Plant Disease • 2017 • 101:1113-1118 • http://dx.doi.org/10.

1094/PDIS-01-17-0142-RE

Population Structure and Genetic Diversity of Phytophthora nicotianae from

Tobacco in Georgia
Yonggang Li, Agricultural College, Northeast Agricultural University, Harbin 150030, China; and Department of Plant Pathology, University
of Georgia, Tifton 31794; Karen Harris-Shultz and Hongliang Wang, United States Department of Agriculture–Agricultural Research Ser-
vice (USDA-ARS), Crop Genetics and Breeding Research Unit, Tifton, GA 31793; Phillip A. Wadl, USDA-ARS, U.S. Vegetable Laboratory,
Charleston, SC 29414; and Pingsheng Ji, Department of Plant Pathology, University of Georgia, Tifton

Abstract
Black shank, caused by Phytophthora nicotianae, occurs worldwide and arithmetic means analyses of 59 isolates using SSR markers grouped
is responsible for significant yield loss in tobacco production in Georgia. the isolates in two major groups. Group I contained 20 isolates, of which
Management of the disease has primarily relied on utilization of tobacco 19 isolates were collected from Berrien County. Group II contained 39
cultivars with resistance to race 0 of the pathogen and application of the isolates collected from Bacon, Cook, Tift, and Toombs Counties as well
fungicide mefenoxam. Races of P. nicotianae currently prevalent in to- as one sample from Berrien County. Genetic diversity of the isolates was
bacco production in Georgia, their sensitivity to mefenoxam, and genetic associated with geographical location of collection, and isolates in group
diversity of the pathogen are largely unknown. To determine population I were primarily (75%) race 1, whereas isolates in group II were primarily
structure and genetic diversity of the pathogen, simple sequence repeat (69%) race 0. The presence of a single pathogen mating type at most of
(SSR) markers were used. Three races of P. nicotianae (races 0, 1, and the locations implies low probability of sexual recombination that may
3) were isolated from infected tobacco plants, with race 3 identified in have contributed to the low genetic diversity at a particular geographical
Georgia for the first time. The majority of isolates were identified as location. Sensitivity of the isolates to mefenoxam indicates that the fun-
A2 mating type and all isolates were sensitive or intermediately sensitive gicide remains to be a potent tool for growers to combat the disease. In-
to mefenoxam at 1 or 10 mg/ml, with effective concentration of mefe- formation generated in the study advances our knowledge about diversity
noxam for 50% mycelial growth reduction values ranging from <0.01 and population structure of P. nicotianae, which facilitates development
to 0.12 mg/ml. Bayesian and unweighted pair group method with and implementation of effective disease management programs.

Phytophthora nicotianae Breda de Haan, the causal agent of to- most widely used fungicide to control tobacco black shank is mefe-
bacco black shank, occurs worldwide and infects a variety of plant noxam, and it was only recently that some newer fungicides were
species. It is a soilborne pathogen and also named P. parasitica demonstrated to be effective alternative or complementary tools to
var. nicotianae (Breda de Haan) Tucker and P. nicotianae var. nico- combat the disease (Ji et al. 2014; Qu et al. 2016). P. nicotianae iso-
tianae G. M. Waterhouse (Erwin and Ribeiro 1996). The pathogen is lated in Georgia from tobacco was found to be sensitive to mefenoxam
destructive on tobacco (Nicotiana tabacum), causing significant two decades ago (Csinos and Bertrand 1994). It was reported that re-
quality and yield loss in the southeastern United States. Common duced sensitivity to mefenoxam might occur in P. nicotianae popula-
symptoms caused by black shank include root rot and necrosis of tions following continuous application of the compound (Shew 1985).
lower stems, leaf yellowing, plant stunting, and wilting (Csinos Hence, it is desirable to evaluate potential resistance of P. nicotianae
and Bertrand 1994; Shew and Lucas 1998). populations currently prevalent in tobacco production to mefenoxam
P. nicotianae is a diversified pathogen, with four races currently to determine this fungicide’s usefulness for managing black shank.
identified. Race 0 isolates are not pathogenic on tobacco carrying Although it has long been known that P. nicotianae from tobacco is
Php or Phl genes, whereas race 1 isolates cause disease on tobacco diversified, with different races, limited information is available re-
with these genes (Apple 1967). Some isolates in South Africa were garding genetic diversity of the pathogen and the potential relationship
designated as race 2 and had differential responses to ‘KY 14xL8’ between pathogen genetic diversity and other traits such as races. In a
and ‘Burley 21xL8’ tobacco, and did not cause disease on ‘Delcrest recent study (Biasi et al. 2016), genetic diversity of P. nicotianae
202’ (Lamprecht et al. 1974). Race 3 isolates caused disease on to- strains from different host plants was assessed by simple sequence
bacco with the Phl gene but were not pathogenic on tobacco carrying repeat (SSR) analysis, which indicated that genetic grouping was
the Php gene (McIntyre and Taylor 1978). Races 0 and 1 are widely strongly associated with host types from which the strains were iso-
distributed worldwide, race 2 was identified in South Africa only, lated. SSR are tandemly repeated motifs in the nuclear genomes of
and race 3 was reported in the eastern United States, including Con- eukaryotic organisms. They are highly polymorphic, multiallelic,
necticut, North Carolina, and Virginia (Gallup and Shew 2010; evenly dispersed throughout the genome, and have been an efficient
McIntyre and Taylor 1978; Parkunan et al. 2010). marker system in studies of the genetic variation of Phytophthora
Management of black shank of tobacco is a challenging task due to spp. (Biasi et al. 2016; Wang et al. 2009). Hence, the objectives of this
the diversity of the pathogen, especially the aggressiveness of race 1 research were to develop SSR markers for P. nicotianae and study ge-
strains on tobacco cultivars. Due to the wide distribution of race 1, netic and phenotypic variations of P. nicotianae causing black shank
reliance on cultivars with resistance to race 0 strains is not sufficient of tobacco in Georgia. Information generated in the study enhances
to manage the disease effectively. Application of fungicides is com- our understanding of population structure of the pathogen and facili-
monly used by growers to reduce the disease, although only limited tates development of effective programs to manage the disease.
fungicides are available for effective black shank management. The
Materials and Methods
Isolates of P. nicotianae and race determination. Isolates of P.
Corresponding author: P. Ji; E-mail: [email protected] nicotianae were collected in Georgia from infected tobacco plants in
Accepted for publication 16 March 2017. 2013 and 2014, and generation of single-spore isolates and their path-
ogenicity on tobacco (‘K326’) was reported previously (Qu et al.
2016). Fifty-nine single-spore isolates from different counties in
© 2017 The American Phytopathological Society Georgia were used for race determination in this study (Table 1).

Plant Disease / July 2017 1113

 Three genotypes of tobacco that have different degrees of resistance
to P. nicotianae were used, including K326 that has no resistance
Table 1. Location of isolation, races, and sensitivity to mefenoxam of 59 Phy- genes and breeding lines ‘NC1071’ and ‘L8’ that have the Php gene
tophthora nicotianae isolates from tobacco in Georgia
and Phl gene, respectively (Gallup and Shew 2010). L8 is susceptible
Disease incidence on Sensitivity to to race 3, and both NC1071 and L8 are susceptible to race 1 but re-
tobacco cultivar (%) mefenoxama sistant to race 0. K326 is susceptible to all races (0, 1, and 3).
Isolate County L8 NC1071 K326 Race 1 mg/ml 10 mg/ml To prepare inoculum, 50 autoclaved wheat seeds (30 min at 121°C
for 3 consecutive days) were placed on a V8 agar plate with a myce-
Y302 Toombs 0 0 100 0 S S
lial plug (0.7 cm in diameter) of P. nicotianae isolates at the center of
Y504 Toombs 0 0 100 0 S S
the plate. After incubating for 10 days at 25°C, wheat seed fully col-
Y203 Bacon 0 0 100 0 I S
onized by mycelium were utilized to inoculate seedlings of tobacco,
Y503 Toombs 0 0 100 0 S S
as described previously (Qu et al. 2016). Briefly, tobacco seed (K326,
Y201 Bacon 100 0 100 3 I I
L8, and NC1071) were sown in potting mix/sand (2:1, vol/vol) in
Y305 Toombs 0 0 100 0 S S
Pn202A Cook 100 100 100 1 S S
15-cm pots and 3-week-old seedlings were transplanted into seed-
Pn29A Tift 100 100 100 1 I I
ling trays (cells of 3.6 by 3.6 by 6.0 cm) in the potting mix/sand.
Y301 Toombs 0 0 100 0 S S One seedling was transplanted into a cell, and each seedling was in-
Pn40A Tift 100 100 100 1 I S oculated by placing two wheat seeds near the plant under the soil
Pn13B Berrien 100 100 100 1 I I surface 10 days after transplanting. Experimental design was a ran-
Pn38A Tift 0 0 100 0 S S domized complete block and three replicates were used, with one
Y104 Bacon 0 0 100 0 S S plant for an isolate or tobacco genotype for each replicate. Three
Pn32A Tift 0 0 100 0 S S plants inoculated with autoclaved wheat seed were used as a control
Pn27A Tift 0 0 100 0 S S for each tobacco genotype. The seedlings were incubated at 20 and
Pn21A Tift 100 100 100 1 I S 30°C (night and day, respectively) in a greenhouse with a 12-h pho-
Pn206A Cook 100 0 100 3 S S toperiod, and watered daily using a sprinkler. Percent diseased plants
Pn25A Tift 0 0 100 0 S S (disease incidence) was recorded once a week for 2 weeks following
Pn26A Tift 0 0 100 0 S S inoculation. The experiment was repeated one more time under sim-
Pn36A Tift 100 100 100 1 I S ilar conditions. Diseased plants were sampled for isolation and confir-
Pn30A Tift 100 0 100 3 I S mation of the causal agent, as described in our previous study (Qu
Y304 Toombs 0 0 100 0 S S et al. 2016).
Y205 Bacon 0 0 100 0 S S Determining mating types of P. nicotianae isolates. Mycelial
Y103 Bacon 0 0 100 0 S S plugs (7 mm in diameter) from 7-day-old isolates grown on V8 agar
Pn28A Tift 0 0 100 0 S S at 25°C were transferred to V8 plates (9 cm in diameter) and paired
Pn201A Cook 0 0 100 0 I S with P. nicotianae isolates of known A1 and A2 mating types. Each
Y406 Toombs 0 0 100 0 S S of the 59 P. nicotianae isolates was placed 3 cm apart from an A1 or
Y306 Toombs 0 0 100 0 S S A2 isolate on a plate. The test isolates were also paired with them-
Pn204A Cook 100 0 100 3 S S selves. Three plates were used for each pairing and the plates were
Y303 Toombs 0 0 100 0 S S wrapped with Parafilm and incubated at 25°C. Production of oo-
Pn207A Cook 0 0 100 0 I S spores was observed periodically under a microscope until 6 weeks
Y102 Bacon 100 100 100 1 S S after incubation and the experiment was conducted twice.
Pn34A Tift 100 100 100 1 S S Determining sensitivity of P. nicotianae isolates to mefenoxam.
Pn205A Cook 0 0 100 0 S S Ridomil Gold (45.3% mefenoxam) provided by Syngenta (Greens-
Pn37A Tift 0 0 100 0 S S boro, NC) was used to make a stock solution in sterile distilled water.
Pn23A Tift 0 0 100 0 S S The stock solution was used to amend V8 agar at mefenoxam con-
Pn33A Tift 0 0 100 0 I S centrations of 0 (used as a control), 0.01, 0.1, 0.25, 0.5, 1, and
Pn39A Tift 0 0 100 0 I S 10 mg/ml. After being grown on V8 agar for 7 days (25°C), a myce-
Pn203A Cook 0 0 100 0 I S lial plug of P. nicotianae isolate was transferred to a mefenoxam-
Pn105A Berrien 0 0 100 0 I S amended plate. The 59 isolates were tested with three plates for each
Pn12A Berrien 0 0 100 0 I S
isolate–fungicide concentration combination. After incubating for
Pn6A Berrien 100 100 100 1 S S
7 days at 25°C, colony diameters were measured and effective con-
Pn18B Berrien 0 0 100 0 S S
centration of mefenoxam for 50% mycelial growth reduction (EC50)
Pn110A Berrien 100 100 100 1 S S
was calculated using the previously described methods (Qu et al.
Pn108A Berrien 100 100 100 1 S S
2016). The percentage of resistant (colony size >90% of the control),
Pn19A Berrien 100 100 100 1 I S
intermediately sensitive (30 to 90% of the control), and sensitive
Pn112A Cook 100 100 100 1 I S
Pn102A Berrien 100 100 100 1 I S
(<30% of the control) isolates was calculated. Data from two re-
Pn13A Berrien 100 100 100 1 I S
peated tests were pooled for calculation of EC50 and percentage of
Pn104A Berrien 100 0 100 3 I S resistant or sensitive isolates.
Pn15A Berrien 100 100 100 1 I S Designing SSR. The P. nicotianae isolate INRA-310 (syn. P. par-
Pn109A Berrien 100 100 100 1 I S asitica, National Center for Biotechnology Information accession
Pn18A Berrien 100 0 100 3 I S number PRJNA259235) genome sequence was used for SSR discov-
Pn2A Berrien 100 100 100 1 I S ery. Scaffolds of less than 100 kb were screened for SSR motifs and
Pn15B Berrien 100 100 100 1 S S primer pairs were designed using BatchPrimer3 (You et al. 2008).
Pn19B Berrien 100 100 100 1 I S Due to size limitations in uploading files to BatchPrimer3, longer
Pn103A Berrien 100 100 100 1 I S scaffolds were not screened. From the 109 primer pairs, 20 were se-
Pn14A Berrien 100 100 100 1 I S lected with the longest SSR repeat length (24 to 66 bp).
Pn20A Berrien 100 100 100 1 S S Determining genetic diversity of P. nicotianae isolates. Twenty
a Sensitivity to mefenoxam was determined based on in vitro mycelial growth. SSR primer pairs were screened for polymorphisms using 10
S = sensitive (i.e., mycelial growth on mefenoxam-amended agar plates was P. nicotianae isolates. After incubating on V8 agar at 25°C for 7 days,
less than 30% of that on the control plates) and I = intermediate sensitive mycelium of the isolates was scraped using a sterilized scalpel, and
(i.e., mycelial growth on mefenoxam-amended agar plates was 30 to 90% approximately 0.1 g of mycelium was put in each 1.5-ml microcen-
of the control). trifuge tube. The mycelium was ground in liquid nitrogen using a
1114 Plant Disease / Vol. 101 No. 7
pestle, and DNA was extracted using the DNeasy Plant Mini Kit was performed twice: once with isolates grouped by location and
(Qiagen, Valencia, CA). DNA concentration was quantified by a Nano- once with isolates grouped by race. The Excel add-in GenAlEx 6.5
Drop spectrophotometer (Thermo Fisher Scientific, Waltham, MA). (Peakall and Smouse 2012) was used to calculate pairwise population
Gradient polymerase chain reaction (PCR) was performed at a 45 differentiation (fixation index [FST]) for location and race.
to 60°C annealing temperature using 20 pairs of SSR primers and one
isolate; 50°C yielded the best result and was used in subsequent stud- Results
ies. Each PCR was conducted in a 10-ml mixture containing 5× Clear Race and mating type determination. About half of the isolates
GoTaq reaction buffer (2 ml; Promega Corp., Madison, WI), 2.5 mM (30 of 59) were identified as race 0 that caused disease on K326 but
dNTP (0.8 ml), 25 mM MgCl2 (1 ml), GoTaq DNA polymerase not L8 and NC1071. Twenty-three isolates were race 1 that caused
(0.04 ml; Promega Corp.), M13-tagged forward primer (0.5 ml) disease on K326, L8, and NC1071. Six isolates caused disease on
and reverse primer (2.0 ml) (both at 1 mM), 1 mM M13 primer K326 and L8 but did not cause disease on NC1071, and hence were
(M13-TGTAAAACGACGGCCAGT) fluorescently labeled with identified as race 3 (Table 1). Most isolates were identified as the
the IRDye 800 CW fluorophore (1.8 ml; Eurofins MWG Operon, A2 mating type and three isolates (Pn21A, Pn38A, and Pn207A)
Huntsville, AL), sterile water (0.86 ml), and 1 ml of P. nicotianae iso- were A1.
late DNA (2.5 ng/ml). PCR was conducted as an initial denaturation Sensitivity of P. nicotianae isolates to mefenoxam. Among the
(94°C, 3 min), 94°C for 30 s for 39 cycles, 50°C for 60 s, 72°C for 70 s, isolates, 55.9 and 44.1% were sensitive or intermediately sensitive,
and a final extension for 10 min at 72°C. The product of PCR (2 ml) respectively, to mefenoxam at 1 mg/ml (Table 1). For mefenoxam
was mixed with 5 ml of Blue Stop solution (LI-COR Biosciences, at 10 mg/ml, 94.9 and 5.1% of the isolates were sensitive or interme-
Lincoln, NE), and 0.3 ml of the mixture was used to run a polyacryl- diately sensitive, respectively. Isolates Y201, Pn13B, and Pn29A had
amide gel (6.5%) using a 4300 DNA Analyzer (LI-COR). Seven relatively higher EC50 values than other isolates but isolates resistant
pairs of primers were selected (Table 2) because these loci generated to the compound were not found. EC50 values of mefenoxam for in-
polymorphisms among the 59 isolates and these markers were used hibition of mycelium growth of the isolates were <0.01 to 0.12 mg/ml
for SSR analysis using the conditions described above. The presence (Fig. 1).
or absence of a band (coded as 1 or 0, respectively) on the gel images Genetic diversity of P. nicotianae isolates. Among the 20 SSR
for different sizes of the alleles was recorded for unweighted pair primer pairs tested, 7 pairs of primers produced nine reproducible
group method with arithmetic means (UPGMA) and the Structure polymorphic bands (alleles). DICE genetic similarity coefficients be-
analyses. tween the 59 isolates ranged from 0.22 to 1.0, with a mean of 0.71.
Marker data were loaded into NTSTSpc (Rohlf 2008) for the Using UPGMA cluster analysis, the isolates can be placed in two
UPGMA cluster analysis. The SIMQUAL module in NTSYSpc soft-
ware was used to calculate genetic similarity between each pair of P.
nicotianae isolates based on DICE coefficient of similarity (Nei and
Li 1979). The SAHN module of NTSYSpc (UPGMA procedure) was
used to generate a dendrogram based on matrix of similarity. Free-
Tree program (Hampl et al. 2001) was used to conduct bootstrapping
analysis, which estimates the reliability of individual branching
points of a tree, and the number of repetitions was 1,000. Values
of bootstrap larger than 50% were shown, except that the bootstrap
value for the major groups was shown.
Structure version 2.3.4 (Pritchard et al. 2000) was used for a
Bayesian analysis using the admixture model, which infers whether
the individual i has inherited a portion of its genetic material from an-
cestors in population k. For measuring different k values, 20 indepen-
dent replicates were made for each k value between 1 and 10 for the
sampling locations and race data. A burn-in period of 250,000 itera-
tions and 250,000 Markov Chain Monte Carlo repetitions were used
in all analyses. Estimation of the best k value was determined by
Structure Harvester (Earl and von Holdt 2012), which determines ap-
propriately how many clusters (k) there are using the ad hoc statistic
Dk. This is according to the second-order rate of change in the log Fig. 1. Concentration of mefenoxam for suppressing 50% of mycelial growth (EC50) of
probability of the data between successive values of k. The analysis Phytophthora nicotianae isolates.

Table 2. Primer sequences of simple sequence repeats markers used to study genetic diversity of Phytophthora nicotianae isolates
Locus Primer sequence 59- 39 Repeat motif Scored alleles (n) Allele size (bp)a
Pn176 F: TGTCCTTCGCTCACTATTTACG (TC)33 2 145, 147
R: CTGTTGGTGTTACGGGGTATTT … … …
Pn189 F: AGCGAGAATACCTTTGTGTGGT (CT)17 1 200
R: CGGTTGAATCGAGATATCCTACA … … …
Pn251 F: CCTGACACTTACCACCAACTCA (CTCA)10 2 165, 172
R: TAAATTTGCAGCGTTCCATAAG … … …
Pn372 F: TTATGCTGACGTAGCGCTGTAT (AT)14 1 156
R: ATCTAATGCCTTTGTCGTTCGT … … …
Pn410 F: CCTTCATCTTGTACGGGACATT (TC)15 1 151
R: ACGAAAATCAACGGTTCCAATA … … …
Pn511 F: GGAGAAGTGCTCTTCGTTGTCT (ACG)8 1 180
R: CAACGGGAGCATCGGTAG … … …
Pn535 F: GCCAACTCCATCATCATCATC (TTC)8 1 180
R: TTAACAATGGAGACCCGAACTT … … …
a Markers with only one scored allele were dominant loci (presence or absence).

Plant Disease / July 2017 1115

groups (Fig. 2). There were 20 isolates in group I; all were isolated UPGMA and Structure analyses (Tables 3 and 4), because Berrien
from Berrien County, except for one isolate, Pn112A, from Cook County, GA, is highly differentiated from the other counties
County. Additionally, 15 of 20 isolates in group I were identified (FST $ 0.64) and races 0 and 1 are also highly differentiated.
as race 1, whereas the other isolates were either race 0 (Pn105A,
Pn12A, and Pn18B) or race 3 (Pn18A and Pn104A). There were 39 Discussion
isolates in group II that were isolated from Bacon, Cook, Tift, and Tobacco is an economically important crop in Georgia, with over
Toombs Counties, except one isolate, Pn13B, from Berrien County. 6,500 ha produced and a farm gate value of approximately $80 mil-
The majority of the race 0 isolates were in group II (27 of 30). lion annually (Wolfe and Stubbs 2015). Black shank has been one of
Structure analyses found evidence of two distinct clusters and sup- the most devastating diseases affecting tobacco production in the
ported the UPGMA cluster analysis (Fig. 3). In agreement with the southeastern United States (Csinos 2005; Csinos and Bertrand
UPGMA cluster analysis, Structure analysis, represented as bar plots 1994; Shew and Lucas 1998). Studies conducted over a decade
of individual Bayesian assignment probabilities of P. nicotianae iso- ago indicated that two races of P. nicotianae (races 0 and 1) were
lates, displayed the finding that isolates placed in group I (shaded in present in commercial tobacco fields in Georgia (Csinos 2005).
red) were primarily from Berrien County, GA, whereas isolates col- However, genetic diversity of P. nicotianae populations and the
lected from Bacon, Cook, Tift, and Toombs Counties were primarily prevalent races currently affecting tobacco production in Georgia
in group II (green shading). Finally, Structure analysis was in agree- are unknown. In the present study, we identified two genetic groups
ment with UPGMA clustering, because the Bayesian assignment of P. nicotianae isolates from tobacco in Georgia using SSR markers.
probabilities for P. nicotianae isolates also showed that most isolates Races 0 and 1 were the prevailing races known to occur in Georgia
that were race 0 belonged to group II whereas most of the isolates that prior to our study (Csinos 2005). We, for the first time, identified race
were race 1 belonged to group I. 3 in Georgia, providing information on the population structure of
The FST is used to estimate the degree of population differentia- P. nicotianae that can be used for designing effective management
tion. It is suggested that FST values of 0 to 0.05 represent little genetic programs for black shank.
differentiation, 0.05 to 0.15 represent moderate genetic differentia- Both races 0 and 1 were found in different areas in Georgia in the
tion, 0.15 to 0.25 represent great genetic differentiation, and FST val- study, which is in agreement with findings from earlier studies. It was
ues greater than 0.25 represent very great genetic differentiation reported that races 1 and 0 of P. nicotianae were widely distributed in
(Hartl and Clark 1997). Pairwise comparisons of population differen- tobacco-producing regions in Georgia, with an increase of race 1
tiation (FST) for sampling location and race of P. nicotianae support population from 16% (Csinos and Bertrand 1994) to 83% (Csinos

Fig. 2. Unweighted pair group method with arithmetic mean cluster analysis of Phytophthora nicotianae isolates.

1116 Plant Disease / Vol. 101 No. 7

2005), probably due to increased use of Ph gene-carrying tobacco that mefenoxam remained effective for black shank management
cultivars. In the present study, 50.8 and 39.0% of the isolates were (Parkunan et al. 2010).
identified as race 0 or 1, respectively, indicating that the two races Genetic diversity of P. nicotianae isolates from tobacco has been
are currently the dominant races. About 10% of the isolates we col- assessed in a few studies. Genetic variation of isolates of P. nicotia-
lected in Georgia were race 3 and not reported previously in the state. nae in a single tobacco field in North Carolina was determined by
Race 3 of P. nicotianae was first identified in Connecticut in the amplified fragment length polymorphism (AFLP) analysis (Sullivan
1970s (McIntyre and Taylor 1978). More recently, it was reported et al. 2010). About half of the isolates were clustered in one genetic
in North Carolina (Gallup and Shew 2010) and Virginia (Parkunan group and the other half were divided into 27 AFLP groups, with no
et al. 2010). Existence of race 3 in Georgia indicates that this race relationship between races (0 and 1) and AFLP groups. Diversity of
is widely distributed in the southeastern United States. 63 isolates from tobacco in China was assessed using randomly am-
Mefenoxam or metalaxyl (active ingredient: mefenoxam) is the plified polymorphic DNA (RAPD) analysis (Zhang et al. 2003). The
primary fungicide used to control black shank in tobacco. An earlier isolates were clustered in two major groups, with no relationship be-
study conducted in Georgia showed that tobacco P. nicotianae iso- tween RAPD groups and geographical origins of the isolates. In a re-
lates had different sensitivity to metalaxyl, with ED50 ranging from cent study (Biasi et al. 2016), diversity of 20 isolates of P. nicotianae
0.96 to <0.01 mg/ml (Csinos and Bertrand 1994). It appeared that from tobacco was evaluated by SSR markers. Variability among the
sensitivity of P. nicotianae isolates in Georgia to mefenoxam did isolates was observed and genetic variation was associated with geo-
not reduce over the last two decades because the EC50 for inhibiting graphical locations of isolation. In the present study, the P. nicotia-
mycelial growth of the isolates, in the present study, ranged from nae isolates from different locations in Georgia were grouped in
<0.01 to 0.12 mg/ml. Resistance to mefenoxam has not been reported two major clusters by SSR analysis. The groupings were based on
in isolates of P. nicotianae from tobacco. In South Africa, sensitivity
of 132 P. nicotianae isolates from tobacco to metalaxyl was studied
(Van Jaarsveld et al. 2002). Metalaxyl at 1.0 mg/ml completely Table 4. Pairwise fixation index values for races of Phytophthora nicotianae
inhibited growth of most of the isolates, although isolates from some isolatesa
areas had higher EC50 values of 1.02 to 3.57 mg/ml. Studies with iso- Race Race 0 Race 1 Race 3
lates of P. nicotianae from tobacco in North Carolina for sensitivity
to metalaxyl indicated that ED50 values were 0.3 to 1.2 mg/ml (Shew Race 0 … … …
1985). A more recent study showed that the majority of P. nicotianae Race 1 0.29* … …
isolates from tobacco in Virginia were highly sensitive to mefe- Race 3 0.00 0.07 …
noxam and a few isolates were intermediately sensitive, suggesting a Asterisk (*) indicates significant at P < 0.001 based on 9,999 permutations.

Fig. 3. Bar plots of individual Bayesian assignment probabilities of simple sequence repeats for Phytophthora nicotianae isolates using the program Structure for two clusters. Each
vertical line represents an individual’s probability of belonging to one of k clusters (represented by different colors) or a combination if ancestry is mixed. For each isolate, race
designation is provided in parentheses.

Table 3. Pairwise fixation index values based on collection location of Phytophthora nicotianae isolates in Georgiaa
Location Bacon County Berrien County Cook County Tift County Toombs County
Bacon County … … … … …
Berrien County 0.78* … … … …
Cook County 0.00 0.64* … … …
Tift County 0.00 0.76* 0.07** … …
Toombs County 0.00 0.77* 0.11** 0.03 …
a Asterisks * and ** indicate significant at P < 0.001 and 0.05, respectively, based on 9,999 permutations.

Plant Disease / July 2017 1117

collection location, and group I was primarily composed of isolates Hampl, V., Pavlı́cek, A., and Flegr, J. 2001. Construction and bootstrap analysis of
that were race 1 (75%) and group II isolates were primarily (69%) DNA fingerprinting-based phylogenetic trees with a freeware program
FreeTree: Application to trichomonad parasites. Int. J. Syst. Evol. Microbiol.
race 0. These findings are in agreement with the previous studies that 51:731-735.
P. nicotianae populations on tobacco are genetically diverse. Hartl, D. L., and Clark, A. G. 1997. Principles of Population Genetics, 3rd ed.
The majority of isolates sampled from Georgia were the A2 mating Sinauer Associates, Inc., Sunderland, MA.
type. The existence of a single mating type of the pathogen in most of Ji, P., Csinos, A. S., Hickman, L. L., and Hargett, U. 2014. Efficacy and application
the sampling fields may imply low probability of sexual recombina- methods of oxathiapiprolin for management of black shank on tobacco. Plant
tion, which could have contributed to the low genetic diversity at a Dis. 98:1551-1554.
Lamprecht, M. P., Prinsloo, G. C., and van Wyk, R. J. 1974. Inheritance of
particular geographical location. It was reported (Parkunan et al. resistance to race 2 of the black shank fungus, Phytophthora nicotianae
2010) that the majority (about 94%) of P. nicotianae isolates from (B. de Haan) var. nicotianae, of tobacco. Agroplantae 6:73-76.
tobacco in Virginia were the A2 mating type and 6% of the isolates McIntyre, J. L., and Taylor, G. S. 1978. Race 3 of Phytophthora parasitica var.
were A1. In another study (Peng et al. 2011), P. nicotianae isolated nicotianae. Phytopathology 68:35-38.
from tobacco in Guizhou, China, were determined to be A2 and other Nei, M., and Li, W. H. 1979. Mathematical model for studying genetic variation in
terms of restriction endonucleases. Proc. Natl. Acad. Sci. USA 76:5269-5273.
mating types were not present, indicating a low possibility of sexual Parkunan, V., Johnson, C. S., Bowman, B. C., and Hong, C. X. 2010. Population
recombination. structure, mating type, and mefenoxam sensitivity of Phytophthora nicotianae
In summary, this study provides new insights into the current sta- in Virginia tobacco fields. Plant Dis. 94:1361-1365.
tus and diversity of P. nicotianae affecting tobacco in Georgia. A Peakall, R., and Smouse, P. E. 2012. GenAlEx 6.5: Genetic analysis in Excel.
new race (race 3) was identified in the state for the first time, and Population genetic software for teaching and research-an update. Bioinformatics
28:2537-2539.
all isolates were found to be sensitive or intermediately sensitive to Peng, L. J., Ding, H. X., and Ge, Y. Y. 2011. Mating type and distribution of
mefenoxam, which is valuable information for tobacco growers to Phytophthora nicotianae in Guizhou province. J. Henan Agric. Sci. 40:93-96.
manage the disease. The SSR markers used in this study were a useful Pritchard, J. K., Stephans, M., and Donnelly, P. 2000. Inference of population
tool to analyze genetic diversity of the pathogen, which revealed that structure using multilocus genotype data. Genetics 155:945-959.
P. nicotianae populations isolated from tobacco grown in Georgia Qu, T., Shao, Y., Csinos, A. S., and Ji, P. 2016. Sensitivity of Phytophthora
could be classified into two groups. Further research to monitor po- nicotianae from tobacco to fluopicolide, mandipropamid and oxathiapiprolin.
Plant Dis. 100:2119-2125.
tential gene migration among populations of the pathogen at different Rohlf, F. J. 2008. NTSYSpc: Numerical Taxonomy System, Version 2.20. Exeter
locations would advance our understanding of the spread and ecol- Publ., Setauket, NY.
ogy of this important pathogen in tobacco production. Shew, H. D. 1985. Response of Phytophthora parasitica var. nicotianae to
metalaxyl exposure. Plant Dis. 69:559-562.
Shew, H. D., and Lucas, G. B. 1998. Compendium of Tobacco Diseases, 2nd ed.
Literature Cited American Phytopathological Society, St. Paul, MN.
Apple, J. L. 1967. Occurrence of race 1 of Phytophthora parasitica var. nicotianae Sullivan, M. J., Parks, E. J., Cubeta, M. A., Gallup, C. A., Melton, T. A., Moyer,
in North Carolina and its implications in breeding for disease resistance. Tob. J. W., and Shew, H. D. 2010. An assessment of the genetic diversity in a field
Sci. 11:79-83. population of Phytophthora nicotianae with a changing race structure. Plant
Biasi, A., Martin, F. N., Cacciola, S. O., di San Lio, G. M., Grünwald, N. J., and Dis. 94:455-460.
Schena, L. 2016. Genetic analysis of Phytophthora nicotianae populations from Van Jaarsveld, E., Wingfield, M. J., and Drenth, A. 2002. Evaluation of tobacco
different hosts using microsatellite markers. Phytopathology 106:1006-1014. cultivars for resistance to races of Phytophthora nicotianae in South Africa.
Csinos, A. S. 2005. Relationship of isolate origin to pathogenicity of race 0 and 1 of J. Phytopathol. 150:456-462.
Phytophthora parasitica var. nicotianae on tobacco cultivars. Plant Dis. 89: Wang, Z., Langston, D. B., Csinos, A. S., Gitaitis, R. D., Walcott, R. R., and Ji, P.
332-337. 2009. Development of an improved isolation approach and simple sequence
Csinos, A. S., and Bertrand, P. F. 1994. Distribution of Phytophthora parasitica repeat markers to characterize Phytophthora capsici in irrigation ponds in
var. nicotianae races and their sensitivity to metalaxyl in Georgia. Plant Dis. southern Georgia. Appl. Environ. Microbiol. 75:5467-5473.
78:471-474. Wolfe, K., and Stubbs, K. 2015. 2014 Georgia Farm Gate Value Report. AR-15-
Earl, D. A., and von Holdt, B. M. 2012. Structure Harvester: A website and 01. The Center for Agribusiness and Economic Development, University of
program for visualizing Structure output and implementing the Evanno Georgia College of Agricultural and Environmental Sciences, Athens, GA.
method. Conserv. Genet. Resour. 4:359-361. You, F. M., Huo, N., Gu, Y. Q., Luo, M., Ma, Y., Hane, D., Lazo, G. R., Dvorak, J.,
Erwin, D. C., and Ribeiro, O. K. 1996. Phytophthora nicotianae. Pages 391-407 and Anderson, O. D. 2008. BatchPrimer3: A high throughput web application
in: Phytophthora Diseases Worldwide. American Phytopathological Society, for PCR and sequencing primer design. BMC Bioinformatics 9:253.
St. Paul, MN. Zhang, X. G., Sun, W. X., Guo, L., Yu, J. F., and Chang, C. J. 2003. Genetic and
Gallup, C. A., and Shew, H. D. 2010. Occurrence of race 3 of Phytophthora pathogenic variation among tobacco black shank strains of Phytophthora
nicotianae in North Carolina, the causal agent of black shank of tobacco. parasitica var. nicotianae from the main tobacco growing in China. J.
Plant Dis. 94:557-562. Phytopathol. 151:259-266.

1118 Plant Disease / Vol. 101 No. 7