the
requirements of decisions G 1/03 and G 2/03 (OJ EPO
2004, 413 and 448, hereinafter: decision G 1/03, unless
a different specific reference is made) were not met.
The disclaimers served to render the subject-matter of
claim 1 novel under Article 54(2) EPC over D1, but D1
clearly belonged to the same technical field as it also
dealt with catalytic DNA molecules. It was thus not so
unrelated to and removed from the claimed invention
that the person skilled in the art would never have
taken it into consideration when making the invention.
Moreover, D1 had the same inventor and applicant as the
application in suit and its content was to a large
extent identical to that of the application.

C5642.D
- 5 - G 0002/10

V. The referring decision

The referring Board considers claim 1 in both the


appellant's main request and its auxiliary request I to
offend against Article 123(2) EPC. According to the
referring Board these claims are limited by "three
negative features" which are not disclosed in the
application as filed. The exclusion from the ambit of
protection of claim 1 of the specific (first and
second) substrate binding arms and of the specific
substrate sequence of the prototype "10 to 23" motif
(cf. Figures 8 and 9) by the negative features is said
to constitute a selection within the broader outline of
the changes proposed in example 6, in particular on
page 87, lines 24 to 28. For this selection no direct
and unambiguous support is found in the application as
filed (see point 11. of the Reasons).

By contrast, in auxiliary requests II and III the


negative features characterising claim 1 of the
preceding requests have been replaced by disclaimers,
the subject-matter of which was disclosed as an
embodiment of the invention.

As was observed in point 4.2.3 of decision G 1/07,


following decision G 1/03, which dealt with the issue
of so-called undisclosed disclaimers, different
opinions have been expressed in the jurisprudence of
the boards of appeal as to whether the findings of the
said decisions of the Enlarged Board relate also to
disclaimers disclaiming embodiments which are disclosed
in the application as filed as being part of the
invention or whether they do not relate thereto. In the
case before the referring Board, whether the first

C5642.D
- 6 - G 0002/10

approach is followed rather than the second, makes a


decisive difference. In the first case auxiliary
requests II and III would have to be rejected under
Article 123(2) EPC, with the consequent dismissal of
the appeal. In the second case these requests would be
considered not to offend against Article 123(2) EPC and
the decision under appeal could be set aside.

VI. The course of the proceedings before the Enlarged Board

By decision of 6 August 2010 the Enlarged Board invited


the President of the EPO to comment in writing on the
point of law referred to the Enlarged Board and also
issued an invitation for third parties to file
comments. The President of the EPO and a number of
third parties submitted comments in writing. On
18 March 2011 the Enlarged Board issued a summons to
attend oral proceedings and thereafter, on 21 June
2011, a communication drawing attention to a number of
issues that appeared of significance for discussion in
the oral proceedings. Oral proceedings were held on
4 August 2011. At the end of the oral proceedings the
chairman announced that the Enlarged Board would give
its decision in writing.

VII. The appellant's submissions

The submissions of the appellant may be summarised as


follows:

Decision G 1/03 does not apply to disclaimers excluding


disclosed embodiments. The legal analysis by the
Enlarged Board in decision G 1/03 was determined by the
questions put to it. These questions did not include an

C5642.D
- 7 - G 0002/10

assessment of the situation where the subject-matter to


be excluded was disclosed only in positive terms.
Furthermore, the manner in which the Enlarged Board
defined how the disclaimer should be drafted (in
point 3. of the Reasons), i.e. that it should not
remove more than is necessary to restore novelty or to
disclaim subject-matter excluded from patentability for
non-technical reasons, shows that G 1/03 was not
intended to apply to disclaimers for positively
disclosed embodiments, since in the latter case the
wording of the disclaimer is imposed by the wording of
the embodiment. This difference between the two types
of disclaimers clearly illustrates their fundamentally
different nature.

As regards point 2.5 of the Reasons of decision G 1/03,


relied on by the Board in decision T 1050/99, the cited
passage of the Enlarged Board's decision does not
justify the Technical Board's conclusions. There is
nothing in that section of G 1/03 to suggest that the
Enlarged Board was considering a situation "where the
disclaimer is not disclosed in the application as filed
and the subject-matter excluded by it is". On the
contrary, both decisions T 170/87 and T 313/86, which
are the only decisions referred to in this passage of
G 1/03 in the context of exclusion of subject-matter,
addressed the question of disclaimers in the absence of
support for the subject-matter to be excluded.

In its decision G 1/07 the Enlarged Board addressed the


issue of different opinions having been expressed in
the jurisprudence of the boards of appeal on the issue
and defined only two possibilities with regard to the

C5642.D
- 8 - G 0002/10

approach to be applied when assessing disclaimers for


disclosed embodiments, namely:

(a) application of G 1/03 or

(b) application of the jurisprudence following


decision T 4/80, as summarized in decision
T 1107/06. Since only two alternatives were
indicated by the Enlarged Board in decision
G 1/07, the approach to be adopted must be the
approach as defined in T 4/80 and the subsequent
decisions, including T 1107/06. This approach is
also that still summarised in the previous version
of the Guidelines for Examination as published in
June 2005 (see III, 4.2).

A disclaimer whose subject-matter is disclosed as an


embodiment of the invention in the application as filed
is not contrary to Article 123(2) EPC. In such a case
the applicant clearly does not draw any unwarranted
advantage within the meaning of decision G 1/93
(point 9. of the Reasons), since he or she is merely
claiming the originally disclosed invention less a
particular embodiment, both of which were described
initially. Therefore the legal security of third
parties cannot be jeopardised by such a disclaimer.

In accordance with decision T 1107/06 the question to


be asked is not whether it can be inferred from the
application as filed that the applicant intended to
exclude the subject-matter of the disclaimer, but
rather whether the subject-matter remaining in the
claim after insertion of the disclaimer finds support
(point 45. of the Reasons). In that decision the

C5642.D
- 9 - G 0002/10

Technical Board concluded that the skilled person faced


with the generic disclosure of the invention and the
specific disclosure of an illustrative embodiment
falling within the generic disclosure will normally
infer that all the other embodiments comprised in the
generic disclosure without being mentioned specifically
also form part of the invention. The non-exemplified or
non-preferred embodiments are thus implicitly disclosed
as the logical complement of the explicitly mentioned
embodiments. This "logical complement" approach is the
correct approach. Indeed, as a matter of logic, the
singling out of a small group (Y) within a larger group
(X), necessarily gives two groups i.e. the small group
(Y) and the remaining group which is the larger group
minus the smaller group (X-Y). A disclosure which
singles out the subgroup (Y) from the larger group (X)
thus implicitly describes the remaining group (X-Y). A
claim directed to (X-Y) is therefore fully supported by
the disclosure of (Y) singled out from (X).

The boards of appeal regularly accept that a given


subject-matter can be defined in positive or negative
terms, one being the complement of the other. Reference
is made to decisions T 4/80 and T 448/93.

VIII. The appellant's requests

In the oral proceedings before the Enlarged Board the


appellant requested that the answer to the referred
question be no, provided there is a clear and
unambiguous disclosure of the subject-matter remaining
in the claim.

C5642.D
- 10 - G 0002/10

IX. The comments made by the President of the EPO

On the basis of established case law following decision


T 4/80 the first instance practice was to accept that,
if specific subject-matter was originally disclosed as
a possible embodiment of the invention, a disclaimer
could be introduced into the claim in order to exclude
this embodiment from the scope of protection, provided
the subject-matter remaining claimed could not be
defined more clearly and concisely by positive features
or if such positive definition would unduly limit the
scope of the claim. This practice did not change after
decision G 1/03. Based on the phrasing of the question
referred in case G 1/03, but in particular also on the
text of the answers given by the Enlarged Board of
Appeal, it was considered that the Enlarged Board of
Appeal dealt only with the situation in which neither
the disclaimer nor the subject-matter excluded by the
disclaimer was disclosed in the application as filed.
However, after a number of decisions concluded that
disclaimers based on embodiments which are disclosed in
the original application as part of the invention have
to be considered as undisclosed disclaimers to which
the criteria set out in G 1/03 apply, the practice of
the first instance department was adapted to the new
jurisprudence. This practice was not changed again in
the light of T 1107/06. The current practice can be
seen from the Guidelines published in April 2010.

As was said in decision T 1107/06, point 45. of the


Reasons, the decisive question to ask under
Article 123(2) EPC is not whether the skilled person
could infer from the original disclosure that the
applicant intended to exclude the disclaimed subject-

C5642.D
- 11 - G 0002/10

matter from the scope of protection. Rather it has to


be ascertained whether there is a clear and unambiguous
disclosure, be it explicit or implicit, of the subject-
matter remaining in the claim.

When there is a generic disclosure of the invention


together with a specific disclosure of an illustrative
or preferred embodiment falling under the generic
disclosure, the skilled person will normally infer that
all the other embodiments comprised in the generic
disclosure without being mentioned specifically also
form part of the invention. The non-exemplified or non-
preferred embodiments are thus implicitly disclosed as
the logical complement of the exemplified or preferred
embodiments.

It follows that a disclaimer excluding protection for


subject-matter disclosed as an embodiment of the
invention in the application as filed does not
necessarily infringe Article 123(2) EPC. Where the
subject-matter remaining in the claim is not directly
and unambiguously derivable from the application as
filed, the criteria established in G 1/03 regarding the
allowability of a disclaimer should be applied.

The amendment's admissibility is a matter which must be


assessed in each particular case on its own merits.

Such a view would and should be consistent with the


determination of the disclosure and the rights
derivable therefrom in other provisions which build on
the disclosure of a document.

C5642.D
- 12 - G 0002/10

Regarding novelty this would imply that an application


with a generic disclosure of the invention together
with a specific disclosure of an illustrative or
preferred embodiment falling under the generic
disclosure may be novelty destroying for a later
application containing the disclaimer.

Taking the disclosure as the basis for the right to


priority, as stated in decision G 2/98 and confirmed in
G 1/03, this means that a disclaimer not infringing
Article 123(2) EPC, which is allowable during the
prosecution of a European patent application, does not
change the identity of the invention within the meaning
of Article 87(1) EPC. By the same token, its
introduction should also be allowable when drafting and
filing a divisional application if the earlier
application as filed does not contain the disclaimer
but discloses its subject-matter as an embodiment of
the invention.

Disclaiming disclosed subject-matter may also become


relevant in order to avoid double patenting in the case
of overlapping claims between two EP applications, for
instance parent and divisional applications or priority
and successive applications or between the patent
granted on a European patent application and the patent
granted on a preceding application in a designated
state, the priority of which is claimed in the European
application, if double patenting is prohibited in the
designated state. A disclaimer should also be allowable
where a third party files a new application under
Article 61(1)(b) EPC confined to that part of the
original subject-matter to which it has become
entitled. An additional reason for a disclaimer could

C5642.D
- 13 - G 0002/10

be that the subject-matter is excluded from


patentability for non-technical reasons.

In any case, clear guidance should be given regarding


the requirements concerning the allowability of
disclaimers, including suitable transitional
arrangements, if appropriate, for pending applications
and patents.

X. The submissions of the amici curiae

Amici curiae briefs were received from Astra Zeneca AB,


the Chartered Institute of Patent Attorneys (CIPA) and
several professional representatives. The submissions
made were essentially:

- The referred question is unclear and the answer


depends on the individual circumstances of the case
under consideration. Disclaiming a disclosed embodiment
does not jeopardise legal certainty for third parties
and does not improve the applicant's position.

- The applicant may have a legitimate interest in


further pursuing a claimed generic invention and a
specific embodiment thereof in related applications,
either to obtain rapid grant for the specific
embodiment or for funding or licensing purposes.

- G 1/03 did not decide the presently referred issue.

- The test to be applied on the assessment of the


disclaimer is whether the specific disclaimer made
results in new subject-matter being disclosed.

C5642.D
- 14 - G 0002/10

- As a matter of logic the disclosure of a narrow


region B (whether having an advantageous feature or
not) within a general region A inevitably and
inescapably discloses the region A-B. In terms of
technical teaching disclaiming B has no technical
teaching on its own. It merely limits the scope of the
claim.

- A priori, under Article 123(2) EPC a disclaimer can


be introduced for any purpose, i.e. the disclaimed
embodiment may in fact be patentable.

- The prior art situation is not relevant for assessing


the disclaimer under Article 123(2) EPC. Otherwise the
disclaimer could initially be held to satisfy
Article 123(2) EPC and later be held to violate
Article 123(2) EPC because new prior art is found.

- The applicant should not be in a worse position


through disclosing a disclaimed embodiment than by not
disclosing a disclaimed embodiment. If the relevant
prior art cannot be considered as an accidental
anticipation of the disclaimed embodiment, then the
applicant may have to show that the embodiments
remaining within the scope of the claim are patentable
in comparison with the disclaimed embodiment. To that
extent exactly the same situation can arise as in cases
where the claim is limited by some other form of
amendment.

C5642.D
- 15 - G 0002/10

Reasons for the decision

1. Admissibility of the referral

In decision G 1/07 (OJ EPO 2011, 134, point 4.2.3 of


the Reasons) the Enlarged Board of Appeal pointed out
that it was aware that, subsequent to decisions G 1/03
and G 2/03 (OJ EPO 2004, 413 and 448) different
opinions have been expressed in the jurisprudence of
the boards of appeal on whether decisions G 1/03 and
G 2/03 relate to the disclaiming of embodiments which
are disclosed as part of the invention in the
application as filed or whether in that situation the
jurisprudence as previously established following
decision T 4/80 (OJ EPO 1982, 149) continues to apply.
Reference was made by the Enlarged Board to decision
T 1107/06 of 3 December 2008, points 31. et seq. of the
Reasons, and the decisions cited therein.

In spite of the somewhat broad wording of the referred


question, which asks generally whether disclaiming an
embodiment disclosed in the application as filed as an
embodiment of the invention infringes Article 123(2)
EPC, it is to be understood from points 15. and 16. of
the Reasons of the referring decision that the referral
was made mainly, if not exclusively, in order that the
divergence of views identified in decisions T 1107/06
and G 1/07 could be clarified.

There is, furthermore, a divergence of views in the


jurisprudence of the boards of appeal not only with
regard to the question of what the Enlarged Board
actually decided in decision G 1/03 but also with
respect to the question of what the right solution to

C5642.D
- 16 - G 0002/10

the question ought to be. Is it the application of the


criteria set out in decision G 1/03 or should the
relevant test be whether the subject-matter remaining
in the claim after the introduction of the disclaimer
was disclosed in the application as filed, as was held
in decision T 1107/06?

This question is indisputably also a point of law of


fundamental importance within the meaning of
Article 112(1) EPC and, since the question of
compliance with Article 123(2) EPC is normally examined
before substantive examination, the referral is
admissible (see G 1/03, point 1.2 of the Reasons).

2. The construction of the referred question

2.1 Disclaimer infringing Article 123(2) EPC?

The referring Board has asked whether a disclaimer


infringes Article 123(2) EPC if its subject-matter was
disclosed as an embodiment of the invention in the
application as filed. However, since Article 123(2) EPC
deals with amendments and since the disclaimer as such
defines subject-matter that is not claimed, the
question is construed as intended to ask whether an
amendment to a claim by the introduction of a
disclaimer infringes Article 123(2) EPC if the subject-
matter of the disclaimer was disclosed as an embodiment
of the invention in the application as filed.

C5642.D
- 17 - G 0002/10

2.2 The term "disclaimer"

In decision G 1/03 (point 2. of the Reasons) the


Enlarged Board of Appeal gave a definition of the term
"disclaimer", which states that in accordance with
consistent practice, the term "disclaimer" is used in
the decision as meaning an amendment to a claim
resulting in the incorporation therein of a "negative"
technical feature, typically excluding from a general
feature specific embodiments or areas. This is the
understanding of the term "disclaimer" on which the
present decision is also based.

2.3 The term "embodiment"

The referring Board has drafted the question of the


infringement of Article 123(2) EPC on the basis that
the disclaimed subject-matter is an "embodiment" of the
invention. The term "embodiment" is commonly used to
define a specific combination of features or a specific
mode of carrying out the invention, by contrast to a
more abstract definition of features which can be
carried out in more than one way.

As regards disclaimers, it is, however, not generally


so that only one specific embodiment is excluded from
protection. On the contrary, disclaimers are often
defined in much broader terms. The disclaimers then -
at least potentially - exclude a plurality of
embodiments, a whole (sub-) group thereof or a whole,
even if limited, area falling within the ambit of a
generic claim. In this respect, the Enlarged Board
notes that e.g. in claim 1 of auxiliary request III all
catalytic molecules are excluded from protection which

C5642.D
- 18 - G 0002/10

show site-specific intermolecular catalytic cleavage of


the substrate corresponding to a defined portion of
sequence ID number 135 under defined conditions.

The main problem of the compatibility of disclosed


disclaimers with Article 123(2) EPC does not lie in one
specific "embodiment" of an invention being disclaimed
from a broad generic claim. Rather, it arises in those
cases in which a whole area or subclass is disclaimed.
It is cases of this kind that have given rise to doubts
whether, after the introduction of such a broad
disclaimer, the subject-matter remaining in the claim
is still the same as that formerly claimed, and have
prompted the idea that, when the requirements of
Article 123(2) EPC are examined, the nature of the
subject-matter remaining in the claim must be assessed.
It appears immediately evident that the nature of the
question differs according to whether only one specific
embodiment is disclaimed from a generally drafted
claim, or whether, on the other hand, a whole subgroup
or area is disclaimed.

In decision G 1/03, point 2.1.3 of the Reasons, the


Enlarged Board defines the possible contents of a
disclaimer in a much broader sense than by referring to
the exclusion of an embodiment. In the context of
explaining why, for the purpose of delimiting the
claimed-subject matter with respect to a conflicting
application, a disclaimer is not in contradiction to
Article 123(2) EPC, the Enlarged Board speaks very
generally of "an invention comprising "different
specific embodiments or groups thereof" having been
disclosed in the application as filed, a "part of
which" is excluded from the requested protection. There

C5642.D
- 19 - G 0002/10

is no definition of a degree of narrowness required


from the part to be excluded in order to be the
potential subject-matter of a disclaimer.

This explains the broad wording of answer 1 in decision


G 1/03, which does not use a narrow term such as
"embodiment". Instead, it answers the referred question
generally, with respect to "subject-matter" excluded by
the disclaimer, in correspondence to the terminology
used in question 1 of referring decision T 507/99 (OJ
EPO 2003, 225).

For these reasons, the use of the term "embodiment" in


the referred question can not be a reason for
construing the question too narrowly. All - and in
particular the critical - uses of disclaimers, i.e.
disclaimers excluding whole (sub)groups of embodiments
or areas from the claimed subject-matter need to be
considered in order to deal with the referred question
in an appropriate way. As a consequence, the Enlarged
Board holds that the term "embodiment" in the referred
question should be understood as addressing the issue
of disclaiming "subject-matter". This term will figure
in the Enlarged Board's answer.

3. Did G 1/03 decide the issue of disclaimers disclaiming


subject-matter disclosed in the application as filed?

In the decisions of technical boards of appeal cited in


decision T 1107/06, point 42. of the Reasons, the
expression "disclaimer which is not disclosed in the
application as filed" in answer 2 of decision G 1/03
has been read as meaning that the criteria set out in
answer 2 were meant to apply to all cases in which the

C5642.D
- 20 - G 0002/10

disclaimer as such was not disclosed in the application


as filed and hence also to cases in which, albeit the
disclaimer not being disclosed as such, its subject-
matter was disclosed in the application as filed.

Such a reading of decision G 1/03 is incorrect, for the


following reasons:

3.1 It is particularly clear from question 1 of the first


referring decision, T 507/99 (Headnote), that that
referral was only directed to the situation in which
neither the disclaimer nor the subject-matter excluded
by it from the scope of the claim has a basis in the
application as filed. Question 1 sets out this
condition explicitly, the referring Board having
ascertained in point 3. of the Reasons that in the case
under consideration neither the disclaimers as such nor
the excluded subject-matter had been disclosed in the
application as filed.

The second referring decision, T 451/99 (OJ EPO 2003,


334, Headnote), uses the term "disclaimer not supported
by the application as filed" in the first referred
question, but it is clear, in particular from points 4.
and 24. of the Reasons, that by using this term the
referring Board was - also - addressing a situation in
which neither the disclaimer as such nor the excluded
subject-matter was disclosed in the application as
filed.

3.2 In spite of some differences in wording, in both


referring decisions the further questions asking the
Enlarged Board to define the criteria to be applied in
assessing the admissibility of a disclaimer, refer back

C5642.D
- 21 - G 0002/10

to the respective first question put. In both


decisions, the further questions were put to the
Enlarged Board only for the event that the Enlarged
Board did not answer question 1 by saying that an
amendment to a claim by the introduction of a
disclaimer is unallowable under Article 123(2) EPC for
the sole reason that neither the disclaimer nor the
subject-matter excluded by it from the scope of the
claim has a basis in the application as filed (i.e. is
supported by the application as filed, in the
terminology of T 451/99).

3.3 The Enlarged Board's answers follow exactly the


structure of the referred questions. They start by
giving the basic principle in answer 1. It is expressly
stated therein that the answer relates to the case in
which neither the disclaimer nor the subject-matter
excluded by it from the scope of the claim has a basis
in the application as filed. Answer 2 and its sub-
answers then address the further referred questions and
define in more detail the criteria to be applied for
assessing the allowability of such a disclaimer.

In this respect also following the structure of the


referred questions, answer 1 is, however, only drafted
in negative terms by giving the reason for which an
amendment may not be refused under Article 123(2) EPC
(i.e. not for the sole reason that neither the
disclaimer nor the subject-matter excluded by it from
the scope of the claim has a basis in the application
as filed). It is, hence, clear that answer 1 only
partly dealt with the referred questions and that
further answers were required to settle them.

C5642.D
- 22 - G 0002/10

In such a situation, where an answer completes another


answer in order to settle the questions posed, the
questions all being defined by a particular set of
circumstances (here the fact that neither the
disclaimer nor the subject-matter excluded by it has a
basis in the application as filed), such further answer
cannot be taken out of context or read in isolation.
Just as for the further referred questions (see in this
respect in particular decision T 507/99), answer 2
refers back to and further elucidates the criteria to
be applied in the context of the basic answer given in
answer 1. When read in the context of answer 1, it
appears that the term "disclaimer which is not
disclosed in the application as filed" used in answer 2
is the term linking this answer to answer 1. It may be
that this passage of answer 2 could have been worded by
repeating verbatim the corresponding formulation in
answer 1. However, it can nevertheless be deduced
clearly from the above-described structure of the
answers - which corresponds to the structure of the
referred questions - that the Enlarged Board's answer
to subsidiary question 2 refers to the situation
addressed in answer 1, i.e. to the situation in which
neither the disclaimer nor the subject-matter excluded
by it have a basis in the application as filed. In the
Reasons of decision G 1/03 that situation is later
referred to by the use of the term "undisclosed
disclaimer" (see e.g. point 2.1 of the Reasons), and in
the present case the same terminology will be used.

Hence, the controversial passage in answer 2 cannot be


read to mean that the Enlarged Board intended to decide
that a case not addressed by the referred questions,
i.e. the situation in which the subject-matter excluded

C5642.D
- 23 - G 0002/10

by the disclaimer is disclosed in the application as


filed, was a case to which the criteria set up in
answer 2 were to be applied.

3.4 In the absence of indications to the contrary, it can


be presumed that the Enlarged Board would have clearly
stated so if it had intended to give answer 2 a meaning
going beyond the scope of the questions posed. Nor is
there anything in the further text of decision G 1/03
which indicates that the Enlarged Board envisaged that
the requirements for the allowability of disclaimers,
as set out in answer 2, should apply to the disclaiming
of subject-matter disclosed in the application as
filed.

3.5 Point 2.5 of the Reasons of decision G 1/03 does not


support the conclusion drawn from that passage by the
technical board in decision T 1050/99 of 2 January
2005, points 6. and 7.(d) of the Reasons, that G 1/03
also relates to disclaimers for disclosed subject-
matter. In point 2.5 of the Reasons of decision G 1/03
the Enlarged Board generally addresses the question as
to whether, if a claim comprises non-working
embodiments, such embodiments may be disclaimed. It is
nowhere mentioned that, although the object of the said
decision was disclaimers for subject-matter which was
not disclosed in the application as filed, the
discussion in point 2.5 of the Reasons relates to the
situation in which the non-working embodiments are
disclosed in the application as filed. The fact that
the two decisions cited by the Enlarged Board in this
context, i.e. T 170/87 (OJ EPO 1989, 441, point 8.4 of
the Reasons) and T 313/86 of 12 January 1988, referred
to in decision T 170/87, addressed the question of

C5642.D
- 24 - G 0002/10

disclaimers in the absence of disclosure of the


subject-matter to be excluded in the application as
filed, also points away from the interpretation of that
passage in the sense advocated in decision T 1050/99.

3.6 Furthermore, as the appellant's representative has


pointed out, the requirement laid down by the Enlarged
Board in point 3. of the Reasons of decision G 1/03 for
drafting a disclaimer, i.e. that "the disclaimer should
not remove more than is necessary to restore
novelty..." is not suitable for the disclaiming of
disclosed subject-matter, since in that case the
wording of the disclaimer must be configured in
accordance with the disclosure of the disclaimed
subject-matter in the application as filed.

3.7 In point 2. of the Reasons of decision G 1/03, the


Enlarged Board explains why it uses the term
"undisclosed" disclaimer instead of the term
"unsupported" disclaimer, which had been used in
referring decision T 451/99 for the situation in which
neither the disclaimer as such nor the disclaimed
embodiments were disclosed in the application as filed.
As is apparent from the Enlarged Board's explanations,
the only reason for the change in terminology adopted
by it was to avoid any confusion between the
requirements of Article 123(2) EPC and those of
Article 84 EPC, which uses the term "supported".

3.8 For the Enlarged Board it is furthermore an important


element in arriving at this conclusion that national
decisions have taken the same stance and read decision
G 1/03 in the same way ("Napp Pharmaceutical Holdings
Ltd v. Ratiopharm GmbH and Sandoz Ltd", Court of Appeal

C5642.D
- 25 - G 0002/10

(England and Wales), [2009] EWCA Civ 252, point 82. et


seq. of the Reasons, with reference to T 1139/00;
"Mundipharma Pharmaceuticals B.V. v. Sandoz B.V.",
District Court of The Hague of 7 April 2010, case no.
340373/09-2029, point 4.11 et seq. of the Reasons).
This has been made particularly explicit in the above
cited decision of the District Court of the Hague, in
which the Court sets out in a very comprehensive and
convincing reasoning, which is analogous to the
Enlarged Board's reasoning in the present decision, why
it comes to the conclusion that decision G 1/03 only
relates to the situations in which "neither for the
disclaimer nor for the subject-matter of the disclaimer
(i.e. that which is excluded) a basis can be found in
the original application" (loc.cit., translation into
English on file).

3.9 To conclude, it cannot be said that answer 2 of


decision G 1/03 relates to the disclaiming of subject-
matter disclosed as part of the invention in the
application as filed.

4. Does an amendment to a claim by the introduction of a


disclaimer disclaiming subject-matter disclosed in the
application as filed infringe Article 123(2) EPC?

4.1 The scope of the referred question

In point 15. of the Reasons of the referring decision


the referring Board defines the purpose of the referral
as being to clarify the controversial issue of whether
the conditions set out in decision G 1/03 apply to the
disclaiming of disclosed subject-matter or whether the
relevant test should be whether the subject-matter

C5642.D
- 26 - G 0002/10

remaining in the claim after the introduction of the


disclaimer is disclosed in the application as filed
(see also point 1. above). It is clear, however, that
when considering and deciding the referred question,
which has been drafted in a broader manner, the
Enlarged Board cannot in any way be confined to
deciding only on these two opposed alternative
interpretations adopted by the boards of appeal. On the
contrary, even though the Enlarged Board will consider
what has been said on the matter in prior decisions, it
is the Enlarged Board's role to define of its own
motion the criteria determining when disclaiming
disclosed subject-matter must be considered to infringe
Article 123(2) EPC.

4.2 The text of Article 123(2) EPC

Article 123(2) EPC reads:

"(2) The European patent application or European patent


may not be amended in such a way that it contains
subject-matter which extends beyond the content of the
application as filed."

4.3 The basic principle underlying Article 123(2) EPC, in


the jurisprudence of the Enlarged Board

The importance and the applicability, without


exception, of Article 123(2) EPC was underlined in the
jurisprudence of the Enlarged Board of Appeal as early
as in its opinion G 3/89 and decision G 11/91 (OJ EPO
1993, 117 and 125, relating to amendments by way of
correction). From these rulings it follows that any
amendment to the parts of a European patent application

C5642.D
- 27 - G 0002/10

or of a European patent relating to the disclosure (the


description, claims and drawings) is subject to the
mandatory prohibition on extension laid down in
Article 123(2) EPC and can therefore, irrespective of
the context of the amendment made, only be made within
the limits of what a skilled person would derive
directly and unambiguously, using common general
knowledge, and seen objectively and relative to the
date of filing, from the whole of these documents as
filed, points 1., 1.3 and 3. of the Reasons.

These findings were in principle confirmed in decision


G 1/93 (OJ EPO 1994, 541, answer 1, first sentence)
with respect to the ground of opposition under
Article 100(c) EPC and, on a more general level, in
decision G 2/98 (OJ EPO 2001, 413), dealing with the
requirement of the "same invention" under Article 87(1)
EPC. In that decision the Enlarged Board also relied on
a disclosure test for determining whether the later
application is for the same invention as the priority
application and made explicit reference to the
disclosure test applied under Article 123(2) EPC
(answer, see also point 1. and 9. of the Reasons).

In decision G 1/93, concerned with the relationship


between paragraphs 2 and 3 of Article 123 EPC in the
situation of the patentee being caught in a so-called
"inescapable trap", the Enlarged Board stated with
respect to the argument advanced of there being a
mutual relationship between paragraphs 2 and 3 of
Article 123 EPC, the one to be applied as primary and
the other as subsidiary depending on the facts of the
individual case:

C5642.D
- 28 - G 0002/10

"This interpretation is not in line with the mandatory


character of Article 123(2) EPC, as explained by the
Enlarged Board in its opinion in case G 3/89 (OJ EPO
1993, 117)" (point 13. of the Reasons).

In decision G 1/93 the Enlarged Board however conceded


that, where an undisclosed limiting feature - without
providing a technical contribution to the subject-
matter of the claimed invention - merely excludes
protection for part of the subject-matter of the
claimed invention as covered by the application as
filed, the adding of such a feature cannot reasonably
be considered to give any unwarranted advantage to the
applicant and is, on a proper interpretation of
Article 123(2) EPC, therefore not to be considered as
subject-matter extending beyond the content of the
application as filed within the meaning of that
provision (point 16. of the Reasons).

It is, however, evident from the context of these


findings that by introducing the "technical
contribution" criterion the Enlarged Board did not
intend to amend the definition concerning when an
amendment is allowable under Article 123(2) EPC
generally, but that it only sought a way of avoiding
the potentially fatal consequences of the patentee
being caught in the "inescapable trap" between the
requirements of paragraphs (2) and (3) of Article 123
EPC (see point 13. of the Reasons).

Although the general principle expressed in that


decision, namely that the purpose of Article 123(2) EPC
is to avoid the applicant obtaining an unwarranted
advantage by means of an amendment, is often cited and

C5642.D
- 29 - G 0002/10

has also been relied on in later decisions of the


Enlarged Board as being the purpose underlying
Article 123(2) EPC, such later decisions have also made
clear that the issue in question in decision G 1/93
related to the conflicting requirements of
Article 123(2) and (3) EPC and "hence, dealt with a
completely different legal situation". This is how the
Enlarged Board put it in its decision G 2/98, point 10.
of the Reasons, in which decision the disclosure test
of G 3/89 was applied to the concept of the same
invention.

Decision G 1/03, in point 2., penultimate paragraph of


the Reasons, also starts from the premise that decision
G 1/93 was concerned with the relationship between
paragraphs (2) and (3) of Article 123 EPC. After having
addressed the conflict identified in decision T 323/97
between decisions G 1/93 and G 2/98 with respect to the
question of whether it matters that an added feature
provides a technical contribution to the claimed
subject-matter, the Enlarged Board refrains from taking
any position but ends by saying: "The question answered
in T 323/97 in the negative is examined below in
relation to the different situations arising in the
present proceedings" (point 2. of the Reasons, last
para.).

It can thus be stated that neither decision G 1/93 nor


decision G 1/03 intended to modify the general
definition of the requirements of Article 123(2) EPC
established in opinion G 3/89 and decision G 11/91,
which definition has become the generally accepted, one
could also say the "gold" standard, for assessing any
amendment for its compliance with Article 123(2) EPC.

C5642.D
- 30 - G 0002/10

Therefore that definition also applies to the kind of


cases underlying the present referral.

4.4 Is it to be derived from G 1/03 that the introduction


of a disclaimer disclaiming disclosed subject-matter
cannot a priori modify the subject-matter remaining in
the claim and that it is therefore always allowable?

Certain passages in this decision could be and indeed


have been interpreted as expressing the Enlarged
Board's position that introducing a disclaimer could a
priori not change the technical information in the
application and therefore not modify the subject-matter
remaining in the claim.

4.4.1 The decision

In point 2.1.3 of the Reasons the Enlarged Board states


after a detailed discussion of the legal history of
Article 54(3) EPC (whole contents vs. prior claim
approach) with respect to the question of a potential
change of the content of technical information in the
application by the introduction of a disclaimer:

"For the interpretation of Article 123(2) EPC, it may


be concluded from the foregoing (point 2.1.1) that the
purpose of a disclaimer excluding a conflicting
application is merely to take account of the fact that
different applicants are entitled to patents in respect
of different aspects of inventive subject-matter and
not to change the given technical teaching. The
disclaimer splits the invention as a whole in two
parts: ...

C5642.D
- 31 - G 0002/10

Such a disclaimer, only excluding subject-matter for


legal reasons, is required to give effect to
Article 54(3) EPC and has no bearing on the technical
information in the application. It is, therefore, not
in contradiction to Article 123(2) EPC. ... An
invention comprising different specific embodiments or
groups thereof has been disclosed in the application as
filed, a part of which is excluded from the requested
protection, i.e. no longer claimed. The remaining
subject-matter is not modified by the disclaimer. ..."

In point 2.2.1 of the Reasons the Enlarged Board then


states:

"The concept of accidental anticipation is akin to the


situation of conflicting applications already
discussed, starting from the premise that only novelty
is at stake. In the case of an accidental anticipation,
the exclusion of the unrelated state of the art is
likewise not intended to contribute to the inventive
merit of the technical teaching given."

4.4.2 Meaning of that jurisprudence

In order to assess correctly the statements cited in


the foregoing, the context in which they were made as
well as some further findings in this decision must be
considered.

The context is first that in a preceding passage,


in point 2., second paragraph of the Reasons, the
Enlarged Board had already dealt with and refuted the
argument that a disclaimer is a mere voluntary
restriction by which the applicant abandons part of the

C5642.D
- 32 - G 0002/10

claimed subject-matter and that, therefore, the


disclaimer per se is not a technical feature of the
claim, cannot violate Article 123(2) EPC and should
always be allowed. The Enlarged Board replied by
stating that any amendment to a claim is presumed to
have a technical meaning, otherwise it would be useless
to have it in the claim. Hence, it appears that the
proposition that disclaiming subject-matter could per
se not change the content of technical information in
the application and could therefore per se not violate
Article 123(2) EPC, was not endorsed by the Enlarged
Board of Appeal.

As a consequence, it appears that the purpose of the


example given in point 2.1.3 of the Reasons of an
invention comprising different specific embodiments or
groups thereof disclosed in the application as filed, a
part of which is excluded from the requested
protection, must be understood as giving a typical
example in which the disclaimer does not normally
change the teaching of the subject-matter remaining in
the claim and does not normally add information. It
cannot be read as meaning that the Enlarged Board
wished to establish the principle that an amendment to
a claim by the introduction of a disclaimer disclaiming
a disclosed embodiment could per se not modify the
subject-matter remaining in the claim and could
therefore never violate Article 123(2) EPC.

This is corroborated by the Enlarged Board's findings


in points 2.6.2 and 2.6.5 of the Reasons. In
point 2.6.2 the Enlarged Board speaks of "the principle
that an undisclosed limitation has to be a mere
disclaimer in the above sense" to be allowable. What is

C5642.D
- 33 - G 0002/10

meant thereby is then further explained in point 2.6.5


of the Reasons, in which the Enlarged Board states:

"2.6.5 It results from the foregoing that a disclaimer


may serve exclusively the purpose for which it is
intended and nothing more. In the case of a disclaimer
concerning conflicting applications, its purpose is to
establish novelty with respect to a prior application
in the sense of Article 54(3) EPC. In the case of a
disclaimer concerning state of the art under
Article 54(2) EPC, its purpose is to establish novelty
vis-à-vis an accidental anticipation as defined in this
decision. Finally, a disclaimer excluding subject-
matter not eligible for patent protection may only
serve the purpose of removing such specific legal
obstacle. If a disclaimer has effects which go beyond
its purpose as stated above, it is or becomes
inadmissible."

It is true that these findings, in particular the last-


cited sentence, are only embedded in the reasons for
the decision and have not found their direct entrance
into answer 2 in the order, setting out the criteria to
be applied for assessing the allowability of an
undisclosed disclaimer. That does not mean, however,
that the above-cited findings were not made
purposefully and need not be taken as meaning what is
stated therein. The gist of the questions referred to
the Enlarged Board in cases G 1/03 and G 2/03, on which
the Enlarged Board had to give an answer, was to
establish whether and, if so, under which circumstances
undisclosed disclaimers could be considered allowable
at all, as a matter of principle, despite the absence
of a basis in the application as filed. It is this

C5642.D
- 34 - G 0002/10

question and no more the Enlarged Board has answered in


answer 2. The wording the Enlarged Board chose in the
starting line of answer 2, reading "a disclaimer may be
allowable" indicates that with the criteria set up in
answer 2 the Enlarged Board did indeed not intend to
give a complete definition of when a disclaimer
violates Article 123(2) EPC and when it does not.

It is in this sense that the teaching of decision


G 1/03 has also been interpreted first in decision
T 1139/00 of 10 February 2005 and then in the above-
cited national decisions, also with respect to
disclaimers for disclosed subject-matter.

In decision T 1139/00, the Board, after having stated


in point 2.5 of the Reasons that the subject-matter
excluded by the disclaimer in question is supported by
the application as filed, gives an extensive technical
reasoning in points 3. and 4. (bearing the heading
"Article 123(2) EPC") of the Reasons as to why the
introduction of the disclaimer only limits the scope of
protection "without providing any technical
contribution to the invention as claimed" (point 3.1 of
the Reasons), and why it only "leaves a more limited
group" (point 4.1 of the Reasons, at the end). Thus,
the Board did not consider Article 123(2) EPC as being
automatically fulfilled as a consequence of the
limitation having been performed by a disclaimer for
disclosed subject-matter.

In the decision handed down by the Court of Appeal of


England and Wales cited above Jacob LJ states in
point 82. of the Reasons, making reference to decision
T 1139/00:

C5642.D
- 35 - G 0002/10

"G 1/03 does not set up any further or more extensive


rule than the basic rule that an undisclosed disclaimer
is permissible as not adding matter provided it is a
"mere disclaimer"."
In point 83. of the Reasons he then goes on, again with
reference to decision T 1139/00: "So this TBA has held
that G 1/03 is confined to novelty restoring or
exclusion of unpatentable subject-matter disclaimers.
It went on, rightly in our view, to address the real
question: was there added subject-matter?"
And, in point 85. of the Reasons, by referring to the
appealed decision: "Floyd J was entirely right when he
said: [122] Nevertheless, the test for added subject
matter remains that set out in the Convention and the
Act...."

In the decision of the District Court of the Hague the


Court also expressly endorses the finding in decision
T 1139/00 that "the allowability of a "disclosed"
disclaimer must be tested against Article 123 paragraph
2 of the EPC" and that it is "conceivable that the
technical teaching of the patent changes if subject
matter is excluded, which subject matter had initially
been included in positive terms..." (points 4.14 and
4.15 of the Reasons).

4.5 The criteria to be applied

4.5.1 The disclosure test

It is thus in accordance with the above-cited


jurisprudence of the Enlarged Board and the national
decisions that the principle that any amendment to an
application or a patent, and in particular to a claim,

C5642.D
- 36 - G 0002/10

must fulfil the requirements of Article 123(2) EPC also


applies to an amendment limiting the claim by
disclaiming disclosed subject-matter.

Therefore, as is the case for any other amendment, the


test for an amendment to a claim by disclaiming
subject-matter disclosed as part of the invention in
the application as filed must be that after the
amendment the skilled person may not be presented with
new technical information. Hence, disclaiming subject-
matter disclosed in the application as filed can also
infringe Article 123(2) EPC if it results in the
skilled person being presented with technical
information which he would not derive directly and
unambiguously, using common general knowledge, from the
application as filed.

4.5.2 How is the original disclosure of the claimed subject-


matter to be determined with respect to a claim amended
by the introduction of a disclaimer?

The critical question is how the original disclosure of


the claimed subject-matter is to be determined in the
case of the introduction into a claim of a disclaimer
disclaiming disclosed subject-matter. If a positive
feature, which defines subject-matter that is actually
claimed, is introduced into a claim, it can be examined
whether the subject-matter of that feature was
disclosed in the application as filed. With respect to
the new combination of features which is claimed after
the introduction of that feature, it can be examined
whether that combination was disclosed in the
application as filed.

C5642.D
- 37 - G 0002/10

By contrast, the technical subject-matter defined in


the disclaimer does not make the disclaimed subject-
matter as such a part of the definition of the claimed
invention. A disclaimer does not as such define a
feature of the claimed invention. It is just the
opposite. It defines something that is not claimed.
Hence, when it comes to determining whether, after the
introduction of the disclaimer, the claim infringes
Article 123(2) EPC or whether it is in conformity with
it, this cannot be decided solely by establishing that
the disclaimed subject-matter is disclosed in the
application as filed.

Whether the skilled person is presented with new


information depends on how he or she would understand
the amended claim, i.e. the subject-matter remaining in
the amended claim and on whether, using common general
knowledge, he or she would regard that subject-matter
as at least implicitly disclosed in the application as
filed.

That statement corresponds to the definition given in


Article 123(2) EPC. Transposed to the presently
discussed issue of an amendment to a claim,
Article 123(2) EPC would read:

"The claim may not be amended in such a way that it


contains subject-matter which extends beyond the
content of the application as filed."

Hence, it follows from the wording of Article 123(2)


EPC itself that the point of reference for assessing an
amended claim for its compatibility with Article 123(2)
EPC is the subject-matter which the claim contains

C5642.D
- 38 - G 0002/10

after the amendment. In other words, it is the subject-


matter remaining in the claim after the amendment.

4.5.3 Rules of logic

Whether that subject-matter was originally disclosed or


not cannot be decided by following so-called rules of
logic, in the sense that if an application discloses a
general teaching and specific embodiments, groups
thereof or areas, then all other potential embodiments,
groups thereof or areas falling within the ambit of the
general teaching (but not as such disclosed in the
application as filed) would thereby, by implication,
inevitably also be disclosed. In this context it was
also submitted that the disclosure of an embodiment or
smaller region (B) within a broader region (A),
likewise disclosed, would thereby logically and
inevitably disclose the subject-matter of the broader
region minus the embodiment (A-B) and that a claim
containing such a disclaimer would for that reason not
contain subject-matter offending against Article 123(2)
EPC.

Even if it may be said that there is not normally a


problem with the original disclosure for the remaining
subject-matter when originally disclosed specific
embodiments, groups thereof or areas are disclaimed
from the scope of a more general claim reflecting a
more general teaching which has equally been disclosed,
the question can nevertheless not be decided
schematically. In particular, no principle can be
acknowledged, which would be applicable a priori¸ to
the effect that disclaiming disclosed specific
embodiments, groups thereof or areas from a broader

C5642.D
- 39 - G 0002/10

claim can never infringe Article 123(2) EPC. Also, no


so-called rule of logic applies, in the sense that
where an application discloses a general teaching and
specific embodiments, groups thereof or areas, all
other potential embodiments or intermediate
generalisations falling within the ambit of the general
teaching (but not as such disclosed in the application
as filed) would thereby, by implication, inevitably
also be disclosed. On the other hand, any schematic
reasoning solely suggesting that the introduction of
the disclaimer modifies the subject-matter remaining in
the claim because that amended claim contains less than
the unamended claim, would also not be sufficient to
motivate an objection under Article 123(2) EPC.

4.5.4 Need for technical assessment of the case under


consideration

Instead, what is required is an assessment of the


overall technical circumstances of the individual case
under consideration, taking into account the nature and
extent of the disclosure in the application as filed,
the nature and extent of the disclaimed subject-matter
and its relationship with the subject-matter remaining
in the claim after the amendment.

The test to be applied is whether the skilled person


would, using common general knowledge, regard the
remaining claimed subject-matter as explicitly or
implicitly, but directly and unambiguously, disclosed
in the application as filed.

This test is the same as that applied when the


allowability of a limitation of a claim by a positively

C5642.D
- 40 - G 0002/10

defined feature is to be determined. In this respect a


whole body of jurisprudence exists, in particular with
respect to cases in which the limitation could lead to
the singling out of compounds or sub-classes of
compounds or other so-called intermediate
generalisations not specifically mentioned nor
implicitly disclosed in the application as filed (see
Case Law of the Boards of Appeal of the European Patent
Office, sixth edition, July 2010, III.A.1. and 2.). The
principles of that jurisprudence can and must be
applied in the same manner to amendments of claims by
disclaiming disclosed specific embodiments, groups
thereof or areas as they apply to limitations performed
by positively defined features.

Where, for instance, as was said in decision G 1/03


(point 2.1.3 of the Reasons), in the application as
filed an invention has been disclosed and claimed in
general terms and different specific embodiments or
groups thereof have also been disclosed, and one of
these is later excluded from the requested protection
by the disclaimer, the remaining subject-matter, i.e.
the remaining general teaching, will normally not be
modified by the disclaimer. This contrasts with the
situation in which, for instance, the disclaimer would
have the effect of confining the subject-matter
remaining in the claim to a subgroup of the originally
claimed subject-matter, which subgroup could not be
regarded as disclosed in the application as filed, even
taking into account what the skilled person, using
common general knowledge, would regard as implicit in
the contents of the application as filed. In this case
the amendment would contravene Article 123(2) EPC. By
analogy with decision T 615/95, there would be added

C5642.D
- 41 - G 0002/10

matter where the insertion of a disclaimer into a claim


would result in singling out any hitherto not
specifically mentioned or at least implicitly disclosed
individual compound or group of compounds, or would
lead to a particular meaning of the remaining claimed
subject-matter which was not originally disclosed.

4.5.5 The relevance of the fact that the disclaimed subject-


matter is disclosed as part of the invention

Decision T 1102/00 and other decisions following the


same approach have put forward as a reason for not
allowing the disclaiming of subject-matter disclosed in
the application as filed that that subject-matter was
not presented in the application as filed as subject-
matter to be excluded from protection, but on the
contrary as part of the invention. That line of
reasoning does not hold good.

It is in principle for the applicant to determine the


scope of protection he desires by the manner in which
he drafts his claims. There is no provision in the EPC
which would oblige an applicant to seek, in the
individual application under consideration, a
protection corresponding to the broadest possibility
offered by the disclosure of the application. Nor is
there an obligation to draft claims in such a way as to
include the preferred embodiment in their scope. To
amend a claim in a way excluding disclosed subject-
matter from it, in particular when by disclaiming a
preferred embodiment, is at the applicant's risk
because it is clear that when it comes to determining
whether the amended claim fulfils the remaining
requirements of the EPC, such as support by the

C5642.D
- 42 - G 0002/10

description (Article 84 EPC), sufficiency of disclosure


(Article 83 EPC) and inventive step (Article 56 EPC),
the disclaimed subject-matter cannot be taken into
account. In respect of inventive step the questions as
to whether the problem has been solved over the whole
breadth of the claim or whether an advantageous effect
obtained by the remaining claimed subject-matter can be
deduced from the application as filed may in particular
become relevant.

With this proviso, i.e. subject to the claimed subject-


matter fulfilling the requirements of the EPC, the
applicant is free, i.e. he is entitled, not to claim
protection for an embodiment or even a part of the
disclosed invention. The applicant may, for example, be
interested in obtaining a first quicker protection for
a preferred embodiment and pursue the general teaching
in a divisional application. Whether or not and, if so,
under what circumstances, in such a case a disclaimer
would be necessary in order to avoid the so-called
prohibition on double protection is a different matter.
It is sufficient to say that such procedural behaviour
is not abusive and even legitimate. The amici curiae
also mentioned other possible reasons not related to
the requirements for patentability for splitting an
application up into different applications for
different embodiments, for instance for licensing
purposes.

Taking it to the extreme, if the idea were correct that


a disclosed embodiment of the invention could not be
disclaimed because it was presented in the application
as part of the invention, then as a result no limiting
amendment of a claim would be possible at all, since

C5642.D
- 43 - G 0002/10

even in the case of a limitation by positively defined


features the situation is that through this limitation
something is excluded from the claim which was
previously presented as being part of the invention. If
by contrast, an embodiment is presented in the
application as filed as not being part of the
invention, but e.g. as belonging to the state of the
art or as a comparative example, then it cannot be
claimed at all.

To conclude, no convincing reason has been advanced for


not applying the principles developed in the context of
Article 123(2) EPC for the assessment of amendments to
claims by the introduction of positive limiting
features in the same manner to limitations of claims by
disclaimers which disclaim subject-matter disclosed in
the application as filed.

4.6 Coherence of the approach with other issues relating to


disclosure

Such an approach does not distort, but rather


preserves, the structural relationship established in
the EPC, based on the first-to-file system, between the
provisions defining the state of the art and their
impact on patentability, the substantive requirements
for validly claiming a priority (concept of same
invention) or for the filing of divisional applications
and for the right to amend the application. It is vital
that a uniform concept of disclosure is applied in all
these respects and that the rights of an applicant are
uniformly determined in all these contexts as extending
to but at the same time as being limited to the
disclosure made at the relevant point in time. This was

C5642.D
- 44 - G 0002/10

emphasised in decision G 2/98, in which, in the context


of determining the right to priority derivable from an
application, the Enlarged Board endorsed a narrow or
strict interpretation of the concept of "the same
invention", limiting the right to priority to subject-
matter which the person skilled in the art can derive
directly and unambiguously, using common general
knowledge, from the previous application as a whole
(point 9. of the Reasons). In that decision the
Enlarged Board also emphasised that any concept other
than making the entitlement to priority dependent on
the disclosure of the priority document could undermine
patent protection for selection inventions, and held:
"Hence, such priority claims should not be acknowledged
if the selection inventions in question are considered
"novel" according to these criteria" (point 8.4 of the
Reasons). The same must apply to any amendment of an
application under Article 123(2) EPC. It may not create
novel subject-matter.

The importance of applying a uniform concept of


disclosure was again confirmed in decision G 1/03
(point 2.2.2 of the Reasons), where the Enlarged Board
emphasised that "the European Patent System must be
consistent and the concept of disclosure must be the
same for the purposes of Articles 54, 87 and 123 EPC".

Accordingly, it appears that the approach, as adopted


here with regard to the requirements to be met in order
for amendments by the introduction of disclaimers for
disclosed subject-matter to be allowable under
Article 123(2) EPC does not lead to an unjustified
result as compared with any of the above mentioned
matters.

C5642.D
- 45 - G 0002/10

Nor does this approach impair an applicant's right


under Article 76(1) EPC to divide the application and
split its subject-matter up into different
applications, since according to Article 76(1), second
sentence, EPC that right is in any case limited to the
subject-matter which can be regarded as being disclosed
in the earlier (the parent) application as filed (the
"root" application in case of a sequence of divisional
applications, see decisions G 1/05 and G 1/06, OJ EPO
2008, 271 and 307). Therefore, if the subject-matter of
a claim in a divisional application, in which an
embodiment disclosed in the parent application is
disclaimed, cannot be regarded as at least implicitly
disclosed in the parent (or root application in the
case of a sequence of divisional applications), because
the disclaimer has the effect of confining the subject-
matter remaining claimed in the divisional application
to something which can not be regarded as disclosed in
the parent or root (as the case may be) application as
filed, then there is no right to file a divisional
application in respect of that subject-matter.

The same considerations govern the entitlement to the


priority of an earlier application claimed in a later
application in which a disclaimer is introduced
disclaiming subject-matter disclosed in the priority
application.

Finally, the same also applies under Article 61(1)(b)


EPC if the entitled person files a new application and
the original application must be confined to the
subject-matter to which the original applicant remains
entitled. As with any amendment, such an amendment is

C5642.D
- 46 - G 0002/10

also subject to the requirements of Article 123(2) EPC.


This means that where a limitation of the original
application is made by introducing a disclaimer, this
is only allowable to the extent that the subject-matter
remaining in the claim after such limitation can be
regarded as disclosed in the application as filed.

4.7 The President's suggestion

The President has suggested in footnote 28 to his


submissions that where the subject-matter remaining in
the claim is not directly and unambiguously derivable
from the application as filed, the criteria established
in decision G 1/03 should be applied regarding the
allowability of the disclaimer.

The Enlarged Board fails to see any justification for


adopting such an approach. As can be derived from the
Enlarged Board's position developed in the foregoing,
in accordance with the principles developed in the
above cited earlier rulings of the Enlarged Board, the
overriding principle for any amendment to be allowable
under Article 123(2) EPC is that the subject-matter of
an amended claim must be at least implicitly disclosed
to the skilled person, using common general knowledge,
in the application as filed. As has also been set out
in the foregoing that applies equally to the subject-
matter of a claim the scope of which is determined by a
disclaimer. Where this requirement is not fulfilled in
the individual case under consideration because the
effect of the disclaimer is to limit the claim to
subject-matter, such as a subgroup, an intermediate
generalisation or else, which cannot be regarded as
disclosed in the application as filed, then there is no

C5642.D
- 47 - G 0002/10

justification for granting a patent on such a claim. As


has also been set out previously, any other view would
undermine the legal system of the EPC based on the
first-to-file principle and in particular the
patentability of selection inventions.

In the oral proceedings before the Enlarged Board the


representative of the President explained why the
additional application of the criteria established in
answer 2 of decision G 1/03 to the allowability of a
disclaimer for disclosed subject-matter not having
passed the remaining subject-matter test under
Article 123(2) EPC had been suggested. This was because
otherwise, in the case of a state of the art according
to Article 54(3) EPC, an applicant disclaiming
disclosed subject-matter could be in a worse position
than an applicant disclaiming subject-matter for which
there was no disclosure in his application. This was so
since according to decision G 1/03 in the latter case
the applicant did not have to show that the subject-
matter remaining in the claim after the introduction of
the disclaimer was also disclosed as such in the
application as filed.

The Enlarged Board does not hold this discrepancy to


exist. It does not interpret decision G 1/03 to have
intended, in its answer 2, to exhaustively determine
the conditions under which, if fulfilled, an amendment
by introduction of an undisclosed disclaimer was to be
regarded as allowable under Article 123(2) EPC under
all circumstances. As has already been set out in
point 4.4.2 above, the gist of the questions referred
to the Enlarged Board in cases G 1/03 and G 2/03, to
which the Enlarged Board had to give an answer, was to

C5642.D
- 48 - G 0002/10

establish whether and, if so, under which circumstances


undisclosed disclaimers could be considered allowable
at all, as a matter of principle, despite the absence
of a basis in the application as filed. It is this
question and no more the Enlarged Board has answered in
answer 2. The wording the Enlarged Board chose in the
starting line of answer 2, reading "a disclaimer may be
allowable", indicates that with the criteria set up in
answer 2 the Enlarged Board did indeed not intend to
give a complete definition of when an undisclosed
disclaimer violates Article 123(2) EPC and when it does
not.

Hence, in that decision it was not decided that, the


requirements of answer 2 being fulfilled, an
undisclosed disclaimer would be always allowable under
Article 123(2) EPC.

C5642.D
- 49 - G 0002/10

Order

For these reasons it is decided that:

The question referred to the Enlarged Board of Appeal is


answered as follows:

1a. An amendment to a claim by the introduction of a


disclaimer disclaiming from it subject-matter disclosed in the
application as filed infringes Article 123(2) EPC if the
subject-matter remaining in the claim after the introduction
of the disclaimer is not, be it explicitly or implicitly,
directly and unambiguously disclosed to the skilled person
using common general knowledge, in the application as filed.

1b. Determining whether or not that is the case requires a


technical assessment of the overall technical circumstances of
the individual case under consideration, taking into account
the nature and extent of the disclosure in the application as
filed, the nature and extent of the disclaimed subject-matter
and its relationship with the subject-matter remaining in the
claim after the amendment.

The Registrar: The Chairman:

W. Roepstorff P. Messerli

C5642.D

You might also like