1

MCB 402: MOLECULAR BIOLOGY AND GENETIC ENGINEERING

BY

Ichor Smart Ph.D.

DNA, RNA and protein synthesis

The genetic material is stored in the form of DNA in most organisms. In humans, the nucleus of
each cell contains 3 × 109 base pairs of DNA distributed over 23 pairs of chromosomes, and each
cell has two copies of the genetic material. This is known collectively as the human genome. The
human genome contains around 30 000 genes, each of which codes for one protein.

Large stretches of DNA in the human genome are transcribed but do not code for proteins. These
regions are called introns and make up around 95% of the genome. The nucleotide sequence of
the human genome is now known to a reasonable degree of accuracy but we do not yet
understand why so much of it is non-coding. Some of this non-coding DNA controls gene
expression but the purpose of much of it is not yet understood. This is a fascinating subject that
is certain to advance rapidly over the next few years.

The process by which DNA is copied to RNA is called transcription, and that by which RNA is
used to produce proteins is called translation.

DNA replication

Each time a cell divides, each of its double strands of DNA splits into two single strands. Each of
these single strands acts as a template for a new strand of complementary DNA. As a result, each
new cell has its own complete genome. This process is known as DNA replication. Replication is
controlled by the Watson-Crick pairing of the bases in the template strand with incoming
deoxynucleoside triphosphates, and is directed by DNA polymerase enzymes. It is a complex
process, particularly in eukaryotes, involving an array of enzymes.

DNA biosynthesis proceeds in the 5'- to 3'-direction. This makes it impossible for DNA
polymerases to synthesize both strands simultaneously. A portion of the double helix must first
unwind, and this is mediated by helicase enzymes.

The leading strand is synthesized continuously but the opposite strand is copied in short bursts of
about 1000 bases, as the lagging strand template becomes available. The resulting short strands
are called Okazaki fragments (after their discoverers, Reiji and Tsuneko Okazaki). Bacteria have
at least three distinct DNA polymerases: Pol I, Pol II and Pol III; it is Pol III that is largely
involved in chain elongation. Strangely, DNA polymerases cannot initiate DNA synthesis de
novo, but require a short primer with a free 3'-hydroxyl group. This is produced in the lagging
strand by an RNA polymerase (called DNA primase) that is able to use the DNA template and
synthesize a short piece of RNA around 20 bases in length. Pol III can then take over, but it
eventually encounters one of the previously synthesized short RNA fragments in its path. At this
point Pol I takes over, using its 5'- to 3'-exonuclease activity to digest the RNA and fill the gap
 2

with DNA until it reaches a continuous stretch of DNA. This leaves a gap between the 3'-end of
the newly synthesized DNA and the 5'-end of the DNA previously synthesized by Pol III. The
gap is filled by DNA ligase, an enzyme that makes a covalent bond between a 5'-phosphate and a
3'-hydroxyl group. The initiation of DNA replication at the leading strand is more complex.

Mistakes in DNA replication

DNA replication is not perfect. Errors occur in DNA replication, when the incorrect base is
incorporated into the growing DNA strand. This leads to mismatched base pairs, or mispairs.
DNA polymerases have proofreading activity, and a DNA repair enzymes have evolved to
correct these mistakes. Occasionally, mispairs survive and are incorporated into the genome in
the next round of replication. These mutations may have no consequence, they may result in the
death of the organism, they may result in a genetic disease or cancer; or they may give the
organism a competitive advantage over its neighbours, which leads to evolution by natural
selection.

Transcription

Transcription is the process by which DNA is copied (transcribed) to mRNA, which carries the
information needed for protein synthesis. Transcription takes place in two broad steps. First, pre-
messenger RNA is formed, with the involvement of RNA polymerase enzymes. The process
relies on Watson-Crick base pairing, and the resultant single strand of RNA is the reverse-
complement of the original DNA sequence. The pre-messenger RNA is then "edited" to produce
the desired mRNA molecule in a process called RNA splicing.

Formation of pre-messenger RNA

The mechanism of transcription has parallels in that of DNA replication. As with DNA
replication, partial unwinding of the double helix must occur before transcription can take place,
and it is the RNA polymerase enzymes that catalyze this process.

Unlike DNA replication, in which both strands are copied, only one strand is transcribed. The
strand that contains the gene is called the sense strand, while the complementary strand is the
antisense strand. The mRNA produced in transcription is a copy of the sense strand, but it is the
antisense strand that is transcribed.

Ribonucleoside triphosphates (NTPs) align along the antisense DNA strand, with Watson-Crick
base pairing (A pairs with U). RNA polymerase joins the ribonucleotides together to form a pre-
messenger RNA molecule that is complementary to a region of the antisense DNA strand.
Transcription ends when the RNA polymerase enzyme reaches a triplet of bases that is read as a
"stop" signal. The DNA molecule re-winds to re-form the double helix.

RNA splicing: The pre-messenger RNA thus formed contains introns which are not required for
protein synthesis. The pre-messenger RNA is chopped up to remove the introns and create
messenger RNA (mRNA) in a process called RNA splicing
 3

Alternative splicing

In alternative splicing, individual exons are either spliced or included, giving rise to several
different possible mRNA products. Each mRNA product codes for a different protein isoform;
these protein isoforms differ in their peptide sequence and therefore their biological activity. It is
estimated that up to 60% of human gene products undergo alternative splicing. Several different
mechanisms of alternative splicing are known

Alternative splicing contributes to protein diversity - a single gene transcript (RNA) can have
thousands of different splicing patterns, and will therefore code for thousands of different
proteins: a diverse proteome is generated from a relatively limited genome. Splicing is important
in genetic regulation (alteration of the splicing pattern in response to cellular conditions changes
protein expression). Perhaps not surprisingly, abnormal splicing patterns can lead to disease
states including cancer.

Reverse transcription

In reverse transcription, RNA is "reverse transcribed" into DNA. This process, catalyzed by
reverse transcriptase enzymes, allows retroviruses, including the human immunodeficiency virus
(HIV), to use RNA as their genetic material. Reverse transcriptase enzymes have also found
applications in biotechnology, allowing scientists to convert RNA to DNA for techniques such as
PCR.

Translation

The mRNA formed in transcription is transported out of the nucleus, into the cytoplasm, to the
ribosome (the cell's protein synthesis factory). Here, it directs protein synthesis. Messenger RNA
is not directly involved in protein synthesis - transfer RNA (tRNA) is required for this. The
process by which mRNA directs protein synthesis with the assistance of tRNA is called
translation.

The ribosome is a very large complex of RNA and protein molecules. Each three-base stretch of
mRNA (triplet) is known as a codon, and one codon contains the information for a specific
amino acid. As the mRNA passes through the ribosome, each codon interacts with the anticodon
of a specific transfer RNA (tRNA) molecule by Watson-Crick base pairing. This tRNA molecule
carries an amino acid at its 3'-terminus, which is incorporated into the growing protein chain.
The tRNA is then expelled from the ribosome.

Transfer RNA

Transfer RNA adopts a well defined tertiary structure which is normally represented in two
dimensions as a cloverleaf shape.

Two-dimensional structures of tRNA (transfer RNA)In some tRNAs the DHU arm has only
three base pairs.
 4

Each amino acid has its own special tRNA (or set of tRNAs). For example, the tRNA for
phenylalanine (tRNAPhe) is different from that for histidine (tRNAHis). Each amino acid is
attached to its tRNA through the 3'-OH group to form an ester which reacts with the α-amino
group of the terminal amino-acid of the growing protein chain to form a new amide bond
(peptide bond) during protein synthesis. The reaction of esters with amines is generally
favourable but the rate of reaction is increased greatly in the ribosome.

Each transfer RNA molecule has a well defined tertiary structure that is recognized by the
enzyme aminoacyl tRNA synthetase, which adds the correct amino acid to the 3'-end of the
uncharged tRNA. The presence of modified nucleosides is important in stabilizing the tRNA

structure.

The Genetic code

The genetic code is almost universal. It is the basis of the transmission of hereditary information
by nucleic acids in all organisms. There are four bases in RNA (A,G,C and U), so there are 64
possible triplet codes (43 = 64). In theory only 22 codes are required: one for each of the 20
naturally occurring amino acids, with the addition of a start codon and a stop codon (to indicate
the beginning and end of a protein sequence). Many amino acids have several codes
(degeneracy), so that all 64 possible triplet codes are used. For example Arg and Ser each have 6
codons whereas Trp and Met have only one. No two amino acids have the same code but amino
acids whose side-chains have similar physical or chemical properties tend to have similar codon
sequences, e.g. the side-chains of Phe, Leu, Ile, Val are all hydrophobic, and Asp and Glu are
both carboxylic acids. This means that if the incorrect tRNA is selected during translation (owing
to mispairing of a single base at the codon-anticodon interface) the misincorporated amino acid
will probably have similar properties to the intended tRNA molecule. Although the resultant
protein will have one incorrect amino acid it stands a high probability of being functional.
Organisms show "codon bias" and use certain codons for a particular amino acid more than
others. For example, the codon usage in humans is different from that in bacteria; it can
sometimes be difficult to express a human protein in bacteria because the relevant tRNA might
be present at too low a concentration.

First base (5'-end) Middle base Third Base ('3-end)

U C A G
U U Phe Phe Leu Leu
C Ser Ser Ser Ser
A Tyr Tyr Stop Stop
G Cys Cys Stop Trp
C U Leu Leu Leu Leu
C Pro Pro Pro Pro
A His His Gln Gln
G Arg Arg Arg Arg
A U lle lle lle Met
C Thr Thr Thr Thr
 5

First base (5'-end) Middle base Third Base ('3-end)

U C A G
A Asn Asn Lys Lys
G Ser Ser Arg Arg
G U Val Val Val Val
C Ala Ala Ala Ala
A Asp Asp Glu Glu
G Gly Gly Gly Gly

An exercise in the use of the genetic code

One strand of genomic DNA (strand A, coding strand) contains the following sequence reading
from 5' to 3':

TCGTCGACGATGATCATCGGCTACTCGA

This strand will form the duplex

5'-TCGTCGACGATGATCATCGGCTACTCGA-3' 3'-
AGCAGCTGCTACTAGTAGCCGATGAGCT-5'

The sequence of bases in the other strand of DNA (strand B) written 5' to 3' is therefore

TCGAGTAGCCGATGATCATCGTCGACGA

In the mRNA transcribed from strand A of DNA, the sequence of bases written 5' to 3' is

UCGAGUAGCCGAUGAUCAUCGUCGACGA

resulting in an amino acid sequence

Ser-Ser-Ser-Arg-STOP

However, if DNA strand B is the coding strand the mRNA sequence will be

UCGUCGACGAUGAUCAUCGGCUACUCGA

and the amino-acid sequence will be

Ser-Ser-Thr-Met-Ile-Ile-Gly-Tyr-Ser-

The Wobble hypothesis

Close inspection of all of the available codons for a particular amino acid reveals that the
variation is greatest in the third position (for example, the codons for alanine are GCU, GCC,
 6

GCA and GCG). Crick and Brenner proposed that a single tRNA molecule can recognize codons
with different bases at the 3'-end owing to non-Watson-Crick base pair formation with the third
base in the codon-anticodon interaction. These non-standard base pairs are different in shape
from A·U and G·C and the term wobble hypothesis indicates that a certain degree of flexibility or
"wobbling" is allowed at this position in the ribosome.

The ability of DNA bases to form wobble base pairs as well as Watson-Crick base pairs can
result in mismatches occurring during DNA replication. If not repaired by DNA repair enzymes,
these mismatches can lead to genetic diseases and cancer.

Overview of Regulation of Gene Expression

For a cell to function properly, necessary proteins must be synthesized at the proper time. All
cells control or regulate the synthesis of proteins from information encoded in their DNA. The
process of “turning on” a gene to produce mRNA and protein is called gene expression.
Whether in a simple unicellular organism or a complex multi-cellular organism, each cell
controls when its genes are expressed, how much of the protein is made, and when it is time to
stop making that protein because it is no longer needed.

The regulation of gene expression conserves energy and space. It is more energy efficient to turn
on the genes only when they are required. In addition, only expressing a subset of genes in each
cell saves space because DNA must be unwound from its tightly coiled structure to transcribe
and translate the DNA. Cells would have to be enormous if every protein were expressed in
every cell all the time. The control of gene expression is extremely complex. Malfunctions in
this process are detrimental to the cell and can lead to the development of many diseases,
including cancer.

Prokaryotic versus Eukaryotic Gene Expression

Since prokaryotic organisms are single-celled organisms that lack a cell nucleus, their DNA
floats freely in the cell’s cytoplasm. When a particular protein is needed, the gene that codes for
it is transcribed in mRNA, which is simultaneously translated into protein. When the protein is
no longer needed, transcription stops. As a result, the primary method to control how much of
each protein is expressed in a prokaryotic cell is the regulation of transcription.

Eukaryotic cells, in contrast, have intracellular organelles that add to their complexity. In
eukaryotic cells, the DNA is contained inside the cell’s nucleus, where it is transcribed into
mRNA. The newly synthesized mRNA is then modified and transported out of the nucleus into
the cytoplasm, where ribosomes translate the mRNA into protein. The processes of transcription
and translation are physically separated by the nuclear membrane; transcription occurs only
within the nucleus, and translation occurs only in the cytoplasm. The regulation of gene
expression in eukaryotes can occur at all stages of the process.

Prokaryotic Gene Regulation

 7

The DNA of prokaryotes is organized into a circular chromosome that resides in the cell’s
cytoplasm. Proteins that are needed for a specific function, or that are involved in the same
biochemical pathway, are often encoded together in blocks called operons. For example, all five
of the genes needed to make the amino acid tryptophan in the bacterium E. coli are located next
to each other in the trp operon. The genes in an operon are transcribed into a single mRNA
molecule. This allows the genes to be controlled as a unit: either all are expressed, or none is
expressed. Each operon needs only one regulatory region, including a promoter, where RNA
polymerase binds, and an operator, where other regulatory proteins bind.

In prokaryotic cells, there are three types of regulatory molecules that can affect the expression
of operons. Activators are proteins that increase the transcription of a gene. Repressors are
proteins that suppress transcription of a gene. Finally, inducers are molecules that bind to
repressors and inactivate them. Below are two examples of how these molecules regulate
different operons.

The trp Operon: A Repressor Operon

Like all cells, bacteria need amino acids to survive. Tryptophan is one amino acid that the
bacterium E. coli can either ingest from the environment or synthesize. When E. coli needs to
synthesize tryptophan, it must express a set of five proteins that are encoded by five genes.
These five genes are located next to each other in the tryptophan (trp) operon.

When tryptophan is present in the environment, E. coli does not need to synthesize it, and the trp
operon is switched off. However, when tryptophan availability is low, the trp operon is turned
on so that the genes are transcribed, the proteins are made, and tryptophan can be synthesized.

A DNA sequence called the operator is located between the promoter and the first trp gene. The
operator contains the DNA code to which the repressor protein can bind. The repressor protein is
regulated by levels of tryptophan in the cell.

When tryptophan is present in the cell, two tryptophan molecules bind to the trp repressor. This
causes the repressor to change shape and bind to the trp operator. Binding of the tryptophan–
repressor complex at the operator physically blocks the RNA polymerase from binding, and
transcribing the downstream genes. Thus, when the cell has enough tryptophan, it is preventing
from making more.

When tryptophan is not present in the cell, the repressor has no tryptophan to bind to it. The
repressor is not activated and it does not bind to the operator. Therefore, RNA polymerase can
transcribe the operon and make the enzymes to synthesize tryptophan. Thus, when the cell does
not have enough tryptophan, it synthesizes it.
 8

The lac Operon: An Inducer Operon

The lac operon in E. coli has more complex regulation, involving both a repressor and an
activator. E. coli uses glucose for food, but is able to use other sugars, such as lactose, when
glucose concentrations are low. Three proteins are needed to break down lactose; they are
encoded by the three genes of the lac operon.

When lactose is not present, the proteins to digest lactose are not needed. Therefore, a repressor
binds to the operator and prevents RNA polymerase from transcribing the operon.

When lactose is present, lactose binds to the repressor and removes it from the operator. RNA
polymerase is now free to transcribe the genes necessary to digest lactose.

However, the story is more complex than this. Since E. coli prefers to use glucose for food, the
lac operon is only expressed at low levels even when the repressor is removed. But what happens
when ONLY lactose is present? Now the bacterium needs to ramp up production of the lactose-
digesting proteins. It does so by using an activator protein called catabolite activator protein
(CAP).

When glucose levels drop, cyclic AMP (cAMP) begins to accumulate in the cell. cAMP binds to
CAP and the complex binds to the lac operon promoter. This increases the binding ability of
RNA polymerase to the promoter and ramps up transcription of the genes.

Eukaryotic Gene Regulation

In eukaryotes, control of gene expression is more complex and can happen at many different
levels. Eukaryotic genes are not organized into operons, so each gene must be regulated
independently. In addition, eukaryotic cells have many more genes than prokaryotic cells.
Regulation of gene expression can happen at any of the stages as DNA is transcribed into mRNA
and mRNA is translated into protein. For convenience, regulation is divided into five levels:
epigenetic, transcriptional, post-transcriptional, translational, and post-translational Epigenetic
Control fo Gene Expression

The first level of control of gene expression is epigenetic (“around genetics”) regulation.
Epigenetics is a relatively new, but growing, field of biology.

Epigenetic control involves changes to genes that do not alter the nucleotide sequence of the
DNA and are not permanent. Instead, these changes alter the chromosomal structure so that
genes can be turned on or off. This level of control occurs through heritable chemical
modifications of the DNA and/or chromosomal proteins.

One example of chemical modifications of DNA is the addition of methyl groups to the DNA, in
a process called methylation, In general, methylation suppresses transcription. Interestingly,
methylation patterns can be passed on as cells divide. Thus, parents may be able to pass on the
tendency of a gene to be expressed in their offspring. Other heritable chemical modifications of
DNA may also occur.
 9

Modification of Histone Proteins is an Example of Epigenetic Control

The best-studied example of epigenetic regulation is modification of histone proteins. Histones

are chromosomal proteins that tightly wind DNA so that it fits into the nucleus of a cell. The
human genome, for example, consists of over three billion nucleotide pairs. An average
chromosome contains 130 million nucleotide pairs, and each body cell contains 46
chromosomes. If stretched out linearly, an average human chromosome would be over four
centimeters long. In order to fit all of this DNA into the nucleus of a microscopic cell, the DNA
must be tightly wound around proteins. It is also organized so that specific segments can be
accessed as needed by a specific cell type.

The first level of organization, or packing, is the winding of DNA strands around histone
proteins. Histones package and order DNA into structural units called nucleosome complexes,
which can control the access of proteins to the DNA regions. Under the electron microscope, this
winding of DNA around histone proteins to form nucleosomes looks like small beads on a string.
These beads (histone proteins) can move along the string (DNA) and change the structure of the
molecule.

If a gene is to be transcribed, the nucleosomes surrounding that region of DNA can slide down
the DNA to open that specific chromosomal region and allow access for RNA polymerase and
other proteins, called transcription factors, to bind to the promoter region and initiate
transcription. If a gene is to remain turned off, or silenced, the histone proteins and DNA have
different modifications that signal a closed chromosomal configuration. In this closed
configuration, the RNA polymerase and transcription factors do not have access to the DNA and
transcription cannot occur.

How the histone proteins move is dependent on signals found on the histone proteins. These
signals are “tags” – in the form of phosphate, methyl, or acetyl groups – that open or close a
chromosomal region. These tags are not permanent, but may be added or removed as needed.
Since DNA negatively charged, changes in the charge of the histone will change how tightly
wound the DNA molecule will be. When unmodified, the histone proteins have a large positive
charge; by adding chemical modifications like acetyl groups, the charge becomes less positive.

Transcriptional Control of Gene Expression

Transcriptional regulation is control of whether or not an mRNA is transcribed from a gene in

a particular cell. Like prokaryotic cells, the transcription of genes in eukaryotes requires an RNA
polymerase to bind to a promoter to initiate transcription. In eukaryotes, RNA polymerase
requires other proteins, or transcription factors, to facilitate transcription initiation.
Transcription factors are proteins that bind to the promoter sequence and other regulatory
sequences to control the transcription of the target gene. RNA polymerase by itself cannot
initiate transcription in eukaryotic cells. Transcription factors must bind to the promoter region
first and recruit RNA polymerase to the site for transcription to begin.
 10

The Promoter and Transcription Factors

In eukaryotic genes, the promoter region is immediately upstream of the coding sequence. This
region can range from a few to hundreds of nucleotides long. The length of the promoter is gene-
specific and can differ dramatically between genes. The longer the promoter, the more available
space for proteins to bind. Consequently, the level of control of gene expression can differ quite
dramatically between genes. The purpose of the promoter is to bind transcription factors that
control the initiation of transcription.

Within the promoter region, just upstream of the transcriptional start site, resides the TATA box.
This box is simply a repeat of thymine and adenine dinucleotides (literally, TATA repeats).
Transcription factors bind to the TATA box, assembling an initiation complex. Once this
complex is assembled, RNA polymerase binds to its upstream sequence and becomes
phosphorylated. This releases part of the protein from the DNA, activates the transcription
initiation complex, and places RNA polymerase in the correct orientation to begin transcription.

Figure 1. Each gene has a promoter upstream of the coding sequence. The promoter binds to
transcription factors and helps RNA polymerase to bind and start transcription. Many genes also
have upstream enhancers. Enhancers bind activators, bend around, and help RNA polymerase
start transcription.
 11

Enhancers and Repressors

In some eukaryotic genes, there are regions that help increase transcription. These regions, called
enhancers, are not necessarily close to the genes; they can be located thousands of nucleotides
away. They can be found upstream, within the coding region, or downstream of a gene.
Enhancers are binding sites for activators. When an enhancer is far away from a gene, the DNA
folds such that the enhancer is brought into proximity with the promoter, allowing interaction
between the activators and the transcription initiation complex.

Like prokaryotic cells, eukaryotic cells also have mechanisms to prevent transcription.
Transcriptional repressors can bind to promoter or enhancer regions and block transcription.
Both activators and repressors respond to external stimuli to determine which genes need to be
expressed.

Post-transcriptional Control of Gene Expression

Post-transcriptional regulation occurs after the mRNA is transcribed but before translation
begins. This regulation can occur at the level of mRNA processing, transport from the nucleus to
the cytoplasm, or binding to ribosomes.

Control of RNA Stability

Another type of post-transcriptional control involves the stability of the mRNA in the cytoplasm.
The longer an mRNA exists in the cytoplasm, the more time it has to be translated, and the more
protein is made. Many factors contribute to mRNA stability, including the length of its poly-A
tail.

Proteins, called RNA-binding proteins (RBPs) can bind to the regions of the RNA just upstream
or downstream of the protein-coding region. These regions in the RNA that are not translated
into protein are called the untranslated regions, or UTRs. The region just before the protein-
coding region is called the 5′ UTR, whereas the region after the coding region is called the 3′
UTR. The binding of RBPs to these regions can increase or decrease the stability of an RNA
molecule, depending on the specific RBP that binds.

microRNAs, or miRNAs, can also bind to the RNA molecule. miRNAs are short (21–24
nucleotides) RNA molecules that are made in the nucleus as longer pre-miRNAs and then
chopped into mature miRNAs by a protein called dicer. miRNAs bind to mRNA along with a
ribonucleoprotein complex called the RNA-induced silencing complex (RISC). The RISC-
miRNA complex rapidly degrades the target mRNA

Translational Control of Gene Expression

After an mRNA has been transported to the cytoplasm, it is translated into proteins. Control of
this process is largely dependent on the mRNA molecule. As previously discussed, the stability
of the mRNA will have a large impact on its translation into a protein. Translation can also be
regulated at the level of binding of the mRNA to the ribosome. Once the mRNA bound to the
 12

ribosome, the speed and level of translation can still be controlled. An example of translational
control occurs in proteins that are destined to end up in an organelle called the endoplasmic
reticulum (ER). The first few amino acids of these proteins are a tag called a signal sequence. As
soon as these amino acids are translated, a signal recognition particle (SRP) binds to the signal
sequence and stops translation while the mRNA-ribosome complex is shuttled to the ER. Once
they arrive, the SRP is removed and translation resumes.

Post-translational Control of Gene Expression

The final level of control of gene expression in eukaryotes is post-translational regulation.

This type of control involves modifying the protein after it is made, in such as way as to affect
its activity. One example of post-translational regulation is enzyme inhibition. When an enzyme
is no longer needed, it is inhibited by a competitive or allosteric inhibitor, which prevents it from
binding to its substrate. The inhibition is reversible, so that the enzyme can be reactivated later.
This is more efficient than degrading the enzyme when it is not needed and then making more
when it is needed again.

The activity and/or stability of proteins can also be regulated by adding functional groups, such
as methyl, phosphate, or acetyl groups. Sometimes these modifications can regulate where a
protein is found in the cell—for example, in the nucleus, the cytoplasm, or attached to the
plasma membrane.

The addition of an ubiquitin group to a protein marks that protein for degradation. Ubiquitin
acts like a flag indicating that the protein’s lifespan is complete. Tagged proteins are moved to a
proteasome, an organelle that degrades proteins. One way to control gene expression, therefore,
is to alter the longevity of the protein.

POLYMERASE CHAIN REACTION (PCR)

Polymerase chain reaction (PCR) is a technique that can test for the presence of the specific
microorganism, family of microorganisms or expressed genes in environmental samples such as
soil, water or sediment (Wilson et al., 1999), air (Alvarez et al., 1994). Kary Mullis conceived
the idea for the polymerase chain reaction (Mullis, 1990) in the spring of 1983 while an
employee of Cetus Corporation, a biotechnology firm located near Berkeley,California. Mullis
and his assistant Fred Faloona tried to get it to work later in the year, and were soon joined by
other Cetus scientists who saw the great potential of this method. In this later group were people
in Henry Erlich's lab, who had been working on methods to identify mutations in human
genomic DNA as part of a DNA diagnostics group at Cetus. Description of PCR was terse in
their first publication, a 1985 article in Science (Saiki et al., 1985), on detection of the mutation
causing sickle cell anaemia in whole genomic DNA.The details of the PCR method and its uses
were covered more fully in articles published in the next two years (Mullis et al.,1986; Mullis
 13

and Faloona, 1987). A generalnarrative of the invention of PCR, the internal politics of Cetus
Corporation, and the philosophy and anthropology of scientific invention can be found in the
book by Rabinow (Rabinow, 1996).

The DNA polymerase originally used for the PCR was extracted from the bacterium E. coli.
However, after each cycle of DNA synthesis, the reaction must be heated to denature the double
stranded DNA product. Unfortunately, heating also irreversibly inactivated this polymerase, so
new enzyme had to be added at the start of each cycle. The bacterium T. aquaticus lives in hot
springs and produces a DNA polymerase which is not irreversibly inactivated at high
temperature. David Gelfand and his associates at Cetus, purified (Saiki etal., 1988), and
subsequently cloned this polymerase (Lawyer etal., 1993) allowing a complete PCR
amplification to be done without opening the reaction tube. However, the thermostable enzyme
was found to be much more than just a convenience. The DNA synthesis step could now be done
at a higher temperature than was possible with the E. coli enzyme, and it was discovered that the
template DNA strand was now copied with high fidelity,eliminating the nonspecific products
that had plagued earlier attempts at amplification.

In 1993 Kary Mullis was awarded the Nobel Prize for the discovery of PCR.

PCR technique also known as a DNA photocopier is an in vitro technique that uses a
few basic everyday molecular biology reagents to make large numbers of copies of a
specific DNA fragment or a specific region of a DNA strand in a test-tube. The process
which is carried out in a PCR machine requires DNA template, primer(s), Taq or other
polymerase(s), deoxynucleoside triphosphates (dNTPs), buffer solution and divalent
cations (eg.Mg2+ ) to run (Mullis and Faloona, 1987).

PCR permits the detection of target nucleic acid sequences of DNA thereby eliminating the
requirement for growth to detect and identify microorganisms, though when combined with
traditional monitoring of contaminant concentration over time, using PCR to identify
microorganisms capable of degrading contaminants can provide valuable information for site
management and remedy selection.Therefore, in providing a survey for specific microorganisms
or developing targeted information for specific genes which helps in site conceptual model
 14

development, remedy selection and optimization and determination of contaminant attenuation

rates (Lebron et al., 2008).

PCR techniques became popular during the late 1980s and 1990s within the biotechnology
industry and have been very useful in medical diagnosis and environmental detection of
microorganisms. The method is capable of generatingmultiple copies of a specific (target) DNA
sequence(copies of a portion of described gene, entire gene or gene clusters) that are present in a
sample thus representing microorganisms or group of related microorganisms known to
biodegrade contaminants within a shortest possible time with high level of accuracy. It is widely
used for the amplification of 16S rRNA, or its gene before fingerprinting studies.The 16S rRNA
gene is present in all life forms as such considered essential since it encodes the small subunit of
the prokaryotic ribosome.

There are several features of 16S rRNAs and their genes that make it suitable for studies as
phylogenetic markers:

 They are universally present in all cellular forms of life.

 They have sequences with extensive database for pairwise comparison.
 The genes act as molecular chronometer.
 The primary structure is an attenuating sequence of non-variant DNA which is more or
less conserved to highly variable regions.
 The size of nucleotides makes them easier for analysis.
 The function of the ribosomes has remained constant in that it has not changed.
 Lateral gene transfer is rare and therefore absent.
 The genes allow for culture independent analysis of unknown microbial communities
(EMD, 2011; Philp et al., 2005).

Reverse transcriptase PCR (RT-PCR) is a laboratory method which is capable of transforming

RNA associated with biodegradation into complementary DNA (cDNA) that is then detected by
PCR. PCR can be used to amplify DNA sequences for use in further analysis of the sequence by
other environmental molecular diagnostics techniques such as quantitative polymerase chain
reaction (qPCR), microarray analysis and microbial fingerprinting techniques such as denaturing
gradient gel electrophoresis (DGGE). PCR has been used to detect microorganisms capable of
 15

degrading contaminants such as petroleum hydrocarbons, pentachlorophenol, perchlorate,

polychlorinated biphenyls (PCBs), metals, radionuclides and chlorinated solvents (Lebron et al.,
2008; Medigan et al., 2010; Wilson et al., 1999). PCR also has potential applicability in other
environmental monitoring efforts such as tracking of faecal microorganisms (microbial source
tracking) and identifying and tracking microorganisms potentially related to chemical
compounds originating from industrial or energy related activities.

Phylogenetic relationships can be assessed using PCR by pairwise similarities through GenBank
16S rRNA sequence database at NCBI. One hundred percent similarity found between a pair of
16S rRNA sequences by different methods indicates very close relationship to the identity of the
organism being investigated. If the value is lower, it implies that the organisms compared are
unrelated (Philpet al., 2005).

BASIC STEPS INVOLVED IN CONDUCTING PCR

The basic steps in conducting a conventional PCR involves:

i. Denaturation achieved by heating the reaction mixture to a temperature between

90-98 °C such that the dsDNA is denatured into single strands by disrupting the
hydrogen bonds between complementary bases. Oligonucleotide primers are then
added.
ii. A reaction mixture containing all the four deoxynucleotide triphosphates
(dATP,dCTP,dGTP,dTTP) and a thermostable DNA polymerase is added. A
DNA polymerase (Taq) that is not denatured by the high temperature needed to
separate the DNAstrands is used. It is usually sourced from Thermus aquqticus, a
bacterium isolated from hot springs.
iii. Annealing which is achieved by cooling the reaction mixture to a temperature of
45-60 °C such that the primers base pair with the complementary sequence in the
DNA and the hydrogen bonds reform. Primer annealing takes 20 seconds.
iv. Elongation is achieved by adjusting the temperature to 72 °C. This temperature is
considered ideal for polymerase thereby allowing primers extension by joining
the bases complementary to DNA strands; the polymerase continually adds
dNTP's from 5' to 3', reading the template from 3' to 5' side, bases are added
 16

complementary to the template. This completes a first cycle from which another
cycle is continued. As PCR machine is automated thermocycler the same cycle is
repeated up to 30-40 times. Polymerization continues until each newly
synthesized strand has proceeded far enough to contain the site recognized by the
other primer. At this point there would be exactly two copies of the target DNA
sequence (Saiki et al., 1988).
v. The mixture is heated again at 90-95 0C to denature the molecules and separate
the strands and the cycle repeated. Each new strand then acts as a template for
the next cycle of synthesis. Thus amplification proceeds at an exponential
(logarithmic) rate, that is amount of DNA, produced doubles at each cycle. The
amplified product at the end of PCR is called amplicon.
PCR Requirement
The requirement for carrying out PCR include:Thermal cycler, PCR
amplification mix typically containing: sample dsDNA with a target sequence,
thermostable DNA polymerase, two oligonucleotide primers,deoxynucleotide
triphosphate (dNTPs) and reaction buffer containing magnesium ions and other
components.
A typical thermal cycle might be as follows:

-Heat denaturation at 94oCfor 20 seconds

-Primer annealing at 55oCfor 20 seconds

- Primer extension at 72oCfor 30 seconds

Average time for each cycle is approximately 4-5 minutes, considering the fact that
heating and cooling between each stage also have to be considered.
Initiallythesestepsatthree different temperatures were carried out in separate water baths
but nowadays a thermal cycler is used (a machine that automatically changes the
temperature at the correct time for each of the stages and can be programmed to carry out
a set number of cycles). After the introduction of thermocycler, each cycle of replication
can be completed in less than 5 minutes. After 30 cycles, a single molecule of DNA is

amplified into more than a billion copies (230= 1.02 x 109).

 17

Post amplification detection: Following PCR, the amplification product can be detected
using gel electrophoresis followed by ethidium bromide staining and visualization with uv
transillumination. Visualization of a band containing DNA fragments of a particular size
can indicate the presence of the target sequence in the original DNA sample. Absence of a
band may indicate that the target sequence was not present in the original DNA sample.
Confirmation of the amplicons can be made by southern blotting using specific probes.
RECOMBINANT DNA TECHNOLOGY
The field of molecular biology has witnessed a ground breaking revolution over the past few
decades, thanks to the advent of recombinant DNA technology. This powerful and
transformative technique has not only deepened our understanding of genetics and biology but
has also opened the door to a myriad of applications in medicine, agriculture, biotechnology, and
beyond. Recombinant DNA, often abbreviated as rDNA, is a cornerstone of genetic engineering,
allowing scientists to manipulate and combine DNA from different sources to create novel
genetic constructs. In this comprehensive exploration of the world of recombinant DNA, its
historical context, fundamental principles, applications, and the ethical considerations that
surround this groundbreaking technology.
Re c o m b i n a n t Dna t e c h n o l o g y, which is also called gene cloning or molecular
cloning, is a general term that encompasses a number of experimental protocols leading to the
transfer of genetic information (DNA) from one organism to another. There is no single set of
methods that can be used to meet this objective; however, a recombinant DNA experiment often
has the following format:
• The DNA (cloned DNA, insert DNA, target DNA, or Foreign DNA) from a donor organism is
extracted, enzymatically cleaved (cut, or digested), and joined (ligated) to another DNA entity (a
cloning vector) to form a new, recombined DNA molecule (cloning vector– insert DNA
construct, or DNA construct).
• This Cloning vector–insert DNA construct Is transferred Into and maintained within a host cell.
The introduction of DNA into a bacterial host cell is called transformation.
• Those host cells that take up The DNA construct (transformed cells) are identified and selected
(separated, or isolated) from those that do not.
• If required, a DNA construct can be created so that the protein product encoded by the cloned
DNA sequence is produced in the host cell.
Recombinant DNA technology was developed from discoveries in molecular biology, nucleic
acid enzymology, and the molecular genetics of both bacterial viruses (bacteriophages) and
bacterial extrachromosomal DNA elements (plasmids). However, recombinant DNA technology
would not exist without the availability of enzymes that recognize specific double- stranded
DNA sequences and cleave the DNA in both strands at these sequences (restriction enzymes, or
restriction endonucleases). Nucleases that cut nucleic acid molecules internally are
endonucleases, and those that degrade from the ends of nucleic acids are exonucleases.
Restriction Endonucleases
 18

For molecular cloning, both the source DNA that contains the target sequence and the cloning
vector must be consistently cut into discrete and reproducible fragments. It was only after
bacterial enzymes that cut DNA molecules internally at specific base pair sequences were
discovered that molecular cloning became feasible.
Restriction enzymes are DNA-cutting enzymes found in bacteria (and harvested from them for
use). Because they cut within the molecule, they are often called restriction endonucleases.
These enzymes are formally designated type II restriction endonucleases. Despite the fact that
there are other kinds of restriction endonucleases (type I, type III, and type IV), the type II
restriction endonucleases are commonly called restriction endonucleases or simply restriction
enzymes. One of the first type II restriction endonucleases to be characterized was from the
bacterium Escherichia coli, and it was originally designated EcoRI.
More recently, it has been proposed that the use of italics for naming restriction endonucleases
be abandoned. EcoRI is a homodimeric protein (it is made up of two identical proteins) that
binds to a DNA region with a specific palindromic sequence (recognition site, or binding site). In
other words, the sequences of nucleotides in the two strands of the binding site are identical
when either is read in the same polarity, i.e., 5′ to 3′. The EcoRI recognition sequence consists of
6 base pairs (bp) and is cut between the guanine and adenine residues on each strand.
EcoRI specifically cleaves the internucleotide bond between the oxygen of the 3′ carbon of the
sugar of one nucleotide and the phosphate group attached to the 5′ carbon of the sugar of the
adjacent nucleotide. The symmetrical staggered cleavage of DNA by EcoRI produces two single-
stranded, complementary cut ends, each with extensions of 4 nucleotides, known as sticky ends.
In this case, each single-stranded extension terminates with a 5′ phosphate group, and the 3′
hydroxyl group of the opposite strand is recessed. In addition to EcoRI, more than 3,700 type II
restriction endonucleases with about 250 different recognition sites have been isolated from
various bacteria.
The naming protocol for these enzymes is the same as that for EcoRI; the genus is the capitalized
letter, and the first two letters of the species name are in lowercase letters. The strain designation
is occasionally added to the name, such as R in EcoRI, or the serotype of the source bacterium is
sometimes noted, such as d in HindIII. The Roman numerals are used to designate the order of
characterization of different restriction endonucleases from the same organism. For example,
HpaI and HpaII are the first and second type II restriction endonucleases that were isolated from
Haemophilus parainfluenzae.
The palindromic sequences where most type II restriction endonucleases bind and cut a DNA
molecule are within the recognition sites. Some restriction endonucleases digest (cleave) DNA,
leaving 5′ phosphate extensions (protruding ends, or sticky ends) with recessed 3′ hydroxyl ends;
some leave 3′ hydroxyl extensions with recessed 5′ phosphate ends; and some cut the backbones
of both strands within a recognition site to produce blunt-ended (flush-ended) DNA molecules.
The lengths of the recognition sites for different enzymes can be four, five, six, eight, or more
nucleotide pairs. Because of the frequency with which their recognition sites occur in DNA,
restriction endonucleases that cleave within sites of four (four-cutters) and six (six-cutters)
 19

nucleotide pairs are used for most of the common molecular-cloning protocols. The importance
of the type II restriction endonucleases for gene cloning cannot be overstated.
When a DNA sample is treated with one of these enzymes, the same set of fragments is always
produced, assuming that all of the recognition sites are cleaved. In addition, ready access to a
variety of restriction endonucleases adds versatility to gene-cloning strategies. Type IIS
restriction endonucleases form a subgroup of the type II category of restriction enzymes and are
occasionally used for cloning and other molecular studies, such as multiplex colony sequencing.
These enzymes have the fascinating feature of cutting DNA, usually in both strands, a fixed
number of nucleotides away from one end of the recognition site. Moreover, any particular
sequence of nucleotides may be present between the binding sequence and the cut sites. The
cleavages for most type IIS restriction enzymes are staggered. For example, the FokI restriction
endonuclease binds to GGATG CCTAC and cuts 9 nucleotides downstream on the upper strand
and 13 nucleotides downstream on the lower strand, producing a recessed 3′ hydroxyl end and a
4-nucleotide extension at the 5′ phosphate end. One representation of the recognition sequence
and cut sites of the FokI restriction endonuclease is GGATGNNNNNNNNN
CCTACNNNNNNNNNNNNN, where N denotes A, C, G, or T. Of course, with this single-letter
code, it is understood that the nucleotides (N) opposite each other are base paired. A simpler
notation is GGATG(N)9 CCTAC(N)13, and perhaps the simplest is GGATG(9/13). It should be
noted that a few type IIS restriction endonucleases cleave DNA both upstream and downstream
from their recognition sites.
Under natural conditions, bacteria use restriction endonucleases to cleave foreign DNA, such as
that of infecting bacterial viruses (bacteriophages), and have developed systems that protect their
own DNA from being degraded. Most often, methylation of the cytosine residues of a restriction
endonuclease site in the host DNA prevents restriction endonucleases from cutting at these sites,
but the nonmethylated sites of foreign DNA are vulnerable to attack. With the characterization of
large numbers of restriction endonucleases from various bacteria, interesting relationships have
been observed. In some instances, different phosphodiester bonds within the same recognition
site are cleaved by restriction endonucleases from different organisms. For example, the
restriction enzymes XmaI and SmaI both recognize the sequence CCCGGG GGGCCC, but
XmaI cleaves after the first 5′ cytosine in each strand and produces 5′ phosphate extensions
whereas SmaI generates blunt ends by cleaving between the CG GC base pair in the middle of
the recognition site.
The first restriction endonuclease that is discovered to bind to a particular recognition site is
designated the prototype. Any additional restriction endonucleases that attack the same sequence
as the prototype are called isoschizomers. For example, the restriction endonucleases XhoI and
PaeR7I from different organisms both have the same recognition sequences and cleavage
locations. Isoschizomers that cleave at different positions within the same recognition site are
neoschizomers. On the other hand, restriction endonucleases that produce the same nucleotide
extensions but have different recognition sites are designated isocaudomers, e.g., BamHI and
Sau3AI.
 20

In some cases, a restriction endonuclease will cleave a sequence only if the cytosines of the
recognition site are not methylated whereas another restriction endonuclease will cut the same
sequence if these cytosines are methylated. For example, HpaII cleaves only nonmethylated
CCGG GGCC sites, and MspI, an isoschizomer of HpaII, cuts this sequence regardless of
cytosine methylation. This pair of restriction endonucleases is often used to determine the
methylation status of genomic DNA.
If a DNA molecule is not cut by HpaII but is cut by MspI, then the recognition site is methylated.
If both restriction endonucleases cleave a DNA molecule, then the site(s) is not methylated.
Physical maps that designate the relative positions of restriction endonuclease sites on a specific
piece of DNA can be constructed by treating the DNA molecule singly with different restriction
endonucleases and then with combinations of the same restriction endonucleases.
The positions of the cleavage sites can be deduced from an analysis of fragment sizes, which are
determined by agarose gel electrophoresis. It can be deduced that this linear piece of DNA has
two BamHI sites and two EcoRI sites in a definite order with a specified number of base pairs
separating the sites. More specifically, the sizes of fragments produced in each single digestion
can be compared with those from double digestions to determine the positions of the restriction
endonuclease sites and to generate a restriction endonuclease site map (restriction endonuclease
map).
Plasmid Cloning Vectors
Plasmids are self-replicating, double-stranded, circular DNA molecules that are maintained in
bacteria as independent extrachromosomal entities.
Virtually all bacterial genera have natural plasmids. Some plasmids carry information for their
own transfer from one cell to another (e.g., F plasmids), others encode resistance to antibiotics
(R plasmids), others carry specific sets of genes for the utilization of unusual metabolites
(degradative plasmids), and some have no apparent functional coding genes (cryptic plasmids).
Although they are not typically essential for bacterial cell survival under laboratory conditions,
plasmids often carry genes that are advantageous under particular conditions. Plasmids can range
in size from less than 1 kb to more than 500 kb. Each plasmid has a sequence that functions as an
origin of DNA replication; without this site, it cannot replicate in a host cell. Some plasmids are
represented by 10 to 100 copies per host cell; these are called high-copy-number plasmids.
Others maintain one to four copies per cell and are called low-copy-number plasmids. Seldom
does the population of plasmids in a bacterium make up more than approximately 0.1 to 5.0% of
the total DNA. When two or more different plasmids cannot coexist in the same host cell, they
are said to belong to the same incompatibility group, but plasmids from different incompatibility
groups can be maintained together in the same cell. This coexistence is independent of the copy
numbers of the individual plasmids.
Some microorganisms have been found to contain as many as 8 to 10 different plasmids. In
these instances, each plasmid can carry out different functions and have its own unique copy
number, and each belongs to a different incompatibility group. Some plasmids, because of the
specificity of their origin of replication, can replicate in only one species of host cell.
 21

Other plasmids have less specific orgins of replication and can replicate in a number of bacterial
species. These plasmids are called narrow- and broad-host-range plasmids, respectively. As
autonomous, self-replicating genetic elements, plasmids have the basic attributes to make them
potential vectors for carrying cloned DNA. However, naturally occurring (unmodified, or
nonengineered) plasmids often lack several important features that are required for a high-quality
cloning vector. The more important features are:
(1) a choice of unique (single) restriction endonuclease recognition sites into which the insert
DNA can be cloned and
(2) one or more selectable genetic markers for identifying recipient cells that carry the cloning
vector–insert DNA construct. In other words, plasmid cloning vectors have to be genetically
engineered.
Transformation and Selection
The next step in a recombinant DNA experiment requires the uptake of the cloned plasmid DNA
by a bacterial cell, usually E. coli. The process of introducing purified DNA into a bacterial cell
is called transformation, and a cell that is capable of taking up DNA is said to be competent.
Competence occurs naturally in many bacteria. In different bacterial species, usually when cell
density is high or starvation is impending, a set of proteins is produced that facilitates the uptake
of DNA molecules. This phenomenon allows genes to be transferred between different bacteria.
A natural transformation process often entails:
(1) the binding of double-stranded DNA to components of the cell wall;
(2) entry of the DNA into an inner compartment (periplasm), where it is protected from enzymes
that degrade nucleic acids (nucleases);
(3) transmission of one strand into the cytoplasm while the other one is degraded; and
(4) if the DNA is a linear molecule, integration into the host chromosome. If the introduced
DNA is a plasmid, it is maintained in the cytoplasm after the second strand is synthesized.
Competence and transformation are not intrinsic properties of E. coli. However, competence can
be induced in E. coli by various special treatments, such as cold calcium chloride, which in turn
enhance the acquisition of DNA by the cell. A brief heat shock facilitates the uptake of
exogenous DNA molecules. Two parameters—transformation frequency and transformation
efficiency—are used to assess the success of DNA transformation.
The transformation frequency is the ratio of transformed cells to the total number of treated cells.
The transformation efficiency is the number of transformed cells as a function of the amount of
DNA that was originally added to the cells. Generally, transformation is an inefficient process,
with typically no more than 1 cell in 1,000 being transformed. After transformation, most of the
cells have not acquired a new plasmid. Furthermore, a few cells are transformed by
recircularized plasmid DNA that escaped dephosphorylation alkaline phosphatase, others acquire
ligated and nonligated nonplasmid DNA, and a few are transformed by the plasmid–insert DNA
construct. As noted earlier, extrachromosomal DNA that lacks an origin of replication cannot be
maintained within a bacterial cell. Thus, the uptake of nonplasmid DNA is usually of no
consequence in a recombinant DNA experiment.
 22

To ensure that a plasmid–cloned DNA construct is perpetuated in its original form, the E. coli
host cells should have certain features. For example, the absence of restriction endonucleases
ensures that DNA constructs will not be degraded after transformation.
In addition, the integrity of DNA constructs is more likely to be maintained in host cells that are
unable to carry out exchanges between DNA molecules because the host cells are recombination
negative (RecA−). Also, cells that do not produce the endonuclease encoded by the endA1 gene
have increased transformation frequencies. After the transformation step, it is necessary to
identify, as easily as possible, those cells that contain plasmids with cloned DNA. In a pBR322
system in which the target DNA was inserted into the BamHI site, this specific identification is
accomplished using the two antibiotic resistance markers that are carried on the plasmid.
Following transformation, the cells are incubated in medium without antibiotics to allow the
antibiotic resistance genes to be expressed, and then the transformation mixture is plated onto
medium that contains the antibiotic ampicillin.
Applications of recombinant DNA
Recombinant DNA technology has found a wide range of applications across various fields:
Medicine: One of the most significant applications of recombinant DNA technology is in
medicine. It has enabled theproduction of therapeutic proteins and drugs through genetic
engineering. Insulin, for instance, was one of the first recombinant DNA products, and it
revolutionized the treatment of diabetes. Similarly, recombinant DNA technology is used to
produce growth hormone, clotting factors, and vaccines.
Agriculture: In agriculture, recombinant DNA technology has been employed to create
Genetically Modified Organisms (GMOs) with desirable traits. This includes crops that are
resistant to pests, diseases, or herbicides, as well as those with enhanced nutritional profiles.
Genetically modified crops have contributed to increased food production and reduced
agricultural losses.
Biotechnology: Recombinant DNA is a cornerstone of biotechnology. It is used in the
production of biofuels, enzymes, and specialty chemicals. In research, it allows scientists to
manipulate genes and study their functions, facilitating the development of new therapies and
diagnostic tools.
Forensics:
DNA fingerprinting, a technique that relies on theunique patterns of DNA sequences, is widely
used in forensic science for identifying individuals and solving crimes. Recombinant DNA
technology plays a crucial role in DNA analysis and profiling.
Environmental applications:
Recombinant DNA technology has been employed in environmental monitoring and
remediation. It allows the development of biosensors to detect pollutants and the creation of
microorganisms capable of degrading environmental contaminants.
Recombinant DNA technology has transformed the fields of biology, medicine, agriculture, and
biotechnology. It has enabled the production of life-saving drugs, the development of genetically
modified crops, and the advancement of scientific analysis. However, along with its vast
potential, it brings ethical challenges that require careful consideration and regulation.
 23

As analysts continue to push the boundaries of genetic engineering, society must engage in
informed discussions about the responsible use of recombinant DNA technology to harness its
benefits while minimizing potential risks. The genetic revolution is ongoing, and our
understanding of recombinant DNA continues to evolve, promising a future filled with both
opportunities and ethical dilemmas.
Making a Genomic Library
One of the fundamental objectives of molecular biotechnology is the isolation of genes that
encode proteins for industrial, agricultural, and medical applications. In prokaryotic organisms,
structural genes form a continuous coding domain in the genomic DNA, whereas in eukaryotes,
the coding regions (exons) of structural genes are separated by noncoding regions (introns).
Consequently, different cloning strategies have to be used for cloning prokaryotic and eukaryotic
genes. In a prokaryote, the desired sequence (target DNA, or gene of interest) is typically a
minuscule portion (about 0.02%) of the total chromosomal DNA. The problem, then, is how to
clone and select the targeted DNA sequence.
To do this, the complete DNA of an organism, i.e., the genome, is cut with a restriction
endonuclease, and each fragment is inserted into a vector. Then, the specific clone that carries
the target DNA sequence must be identified, isolated, and characterized. The process of
subdividing genomic DNA into clonable elements and inserting them into host cells is called
creating a library (clone bank, gene bank, or genomic library).
A complete library, by definition, contains the entire genomic DNA of the source organism. One
way to create a genomic library is to first treat the DNA from a source organism with a four-
cutter restriction endonuclease, e.g., Sau3AI, which theoretically cleaves the DNA
approximately once in every 256 bp. The conditions of the digestion reaction are set to give a
partial, not a complete, digestion. In this way, all possible fragment sizes are generated. Partial
digestions are carried out with a low concentration of restriction endonuclease or shortened
incubation times.
The fragments become smaller as the reaction period is extended.
To ensure that the entire genome, or most of it, is contained within the clones of a library, the
sum of the inserted DNA in the clones of the library should be three or more times the amount of
DNA in the genome. For example, if a genome has 4 × 106 bp and the average size of an insert is
1,000 bp, then 12,000 clones are required for three fold coverage, i.e., 3[(4 × 10 6 )/103 ]. For the
human genome (3.3 × 109 bp), about 80,000 bacterial artificial chromosome (BAC) clones that
have an average insert size of 150,000 bp compose a library with fourfold coverage, i.e., 4[(3.3 ×
109 )/(15 × 104 )].
From a statistical perspective, the relationship N = ln(1 − P)/ln(1 − f) (where N is the number of
clones, P is the probability of finding a specific gene, and f is the ratio of the length of the
average insert to the size of the entire genome) provides an estimate of the number of clones that
is necessary for a comprehensive genomic library. On this basis, about 700,000 clones are
required for a 99 % chance of discovering a particular sequence in a human genomic library with
an average insert size of 20 kb.
 24

Finally, because restriction endonuclease sites are not randomly located, some fragments may be
too large to be cloned. When this occurs, it may be difficult or even impossible to find a specific
target DNA sequence because the library is incomplete. This problem can be overcome by
forming libraries with different restriction endonucleases. Clearly, the number of clones in a
genomic library depends on the extent of the coverage, the size of the genome of the organism,
and the average size of the insert in the vector. After a library is created, the clone(s) with the
target sequence must be identified. Four popular methods of identification are used: DNA
hybridization with a labeled DNA probe followed by radiographic screening for the probe label,
immunological screening for the protein product, assaying for protein activity, and functional
(genetic) complementation.
BIOINFORMATICS AND GENOMICS.
Molecular Databases
Scientific information is generally presented for expert scrutiny in peer-reviewed articles that are
published in professional periodicals. However, in the mid- to late 1980s, molecular biology
journals were devoting more and more pages to DNA, RNA, and protein sequences derived from
individually cloned genes. Moreover, anyone who wanted to conduct comparative analyses of
nucleotide or amino acid sequences among related genes or proteins, as well as other kinds of
analyses, had the unenviable task of typing out all the sequences from the relevant publications.
The GenBank database was established in 1982 in anticipation of the increasing availability of
DNA sequences. Its purpose was the collection, management, storage, and distribution of
sequence data.
At first, submissions to GenBank were sporadic, but almost complete compliance was achieved
when many journals made database submission a prerequisite for publication. From that point
on, the database became an integral part of sequence-based research. Initially, access to the
GenBank database was through servers that were linked to NSFnet (National Science Foundation
Network). By current standards, the original GenBank interface was primitive, and the download
times were interminable.
From 1990 to 1995, largescale projects, such as genetic and physical mapping of the human
genome, partial sequencing of thousands of complementary DNAs (cDNAs) (expressed
sequence tags [ESTs]), and sequencing of entire genomes, required additional databases and the
expansion of the existing databases for storing and retrieving information. NSFnet was replaced
in 1995 by the Internet (World Wide Web). Thereafter, submissions, access, and especially
retrieval (data mining) of stored molecular information became rapid and easy. The visual
aspects of the online sites improved dramatically, and links among relevant databases were
established. Ready access through the Internet led to the creation of specialized databases for
gene-specific mutations, regulatory sequences, mitochondrial genes and functions, specific
human genetic diseases, protein–protein interactions, protein structures, gene expression data,
and many other types of data.
Generally, the area of research that generates, analyzes, and manages the mountains of
information about genome sequences and all the genes that are transcribed in various cell types
 25

and tissues has been designated genomics. Studies of the entire protein populations of various
cell types and tissues and the numerous protein–protein interactions has been dubbed proteomics.
As new methods were implemented and research targets became more focused, other “omics,”
such as metagenomics, functional genomics (transcriptomics), and metabolomics, emerged.
Generally, the suffix “omics” implies large-scale, whole-genome experimentation, with the
analysis of many samples at one time. As a consequence of this high throughput, there is heavy
reliance on computers and computer programs for assembling, analyzing, archiving, and
distributing genomic data. Diverse computer resources have been developed to handle the
various kinds of genomic information.
The amount of information generated from massively parallel experimental systems is huge. For
example, since its inception, the sequence information in GenBank has been doubling every 18
months. More specifically, after 25 years, GenBank contained more than 80 billion nucleotide
bases from about 80 million sequences derived from more than 100,000 different organisms.
Currently, there are more than 900 molecular databases that range from major DNA and protein
sequence repositories (e.g., GenBank, Ensembl, UCSC Gene Browser, Genome Database,
Universal Protein Resource, and the Ribosomal Database Project) that provide genomic and
proteomic data to bibliographic and informational resources (e.g., OMIM, PubMed, RefSeq, and
Gene Clinics).
Clearly, the proliferation of molecular databases would not have been possible without either
high-speed computers or the programmers who develop the means whereby the information can
be used by the scientific community. Because of its distinctive nature, the extensive use of
computers for storage and analysis of molecular data has become known as bioinformatics.
Broadly speaking, bioinformatics is the development and application of computational tools for
the submission, storage, organization, archiving, acquisition, analysis, and visualization of
biological and medical data.
Database contents are routinely accessed through Internet sites that have tutorials (e.g.,
http://www.ncbi.nlm.nih.gov/Education/) with instructions for accessing the information and
explanations of how to use the software tools for sequence similarity searches, gene prediction,
and many other kinds of analyses. Most molecular databases are designed to meet the needs of
researchers and are not meant for curious visitors.
There are, however, many useful websites that provide overviews of genomics, proteomics,
bioinformatics, and other related topics. In sum, the adage “necessity is the mother of invention,”
which was coined by Richard Franck (1624–1708), aptly encapsulates how bioinformatics has
advanced both genomic and proteomic research.
Programs are written to analyze and visualize the experimental data, and accessible databases
have been developed that are augmented with additional descriptive features (annotations) and
linked to other sources of data to combine as much relevant material as possible. Information is
now accessible that would have been impossible to obtain in the past, and importantly, novel
studies can be contemplated that previously were considered impossible.
METAGENOMICS
 26

For more than 100 years, the identification of microorganisms and the characterization of their
biological functions have required cultivating each strain in the laboratory. In the 1990s, with the
emergence of techniques to extract DNA directly from environmental samples, such as soil and
seawater, researchers began to examine the sequence diversity of microorganisms using the
universal 16S ribosomal RNA gene as a taxonomic marker.
These studies revealed that less than 1% of all bacterial species could be cultured, and therefore,
novel genes that might be of considerable interest for basic and applied research were
inaccessible using methods that depended on growth of bacteria in the laboratory. Considering
the wealth of biotechnologically important genes and proteins that had been obtained from the
relatively few culturable microorganisms, the possibility of harvesting useful genes from the
much greater number of unculturable microorganisms was exciting, if not daunting. With the
development of high-efficiency cloning, robotic workstations that handle thousands of
transformed cells, inexpensive DNA sequencing, microbial DNA sequence databases, and
bioinformatics resources for processing, standardizing, and storing information, it has become
possible to access the genomes of uncultured organisms from environmental and clinical
samples. The study of the collective genomes in these samples is known as metagenomics. The
primary objective of a metagenomic project is to construct a comprehensive DNA library from
all the microorganisms of a particular ecosystem or location.
The metagenomic clones can be characterized in various ways. One tactic entails sequencing the
entire library using the shotgun sequencing strategy with the aim of assembling contiguous
sequences of DNA (contigs) from as many different genomes as possible and identifying both
novel and homologous gene sequences. For example, a massive study that included 50 ocean
samples from locations in the North Atlantic through the Panama Canal to the South Pacific
yielded 6.3 × 109 bases of sequence.
Analysis of the assembled and nonassembled sequences indicated that there might be as many as
400 new bacterial species among the samples, with about 1 × 106 genes that lack significant
sequence similarity with any known gene. The analysis also revealed sequences encoding
potentially novel forms of many proteins, including proteins for repair of ultraviolet light-
induced DNA damage and RuBisCO (ribulose bisphosphate carboxylase), an enzyme that is
important for carbon fixation.
Sequence-based metagenomic projects are especially effective with microbial communities that
have relatively few species. For example, some bacteria are able to thrive on pyrite (iron sulfide)
ore sediments and are associated with extremely acidic runoff from metal and coal mines (acid
mine drainage). Not only is this acidic water (often pH <1.0) harmful to aquatic and terrestrial
ecosystems, but it leaches out environmentally hazardous heavy metal contaminants, such as
copper, lead, zinc, and cadmium, from the ore sediments and mine tailings. The toxic runoff
often continues long after the mining operation has been abandoned. Thus, there is considerable
interest in learning more about the metabolic pathways of the microorganisms found in these
environments and how they survive under such conditions. This information may contribute to
more effective control measures for curtailing the production of acid. In one metagenomic study
of an abandoned mine site in California, the nearly complete genomes of the two major bacterial
 27

species (Leptospirillum group II and Ferroplasma type II) and partial genomes of three other
microbes were cloned and assembled. Although more research is required to determine the
metabolic dynamics of this microbial community, gene assignments for the different genomes
indicated that a rare member of the assemblage, Leptospirillum group III, plays a critical role. It
may be the only organism that fixes atmospheric nitrogen in this environment, and as a result, it
acts as the primary source of nitrogenous compounds and ammonia for the other
microorganisms.
Metagenomic libraries are frequently screened for enzyme activity to identify novel enzymes
with biotechnological potential. Selection for growth of transformed Escherichia coli cells on
particular substrates, complementation tests, and, most often, simple indicator systems are used
for these studies. In one example, a metagenomic library was screened for cloned lipase genes by
growing transformed cells on agar plates that were supplemented with various triglyceride
substrates, such as tricaprylin, and isolating colonies that were surrounded by a clear zone, i.e., a
halo. The halo indicated that the colony produced and secreted an enzyme that digested
tricaprylin.
Relatively large DNA fragments (typically between 5 and 40 kilobase pairs [kb]) must be cloned
to ensure that all genes encoding proteins in the pathway for catabolism of a substrate, often
encoded in a polycistronic operon, are present in a transformed cell. These function-based
metagenomic projects have identified a myriad of enzymes. The availability of robotic systems
for maintaining and transferring transformed cells has been extremely helpful for expression-
based studies, because on average, about 104 to 106 metagenomic clones must be screened to
detect one or two positive colonies. However, there is an inherent limitation with the host cell,
usually E. coli, for selection schemes that depend on transcription and translation of the cloned
gene. Computer modeling using codon usage and other transcription and translation features
from the genes of many different microorganisms suggests that only 40% of the heterologous
genes will be expressed in E. coli. Consequently, to increase the likelihood of identifying
additional novel genes, broad-host-range vectors and other host cells are being used for
constructing and maintaining metagenomic libraries.
Specialized gene expression systems aid in detecting metagenomic clones that carry genes with
certain functions. One example of this type of strategy has been called substrate-induced gene
expression (SIGEX) screening. As the name suggests, this procedure identifies catabolic genes
that are expressed when their promoters are activated in the presence of particular substrates and
relies on the cloning of regulatory elements that are often found upstream of the catabolic genes
that they control. The system utilizes a vector that contains the green fluorescent protein (gfp)
gene under the control of the lac promoter (plac) in a pUC-based plasmid, designated p18GFP.
The cloning site lies between the lac promoter and the gfp gene. DNA from a microbial
community is fragmented and cloned into p18GFP. The cells are grown in the presence of
ampicillin, to prevent the growth of untransformed cells, and IPTG (isopropyl-β-d-
thiogalactopyranoside), which induces the expression of green fluorescent protein from the lac
promoter.
 28

Cells that produce green fluorescent protein in the presence of IPTG are those that carry
plasmids without inserts (i.e., selfligated plasmids), plasmids with inserts that do not prevent
transcription of gfp from the lac promoter (for example, the insert does not contain a
transcriptional terminator), or plasmids with inserts containing promoters that are constitutively
active. Transformed cells of interest in this procedure are those that do not produce green
fluorescent protein in the presence of IPTG because they carry plasmids with inserts that do not
induce expression of gfp under these conditions. To remove cells that produce green fluorescent
protein in the presence of IPTG, the transformed cells are subjected to fluorescence-activated cell
sorting (FACS).
Briefly, FACS consists of streaming cells in single file past a laser beam that detects the
excitation of a fluorochrome that is either attached to or, as in this example, inside the cell and
sorts fluorescent and nonfluorescent cells into separate collection vessels. Accordingly, with
SIGEX screening, the cells with green fluorescent protein, which fluoresces green when exposed
to blue light, are separated from the cells that do not synthesize green fluorescent protein and,
therefore, do not fluoresce. The green fluorescent protein-negative cells are then grown in the
presence of a low-molecular-weight substrate, for example, benzoate. The purpose of this step is
to identify the metagenomic clones that carry cloned DNA segments that are required for
activation of catabolic genes by the interaction of the target substrate, e.g., benzoate. Regulatory
elements, including genes encoding regulatory proteins and the DNA elements that they bind to
in the presence of the target substrate, are usually close to the promoter of the catabolic operon,
and therefore, at least a portion of the catabolic operon is likely to also be present on the cloned
segment. If a catabolic operon is activated by the substrate and transcription continues through
the gfp gene, then green fluorescent protein will be produced.
Consequently, a second round of FACS is carried out, and the cells that express green
fluorescent protein in the presence of the substrate are retained. This procedure enables rapid,
high-throughput screening of a metagenomic library with various substrates. In a broader
context, algorithms have been developed to detect prokaryotic gene sequences, to recognize
DNA sequences that are specific for particular microbial species, and to distinguish members of
known gene families. In sum, the metagenomics approach has begun to reveal an immense
amount of information about the vast microbial world that barely a decade ago was considered
beyond reach.
Sequence-Based Metagenomics
Sequenced-based analysis can involve complete sequencing of clones containing phylogenetic
anchors that indicate the taxonomic group that is the probable source of the DNA fragment.
Alternatively, random sequencing can be conducted, and once a gene of interest is identified,
phylogenetic anchors can be sought in the flanking DNA to provide a link of phylogeny with the
functional gene. A promising application of phylogenetic anchor-guided sequencing is to collect
and sequence many genomic fragments from one taxon. In more complex environments and
 29

taxa, reassembly of a genome may not be feasible, but inference about the physiology and
ecology of the members of the groups can be gleaned from sequence data. This approach has
been initiated with clones from diverse soils carrying 16S rRNA genes that affiliate with the
Acidobacteria phylum, which is abundant in soil and highly diverse (Barns et al., 1999) and
about which little is known (Liles et al., 2003). Complete sequencing of the estimated 500 kb of
Acidobacterium DNA in metagenomic libraries may provide insight into the subgroups of
bacteria in this phylum that have never been cultured.
The use of phylogenetic markers either as the initial identifiers of DNA fragments to study or as
indicators of taxonomic affiliation for DNA fragments carrying genes of interest because of their
function is limited by the small number of available markers that provide reliable placement in
the Tree of life. If a fragment of DNA that is of interest for other reasons does not carry a
dependable marker, its organism of origin remains unknown. The collection of phylogenetic
markers is growing, and as the diversity of markers increases, the power of this approach will
also increase, making it possible to assign more fragments of anonymous DNA to the organisms
from which they were isolated. Moreover, as more genomes are reconstructed, more genes will
be linked to phylogenetic markers even though they were not cloned initially on the same
fragment (Tyson et al., 2006)
Functional Genomics
Genomics encompasses the study of all features of genomes and individual genes at the DNA
level, including mutations, polymorphisms, and phylogenetic relationships that are based on
sequence differences. Another aspect of genomics that is often called functional genomics (or
transcriptomics) is concerned with the patterns of transcription, either qualitatively to determine
which genes are expressed or quantitatively to measure changes in the levels of transcription of
genes. Transcription at the wholegenome level is assessed as a function of clinical conditions, as
a consequence of mutations, in response to natural or toxic agents, in different cells or tissues, or
at different times during biological processes, such as cell division or the development of an
organism.
One of the aims of gene expression studies is to discover the genes that are up- and down
regulated under specific conditions (the transcriptome). In the past, the transcription of only one
or a few genes could be followed at a time. Currently, functional genomics methodology can
track the simultaneous transcription of thousands of genes (gene expression profiling) of either a
cell or a tissue sample. The main experimental approaches for determining gene expression
profiles are DNA microarrays and serial analysis of gene expression (SAGE). Because of the
large amount of data that is generated from these experiments, special computational tools are
required for obtaining, storing, and analyzing the results.
 30

HUMAN GENE CLONING

WHAT IS MEANT BY REPRODUCTIVE CLONING OF ANIMALS INCLUDING
HUMANS?

Reproductive cloning is defined as the deliberate production of genetically identical individuals.

Each newly produced individual is a clone of the original. Monozygotic (identical) twins are
natural clones. Clones contain identical sets of genetic material in the nucleus—the compartment
that contains the chromosomes—of every cell in their bodies. Thus, cells from two clones have
the same DNA and the same genes in their nuclei.

All cells, including eggs, also contain some DNA in the energy-generating “factories” called
mitochondria. These structures are in the cytoplasm, the region of a cell outside the
nucleus. Mitochondria contain their own DNA and reproduce independently. True clones have
identical DNA in both the nuclei and mitochondria, although the term clones is also used to refer
to individuals that have identical nuclear DNA but different mitochondrial DNA.

HOW IS REPRODUCTIVE CLONING DONE?

Two methods are used to make live-born mammalian clones. Both require implantation of an
embryo in a uterus and then a normal period of gestation and birth. However, reproductive
human or animal cloning is not defined by the method used to derive the genetically identical
embryos suitable for implantation. Techniques not yet developed or described here would
nonetheless constitute cloning if they resulted in genetically identical individuals of which at
least one were an embryo destined for implantation and birth.

The two methods used for reproductive cloning thus far are as follows:

• Cloning using somatic cell nuclear transfer (SCNT). This procedure starts with the removal of
the chromosomes from an egg to create an enucleated egg. The chromosomes are replaced with a
nucleus taken from a somatic (body) cell of the individual or embryo to be cloned. This cell
could be obtained directly from the individual, from cells grown in culture, or from frozen tissue.
The egg is then stimulated, and in some cases it starts to divide. If that happens, a series of
sequential cell divisions leads to the formation of a blastocyst, or preimplantation embryo. The
blastocyst is then transferred to the uterus of an animal. The successful implantation of the
blastocyst in a uterus can result in its further development, culminating sometimes in the birth of
an animal. This animal will be a clone of the individual that was the donor of the nucleus. Its
nuclear DNA has been inherited from only one genetic parent.

The number of times that a given individual can be cloned is limited theoretically only by the
number of eggs that can be obtained to accept the somatic cell nuclei and the number of females
available to receive developing embryos. If the egg used in this procedure is derived from the
same individual that donates the transferred somatic nucleus, the result will be an embryo that
receives all its genetic material—nuclear and mitochondrial—from a single individual. That will
also be true if the egg comes from the nucleus donor's mother, because mitochondria are
 31

inherited maternally. Multiple clones might also be produced by transferring identical nuclei to
eggs from a single donor. If the somatic cell nucleus and the egg come from different
individuals, they will not be identical to the nuclear donor because the clones will have
somewhat different mitochondrial genes.

• Cloning by embryo splitting. This procedure begins with in vitro fertilization (IVF): the union
outside the woman's body of a sperm and an egg to generate a zygote. The zygote (from here
onwards also called an embryo) divides into two and then four identical cells. At this stage, the
cells can be separated and allowed to develop into separate but identical blastocysts, which can
then be implanted in a uterus. The limited developmental potential of the cells means that the
procedure cannot be repeated, so embryo splitting can yield only two identical mice and
probably no more than four identical humans.

The DNA in embryo splitting is contributed by germ cells from two individuals—the mother
who contributed the egg and the father who contributed the sperm. Thus, the embryos, like those
formed naturally or by standard IVF, have two parents. Their mitochondrial DNA is identical.
Because this method of cloning is identical with the natural formation of monozygotic twins and,
in rare cases, even quadruplets, it is not discussed in detail in this report.

WILL CLONES LOOK AND BEHAVE EXACTLY THE SAME?

Even if clones are genetically identical with one another, they will not be identical in physical or
behavioral characteristics, because DNA is not the only determinant of these characteristics. A
pair of clones will experience different environments and nutritional inputs while in the uterus,
and they would be expected to be subject to different inputs from their parents, society, and life
experience as they grow up. If clones derived from identical nuclear donors and identical
mitocondrial donors are born at different times, as is the case when an adult is the donor of the
somatic cell nucleus, the environmental and nutritional differences would be expected to be more
pronounced than for monozygotic (identical) twins. And even monozygotic twins are not fully
identical genetically or epigenetically because mutations, stochastic developmental variations,
and varied imprinting effects (parent-specific chemical marks on the DNA) make different
contributions to each twin.

Additional differences may occur in clones that do not have identical mitochondria. Such clones
arise if one individual contributes the nucleus and another the egg—or if nuclei from a single
individual are transferred to eggs from multiple donors. The differences might be expected to
show up in parts of the body that have high demands for energy—such as muscle, heart, eye, and
brain—or in body systems that use mitochondrial control over cell death to determine cell
numbers.

WHAT ARE THE PURPOSES OF REPRODUCTIVE CLONING?

Cloning of livestock is a means of replicating an existing favorable combination of traits, such as

efficient growth and high milk production, without the genetic “lottery” and mixing that occur in
 32

sexual reproduction. It allows an animal with a particular genetic modification, such as the
ability to produce a pharmaceutical in milk, to be replicated more rapidly than does natural
mating. Moreover, a genetic modification can be made more easily in cultured cells than in an
intact animal, and the modified cell nucleus can be transferred to an enucleated egg to make a
clone of the required type. Mammals used in scientific experiments, such as mice, are cloned as
part of research aimed at increasing our understanding of fundamental biological mechanisms.

In principle, those people who might wish to produce children through human reproductive
cloning include:

 Infertile couples who wish to have a child that is genetically identical with one of them,
or with another nucleus donor

 Other individuals who wish to have a child that is genetically identical with them, or with
another nucleus donor

 Parents who have lost a child and wish to have another, genetically identical child

 People who need a transplant (for example, of cord blood) to treat their own or their
child's disease and who therefore wish to collect genetically identical tissue from a cloned
fetus or newborn.

Possible reasons for undertaking human reproductive cloning have been analyzed according to
their degree of justification. For example, in reference 10 it is proposed that human reproductive
cloning aimed at establishing a genetic link to a gametically infertile parent would be more
justifiable than an attempt by a sexually fertile person aimed at choosing a specific genome.

Transplantable tissue may be available without the need for the birth of a child produced by
cloning. For example, embryos produced by in vitro fertilization (IVF) can be typed for
transplant suitability, and in the future stem cells produced by nuclear transplantation may allow
the production of transplantable tissue.

HOW DOES REPRODUCTIVE CLONING DIFFER FROM STEM CELL RESEARCH?

The recent and current work on stem cells that is briefly summarized below and discussed more
fully in a recent report from the National Academies entitled Stem Cells and the Future of
Regenerative Medicine is not directly related to human reproductive cloning. However, the use
of a common initial step—called either nuclear transplantation or somatic cell nuclear transfer
(SCNT) has led Congress to consider bills that ban not only human reproductive cloning but also
certain areas of stem cell research. Stem cells are cells that have the ability to divide repeatedly
and give rise to both specialized cells and more stem cells. Some, such as some blood and brain
stem cells, can be derived directly from adults and others can be obtained from preimplantation
embryos. Stem cells derived from embryos are called embryonic stem cells (ES cells). The
above-mentioned report from the National Academies provides a detailed account of the current
state of stem cell research.
 33

ES cells are also called pluripotent stem cells because their progeny include all cell types that can
be found in a postimplantation embryo, a fetus, and a fully developed organism. They are
derived from the inner cell mass of early embryos (blastocysts). The cells in the inner cell mass
of a given blastocyst are genetically identical, and each blastocyst yields only a single ES cell
line. Stem cells are rarer and more difficult to find in adults than in preimplantation embryos, and
it has proved harder to grow some kinds of adult stem cells into cell lines after isolation.

Production of different cells and tissues from ES cells or other stem cells is a subject of current
research. Production of whole organs other than bone marrow (to be used in bone marrow
transplantation) from such cells has not yet been achieved, and its eventual success is uncertain.

Current interest in stem cells arises from their potential for the therapeutic transplantation of
particular healthy cells, tissues, and organs into people suffering from a variety of diseases and
debilitating disorders. Research with adult stem cells indicates that they may be useful for such
purposes, including for tissues other than those from which the cells were derived. On the basis
of current knowledge, it appears unlikely that adults will prove to be a sufficient source of stem
cells for all kinds of tissues. ES cell lines are of potential interest for transplantation because one
cell line can multiply indefinitely and can generate not just one type of specialized cell, but many
different types of specialized cells (brain, muscle, and so on) that might be needed for
transplants. However, much more research will be needed before the magnitude of the
therapeutic potential of either adult stem cells or ES cells will be well understood.

One of the most important questions concerning the therapeutic potential of stem cells is whether
the cells, tissues, and perhaps organs derived from them can be transplanted with minimal risk of
transplant rejection. Ideally, adult stem cells advantageous for transplantation might be derived
from patients themselves. Such cells, or tissues derived from them, would be genetically
identical with the patient's own and not be rejected by the immune system. However, as
previously described, the availability of sufficient adult stem cells and their potential to give rise
to a full range of cell and tissue types are uncertain. Moreover, in the case of a disorder that has a
genetic origin, a patient's own adult stem cells would carry the same defect and would have to be
grown and genetically modified before they could be used for therapeutic transplantation.

The application of somatic cell nuclear transfer or nuclear transplantation offers an alternative
route to obtaining stem cells that could be used for transplantation therapies with a minimal risk
of transplant rejection. This procedure—sometimes called therapeutic cloning, research cloning,
or nonreproductive cloning, and referred to here as nuclear transplantation to produce stem
cells—would be used to generate pluripotent ES cells that are genetically identical with the cells
of a transplant recipient. Thus, like adult stem cells, such ES cells should ameliorate the rejection
seen with unmatched transplants.

Two types of adult stem cells—stem cells in the blood forming bone marrow and skin stem cells
—are the only two stem cell therapies currently in use. But, as noted in the National Academies'
report entitled Stem Cells and the Future of Regenerative Medicine, many questions remain
 34

before the potential of other adult stem cells can be accurately assessed. Few studies on adult
stem cells have sufficiently defined the stem cell's potential by starting from a single, isolated
cell, or defined the necessary cellular environment for correct differentiation or the factors
controlling the efficiency with which the cells repopulate an organ. There is a need to show that
the cells derived from introduced adult stem cells are contributing directly to tissue function, and
to improve the ability to maintain adult stem cells in culture without the cells differentiating.
Finally, most of the studies that have garnered so much attention have used mouse rather than
human adult stem cells.

ES cells are not without their own potential problems as a source of cells for transplantation. The
growth of human ES cells in culture requires a “feeder” layer of mouse cells that may contain
viruses, and when allowed to differentiate the ES cells can form a mixture of cell types at once.
Human ES cells can form benign tumors when introduced into mice, although this potential
seems to disappear if the cells are allowed to differentiate before introduction into a recipient.
Studies with mouse ES cells have shown promise for treating diabetes, Parkinson's disease, and
spinal cord injury.

The ES cells made with nuclear transplantation would have the advantage over adult stem cells
of being able to provide virtually all cell types and of being able to be maintained in culture for
long periods of time. Current knowledge is, however, uncertain, and research on both adult stem
cells and stem cells made with nuclear transplantation is required to understand their therapeutic
potentials. (This point is stated clearly in Finding and Recommendation 2 of Stem Cells and the
Future of Regenerative Medicine which states, in part, that “studies of both embryonic and adult
human stem cells will be required to most efficiently advance the scientific and therapeutic
potential of regenerative medicine.”) It is likely that the ES cells will initially be used to generate
single cell types for transplantation, such as nerve cells or muscle cells. In the future, because of
their ability to give rise to many cell types, they might be used to generate tissues and,
theoretically, complex organs for transplantation. But this will require the perfection of
techniques for directing their specialization into each of the component cell types and then the
assembly of these cells in the correct proportion and spatial organization for an organ. That
might be reasonably straightforward for a simple structure, such as a pancreatic islet that
produces insulin, but it is more challenging for tissues as complex as that from lung, kidney, or
liver.

The experimental procedures required to produce stem cells through nuclear transplantation
would consist of the transfer of a somatic cell nucleus from a patient into an enucleated egg,
the in vitro culture of the embryo to the blastocyst stage, and the derivation of a pluripotent ES
cell line from the inner cell mass of this blastocyst. Such stem cell lines would then be used to
derive specialized cells (and, if possible, tissues and organs) in laboratory culture for therapeutic
transplantation. Such a procedure, if successful, can avoid a major cause of transplant rejection.
However, there are several possible drawbacks to this proposal. Experiments with animal models
suggest that the presence of divergent mitochondrial proteins in cells may create “minor”
 35

transplantation antigens that can cause rejection; this would not be a problem if the egg were
donated by the mother of the transplant recipient or the recipient herself.

For some autoimmune diseases, transplantation of cells cloned from the patient's own cells may
be inappropriate, in that these cells can be targets for the ongoing destructive process. And, as
with the use of adult stem cells, in the case of a disorder that has a genetic origin, ES
cells derived by nuclear transplantation from the patient's own cells would carry the same defect
and would have to be grown and genetically modified before they could be used for therapeutic
transplantation. Using another source of stem cells is more likely to be feasible (although
immunosuppression would be required) than the challenging task of correcting the one or more
genes that are involved in the disease in adult stem cells or in a nuclear transplantation-derived
stem cell line initiated with a nucleus from the patient.

In addition to nuclear transplantation, there are two other methods by which researchers might be
able to derive ES cells with reduced likeli hood for rejection. A bank of ES cell lines covering
many possible genetic makeups is one possibility, although the National Academies report
entitled Stem Cells and the Future of Regenerative Medicine rated this as “difficult to conceive.
Alternatively, embryonic stem cells might be engineered to eliminate or introduce certain cell-
surface proteins, thus making the cells invisible to the recipient's immune system. As with the
proposed use of many types of adult stem cells in transplantation, neither of these approaches
carries anything close to a promise of success at the moment.

The preparation of embryonic stem cells by nuclear transplantation differs from reproductive
cloning in that nothing is implanted in a uterus. The issue of whether ES cells alone can give rise
to a complete embryo can easily be misinterpreted. The titles of some reports suggest that mouse
embryos can be derived from ES cells alone. In all cases, however, the ES cells need to be
surrounded by cells derived from a host embryo, in particular trophoblast and primitive
endoderm. In addition to forming part of the placenta, trophoblast cells of the blastocyst provide
essential patterning cues or signals to the embryo that are required to determine the orientation of
its future head and rump (anterior-posterior) axis. This positional information is not genetically
determined but is acquired by the trophoblast cells from events initiated soon after fertilization or
egg activation.

Moreover, it is critical that the positional cues be imparted to the inner cells of the blastocyst
during a specific time window of development. Isolated inner cell masses of mouse blastocysts
do not implant by themselves, but will do so if combined with trophoblast vesicles from another
embryo. By contrast, isolated clumps of mouse ES cells introduced into trophoblast vesicles
never give rise to anything remotely resembling a postimplantation embryo, as opposed to a
disorganized mass of trophoblast. In other words, the only way to get mouse ES cells to
participate in normal development is to provide them with host embryonic cells, even if these
cells do not remain viable throughout gestation (Richard Gardner, personal communication). It
has been reported that human and primate ES cells can give rise to trophoblast cells in culture.
 36

However, these trophoblast cells would presumably lack the positional cues normally acquired
during the development of a blastocyst from an egg. In the light of the experimental results with
mouse ES cells described above, it is very unlikely that clumps of human ES cells placed in a
uterus would implant and develop into a fetus. It has been reported that clumps of human ES
cells in culture, like clumps of mouse ES cells, give rise to disorganized aggregates known as
embryoid bodies.

Besides their uses for therapeutic transplantation, ES cells obtained by nuclear transplantation
could be used in laboratories for several types of studies that are important for clinical medicine
and for fundamental research in human developmental biology. Such studies could not be carried
out with mouse or monkey ES cells and are not likely to be feasible with ES cells prepared from
normally fertilized blastocysts. For example, ES cells derived from humans with genetic diseases
could be prepared through nuclear transplantation and would permit analysis of the role of the
mutated genes in both cell and tissue development and in adult cells difficult to study otherwise,
such as nerve cells of the brain. This work has the disadvantage that it would require the use of
donor eggs. But for the study of many cell types there may be no alternative to the use of ES
cells; for these cell types the derivation of primary cell lines from human tissues is not yet
possible.

If the differentiation of ES cells into specialized cell types can be understood and controlled, the
use of nuclear transplantation to obtain genetically defined human ES cell lines would allow the
generation of genetically diverse cell lines that are not readily obtainable from embryos that have
been frozen or that are in excess of clinical need in IVF clinics. The latter do not reflect the
diversity of the general population and are skewed toward genomes from couples in which the
female is older than the period of maximal fertility or one partner is infertile. In addition, it might
be important to produce stem cells by nuclear transplantation from individuals who have diseases
associated with both simple [81] and complex (multiple-gene) heritable genetic predilections.
For example, some people have mutations that predispose them to “Lou Gehrig's disease”
(amyotrophic lateral sclerosis, or ALS); however, only some of these individuals become ill,
presumably because of the influence of additional genes. Many common genetic predilections to
diseases have similarly complex etiologies; it is likely that more such diseases will become
apparent as the information generated by the Human Genome Project is applied. It would be
possible, by using ES cells prepared with nuclear transplantation from patients and healthy
people, to compare the development of such cells and to study the fundamental processes that
modulate predilections to diseases.

Neither the work with ES cells, nor the work leading to the formation of cells and tissues for
transplantation, involves the placement of blastocysts in a uterus. Thus, there is no embryonic
development beyond the 64 to 200 cell stage, and no fetal development.
 37

2-1. Reproductive cloning involves the creation of individuals that contain identical sets of
nuclear genetic material (DNA). To have complete genetic identity, clones must have not only
the same nuclear genes, but also the same mitochondrial genes.

2-2. Cloned mammalian animals can be made by replacing the chromosomes of an egg cell with
a nucleus from the individual to be cloned, followed by stimulation of cell division and
implantation of the resulting embryo.

2-3. Cloned individuals, whether born at the same or different times, will not be physically or
behaviorally identical with each other at comparable ages.

2-4. Stem cells are cells that have an extensive ability to self-renew and differentiate, and they
are therefore important as a potential source of cells for therapeutic transplantation. Embryonic
stem cells derived through nuclear transplantation into eggs are a potential source of pluripotent
(embryonic) stem cell lines that are immunologically similar to a patient's cells. Research with
such cells has the goal of producing cells and tissues for therapeutic transplantation with minimal
chance of rejection.

2-5. Embryonic stem cells and cell lines derived through nuclear transplantation could be
valuable for uses other than organ transplantation. Such cell lines could be used to study the
heritable genetic components associated with predilections to a variety of complex genetic
diseases and test therapies for such diseases when they affect cells that are hard to study in
isolation in adults.

2-6. The process of obtaining embryonic stem cells through nuclear transplantation does not
involve the placement of an embryo in a uterus, and it cannot produce a new individual.

PROS OF THERAPEUTIC CLONING

1. Therapeutic cloning can help create vital organs. This would be helpful for people
suffering from kidney and other disorders, who are forced to wait years for a replacement
organ.
2. When organs are made out of a patient's own cell, doctors do not have to worry about
organ or tissue rejection by the immune system of the patient.
3. Stops the wait time for organs and patients then do not risk loosing their life while
waiting for an organ.
4. Therapeutic cloning may be helpful for preventing diseases, research in this area of
therapeutic cloning is still being preformed.
5. Organs would have an exact match of the patient's DNA.
6. No need for organ donors and no surgery required for the second party.
7. Allows for researchers to test cures for certain diseases, such as, Parkinson's and diabetes.
8. Researchers can study the regeneration of organs.
 38

CONS OF THERAPEUTIC CLONING

1. Adult cells are limiting, so therapeutic cloning relies on stem cells extracted from the
embryos. Just a small portion of stem cells are usable.
2. Some cells mutate and cause tumours in patients.
3. In order to cure disease, millions of eggs are needed. We do not currently have this type
of supply of eggs.
4. Many people believe it is ethically wrong and against "god's" wishes.
5. Extracting eggs from a female is costly and painful for the woman.
6. The cost of therapeutic cloning is very high.

HISTORY AND CONCLUSION

Scientists from Massachusetts-based Advanced Cell Technology, announced in 2001, the cloning
of embryos to be used for advancing therapeutic cloning. A skin cell was inserted into a fertilized
egg that had all of its genetic material removed. The egg soon divided and the whole idea of
therapeutic cloning was discovered. In 2002 California became the first state to legalize research
on therapeutic cloning. Britain then became the first country to give money to scientists
researching therapeutic cloning.

Many right wing conservatives or people who oppose abortion believe that life starts at
conception. They believe that inserting cells into a fertilized cell can create a person, that life is
then killed when the stem cells are removed. They often argue that killing of one life to cure
another is unfair. Many countries do not support research on therapeutic cloning because of this
ideology. Politicians do not consider the pros of therapeutic cloning and how it can be helpful to
the citizens of their country.

Stem cell research is banned in many parts of Europe, such as Germany, Finland, Austria and
Greece. It is also banned in China and Israel. Stem cell research and therapeutic cloning is legal
in, the United Kingdom, the United States and Brazil. Canada's rules on therapeutic cloning and
stem cell research are very strict. Here are the guidelines that Canada created on stem cell
research:
The embryos used must originally have been created for reproductive purposes

1. The persons for whom the embryos were created must provide free and informed consent
for the unrestricted research use of any embryos created, which are no longer required for
reproductive purposes
2. The ova, sperm, nor embryo must not have been obtained through commercial
transactions.

DNA FINGERPRINTING AND FORENSIC ANALYSIS

 39

DNA fingerprinting (also called DNA profiling or forensic genetics) is a technique employed by
forensic scientists to assist in the identification of individuals or samples by their respective
DNA profiles. DNA fingerprinting is a laboratory technique used to determine the probable
identity of a person based on the nucleotide sequences of certain regions of human DNA that are
unique to individuals. DNA fingerprinting is used in a variety of situations, such as criminal
investigations, other forensic purposes and paternity testing. In these situations, one aims to
“match” two DNA fingerprints with one another, such as a DNA sample from a known person
and one from an unknown person.
Although more than 99.1% of the genome is the same throughout the human population, the
remaining 0.9% of human DNA shows variations between individuals. These variable DNA
sequences, termed polymorphic markers, can be used to both differentiate and correlate
individuals. Alec Jeffreys, a geneticist at the University of Leicester in Britain, invented the first
usable version of DNA fingerprinting in 1984. Few years later, a chemical company, Imperial
Chemical Industries (ICI), launched the first kit commercially available. Although it is a
relatively new discipline, it had a great impact on the criminal justice system and society in all
over the world. The application of forensic genetics to the legal arena is aimed to resolve legal
problems, such as paternity tests and inheritance matters, to establish identity in criminal cases
where biological evidence is found at crime scenes, and to identify victims of mass disasters and
missing persons from human remains.

When applying the technique to the human genome, polymorphic regions are analyzed. While
more than 99 % of the human genome is identical across all individuals, 1 polymorphic regions
vary significantly, and can therefore be used to establish a DNA profile that is almost unique to a
person.

The keyword here is 'almost' – because monozygotic twins, who come from a single fertilized
egg, are an exception. They share DNA profiles so similar that they are indistinguishable by
DNA fingerprinting. However, it's worth noting that even monozygotic twins don't share 100 %
of their genome. Recent studies suggest that an average of 5.2 mutations occur early in their
development, leading to minor differences in their DNA profiles.

A rare phenomenon called chimerism can also present a challenge to DNA fingerprinting efforts.
Chimeras are individuals that contain 2 different types of DNA, and have more than one genetic
fingerprint. The case of Lydia Fairchild – who was at risk of losing custody of her children in
2003 due to a DNA test that concluded she was not the biological mother – provides an
extraordinary example. The reason? The DNA in Lydia's blood differed to that in the rest of her
body, a result of her unborn twin sister's cells fusing with her own in the womb.
 40

Uses of DNA fingerprinting

DNA fingerprinting is commonly used in forensics, a field that applies science in a legal setting.
For example, investigators often collect DNA – in the form of blood, hair, semen, saliva or tissue
samples – from crime scenes. These samples are then analyzed, and the resulting DNA profiles
can be compared with the genetic fingerprints of suspects to find matches, helping to convict the
guilty and to exonerate the wrongly accused. Paternity investigations often rely on DNA
fingerprinting as well. Here, the technique is used to compare the child's DNA with the alleged
father's DNA. Additionally, in situations such as natural disasters, DNA fingerprinting can be
applied to teeth or bones to help identify the victims.

Beyond its use in forensics, DNA fingerprinting has found applications in multiple other sectors,
including diagnostics, medical research, ecology, microbiology and genealogy. This article will
focus on the technique's applications in forensics, but we would briefly like to mention that it can
also be used to:

 track the inheritance of diseases;

 understand genetic disorders;
 develop more effective and personalized treatments for patients;
 characterize the variety of microorganisms in an environmental sample;
 investigate foodborne outbreaks and pinpoint their source;
 determine evolutionary relationships between organisms.

Moreover, genealogists use DNA fingerprinting to trace lineages and establish familial
connections. This has opened up new ways for people to explore their ancestry and understand
their heritage.

The DNA fingerprinting process

While DNA fingerprinting relies on variations in the genome to generate an individual's DNA
profile, not all polymorphic regions are examined during this technique. Instead, only certain
sequences are analyzed. For example, the short tandem repeat (STR) approach – commonly used
in forensics – focuses on specific loci that contain sequences of 2 to 6 base pairs that are repeated
multiple times. Since the number of repeats is highly variable among individuals, and since every
individual has 2 alleles of each loci – one inherited from the mother and one from the father –
they provide an ideal basis for DNA fingerprinting. However, the specific method used for STR
analysis varies from country to country; 20 so-called 'CODIS core loci' are routinely used by the
US FBI to create a fingerprint, while the UK relies on 16 loci plus a gender identifier.
 41

The process of performing STR analysis is described step-by-step in the section below. For
information on other DNA fingerprinting techniques, please refer to the 'Types of forensic DNA
analysis' section later in this article.

Step 1: sample collection

A wide variety of samples – including blood, saliva, semen, genital or rectal swabs, skin or tissue
cells, fingernails, hairs and urine – can be collected from crime scenes and used for STR
analysis. Blood, oral swabs and plucked hairs are the most common sample types obtained from
suspects or individuals involved in paternity investigations or other genetic relationship inquiries.
It is important that correct aseptic sample collection techniques are followed to ensure reliable
results.

Step 2: DNA extraction

Once the sample reaches the lab, the next step is to extract DNA from the cells. This process
includes cell lysis, inactivation of nucleases, and purification to separate the DNA from cellular
debris. Several different methods – each with its own pros and cons – can be used for DNA
extraction, and an overview of the different techniques can be found in our blog entitled
'Comparison of RNA and DNA extraction methods'.

Step 3: DNA amplification

To ensure that there is sufficient DNA for downstream analysis, the STR sequences are
amplified using polymerase chain reaction (PCR) methods. However, to be able to effectively
differentiate and identify the various STR sequences during the subsequent analysis step, the
standard PCR protocol has to be modified. When performing a PCR workflow for STR
amplification, you not only require a specific primer pair for each locus, but the primers also
need to attach a unique fluorescent tag to the resulting PCR products.2

Step 4: DNA analysis

After amplification, the DNA sample is run through a capillary containing a gel that allows
smaller STR sequences to travel faster through its pores. At the end of the capillary, a laser beam
and a detector register the fluorescent tag of each sequence. The combination of the travel time
and the fluorescent signal allow the capillary gel electrophoresis system to determine the length
of the STR sequences for each locus analyzed.

Next generation sequencing (NGS) techniques are also used for DNA analysis, and offer several
advantages over traditional capillary gel electrophoresis methods. For example, NGS can be used
to distinguish between STRs of the same length, but containing different base pair sequences,
and offers better handling of degraded DNA samples. However, NGS systems are only cost
 42

effective when applied to high numbers of samples, so the 2 methods continue to co-exist in
DNA fingerprinting.

Step 5: data comparison and interpretation

The final step in a STR analysis workflow involves comparing the genetic fingerprint obtained
with that of another sample. Capillary gel electrophoresis results – electropherograms
representing each sample – can easily be compared to determine whether samples match or
differ, and this process can be performed manually or automated.

For example, a paternity test will likely include 3 samples – from the child, mother and alleged
father – that will be run through the capillary gel electrophoresis system. For each locus of
interest, you will therefore generate 3 electropherograms with 2 peaks representing the 2 alleles.
Figure 1 depicts a possible result of this test, and shows a maternal allele (number 8) and a
paternal allele (number 13) that have been passed to the child at this locus. The alleged father
could therefore possibly be the child's biological father, if similar results are observed for the
other loci required in the test.

The process of comparing a DNA fingerprint from a crime scene sample with that of 1 or more
suspects works in exactly the same way, but the electropherograms would match for both alleles
if they came from the same individual. Many countries store genetic fingerprints from previous
criminal investigations in DNA databanks, allowing forensic scientists to search for a match even
when there are no direct suspects.11,12 In some cases and countries, it is even possible to scan
genealogy databanks for suspects or their relatives. 13 These databanks allow anyone to register
and submit a DNA sample through an at-home testing kit and, while their main purpose is to give
people more information on their genetic background, they have proven useful in certain
criminal investigations.

Concerns and limitations

While DNA fingerprinting is a fascinating technique, and has helped to solve countless crimes,
there are concerns and limitations associated with its use. This chapter will discuss some of the
key challenges regarding the analysis of genetic material for legal purposes, including ethical
reservations, probability considerations and the interpretation of samples containing DNA
mixtures.

Ethical concerns

DNA databanks storing the DNA fingerprints of convicted criminals – and, in some cases, even
innocent individuals – have sparked ethical debates. Critics argue that such practices violate the
 43

right to privacy, especially when the DNA profiles of suspects who are found innocent during the
course of an investigation continue to be stored indefinitely.

In addition to concerns about individual rights, there is the potential that these databanks could
strengthen racial stereotypes. If racial bias results in more frequent arrests of individuals from
certain ethnic groups, their overrepresentation in the databank could lead to more solved crimes
involving members of that group, inadvertently reinforcing this bias.

Ethical discussions around the use of DNA databanks in forensics have been further complicated
by the emergence of commercial genealogy databanks. Questions have been raised about
whether these databanks should be permitted for use in criminal investigations, and about the
extent to which these companies need to disclose the potential use of their customers' genetic
data.

Probability

Another important factor to consider in any forensic investigation is probability. While a match
between 2 DNA fingerprints indicates a high likelihood that the samples originate from the same
individual, it is not absolute proof. Therefore, if 2 DNA samples show the same STR lengths in
all the loci analyzed, the population frequency of each STR is used to calculate a random match
probability. This probability is typically as low as 1 in several billion, so the chances that 2
individuals share the same STRs across all loci is incredibly low, but it cannot be ruled out.
Furthermore, the probability of 2 individuals showing the same genetic fingerprint increases
significantly among relatives, especially siblings.

DNA mixtures

PCR has helped to make DNA fingerprinting an extremely sensitive technique, allowing
minuscule quantities of DNA – such as that left on the handle of a knife at a crime scene – to be
detected. However, this increased sensitivity also means that samples have become more
complex to analyze. Surfaces often contain mixtures of DNA from several individuals, making
data interpretation a challenging process. Probabilistic genotyping software – which uses
statistical and biological models to determine the likelihood that a certain individual contributed
to a mixed DNA sample – can aid these analyses, but these tools are not without their challenges.
Disparities in the software used, its configuration, and the underlying analytical models can
cause separate labs to come to different conclusions, even when analyzing the exact same
evidence.
 44

Types of forensic DNA analysis

Forensic DNA analysis has come a long way since its early beginnings in the 1980s, with the
emergence of several different techniques. STR analysis is now the primary method 18 but, before
its invention, restriction fragment length polymorphism (RFLP) was the dominant technique.
Additionally, since the adoption of STR approaches, other methods such as Y chromosome
analysis, mitochondrial DNA (mtDNA) analysis, single nucleotide polymorphism (SNP) typing
and mini STR analysis have also been developed. This chapter explores the evolution of forensic
DNA analysis techniques, and explains when to use which alternative to STR typing.

Restriction fragment length polymorphism

RFLP analysis begins with the extraction of DNA from a sample. Restriction enzymes are then
used to cut this DNA into thousands of pieces, creating fragments that vary in length due to
polymorphic regions. Next, these fragments are separated by size through gel electrophoresis and
transferred to a membrane.19

Following denaturation, the membrane is incubated with radioactive probes binding to

minisatellite regions in the DNA fragments. Minisatellites are similar to STRs – in that they are
short, repetitive, non-coding DNA sequences – but they are longer, containing 10 to 60 base
pairs.20 After incubation, the probes are visualized by exposing the membrane to X-ray film,
producing a pattern of bands – the DNA fingerprint.

espite its early success, RFLP has been largely replaced by STR approaches that leverage PCR to
enable minute amounts of DNA and partially degraded samples to be analyzed. 19 There are,
however, variations of RFLP that combine the technique with PCR and are still used today. An
example is terminal RFLP (T-RFLP), a popular approach in environmental microbiology studies
to characterize microbial communities. It involves the following steps:

 sample collection;
 DNA extraction;
 PCR amplification, with primers attaching a fluorescent tag to the amplicons;
 amplicon digestion by restriction enzymes;
 size separation and data analysis using capillary gel electrophoresis;
 data interpretation.

Y chromosome analysis

While STR analysis is used to study specific loci on various chromosomes, Y chromosome
analysis examines STR markers found exclusively on the Y chromosome. This technique is
particularly valuable when investigating male-on-female sexual assaults – where minuscule
 45

amounts of male DNA need to be detected in female samples – or determining familial

relationships among males.

Mitochondrial DNA analysis

mtDNA analysis can be more effective than STR approaches when samples contain a low
nuclear DNA content. This can be the case when samples consist of old bones, teeth or hair
shafts. Instead of examining DNA extracted from the nucleus of cells, this technique analyzes
DNA found in mitochondria. As all maternal relatives share identical mtDNA, this method can
also be used to analyze unidentifiable remains by comparing them to maternal relatives.

Single nucleotide polymorphism typing

SNPs are variations in single base positions in the DNA, and represent the most common type of
genetic mutation. The template size for SNP typing can be as short as 50 base pairs – compared
to the requirement of 300 base pairs for STR analysis – so this technique is particularly useful for
analyzing degraded samples. For instance, SNP typing was instrumental in identifying victims of
the World Trade Center disaster.

Mini STR analysis

Mini STR analysis is also designed to handle degraded samples. It attempts to recover
information from these samples by reducing the size of the PCR products needed for STR
sequence analysis. This is achieved by moving the primers as close as possible to the region of
interest.

DNA fingerprinting has come a long way since its discovery in the 1980s. Although it is mainly
used in forensics, its potential is far reaching, with applications ranging from exploring our
genetic heritage to advancing personalized medicine. However, like any technology, it poses
several challenges, including ethical concerns around the use of DNA databases for forensic
purposes. We hope that this blog has enhanced your understanding of how DNA fingerprinting
works, and the various techniques available, while demonstrating the importance of valuing both
discovery and privacy during forensic investigations.

Microbial Enzymes

Microbial enzymes involved in the catabolism of amino acids include deaminases,

decarboxylases, and transaminases that catalyze, respectively, deamination, decarboxylation, and
transamination of amino acids to produce, respectively, α-keto acids, amines, and other amino
acids that then are converted into aldehydes, alcohol, and acid.
Microbial enzymes find applications in many fields, including chemical, fermentation,
agricultural, pharmaceuticals, and food production. Choosing the appropriate expression
 46

systems is important for the enzyme production rate, and bacteria, filamentous fungi, and yeasts
have been used to express recombinant enzymes. Biotechnological applications have increased in
number due to the advantages of these species. However, physiological impacts make high-level
expression of recombinant enzymes hard to achieve. The natural enzymes, especially under
industrial conditions, have limitations such as low catalytic efficiency, activity, and stability.
Strategies such as site-directed mutagenesis, truncation, and terminal fusion have been used to
eliminate these limitations. In this chapter, the commonly used strategies for microbial
enzyme production and molecular engineering are systematically summarized, and we hope this
review could make a contribution to the research and development of the microbial enzyme field.
Microbial enzymes are very interesting biocatalysts that have been extensively studied due to
their advantages compared to chemical catalysts, since the former present better selectivity and
can be used in mild reaction conditions. In addition, several industrial sectors require enzymes
with special characteristics for their applications in the processing of different substrates and raw
materials.
Enzymes are large biomolecules that are responsible for many chemical reactions that are
necessary to sustain life. An Enzyme is a protein molecule and are biological catalysts.

Microorganisms are the primary source of enzymes, because they are cultured in large quantities
in short span of time and genetic manipulations can be done on bacterial cells to enhance the
enzyme production. In addition, the microbial enzymes have been paid more attention due to
their active and stable nature than enzymes from plant and animal. Most of the microorganisms
are unable to grow and produce enzyme under harsh environments that cause toxicity to
microorganisms. However, some microorganisms have undergone various adaptations enabling
them to grow and produce enzymes under harsh conditions. Recently several lines of study have
been initiated to isolate new bacterial and fungal strains from harsh environments such as
extreme pH, temperature, salinity, heavy metal, and organic solvent for the production of
different enzymes having the properties to yield higher.

Forexample, β-glucosidases obtained from Aspergillus strains play an important role due to their
specificity for a wide variety of glycoside substrates. Due to its potential and very broad activity,
β-glucosidase has also been attributed to several important industrial applications, despite the
many challenges related to production and purification that have yet to be overcome to obtain
these enzymes in industrial scale.
The techniques involved in the purification, characterization, and immobilization of β-
glucosidases, becoming enzymes of great importance and potential for several industrial sectors
such as food, chemical, pharmaceutical, and biofuel industries.
Bacterial enzymes
a-Amylase Bacillus
b-Amylase Bacillus
Asparaginase Escherichia coli
 47

Glucose isomeras Bacillus

Penicillin amidase Bacillus
Protease Bacillus
Lipase E.coli
Pullulanase Klebsiella
Fungal enzymes
a-Amylase Aspergillus
Aminoacylase Aspergillus
Glucoamylase Aspergillus
Catalase Aspergillus
Cellulase Trichoderma
Dextranase Penicillium
Glucose oxidase Aspergillus
Lactase Aspergillus
Lipase Rhizopus
Rennet Mucor miehei
Pectinase Aspergillus
Pectin lyase Aspergillus
Protease Aspergillus
Raffinase Mortierella
Yeast enzymes
Invertase Saccharomyces
Lactase Kluyveromyces
Lipase Candida
Raffinase Saccharomyces
Enzymes increase the rate of the reaction. Enzymes are specific, they function with only one
reactant to produce specific products. Enzymes have a three-dimensional structure and they
utilize organic molecules like biotin and inorganic molecules like metal ions (magnesium ions)
for assistance in catalysis. Substrate is the reactant in an enzyme catalyzed reaction. The portion
of the molecule that is responsible for catalytic action of enzyme is the active site.

Enzymes increase the rate of the reaction. Enzymes are specific, they function with only one
reactant to produce specific products. Enzymes have a three-dimensional structure and they
utilize organic molecules like biotin and inorganic molecules like metal ions (magnesium ions)
for assistance in catalysis. Substrate is the reactant in an enzyme catalyzed reaction. The portion
of the molecule that is responsible for catalytic action of enzyme is the active site.
 48

Characteristics of enzymes are as follows:

 Enzymes possess great catalytic power.

 Enzymes are highy specific.
 Enzymes show varying degree of specificities.
 Absolute specificity where the enzymes react specifically with only one substrate.
 Stereo specificity is where the enzymes can detect the different optical isomers and react to only
one type of isomer.
 Reaction specific enzymes, these enzymes as the name suggests reacts to specific reactions only.
 Group specific enzymes are those that catalyze a group of substances that contain specific
substances.
 The enzyme activity can be controlled but the activity of the catalysts can not be controlled.
 All enzymes are proteins.
 Like the proteins, enzymes can be coagulated by alcohol, heat, concentrated acids and alkaline
reagents.
 At higher temperatures the rate of the reaction is faster.
 The rate of the reaction invovlving an enzyme is high at the optimum temperature.
 Enzymes have an optimum pH range within which the enzymes function is at its peak.
 If the substrate shows deviations larger than the optimum temperature or pH, required by the
enzyme to work, the enzymes do not function such conditions.
 Increase in the concentration of the reactants, and substrate the rate of the reaction increase until
the enzyme will become saturated with the substrate; increase in the amount of enzyme,
increases the rate of the reaction.
 Inorganic substances known as activators increase the activity of the enzyme.
 Inhibitors are substances that decrease the activity of the enzyme or inactivate it.

Nomenclature of enzymes

The current system of nomenclature of enzymes uses the name of the substrate or the type of the
reaction involved, and ends with "-ase". Example:'Maltase'- substrate is maltose . 'Hydrolases'-
reaction type is hydrolysis reaction. The International Union of Biochemistry and Molecular
Biology have developed a nomenclature for enzymes, the EC numbers; each enzyme is described
by a sequence of four numbers preceded by "EC", which stands for "Enzyme Commission". The
first number broadly classifies the enzyme based on its mechanism
 49

Classification of enzymes
Enzymes are classified based on the reactions they catalyze into 6 groups: Oxidoreductases,
transferases, hydrolases, lyases, isomearses, ligases.
Oxidoreductases - Oxidoreductase are the enzymes that catalyze oxidation-reduction reactions.
These emzymes are important as these reactions are responsible for the production of heat and
energy.

Transferases - Transferases are the enzymes that catalyze reactions where transfer of functional
group between two substrates takes place.

Hydrolases - Hydrolases are also known as hydrolytic enzymes, they catalyze the hydrolysis
reactions of carbohydrates, proteins and esters.

Lyases - Lyases are enzymes that catlayze the reaction invvolving the removal of groups from
substrates by processes other than hydrolysis by the formation of double bonds.

Isomerases - Isomerases are enzymes that catalyze the reactions where interconversion of cis-
trans isomers is involved.

Ligases - Ligases are also known as synthases, these are the enzymes that catalyze the reactions
where coupling of two compounds is involved with the breaking of pyrophosphate bonds.
Structure of enzyme

Enzymes are proteins, like the proteins the enzymes contain chains of amino acids linked
together. The characteristic of an enzyme is determined by the sequence of amino acid
arrangement. When the bonds between the amino acid are weak, they may be broken by
conditions of high temperatures or high levels of acids. When these bonds are broken, the
enzymes become nonfunctional. The enzymes that take part in the chemical reaction do not
undergo permanent changes and hence they remain unchanged to the end of the reaction.
Enzymes are highly selective, they catalyze specific reactions only. Enzymes have a part of a
molecule where it just has the shape where only certain kind of substrate can bind to it, this site
of activity is known as the 'active site'. The molecules that react and bind to the enzyme is known
as the 'substrate'.
Most of the enzymes consists of the protein and the non protein part called the 'cofactor'. The
proteins in the enzymes are usually globular proteins. The protein part of the enzymes are known
'apoenzyme', while the non-protein part is known as the cofactor. Together the apoenzyme and
cofactors are known as the 'holoenzyme'.
 50

Cofactors may be of three types: prosthetic groups, activators and coenzymes.

Prosthetic groups are organic groups that are permanently bound to the enzyme. Example: Heme
groups of cytochromes and bitotin group of acetyl-CoA carboxylase.
Activators are cations- they are positively charged metal ions. Example: Fe - cytochrome
oxidase, CU - catalase, Zn - alcohol dehydrogenase, Mg - glucose - 6 - phosphate, etc.
Coenzymes are organic molecules, usually vitamins or made from vitamins. they are not bound
permanently to the enzyme, but they combine with the enzyme-substrate complex temporarily.
Example: FAD - Flavin Adenine Dinucleotide, FMN - Flavin Mono Nucleotide, NAD -
Nicotinamide Adenine Dinucleotide, NADP - Nicotinamide Adenine Dinucleotide.
Function of Enzymes
Biological Functions of Enzymes:

•Enzymes perform a wide variety of functions in living organisms.

 They are major components in signal transduction and cell regulation, kinases and phosphatases
help in this function.
 They take part in movement with the help of the protein myosin which aids in muscle
contraction.
 Also other ATPases in the cell membrane acts as ion pumps in active transport mechanism.
 Enzymes present in the viruses are for infecting cell.
 Enzymes play a important role in the digestive activity of the enzymes.
 Amylases and proteases are enzyme sthat breakdown large molecules into absorbable
molecules.
 Variuos enzymes owrk together in a order forming metabolic pathways. Example: Glycolysis.

Biotechnology and Industrial Application of Enzymes:

 Food Processing - Amylases enzymes from fungi and plants are used in production of sugars
from starch in making corn-syrup.
 Catalyze enzyme is used in breakdown of starch into sugar, and in baking fermentation process
of yeast raises the dough.
 Proteases enzyme help in manufacture of biscuits in lowering the protein level.
 51

 Baby foods - Trypsin enzyme is used in pre-digestion of baby foods.

 Brewing industry - Enzymes from barley are widely used in brewing industries.
 Amylases, glucanases, proteases, betaglucanases, arabinoxylases, amyloglucosidase,
acetolactatedecarboxylases are used in prodcution of beer industries.
 Fruit juices - Enzymes like cellulases,pectinases help are used in clarifying fruit juices.
 Dairy Industry - Renin is used inmanufacture of cheese. Lipases are used in ripening blue-mold
cheese. Lactases breaks down lactose to glucose and galactose.
 Meat Tenderizes - Papain is used to soften meat.
 Starch Industry - Amylases, amyloglucosidases and glycoamylases converts starch into glucose
and syrups.
 Glucose isomerases - production enhanced sweetening properties and lowering calorific values.
 Paper industry - Enzymes like amylases, xylanases, cellulases and liginases lower the viscosity,
and removes lignin to soften paper.
 Biofuel Industry - Enzymes like cellulases are used in breakdown of cellulose into sugars which
can be fermented.
 Biological detergent - proteases, amylases, lipases, cellulases, asist in removal of protein stains,
oily stains and acts as fabric conditioners.
 Rubber Industry - Catalase enzyme converts latex into foam rubber.

Enzyme purification : Enzyme purification is vital for the characterization of the function, structure
and interactions of the protein of interest. The purification process may separate the enzyme and non-
enzyme parts of the mixture, and finally separate the desired enzyme from all other enzymes.
Separation of one enzyme from all others is typically the most laborious aspect of enzyme
purification. Separation steps usually exploit differences in protein size, physico-chemical properties,
binding affinity and biological activity. The pure result may be termed enzyme isolate.

Microbial Enzymes Extraction

If the protein of interest is not secreted by the organism into the surrounding solution, the first step
of each purification process is the disruption of the cells containing the protein. Depending on how
fragile the protein is and how stable the cells are, one could, for instance, use one of the following
methods: i) repeated freezing and thawing, ii) sonication, iii) homogenization by high pressure
(French press), iv) homogenization by grinding (bead mill), and v) permeabilization by detergents
(e.g. Triton X-100) and/or enzymes (e.g. lysozyme). Finally, the cell debris can be removed by
centrifugation so that the proteins and other soluble compounds remain in the supernatant.
Also proteases are released during cell lysis, which will start digesting the proteins in the solution. If
the protein of interest is sensitive to proteolysis, it is recommended to proceed quickly, and to keep
the extract cooled, to slow down the digestion. Alternatively, one or more protease inhibitors can be
added to the lysis buffer immediately before cell disruption. Sometimes it is also necessary to
add DNAse in order to reduce the viscosity of the cell lysate caused by a high DNA content.
 52

Purification strategies
1.Precipitation and differential solubilization:
Ammonium sulfate precipitation

In bulk protein purification, a common first step to isolate proteins is precipitation with ammonium
sulfate (NH4)2SO4. This is performed by adding increasing amounts of ammonium sulfate and
collecting the different fractions of precipitate protein. Ammonium sulfate can be removed
by dialysis.The hydrophobic groups on the proteins get exposed to the atmosphere, attract other
protein hydrophobic groups and get aggregated. Protein precipitated will be large enough to be
visible. One advantage of this method is that it can be performed inexpensively with very large
volumes.
The first proteins to be purified are water-soluble proteins. Purification of integral membrane
proteins requires disruption of the cell membrane in order to isolate any one particular protein from
others that are in the same membrane compartment. Sometimes a particular membrane fraction can be
isolated first, such as isolating mitochondria from cells before purifying a protein located in a
mitochondrial membrane.
2. Sucrose gradient centrifugation — a linear concentration gradient of sugar (typically sucrose,
glycerol, or a silica based density gradient media, like Percoll) is generated in a tube such that the
highest concentration is on the bottom and lowest on top. Percoll is a trademark owned by GE
Healthcare companies. A protein sample is then layered on top of the gradient and spun at high
speeds in an ultracentrifuge. This causes heavy macromolecules to migrate towards the bottom of the
tube faster than lighter material. During centrifugation in the absence of sucrose, as particles move
farther and farther from the center of rotation, they experience more and more centrifugal force (the
further they move, the faster they move)
3. chromatographic methods: Many different chromatographic methods exist :
1.Size exclusion chromatography : also known as molecular sieve chromatography, is
a chromatographic method in which molecules in solution are separated by their size, and in some
cases molecular weight. It is usually applied to large molecules or macromolecular complexes such as
proteins and industrial polymers. Typically, when an aqueous solution is used to transport the sample
through the column, the technique is known as gel-filtration chromatography
2.Ion exchange chromatography : is separates compounds according to the nature and degree of
their ionic charge. The column to be used is selected according to its type and strength of charge.
Anion exchange resins have a positive charge and are used to retain and separate negatively charged
compounds (anions), while cation exchange resins have a negative charge and are used to separate
positively charged molecules (cations).
3.Affinity chromatography :is a separation technique based upon molecular conformation, which
frequently utilizes application specific resins. These resins have ligands attached to their surfaces
which are specific for the compounds to be separated. Most frequently, these ligands function in a
 53

fashion similar to that of antibody-antigen interactions. This "lock and key" fit between the ligand and
its target compound makes it highly specific, frequently generating a single peak, while all else in the
sample is unretained
4.High performance liquid chromatography High performance liquid chromatography or high
pressure liquid chromatography is a form of chromatography applying high pressure to drive the
solutes through the column faster. This means that the diffusion is limited and the resolution is
improved. The most common form is "reversed phase" HPLC, where the column material
is hydrophobic. The proteins are eluted by a gradient of increasing amounts of an organic solvent,
such as acetonitrile
Extracellular enzyme

Intracellular enzyme
Break open cells by grinding or ultra-
sonics
Filter

Cell biomass (useful waste

product)

Enzyme in solution

Crude enzyme in solution eg protease

chemical industry

Concentrate by evaporation at low temperature and

pressure or by osmosis

Powdered crude enzyme eg pectinase

Precipitate

Pure enzyme for medicine eg

Chromatography glucose oxidase
54