AL – SALAAM PRIMARY AND SECONDARY SCHOOL

BIOLOGY FORM FOUR

CHAPTER FOUR

The Genetic Material & Protein Synthesis

Q1: Choose the correct answer for each of the following

1. For which of the following is DNA responsible?

a. Directing RNA to make lipids
b. Directing RNA to produce glucose
c. Encoding information for making proteins
d. Encoding information for changing the genetic code
2. Where is RNA found?
a. Only in proteins
b. Only in the nucleus
c. Only in the cytoplasm
d. In the nucleus and cytoplasm
3. What is the basic unit of DNA called?
a. Sugar
b. Nucleotide
c. Phosphate
d. Nucleus acid
4. Which of the following nucleic acids is involved in translation?
a. DNA only
b. mRNA only
c. DNA and mRNA
d. mRNA and tRNA

1|Page Mohamed Ali Ahmed

 5. Within each organism, which nucleotides are found in similar percentages?
a. A and T, G and C
b. A and C, G and T
c. A and C,G and U
d. A and G, T and U
6. Which of the following is NOT a component of DNA?
a. The pyrimidine uracil
b. Five carbon sugars
c. The purine adenine
d. Phosphate groups
7. The basic mechanism of DNA replication is semi-conservative with two new molecules,
a. Each with new strands
b. One with all new strands and one with all old strands
c. Each with one new and one old strands
d. Each with a mixture of old and new strands
8. The bonds that hold two complementary strands of DNA together are
a. Hydrogen bond
b. Peptide bonds
c. Ionic bonds
d. Phosphodiester bonds
9. If one strands of a DNA is 5’ ATCGTTAAGCGAGTCA 3’, then the complementary
strand would be:
a. 5’ TAGCAATTCGCTCAGT 3’
b. 5’ ACTGAGCGAATTGCTA 3’
c. 5’ TGACTCGCTTAACGAT 3’
d. 5’ ATCGTTAAGCGAGTCA 3’
10. Pre-mRNA contains which of the following?
a. Exons only
b. Introns only
c. Both introns and exons
d. Neither introns nor exons

2|Page Mohamed Ali Ahmed

 11. In the genetic code, one codon
a. Consists of three bases
b. Specifies a single amino acid
c. Specifies more than one amino acid
d. Both a and b are correct.
12. An anticodon would be found on which of the following type of RNA?
a. mRNA
b. rRNA
c. tRNA
d. None of all
13. During translation, the codon in mRNA is actually “read” by
a. The A site in the ribosome
b. The P site in the ribosome
c. The anticodon in a tRNA
d. The anticodon
14. The splicing process
a. Occurs in prokaryotes
b. Joins introns together
c. Can produce multiple mRNAs from the same transcript
d. Only joins exons for each gene in one way.
15. If the sequence of (AGC) is a part of the DNA, what is the complementary codon of
mRNA?
a. GGC
b. AGC
c. UCG
d. GCU

3|Page Mohamed Ali Ahmed

Q2: Answer the following Questions:

1. Name the three parts of a nucleotide.

 The three parts of a nucleotide are:
 5 carbon Sugar
 Nitrogenous bases
 Phosphate Group
2. State the base-pairing rules in DNA
 The basic pairing rule for DNA is: (A-T), (C-G)
 Adenine is paired with Thymine, Guanine is paired with Cytosine
3. A template strand of DNA has the following sequence:
3’ – CGTTACCCGAGCCGTACGATTAGG -5’
Use the sequence information to determine
a. The predicted sequence of the mRNA for this gene.
b. The predicted amino acid sequence of the protein
 A. The predicted sequence of the mRNA for this gene is
5'GCAAUGGGCUCGGCAUGCUAAUCC-3'
 B. The predicted amino acid sequence of the protein is 5'GCA AUG GGC UCG GCA UGC
UAA UCC 3' MET-GLY-SER-ALA-CYS-STOP
 B.
Code Amino acid
GCA Alanine
AUG Methionine
GGC Glycine
UCG Serine
GCA Alanine
UGC Serine
UAA Stop code
UCC serine

4|Page Mohamed Ali Ahmed

 4. What is the meaning of:
Genetic code, codon, anticodon, intron, exon, transcription and translation.
 Genetic code: is a sequence of nucleotides in the DNA.
 Codon: are triple bases or nucleotides of the mRNA are called the codon.
 Anticodon: are triple bases or nucleotides of the tRNA are called anticodon.
 Intron: are noncoding sections in pre-mRNA.
 Exon: The sections of DNA (or RNA) that code for proteins are called exons.
 Transcription: is the process by which the genetic instruction in a specific gene
are transcribed or “written” into an RNA molecule.
 Translation: is the process of converting the information of mRNA (codon) into
sequence of amino acids in the process of protein synthesis.
5. Compare types of RNA according structure and function.
 Cells have three major types of RNA
 Messenger RNA (mRNA): this carries the instructions from a gene to make a
protein. mRNA carries the genetic “message” from DNA in the nucleus to the
ribosomes in the cytosol.
 Ribosomal RNA (rRNA): this is an RNA that is part of the structure of ribosomes
which are made of rRNAs and protein.
 Transfer RNA (tRNA) this an RNA which transfers amino acids to the ribosome
to make a protein.
6. Describe the role of helicases and DNA polymerases during DNA replication.
 Role of DNA helicases: moves among the DNA double helix, breaking the torsion and
separating the two chains.
 Role of DNA polymerases: bind the new nucleotides with older chains as a
complimentary.
7. State why DNA replication is a semiconservative process.
 Because In each new molecule is made one old DNA strand and one new DNA strand.
8. Summarize the follow of genetic information
 DNA transcription RNA translation protein
9. Sequence the main steps of transcription
 Anitiation: RNA polymerase binds to a sequence of DNA called the promoter, found
near the beginning of a gene.

5|Page Mohamed Ali Ahmed

  Elongation: One strand of DNA, the template strand, acts as a template for RNA
polymerase.
 Termination: Sequences called terminators signal that the RNA transcript is
complete.
10. List the four ways in which the structure of RNA differ from that of DNA.
 DNA has the bases adenine, thymine, guanine, cytosine.
 RNA has the bases adenine, uracil, guanine, cytosine.
 DNA has sugar deoxiribose.
 RNA has sugar ribose.
 DNA is double stranded.
 RNA is single stranded.
 DNA can duplicate itself
 RNA cannot.
DNA RNA

Double helix Single helix

Has deoxyribose sugar Has ribose sugar

Has thymine Has uracil

In the nucleus In the nucleus and cytoplasm

6|Page Mohamed Ali Ahmed