Original Paper

Med Princ Pract 2020;29:61–68 Received: December 20, 2018

Accepted: June 30, 2019
DOI: 10.1159/000501788 Published online: July 1, 2019

Antimicrobial Resistance Patterns in Methicillin-

Resistant Staphylococcus aureus from Patients
Hospitalized during 2015–2017 in Hospitals in
Poland

Downloaded from http://karger.com/mpp/article-pdf/29/1/61/3128021/000501788.pdf by guest on 28 December 2023

Barbara Kot a Kamila Wierzchowska a Małgorzata Piechota a
Agata Grużewska b
a Department of Microbiology, Faculty of Natural Sciences, Siedlce University of Natural Sciences and Humanities,
Siedlce, Poland; b Department of Agricultural Experimentation, Faculty of Natural Sciences, Siedlce University of
Natural Sciences and Humanities, Siedlce, Poland

Significance of the Study

• In the hospital environment, MRSA isolates can quickly acquire new antimicrobial resistance deter-
minants.
• These results are significant for the empirical use of antibiotics and effective treatment of infections
caused by MDR MRSA.

Keywords used to determine spa gene polymorphism in X-region. Re-

Antibiotic resistance · Methicillin-resistant Staphylococcus sults: A large number of MRSA isolates showed resistance to
aureus · Multidrug-resistant Staphylococcus aureus · Spa levofloxacin (83.9%), ciprofloxacin (83%), erythromycin
types (77.7%) and clindamycin (72.3%). A lower number of MRSA
isolates showed resistance to tetracycline (10.7%), amikacin
(14.2%), gentamicin and trimethoprim with sulfamethoxa-
Abstract zole (8.0%). None of the MRSA isolates were resistant to line-
Objective: The aim of this study was to determine antimicro- zolid and teicoplanin. Among MRSA isolates, 92.9% were
bial resistance profiles of methicillin-resistant Staphylococ- multidrug-resistant (MDR). Resistance to erythromycin,
cus aureus (MRSA) isolates from clinical samples from clindamycin, ciprofloxacin and levofloxacin was the most
patients hospitalized during 2015–2017 in hospitals of common resistance pattern among MDR MRSA isolates. The
­Masovian district in Poland. Materials and Methods: Antimi- highest number of isolates was resistant to 4 groups of anti-
crobial resistance of 112 MRSA isolates was tested with a disc microbials (53.8%). The number of drugs to which MRSA iso-
diffusion method. Isolates were examined for methicillin re- lates were resistant in 2017 was significantly higher than that
sistance using a 30 µg cefoxitin disk. Resistance was con- in 2016 (p = 0.002). The size polymorphism analysis of X frag-
firmed by PCR detection of the mecA gene. PCR was also ment of the spa gene revealed high genetic diversity of the

© 2019 The Author(s) Barbara Kot

Published by S. Karger AG, Basel Department of Microbiology, Faculty of Natural Sciences
Siedlce University of Natural Sciences and Humanities
E-Mail [email protected] This is an Open Access article licensed under the Creative Commons
Attribution-NonCommercial-4.0 International License (CC BY-NC) 14 Bolesława Prusa Str., PL–08-110 Siedlce (Poland)
www.karger.com/mpp E-Mail barbara.kot @ uph.edu.pl
(http://www.karger.com/Services/OpenAccessLicense), applicable to
the online version of the article only. Usage and distribution for com-
mercial purposes requires written permission.
investigated group MRSA isolates. Conclusion: This study mine antimicrobial resistance profiles of MRSA isolates
demonstrates that in the hospital environment, MRSA iso- from different clinical materials from patients hospital-
lates can quickly acquire new antimicrobial resistance deter- ized during 2015–2017 in hospitals of Masovian district
minants and that knowledge of current resistance patterns in Poland.
is important for the effective treatment of infections caused
by MDR MRSA. © 2019 The Author(s)
Published by S. Karger AG, Basel Materials and Methods

MRSA Isolates
A total of 112 MRSA isolates from clinical materials from swabs
Introduction from wounds (22), anus (14) and samples of blood (11), bron-
choalveolar washings (26), respiratory tract (19), urine (4), pus (3),
Staphylococcus aureus is the most common cause of sputum (3) and from other samples (swabs from nose, throat, tra-
cheotomy tube, endotracheal tube and catheter; 10) were studied.
nosocomial infections and is one of the most common The MRSA isolates were obtained from hospitals in Siedlce and
causes of bacteremia and is a bacterial pathogen that rap- Warsaw (Poland) in 2015–2017. The MRSA isolates were collected
idly acquires antibiotic resistance [1]. Microbial infec- in these hospitals as part of routine diagnostic microbiology and

Downloaded from http://karger.com/mpp/article-pdf/29/1/61/3128021/000501788.pdf by guest on 28 December 2023

tions with antimicrobial resistant strains increased the came from different patients. The numbers of MRSA isolates ob-
risk of mortality and increased costs related to treatment tained in 2015, 2016 and 2017 were 18, 23 and 71, respectively.
Identification of isolates as S. aureus was confirmed by Gram’s
compared to infections caused by susceptible strains [2]. staining, positive test for catalase activity and tube test for coagu-
Antimicrobial resistance in methicillin-resistant strains lase. The PCR analysis to amplify the part of the nuc gene, encoding
of S. aureus (MRSA) is associated with the acquisition of thermostable nuclease specific for S. aureus was used to confirm
a mobile genetic element called the staphylococcal cas- that the isolates belong to the S. aureus species [10].
sette chromosome mec, which carries the mecA gene, en-
Antibiotic Susceptibility Testing
coding the low-affinity penicillin-binding protein 2a and All staphylococcal isolates were examined for methicillin resis-
confers resistance to the β-lactam antibiotics [3]. A new tance by disc diffusion assay. Resistance to methicillin was con-
mec variant, named mecC, which shows only 70% nucleo- firmed by PCR to detect the mecA gene [11]. The susceptibility of
tide sequence homology with the classical mecA gene was the isolates was tested with a disc diffusion method [12] using the
described in 2011 and from this time, MRSA strains con- following antibiotic discs (Oxoid, Basingstoke, UK): penicillin (10
U), teicoplanin (30 µg), gentamicin (10 µg), amikacin (30 µg),
taining mecC have been sporadically isolated from both erythromycin (15 µg), tetracycline (30 µg), ciprofloxacin (5 µg),
humans and animals. Resistance to cefoxitin was report- levofloxacin (5 µg), clindamycin (2 µg), trimethoprim/sulfa-
ed as correctly identifying mecC-positive MRSA [4]. methoxazole (1.25/23.75 µg) and linezolid (30 µg). S. aureus ATCC
MRSA, besides resistance to β-lactam antibiotics, are fre- 29213 and S. aureus ATCC 25923 were used as control strains.
quently resistant to other antimicrobial agents such as
Isolation of DNA
macrolides, tetracycline, aminoglycosides, chloramphen- Genomic DNA was isolated from bacterial cells by using the
icol and fluoroquinolones may rapidly spread in hospital NucleoSpin Microbial DNA (Macherey-Nagel GmbH & Co. KG,
environment through infected or colonized patients, or Düren, Germany) according to the manufacturer’s protocol. 2.5 µL
colonized personnel [5]. MRSA are widespread in various of the total extracted material from each test sample was used as a
countries both in hospital environments and occur in template DNA for PCR application.
community, and livestock MRSA is endemic in hospitals Primers and PCR Conditions
worldwide [6, 7]. Infections caused by multidrug-resis- The primers specific for the nuc, mecA, blaZ [13], and spa [14]
tant (MDR) strains lead to prolonged hospital stay, in- synthesized by DNA-Gdańsk (Gdańsk, Poland) are listed in Table
creased mortality and have been routinely detected in 1. The monoplex PCR for each gene was performed in a 25 µL vol-
hospitalized patients including those in high-income ume containing 2.5 µL of DNA template, 1× PCR buffer, 0.2 mM
each dATP, dCTP, dGTP and dTTP (Fermentas, Vilnius, Lithua-
countries. These infections are estimated to affect nia), the specific primers at 150 nM, and 1 U of RedTag Genomic
>150,000 patients annually in the European Union [8]. DNA polymerase (Sigma Aldrich, Steinheim, Germany). The am-
MDR may infect different parts of the body including plifications of fragments specific for the nuc, blaZ and mecA genes
wounds, respiratory tract, soft tissue, skin and blood- were carried out in the following conditions: initial denaturation
stream particularly in immunocompromised, elderly or (94 ° C, 4 min), followed by 35 subsequent cycles consisting of de-
naturation (94 ° C, 30 s), primer annealing (55 ° C, 30 s), extension
young patients [9]. The rise of drug-resistant MRSA is a (72 ° C, 30 s), and final extension (72 ° C, 5 min). The highly poly-
serious problem in the treatment and control of staphy- morphic region X of the spa gene was amplified by PCR according
lococcal infections. The aim of this study was to deter- to Szweda et al. [15].

62 Med Princ Pract 2020;29:61–68 Kot/Wierzchowska/Piechota/Grużewska

DOI: 10.1159/000501788
 Table 1. Oligonucleotide primers used in the study

Primers Sequence (5’ → 3’) Amplicon length, bp References

nuc (F) GCGATAGATGGTGATACGGTT 270 [10]

nuc (R) AGCCAAGCCTTGACGAACTAAAGC
mecA (F) AAAATCGATGGTAAAGGTTGGC 533 [11]
mecA (R) AGTTCTGCAGTACCGGATTTGC
blaZ (F) AAGAGATTTGCCTATGCTTC 517 [13]
blaZ (R) GCTTGACCACTTTTATCAGC
spa (F) CAAGCACCAAAAGAGGAA 100–388 [14]
spa (R) CACCAGGTTTAACGACAT

Amplifications were carried out in the Eppendorf Mastercycler

nexus gradient (Hamburg, Germany). The PCR products were an- M 1 2 3 4

Downloaded from http://karger.com/mpp/article-pdf/29/1/61/3128021/000501788.pdf by guest on 28 December 2023

alysed by electrophoresis in 1.5% agarose gels stained with ethid-
ium bromide. Molecular size markers (Sigma-Aldrich) were also 500 bp
run for verification of product size. The gel was electrophoresed in nuc
250 bp (270 bp)
2× Tris-borate buffer at 70 V for 1.5 h. The PCR amplicons were
visualized using UV light (Syngen Imagine, Syngen Biotech,
Wrocław, Poland). a

Statistical Analysis M 1 2 3 4 5 6 7 8 9
One-factorial analysis of variance (ANOVA) was applied to
evaluate the relationship of the level of MDR with the clinical spec-
imens from which MRSA isolates were obtained. One-factorial 500 bp blaZ
ANOVA and post hoc Tukey’s test were used to evaluate signifi- (517 bp)
cance of differences between the number of drugs to which MRSA
isolates were resistant in 2015, 2016 and 2017. b

M 1 2 3 4
Results
mecA
The PCR product specific for the nuc gene, encoding 500 bp
(533 bp)
thermostable nuclease in S. aureus was detected in all iso-
lates (Fig. 1a). The isolates were resistant to penicillin and c
the blaZ gene encoding β-lactamase was present in these
isolates (Fig. 1b). All isolates were resistant to cefoxitin,
Fig. 1. Electrophoresis in 1.5% agarose gel PCR products obtained
and mecA gene was detected in all isolates (Fig. 1c). A by using specific primers for nuc (a), blaZ (b) and mecA gene (c).
large number of MRSA isolates showed resistance to Line M – molecular weight markers (GenoPlast Biochemicals, Po-
­fluoroquinolones: ciprofloxacin –83% and levofloxacin land), Lines: 1, 2, 3, 4 – products (270 bp) specific for nuc gene (a);
–83.9%, macrolides (erythromycin –77.7%) and lincos- 1, 2, 3, 4, 5, 6, 7, 8, 9 – products (517 bp) specific for blaZ gene (b);
amides (clindamycin –72.3%. The percentage of MRSA 1, 3, 4 – products (533 bp) specific for mecA gene (c).
isolates resistant to levofloxacin, ciprofloxacin, clindamy-
cin and erythromycin varied in the years 2015–2017, but
the highest percentage of isolates resistant to these anti-
biotics was found in 2017 (Table 2). A lower number of isolates were MDR. Out of 112 MRSA isolates, 104 (92.9%)
MRSA isolates showed resistance to tetracycline (10.7%), were MDR. Besides resistance to β-lactam antibiotics, re-
amikacin (14.2%), gentamicin (8.0%) and trimethoprim sistance to erythromycin, clindamycin, ciprofloxacin and
with sulfamethoxazole (8.0%). None of the MRSA isolates levofloxacin was the most common resistance pattern
was resistant to linezolid and teicoplanin (Table 2). The among MDR MRSA isolates (Table 3).
MRSA isolates were tested against 9 groups of antimicro- In all, 53.8% of the MDR MRSA isolates were resistant
bials, and resistance to at least 3 groups indicated that the to 4 groups of antimicrobials, and 25% showed resistance

Antimicrobial Resistance Patterns in Med Princ Pract 2020;29:61–68 63

MRSA DOI: 10.1159/000501788
Table 2. Antimicrobial resistance of MRSA isolated from patients hospitalized in 2015–2017

Antimicrobial Antimicrobial agent Resistant isolates in years, n (%)

category 2015 (n = 18) 2016 (n = 23) 2017 (n = 71) total (n = 112)

β-Lactams Penicillin 18 (100) 23 (100) 71 (100) 112 (100)

Aminoglycosides Amikacin 2 (11.1) 0 14 (19.7) 16 (14.2)
Gentamicin 3 (16.6) 0 6 (8.4) 9 (8.0)
Fluoroquinolones Levofloxacin 15 (83.3) 13 (56.5) 66 (92.9) 94 (83.9)
Ciprofloxacin 15 (83.3) 12 (52.2) 66 (92.9) 93 (83)
Lincosamides Clindamycin 8 (44.4) 16 (69.6) 57 (80.3) 81 (72.3)
Macrolides Erythromycin 13 (72.2) 16 (69.6) 58 (81.7) 87 (77.7)
Glycopeptides Teicoplanin 0 0 0 0
Tetracyclines Tetracycline 4 (22.2) 3 (13.0) 5 (7.0) 12 (10.7)
Oxazolidinones Linezolid 0 0 0 0
Other Trimethoprim/sulfamethoxazole 1 (5.5) 0 8 (11.3) 9 (8.0)

Downloaded from http://karger.com/mpp/article-pdf/29/1/61/3128021/000501788.pdf by guest on 28 December 2023

MRSA, methicillin-resistant Staphylococcus aureus.

to 3 groups of antimicrobials. Most of the isolates resistant ed isolates was between 4 and 14. The MRSA isolates with
to 3 groups of antimicrobials were resistant to β-lactams, 8, 9, 10 and 11 repeats in the amplified region were de-
macrolides and lincosamides or fluoroquinolones. The re- tected most frequently (22.3, 10.7, 13.4 and 28.6%; Table
sistance to 5 groups of antimicrobials was observed in 4).
14.4% of MDR MRSA isolates from bronchoalveolar
washings (6), sputum (2), wound (2), blood (1), respira-
tory tract (1), anus (1) and from other samples (2). The Discussion
resistance to β-lactams, macrolides, lincosamides, fluoro-
quinolones and aminoglycosides or tetracycline was the S. aureus is recognized as one of the most frequent
most common among them. Six MDR MRSA isolates causative agents of hospital-associated and device-associ-
(5.8%) resistant to 6 group of antimicrobials were isolated ated infections [16]. The hospital environment and the
from respiratory tract (1), bronchoalveolar washing (2), endogenous microflora of patients and health care work-
wound (2) and anus (1). One isolate from urine was resis- ers may play important roles as the source, reservoirs and
tant to seven groups of antimicrobials (Table 3). One-fac- vectors for the spread of antibiotic-resistant bacteria. Re-
torial ANOVA showed that the level of MDR was not sig- search on the dynamics of resistance development, iden-
nificantly associated with the clinical specimens from tification of high-risk strains and molecular basis of resis-
which MRSA isolates were obtained (p = 0.251). The mean tance are very important and required. The association of
number of drugs to which MRSA isolates were resistant in S. aureus with antimicrobial resistance profiles can pro-
2015, 2016 and 2017 was 4.4 ± 1.2, 3.9 ± 1.5 and 5.0 ± 1.3 vide useful information for the clinical treatment of infec-
respectively. Statistical analysis using Tukey’s test showed tion caused by this microorganism. MRSA have emerged
that the level of multi-drug resistance in 2015 and 2016 did as a significant threat in both the hospital and commu-
not significantly differ, but the isolates from 2017 were nity environment. Limited treatment options of infec-
resistant to significantly more antimicrobials compared to tions caused by MRSA result in higher mortality and in-
those obtained in 2016 (p = 0.002; Fig. 2). creased financial costs. Among MDR bacteria, MRSA is a
The genotypic diversity of the investigated MRSA iso- major cause of healthcare-associated infections in the EU.
lates was revealed by the size polymorphism analysis of In 2008, MRSA caused in the UE 44% of healthcare-asso-
X fragment of the spa gene coding protein A. Amplifica- ciated infections, 22% of attributable extra deaths and
tion of the X-region of spa yielded a single amplicon for 41% of extra days of hospitalization associated with these
each isolate. Eleven differently sized amplicons of ap- infections [17]. In the United States, MRSA causes be-
proximately 148-388 bp were detected. The number of tween 11,000 and 18,000 deaths annually and 80,000 in-
repeats of the 24 nucleotide sequence in X-region in test- vasive infections [18].

64 Med Princ Pract 2020;29:61–68 Kot/Wierzchowska/Piechota/Grużewska

DOI: 10.1159/000501788
Table 3. Resistance patterns of MRSA isolates from different clinical specimens

Resistance patterns Antibiotic groups Strains to which Specimen

to which resistance resistance was seen,
was seen n (%)

P/E/CC/CIP/LVX 4 48 (42.8) Respiratory tract (9), blood (7), urine (1), anus (7),
bronchoalveolar washings (13), wound (7), purulence
(1), other (3)
P/E/CC 3 9 (8.0) Blood (2), anus (3), wound (2), purulence (2)
P/E/CIP/LVX 3 9 (8.0) Respiratory tract (4), urine (1), anus (3), wound (1)
P/E/CC/CIP/LVX/AN 5 8 (7.1) Blood (1), sputum (1), bronchoalveolar washings (4),
wound (1), other (1)
P/E/CC/CIP/LVX/TE 5 4 (3.6) Respiratory tract (1), sputum (1), bronchoalveolar
washings (1), wound (1)

Downloaded from http://karger.com/mpp/article-pdf/29/1/61/3128021/000501788.pdf by guest on 28 December 2023

P/E/CC/CIP/LVX/GM/SXT 6 2 (1.8) Respiratory tract (1), bronchoalveolar washings (1)
P/E/CIP/LVX/GM 4 2 (1.8) Respiratory tract (1), other (1).
P/CIP/LVX/TE 3 2 (1.8) Blood (1), wound (1)
P/E/CC/CIP/LVX/AN/SXT 6 2 (1.8) Bronchoalveolar washings (1), wound (1)
P/E/CC/TE 4 2 (1.8) Wound (1), other (1)
P/CC/CIP/LVX 3 2 (1.8) Wound (2)
P/CIP/LVX/AN 3 2 (1.8) Bronchoalveolar washings (2)
P/E/CIP/LVX/GM/AN/SXT 5 1 (0.9) Bronchoalveolar washings (1)
P/E/CC/CIP/LVX/GN/SXT/TEC 7 1 (0.9) Urine (1)
P/E/CC/CIP/LVX/GM/AN/SXT 6 1 (0.9) Anus (1)
P/E/CC/CIP/LVX/AN/GM/SXT 6 1 (0.9) Wound (1)
P/CIP/LVX/GM/AN/TE 4 1 (0.9) Wound (1)
P/E/CC/CIP/LVX/LZD 5 1 (0.9) Anus (1)
P/CIP/LVX/GM/TE 4 1 (0.9) Wound (1)
P/CC/CIP/LVX/TE 4 1 (0.9) Urine (1)
P/E/CC/CIP/AN 5 1 (0.9) Other (1)
P/CC/CIP/LVX 3 1 (0.9) Bronchoalveolar washings (1)
P/E/CC/CIP 4 1 (0.9) Anus (1)
P/CC/TE 3 1 (0.9) Sputum (1)
Total of MDR MRSA 104 (92.9)

P, penicillin; CIP, ciprofloxacin; LVX, lewofloxacin; E, erythromycin; CC, clindamycin; AN, amikacin; TE, tetracycline; GM,
gentamicin; SXT, trimethoprim/sulfamethoxazole; TEC, teicoplanin; LZ, linezolid; MRSA, methicillin-resistant Staphylococcus aureus;
MDR, multidrug-resistant.

In the current study, we investigated drug resistance MRSA isolates because they represent a high percentage
of MRSA isolates from different clinical materials from among of S. aureus isolates from clinical materials in
hospitalized patients in Masovian district in Poland. We many countries. MRSA accounts for about 60% of clini-
have undertaken studies evaluating the resistance of cal S. aureus isolates from intensive care units in the

Antimicrobial Resistance Patterns in Med Princ Pract 2020;29:61–68 65

MRSA DOI: 10.1159/000501788
 Table 4. Diversity of the 24 bp repeats in X-region of the spa gene in MRSA isolates from patients hospitalized in
2015–2017

24 bp repeats in Size of the PCR Isolates with repeats in region X, n (%) Total
X-region of spa product, bp 2015 (n = 18) 2016 (n = 23) 2017 (n = 71) (n = 112)

4 148 0 1 (4.3) 0 1 (0.9)

5 172 3 (16.7) 2 (8.7) 1 (1.4) 6 (5.3)
6 196 0 1 (4.3) 2 (2.8) 3 (2.7)
7 220 1 (5.5) 2 (8.7) 6 (8.4) 9 (8.0)
8 244 2 (11.1) 1 (4.3) 22 (31.0) 25 (22.3)
9 268 4 (22.2) 2 (8.7) 6 (8.4) 12 (10.7)
10 292 1 (5.5) 4 (17.4) 10 (14.1) 15 (13.4)
11 316 8 (44.4) 9 (39.1) 15 (21.1) 32 (28.6)
12 340 0 9 (39.1) 1 (1.4) 1 (0.9)
13 364 0 0 6 (8.4) 6 (5.3)
14 388 0 1 (4.3) 1 (1.4) 2 (1.8)

Downloaded from http://karger.com/mpp/article-pdf/29/1/61/3128021/000501788.pdf by guest on 28 December 2023

MRSA, methicillin-resistant Staphylococcus aureus.

ranged from 3.7 to 63.1% (average 22.7%). In our study,

7
b we investigated the susceptibility of MRSA isolates to 9
6 a, b a groups of antimicrobials, and a very high percentage
5 (92.9%) of isolates was MDR. According to Campanile et
Antimicrobials, n

4 al. [22], all MRSA isolates from nosocomial infections

3 isolated in 2012 in Italy were MDR organisms. A high
2 percentage of S. aureus strains (82.3%) from hospitalized
1
patients in Ethiopia were resistant to 3 or more antimi-
crobials [7]. A high percentage of our MDR isolates were
0
2015 2016 2017 resistant to 4 groups of antimicrobials (53.8%). Some iso-
lates were resistant to 3, 5 or 6 groups of antibiotics, and
one isolate was resistant to 7 groups of antibiotics. These
Fig. 2. The level of MDR among MRSA isolated in 2015–2017. The
mean number of antimicrobials to which MRSA isolates were re- results indicate that the possibilities of treating infections
sistant was compared irrespective of the specimen type. Different caused by MDR MRSA using available antibiotics are
letter (a, b) superscripts indicate significant differences (Tukey’s very limited. The level of resistance to fluoroquinolones,
test, p = 0.002). The mean number of drugs to which MRSA isolates clindamycin and erythromycin of our MRSA isolates was
in 2017 were resistant was significantly higher than that isolated in similar to the resistance level of MRSA isolates in Italy,
2016 (Tukey’s test, p = 0.002).
while percentages of isolates resistant to gentamicin and
tetracycline in Italy [22] was slightly higher than in our
research. Our study revealed that the percentage of
United States [19] and the same percentage of hospital S. strains resistant to amikacin, gentamicin, tetracycline
aureus strains in China and Nepal [20, 21]. The propor- and trimethoprim/sulfamethoxazole was lower com-
tion of MRSA among all S. aureus isolates reached 35.8% pared to other results [7, 25]. Our study also showed that
in Italy [22], above 40% in Philippines [23] and 68.4% in the level of MDR among of MRSA isolates in Poland in-
Ethiopia [7]. This is of concern because MRSA limit the creased as the number of drugs to which isolates were
choice of antibiotics for treating infections caused by resistant in 2017 was significantly higher than in 2016,
them. The previous study conducted in Poland by and also higher (although insignificantly) compared to
Łuczak-Kadłubowska et al. [24] who investigated S. au- 2015. The development of resistance to many antibiotics
reus isolates from 39 hospitals showed that the propor- by S. aureus is associated with acquisition of determi-
tion of MRSA isolates depended on the hospital and nants by horizontal gene transfer of mobile genetic ele-

66 Med Princ Pract 2020;29:61–68 Kot/Wierzchowska/Piechota/Grużewska

DOI: 10.1159/000501788
ments and can also emerge by mutations that alter the who investigated S. aureus isolated from bovine mastitis
drug-binding sites on molecular targets and by the ex- in Poland, which may indicate that these spa types are
pression of endogenous efflux pumps [26]. widespread in Poland.
Our study revealed substantial genetic diversity of the
analyzed group of MRSA isolates, which rather excludes
their origin from the same initial strain and indicates that Conclusion
these isolates have emerged from outside the hospitals.
Grundmann et al. [27] showed that spa types MRSA in About 93% of MRSA isolates from different clinical
Europe form distinctive geographical clusters and genet- materials from hospitalized patients in Masovian district
ic diversity of MRSA differed considerably among the in Poland were MDR organisms. A high percentage of
countries. The number of spa types of MRSA isolates in MRSA isolates showed resistance to fluoroquinolones,
26 European countries was 155. The highest number of macrolides and lincosamides, while a fewer of them
spa types among MRSA isolates was showed in France showed resistance to tetracycline, aminoglycosides and
(27), Ireland (26) and Belgium (25). In our research, we trimethoprim with sulfamethoxazole. Resistance to
found 11 spa types, which were similar to number of spa erythromycin, clindamycin, ciprofloxacin and levofloxa-

Downloaded from http://karger.com/mpp/article-pdf/29/1/61/3128021/000501788.pdf by guest on 28 December 2023

types in Bulgaria (11), Croatia (13), Italy (15) and Portu- cin was the most common resistance pattern among
gal (13) [27]. We found that 83% of MRSA isolates had MDR MRSA isolates. No MRSA isolates were resistant to
>7 repeats in X-region of spa gene. S. aureus with repeats linezolid and teicoplanin. It is important to note that
more than 7 in the X-region are more transmissible and these data shows that the isolates from 2017 were resistant
these isolates are involved in epidemic outbreaks, while to a significantly higher number of antimicrobials com-
the presence of 7 or less repeats is indicative of a non- pared to those obtained in 2016, which indicates rapid
epidemic phenotype [28]. The allele with 11 repeats was acquisition of new antimicrobial resistance determinants
the most common (28.6%). Similar results was obtained by MRSA isolates in the hospital environment.
by Montesinos et al. [29] who investigated MRSA isolates
from hospitalized patients and outpatients in Spain. In
Acknowledgements
the present study, isolates with 8, 9 and 10 repeats in the
amplified region of spa gene were also frequently detect- This work was supported by the Siedlce University of Natural
ed. Similar results were obtained by other authors [15, 30] Science and Humanities (Scientific Research Project No. 316/12/S).

References
1 Boucher HW, Talbot GH, Bradley JS, Ed- 6 Kot B, Piechota M, Wolska KM, Frankowska 10 Brakstad OG, Aasbakk K, Maeland JA. Detec-
wards JE, Gilbert D, Rice LB, et al. Bad bugs, A, Zdunek E, Binek T, et al. Phenotypic and tion of Staphylococcus aureus by polymerase
no drugs: no ESKAPE! An update from the genotypic antimicrobial resistance of staphy- chain reaction amplification of the nuc gene.
Infectious Diseases Society of America. Clin lococci from bovine milk. Pol J Vet Sci. 2012; J Clin Microbiol. 1992 Jul;30(7):1654–60.
Infect Dis. 2009 Jan;48(1):1–12. 15(4):677–83. 11 Murakami K, Minamide W, Wada K, Naka-
2 Mulvey MR, Simor AE. Antimicrobial resis- 7 Tadesse S, Alemayehu H, Tenna A, Tadesse mura E, Teraoka H, Watanabe S. Identifica-
tance in hospitals: how concerned should we G, Tessema TS, Shibeshi W, et al. Antimicro- tion of methicillin-resistant strains of staphy-
be? CMAJ. 2009 Feb;180(4):408–15. bial resistance profile of Staphylococcus aure- lococci by polymerase chain reaction. J Clin
3 Katayama Y, Ito T, Hiramatsu K. A new class us isolated from patients with infection at Ti- Microbiol. 1991 Oct;29(10):2240–4.
of genetic element, staphylococcus cassette kur Anbessa Specialized Hospital, Addis Aba- 12 CLSI. Performance Standards for Antimicro-
chromosome mec, encodes methicillin resis- ba, Ethiopia. BMC Pharmacol Toxicol. 2018 bial Susceptibility Testing. 26th edition. CLSI
tance in Staphylococcus aureus. Antimicrob May;19(1):24. Supplement M100. Wayne, PA: Clinical and
Agents Chemother. 2000 Jun;44(6):1549–55. 8 Köck R, Becker K, Cookson B, van Gemert- Laboratory Standards Institute; 2016.
4 Dupieux C, Bouchiat C, Larsen AR, Pichon B, Pijnen JE, Harbarth S, Kluytmans J, et al. 13 Vesterholm-Nielsen M, Olhom Larsen M, El-
Holmes M, Teale C, et al. Detection of mecC- Methicillin-resistant Staphylococcus aureus merdahl Olsen J, Moller Aarestrup F. Occur-
positive Staphylococcus aureus: what to expect (MRSA): burden of disease and control chal- rence of the blaZ gene in penicillin resistant
from immunological tests targeting PBP2a? J lenges in Europe. Euro Surveill. 2010 Oct; Staphylococcus aureus isolated from bovine
Clin Microbiol. 2017 Jun;55(6):1961–3. 15(41):19688. mastitis in Denmark. Acta Vet Scand. 1999;
5 Ness T. [Multiresistant bacteria in ophthal- 9 Tong SY, Davis JS, Eichenberger E, Holland 40(3):279–86.
mology]. Ophthalmologe. 2010 Apr; 107(4): TL, Fowler VG Jr. Staphylococcus aureus in-
318–22. fections: epidemiology, pathophysiology,
clinical manifestations, and management.
Clin Microbiol Rev. 2015 Jul;28(3):603–61.

Antimicrobial Resistance Patterns in Med Princ Pract 2020;29:61–68 67

MRSA DOI: 10.1159/000501788
14 Frénay HM, Bunschoten AE, Schouls LM, van 19 Noskin GA, Rubin RJ, Schentag JJ, Kluytmans 25 Udo EE, Boswihi SS. Antibiotic resistance
Leeuwen WJ, Vandenbroucke-Grauls CM, J, Hedblom EC, Smulders M, et al. The burden trends in methicillin-resistant Staphylococcus
Verhoef J, et al. Molecular typing of methicil- of Staphylococcus aureus infections on hospi- aureus isolated in Kuwait hospitals: 2011–
lin-resistant Staphylococcus aureus on the ba- tals in the United States: an analysis of the 2015. Med Princ Pract. 2017;26(5):485–90.
sis of protein A gene polymorphism. Eur J 2000 and 2001 Nationwide Inpatient Sample 26 Foster TJ. Antibiotic resistance in Staphylo-
Clin Microbiol Infect Dis. 1996 Jan;15(1):60– Database. Arch Intern Med. 2005 Aug; coccus aureus. Current status and future pros-
4. 165(15):1756–61. pects. FEMS Microbiol Rev. 2017 May;41(3):
15 Szweda P, Schielmann M, Milewski S, Fran­ 20 Cheng H, Yuan W, Zeng F, Hu Q, Shang W, 430–49.
kowska A, Jakubczak A. Biofilm production Tang D, et al. Molecular and phenotypic evi- 27 Grundmann H, Aanensen DM, van den Wi-
and presence of ica and bap genes in Staphy- dence for the spread of three major methicil- jngaard CC, Spratt BG, Harmsen D, Friedrich
lococcus aureus strains isolated from cows lin-resistant Staphylococcus aureus clones as- AW; European Staphylococcal Reference
with mastitis in the eastern Poland. Pol J Mi- sociated with two characteristic antimicrobial Laboratory Working Group. Geographic dis-
crobiol. 2012;61(1):65–9. resistance profiles in China. J Antimicrob tribution of Staphylococcus aureus causing in-
16 Danzmann L, Gastmeier P, Schwab F, Von- Chemother. 2013 Nov;68(11):2453–7. vasive infections in Europe: a molecular-epi-
berg RP. Health care workers causing large 21 Upreti N, Rayamajhee B, Sherchan SP, demiological analysis. PLoS Med. 2010 Jan;
nosocomial outbreaks: a systematic review. Choudhari MK, Banjara MR. Prevalence of 7(1):e1000215.
BMC Infect Dis. 2013 Feb;13(1):98. methicillin resistant Staphylococcus aureus, 28 Frénay HM, Theelen JP, Schouls LM, Van-
17 European Centre for Disease Prevention multidrug resistant and extended spectrum denbroucke-Grauls CM, Verhoef J, van Leeu-
and Control/European Medicines Agency β-lactamase producing gram negative bacilli wen WJ, et al. Discrimination of epidemic and
(ECDC/EMEA). Joint technical report The causing wound infections at a tertiary care nonepidemic methicillin-resistant Staphylo-

Downloaded from http://karger.com/mpp/article-pdf/29/1/61/3128021/000501788.pdf by guest on 28 December 2023

bacterial challenge: time to react. Stockholm: hospital of Nepal. Antimicrob Resist Infect coccus aureus strains on the basis of protein A
ECDC/EMEA; 2009. Available from: http:// Control. 2018 Oct;7(1):121. gene polymorphism. J Clin Microbiol. 1994
www.ecdc.europa.eu/en/publications/Publi- 22 Campanile F, Bongiorno D, Perez M, Mon- Mar;32(3):846–7.
cations/0909_TER_The_Bacterial_Chal- gelli G, Sessa L, Benvenuto S, et al.; AMCLI 29 Montesinos I, Salido E, Delgado T, Cuervo M,
lenge_Time_to_React.pdf. – S. aureus Survey Participants. Epidemiology Sierra A. Epidemiologic genotyping of meth-
18 Morgenstern M, Erichsen C, Hackl S, Mily J, of Staphylococcus aureus in Italy: first nation- icillin-resistant Staphylococcus aureus by
Militz M, Friederichs J, et al. Antibiotic resis- wide survey, 2012. J Glob Antimicrob Resist. pulsed-field gel electrophoresis at a university
tance of commensal Staphylococcus aureus 2015 Dec;3(4):247–54. hospital and comparison with antibiotyping
and coagulase-negative staphylococci in an 23 Juayang AC, de Los Reyes GB, de la Rama AJ, and protein A and coagulase gene poly­
international cohort of surgeons: a prospec- Gallega CT. Antibiotic resistance profiling of morphisms. J Clin Microbiol. 2002 Jun;40(6):
tive point-prevalence study. PLoS One. 2016 Staphylococcus aureus isolated from clinical 2119–25.
Feb;11(2):e0148437. specimens in a tertiary hospital from 2010 to 30 Kuźma K, Malinowski E, Lassa H, Kłossowska
2012. Interdiscip Perspect Infect Dis. 2014; A. Analysis of protein A gene polymorphism
2014:898457. in Staphylococcus aureus isolates from bovine
24 Łuczak-Kadłubowska A, Sulikowska A, Em- mastitis. Bull Vet Inst Pulawy. 2005;49:41–4.
pel J, Piasecka A, Orczykowska M, Kozinska
A, et al. Countrywide molecular survey of
methicillin-resistant Staphylococcus aureus
strains in Poland. J Clin Microbiol. 2008 Sep;
46(9):2930–7.

68 Med Princ Pract 2020;29:61–68 Kot/Wierzchowska/Piechota/Grużewska

DOI: 10.1159/000501788