See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/47674009

Development of ARMS PCR tests for detection of common CFTR gene

mutations

Article in Biopolymers and Cell · September 2010

DOI: 10.7124/bc.00016C · Source: DOAJ

CITATIONS READS

3 1,519

3 authors, including:

Oleksandr Soloviov Ludmila Livshits

National Academy of Sciences of Ukraine National Academy of Sciences of Ukraine
10 PUBLICATIONS 13 CITATIONS 101 PUBLICATIONS 1,462 CITATIONS

SEE PROFILE SEE PROFILE

All content following this page was uploaded by Oleksandr Soloviov on 22 March 2016.

The user has requested enhancement of the downloaded file.

ISSN 0233-7657. Biopolymers and Cell. 2010. Vol. 26. N 5

BIOMEDICINE

Development of ARMS PCR tests for detection

of common CFTR gene mutations
O. O. Soloviov, V. M. Pampukha, L. A. Livshits

Institute of Molecular Biology and Genetics NAS of Ukraine

150, Akademika Zabolotnoho Str., Kyiv, Ukraine, 03680
[email protected]

Aim. To develop diagnostic assays, based on the amplification refractory mutation system (ARMS) prin-
ciple, for detection of common mutations in the CFTR gene using two approaches: standard PCR with fur-
ther gel-electrophoresis and Real-Time PCR with SYBR Green. Materials. For this study we have chosen
the following mutations: dF508, W1282X, R117H, 621 + 1G > T, 2143delT with the frequencies in Ukraine:
dF508 – 43.3 %; 2143delT – 1.38 %; W1282X – 1.1 %; R117H, 621 + 1G > T – < 0.6 %. For the deve-
lopment and validation of the assay we have used control DNA samples with abovementioned mutations,
which were previously examined using RFLP and heteroduplex analysis. Results. We have designed the
primers and optimized the conditions of ARMS PCR performing for the analysis of dF508, W1282X, R117H,
621 + 1G > T, 2143delT mutations. To validate the developed assays we have analyzed control DNA
samples with the following mutations: W1282X (n = 3), R117H (n = 2), 621 + 1G > T (n = 1), 2143delT (n =
= 1). For validation of the dF508 assay we have analyzed 100 heterozygous carriers and 50 homozygous
carriers. We have analyzed 48 patients with cystic fibrosis, in which only one mutation was previously
detected in combination with unknown mutant variant, using the developed ARMS assay for the 2143delT
mutation, and detected 4 heterozygous carriers. No differences were observed in comparison with the
standard protocols. Conclusions. It was shown that ARMS is a reliable, rapid and inexpensive method, and
the developed assays can be applied in the standard PCR protocol with further gel-electrophoresis as well
as using Real-Time PCR with SYBR Green for the molecular genetic diagnostics of cystic fibrosis.
Keywords: ARMS, Real-Time PCR, cystic fibrosis, CFTR gene.

Introduction. Cystic fibrosis (CF) is one of the most DNA and distinguishing between the normal, hetero-
common autosomal-recessive disorders in Caucasians zygous and homozygous mutant genotypes. This me-
that occurs with the frequency of 1/2500 newborns and thod is commonly referred to as PCR-ARMS or ARMS
is caused by mutations in the CFTR gene. More than (amplification refractory mutation system). ARMS is
1700 mutations were identified in this gene and the based on the observation that PCR amplification is in-
dF508 deletion was described as a causative mutation efficient or completely refractory if there is a mismatch
[1, 2]. A number of methods are applied for molecular between the 3' terminal nucleotide of a PCR primer and
genetic diagnostics of CF, namely, RFLP, SSCP, a corresponding template [3–5].
DGGE, dHPLC etc., but they are relatively slow and te- This approach implies two PCR reactions. Ampli-
chnically demanding. fication of the normal allele is accomplished using a
Several independent groups described a PCR-ba- primer complementary to the normal allele. Conver-
sed approach for analyzing known point mutations in sely, only the mutant allele will be amplified if the 3' re-
sidue is complementary to the mutant sequence. Thus,
Ó Institute of Molecular Biology and Genetics NAS of Ukraine, 2010 as a result a normal individual generates PCR product

378
 DEVELOPMENT OF ARMS PCR TESTS FOR DETECTION OF COMMON CFTR GENE MUTATIONS

Sequences of primers for ARMS tests

Mutation Nucleotide sequence Amplicon size, bp

dF508 GCCTGGCACCATTAAAGAA – common 80

GTATCTATATTCATCATAGGAAACACCACA – wild type

GTATCTATATTCATCATAGGAAACACCATT – mutant

R117H TTTGTAGGAAGTCACCAAAGCAGT – common 111

CCTATGCCTAGATAAATCGCGATAGAAC – wild type

CCTATGCCTAGATAAATCGCGATAGAAT – mutant

621 + 1G > T TGCCTTCTCTTTATTGTGAGGACACT – common 138

TGCCATGGGGCCTGTGCAAGGAAGTATTCC – wild type

TGCCATGGGGCCTGTGCAAGGAAGTATTCA – mutant

W1282X CCCATCACTTTTACCTTATAGGTGGGCCTC – common 178

CCTGTGGTATCACTCCAAAGGCTTTCCAC – wild type

CCTGTGGTATCACTCCAAAGGCTTTCCAT – mutant

2143delT ATGGGATGTGATTCTTTCGA – common 81

GAGACCTTACACCGTTTCTCATTA – wild type

GAGACCTTACACCGTTTCTCATAG – mutant

only in the normal reaction; a heterozygote gives pro- ne as dF508 – 43.3 %; 2143delT – 1.38 %; W1282X –
ducts in both reactions, and a homozygous mutant in- 1.1 %; R117H, 621 + G > T – < 0,6 %.
dividual gives amplification only in the mutant reaction Materials and methods. DNA extraction. DNA was
[6]. extracted from peripheral blood leukocytes by standard
This method has many advantages over the tradi- phenol-chloroform extraction methods [9].
tional methods of mutation detection: it is rapid (the ARMS primers and conditions. ARMS PCR ampli-
analysis is done in 2–3 hours), inexpensive, reliable fication of the dF508, W1282X, R117H, 621 + 1G > T
when a positive control sample is used, and it can be and 2143delT mutations was performed with using
easily visualized not only by electrophoresis in agarose specific oligonucleotide primers complementary either
gel but also by means of Real-Time PCR system. How- to the wild type sequence, or the DNA with mutation
ever, the ARMS method depends on several factors: (Table).
proper primers design and optimization of PCR con- The PCR reaction was performed in a final volume
ditions to avoid nonspecific amplification of the nor- of 15 µl containing 1 ´ PCR buffer, 1.5 mM MgCl2,
mal/mutant allele that could bring to false positive or 200 µM of each dNTP, 0.2 units of Taq-DNA poly-
negative results [6, 7]. merase (Biolabtech company) and 50–200 ng of the
Our aim was to develop ARMS methods for the DNA template.
analysis of common mutations causing CF, using both The Real-Time PCR was performed in a final vo-
general PCR with the agarose gel electrophoresis sys- lume of 15 µl containing 1 ´ PCR buffer, 1.5 mM
tem and Real-Time PCR assay as a prototype of the test MgCl2, 200 µM of each dNTP, 0.2 units of Taq-DNA
kits for molecular genetic diagnostics of CF. For our polymerase (Biolabtech company), 1 ml 2 ´ SYBR Gre-
study we have chosen the following mutations: dF508, en and 25–50 ng of the DNA template.
W1282X, R117H, 621 + 1G > T, 2143delT. We have The control DNA samples with the dF508,
calculated the frequencies of these mutations in Ukrai- W1282X, R117H, 621 + 1G > T, 2143delT mutations

379
SOLOVIOV O. O., PAMPUKHA V. M., LIVSHITS L. A.

A B
n m n m n m n m

111 bp

111 bp

1 2 1 2

Fig. 1. Electrophoregram for the analysis of a single ARMS assay for the R117H mutation in exon 4 of the CFTR gene of the wild type samp-
les; 1.8 % agarose gel. The first lanes (n) of each sample are the products with normal set of primers and the second lanes (m) – amplification
products with mutant set of primers. The results with the concentration of primers 5 pM (A) show that the sample 1 corresponds to heterozy-
gous carrier of the R117H mutation. Reducing the concentration of primers to 2.5 mM (B) eliminates nonspecific amplification of the mutant
product

220 70

PCR Base Line Subtracted Curve Fit RFU

PCR Base Line Subtracted Curve Fit RFU

200
60
180 wt
50
160
140 40
120 30
wt
100
20
80
60 10 mut
mut
40 0
20
–10
0
0 5 10 15 20 25 30 35 0 5 10 15 20 25 30 35

A Cycle Cycle
B

Fig. 2. Fluorogram of the R117H mutation (mut) detection in exon 4 of the CFTR gene of the wild type (wt) samples using ARMS Real-Time
PCR with the concentration of primers 5 pM (A) – the sample looks like a heterozygous carrier of R117H mutation. Reducing the
concentration of primers to 2.5 pM (B) eliminates nonspecific amplification of the mutant product
n m n m n m n m n m n m n m
Results and discussion. To optimize the PCR
conditions to avoid non-specific amplification of the
alleles we have chosen appropriate concentrations of
primers and annealing temperature. Annealing tempe-
rature was determined using the gradient PCR (data not
80 bp
shown); the temperature was: for dF508 – 59 °C; for
1 2 3 4 5 6 7 8 2143delT – 64 °C and for the mutations R117H,
Fig. 3. Electrophoregram of the dF508 ARMS detection in 1.8 % 621 + 1 G > T, W1282X – 67 °C.
agarose gel:1–3, 6, 7 – normal individuals; 4 – heterozygous carrier It has been shown that the titrating of the concen-
of the dF508; 5 – homozygous carrier of the dF508; 8 – molecular
weight marker (100 bp ladder)
trations of primers and/or Mg2+ can improve the speci-
ficity of the assay [6, 7]. In Fig. 1 the electrophoregram
were previously analyzed using RFLP and a hetero- of ARMS PCR assay for the R117H mutation detec-
duplex assay [8, 10–13]. tion with different concentrations of primers is shown.

380
 DEVELOPMENT OF ARMS PCR TESTS FOR DETECTION OF COMMON CFTR GENE MUTATIONS

180

160 140
PCR Base Line Subtracted Curve Fit RFU

PCR Base Line Subtracted Curve Fit RFU

140 120

120 wt 100

100 80 wt
80 60
mut
60 40
40 20
mut
20 0
0 –20
–20 –40
–40
0 5 10 15 20 25 30 35 0 5 10 15 20 25 30 35 40
A Cycle B Cycle

110
100
PCR Base Line Subtracted Curve Fit RFU

90
80
70
60
50 mut
40
30
20 Fig. 4. Fluorogram of the ARMS Real-Time PCR detection of
wt
10 the dF508 mutation (mut): A – the profile of the normal
0 individual (only the wild type (wt) sequence amplifies); B –
the profile of the heterozygous carrier (wild type and mutant
–10
sequences amplify with similar effectiveness); C – the profile
0 5 10 15 20 25 30 35 of the homozygous mutation carrier (only the mutant sequen-
C Cycle ce amplifies)

Amplification of the normal samples with the con- dard PCR with further agarose gel electrophoresis of
centration of primers 5 mM can lead to the formation of the amplified products and Real-Time PCR assay are
the PCR product with the mutant pair of primers, while presented in Fig. 3 and Fig. 4 correspondently.
the reduction of concentration to 2.5 mM prevents from Considering the optimized annealing temperatures
nonspecific amplification. and primers concentrations, the following amplifi-
The influence of the primers concentration on the cation conditions for detection assays of the dF508,
ARMS specificity is more significant when using Real- R117H, 621 + 1 G > T, W1282X, 2143delT mutations
Time PCR. In Fig. 2 the same experiment for the were proposed:
R117H mutation is shown. – concentration of each primer: dF508 – 6 pM;
We have determined the optimal primers concen- R117H – 2.5 pM; W1282X, 621 + 1 G > T, 2143delT –
trations for the developed assay: dF508 – 6 pM of each 10 pM.
primer; R117H – 2.5 pM of each primer; W1282X, – the cycling conditions for the dF508 mutation
621 + 1 G > T, 2143delT – 10 pM of each primer. The were: initial denaturation at 95 °C for 5 min, 30 cycles
results of detection of the dF508 deletion using stan- consisting of denaturation at 95 °C for 30 s, annealing

381
SOLOVIOV O. O., PAMPUKHA V. M., LIVSHITS L. A.

trol sample, appeared to be the dI507 mutation, that

proves the effectiveness of the developed assay.
For the analysis of 2143delT mutation we have
used the heteroduplex assay to identify the mutant pro-
file for further detection of this deletion with ARMS
PCR (Fig. 5) [12, 13]. Using the heteroduplex analysis
of the exon 13 CFTR gene we have identified the
2143delT and 2184insA mutations in the control DNA
samples. However, application of the heteroduplex
analysis for detection of the single-nucleotide deleti-
ons/insertions is restricted because of impossibility to
195 bp detect the mutant homozygote; therefore the ARMS
1 2 3 4 5 test is preferable.
We have analyzed 48 CF patients, in which one
Fig. 5. Electrophoregram of the heteroduplex analysis of exon 13 of
the CFTR gene, 10 % PAGE: 1 – molecular weight marker (50 bp mutation was previously detected, using the developed
ladder); 2, 3 – normal individuals; 4 – heterozygous carriers of ARMS assay for the 2143delT mutation and detected
4 heterozygous carriers. The 2184insA mutation was
at 59 °C for 30 s, extension at 72 °C for 30 s and a final identified in 12 CF patients using the heteroduplex
elongation step at 72 °C for 3 min. analysis.
– the cycling conditions for the 2143dT mutation Conclusions. We have developed and, using the
were: initial denaturation at 95 °C for 5 min, 30 cycles analysis of the control DNA samples, validated the di-
consisting of denaturation at 95 °C for 30 s, annealing agnostic assays for the detection of common CF mu-
at 64 °C for 30 s, extension at 72 °C for 30 s and a final tations: dF508, R117H, 621 + 1G > T, W1282X and
elongation step at 72 °C for 3 min. 2143delT with the ARMS PCR approach. It was shown
– the cycling conditions for the R117H, 621 + 1 G > that the ARMS is a reliable, rapid and inexpensive
T, W1282X mutations were: initial denaturation at method and the developed assays can be applied in the
95 oC for 5 min, 30 cycles consisting of denaturation at standard PCR protocol with further gel-electrophoresis
95 °C for 30 s, annealing at 66 °C for 30 s, extension at as well as Real-Time PCR with SYBR Green.
72 °C for 30 s, and a final elongation step at 72 °C for
Î. Î. Ñîëîâéîâ, Â. Ì. Ïàìïóõà, Ë. À. ˳âøèöü
3 min.
– in case of the Real-Time PCR procedure, the cyc- Ðîçðîáêà òåñò³â íà îñíîâ³ àëåëü-ñïåöèô³÷íî¿ ÏËÐ äëÿ
äåòåêö³¿ ðîçïîâñþäæåíèõ ìóòàö³é ó ãåí³ òðàíñìåáðàííîãî
ling conditions were as follows: initial denaturation at
ðåãóëÿòîðíîãî á³ëêà ìóêîâ³ñöèäîçó
95 °C for 10 min, 35 two-step cycles consisting of de-
naturation at 95 °C for 20 s and annealing with elonga- Ðåçþìå
tion at 57 °C (for dF508), 64 °C (for 2143dT) and 67 °C Ìåòà. Ìåòà äîñë³äæåííÿ ïîëÿãàëà ó ðîçðîáö³ ä³àãíîñòè÷íèõ
ìåòîäèê, îñíîâàíèõ íà ïðèíöèï³ àëåëü-ñïåöèô³÷íî¿ ÏËÐ äëÿ
(R117H, 621 + 1 G > T, W1282X) for 30 s.
àíàë³çó ðîçïîâñþäæåíèõ ìóòàö³é â ãåí³ ÒÐÁÌ ç âèêîðèñòàííÿì
To validate the method developed we have analy- äâîõ ï³äõîä³â: òðà äèö³éíî¿ ÏËÐ ç ïîäàëü øèì ðîçä³ëåííÿì ïðî-
zed the control DNA samples with the W1282X (n = 3), äóêò³â ó ãåëü-åëåêòðî ôîðåç³ òà ç âèêîðèñòàííÿì ÏËÐ ó ðå àëü -
íîìó ÷àñ³. Ìåòîäè. Äëÿ äîñë³äæåííÿ îáðàíî òàê³ ìó òàö³¿ –
R117H (n = 2), 621 + 1G > T (n = 1), 2143delT (n = 1) dF508, W1282X, R117H, 621 + 1G > T, 2143delT ç ÷àñòî òîþ
mutations. For validation of the dF508 ARMS test we çóñòð³÷àëü íîñò³ â Óêðà¿í³: dF508 – 43,3 %; 2143delT – 1,38 %;
have analyzed 100 heterozygous carriers and 50 homo- W1282X – 1,1 %; R117H ³ 621 + 1G > T – < 0,6 %. Âèêîðèñòàíî
êîíòðîëüí³ çðàçêè ÄÍÊ ç â³äïîâ³äíèìè ìó òàö³ÿìè, ³äåíòèô³êî-
zygous carriers of the dF508 mutation. No differences âàí³ ìåòîäàìè ãåòåðîäóïëåêñíîãî àíàë³çó òà ÏÄÐÔ. Ðåçóëü-
were observed in the results obtained using the stan- òàòè. Ïðîâåäåíî äèçàéí òà îïòèì³çîâàíî óìîâè àëåëü-ñïå -
dard protocols, except for one control DNA sample öèô³÷íî¿ àìïë³ô³êàö³¿ äëÿ âèâ ÷åííÿ ìóòàö³é dF508, W1282X,
R117H, 621 + 1G > T, 2143delT. Ðîç ðîáëåí³ ìåòî äè êè àíàë³çó
with heterozygous dF508 mutation, which as a result of ï³äòâåð äæåíî ïåðåâ³ðêîþ êîíòðîëü íèõ çðàçê³â ÄÍÊ ç ìóòà-
the detailed analysis using the standard sequenced con- ö³ÿìè W1282X (n = 3), R117H (n = 2), 621 + 1G > T (n = 1),

382
 DEVELOPMENT OF ARMS PCR TESTS FOR DETECTION OF COMMON CFTR GENE MUTATIONS

2143delT (n = 1). Ùîá ïå ðåâ³ðèòè òåñò íà dF508 íàìè ïðî àíà- REFERENCES
ë³çîâàíî 100 íîñ³¿â äàíî¿ ìóòàö³¿ â ãåòåðîçèãîòíîìó ñòàí³ òà
50 – â ãîìîçèãîòíîìó. Çà äîïîìîãîþ ñòâîðåíî¿ ìåòîäèêè äå- 1. Kerem B.-S., Rommens J. M., Buchanan D. M., Cox T. K.,
òåêö³¿ 2143delT ïðîàíàë³çîâà íî òà êîæ 48 ïàö³ºíò³â, õâî ðèõ íà Chakravarti A., Buchwald M., Tsui L.-C. Identification of the
ìó êîâ³ñöèäîç, ó ÿêèõ ïåð âèííî âèÿâ ëåíî ëèøå ïî îäí³é ìóòàö³¿ cystic fibrosis gene: genetic analysis // Science.–1989.– 245,
ðàçîì ç íåâ³äîìèì ìóòàíòíèì âàð³àíòîì.  ðåçóëüòàò³ àíà- N 4922.–P. 1073–1080.
ë³çó ñåðåä íèõ âèçíà÷åíî ùå ÷îòèðè íîñ³¿ çàçíà÷åíî¿ äåëåö³¿ â ãå- 2. Tsui L. C. Cystic fibrosis mutation database: www.genet.si-
òåðîçèãîòíîìó ñòàí³. Ïðè öüîìó íå âñòàíîâëåíî ðîçá³æíîñ- ckkids.com.ca.
òåé â äàíèõ, îòðèìàíèõ ç âèêîðèñòàííÿì ñòàíäàðòíèõ
3. Newton C. R., Graham A., Heptinstall L. E., Powell S. J.,
ïðîòîêîë³â àíàë³çó äîñë³äæåíèõ ìóòàö³é. Âèñíîâêè. Ïîêàçà- Summers C., Kalsheker N., Smith J. C., Markham A. F. Ana-
íî, ùî ìå òîä àëåëü-ñïå öèô³÷íî¿ ÏËÐ º øâèä êèì òà â³äíîñ íî lysis of any point mutation in DNA. The amplification refrac-
íåäîðîãèì, éîãî ìîæíà çàñòîñîâóâàòè äëÿ äåòåêö³¿ â³äîìèõ tory mutation system (ARMS) // Nucl. Acids Res.–1989.–17,
ìó òàö³é ó ãåí³ ÒÐÁÌ. N 7.–P. 2503–2516.
Êëþ÷îâ³ ñëî âà: àëåëü-ñïå öèô³÷íà ÏËÐ, ÏËÐ ó ðå àëü íîìó 4. Okayama H., Curiel D. T., Brantly M. L., Holmes M. D.,
÷àñ³, ìó êîâ³ñöèäîç, ãåí ÒÐÁÌ. Crystal R. D. Rapid nonradioactive detection of mutations in
the human genome by allele-specific amplification // J. Lab.
À. À. Ñîëîâü åâ, Â. Í. Ïàì ïóõà, Ë. À. Ëèâ øèö Clin. Med.–1989.–114, N 2.–P. 105–113.
Ðàçàðàáîòêà òåñòîâ íà îñíîâå àëëåëü-ñïåöèôè÷åñêîé ÏÖÐ äëÿ 5. Sommer S. S., Groszbach A. R., Bottema C. D. PCR amp-
lification of specific alleles (PASA) is a general method for
äåòåêöèè ðàñïðîñòðàíåííûõ ìóòàöèé â ãåíå òðàíñìåáðàííîãî rapidly detecting known singlt-base changes // Biotechni-
ðåãóëÿòîðíîãî áåëêà ìóêîâèñöèäîçà ques.–1992.–12, N 1.–P. 82–87.
6. Patrinos G. P., Ansorge W. Molecular diagnostics.–Amster-
Ðåçþìå
dam: Elsevier, 2005.–461 p.
Öåëü. Öåëü ðàáîòû ñîñòîÿëà â ðàçðàáîòêå äèàãíîñòè÷åñêèõ 7. Ferrie R. M., Schwarz M. J., Robertson N. H., Vaudin S., Su-
ìåòîäèê, îñíîâàííûõ íà ïðèíöèïå àëëåëü-ñïåöèôè÷åñêîé ÏÖÐ per M., Malone G., Little S. Development, multiplexing and
äëÿ àíàëèçà ðàñïðîñòðàíåííûõ ìóòàöèé â ãåíå ÒÐÁÌ ñ èñïîëü - application of ARMS tests for common mutations in the
çîâàíèåì äâóõ ïîäõîäîâ: òðàäèöèîííîé ÏÖÐ c äàëüíåéøèì ðàç- CFTR gene // Amer. J. Hum. Genet.–1992.–51, N 2.–P. 251–
äåëåíèåì ïðîäóêòîâ â ãåëü-ýëåêòðîôîðåçå è ÏÖÐ â ðåàëüíîì 262.
âðåìåíè. Ìåòîäû. Äëÿ èññëåäîâàíèé âûáðàíû ñëåäóþùèå ìó - 8. Livshits L. A., Kravchenko S. A., Mikhaylets L. P., Sopko N. I.
òà öèè – dF508, W1282X, R117H, 621 + 1G > T, 2143delT ñ ÷àñ - Mutation screening results // Eur. Com. Concer. Act. Cystic
òî òîé âñòðå ÷à åìîñ òè â Óêðà èíå: dF508 – 43,3 %; 2143delT – Fibrosis Newsletter.–1996.–3, N 2.–P. 3–4.
1,38 %; W1282X – 1,1 %; R117H è 621 + 1G > T – < 0,6 %. 9. Maniatis T., Fritsch E. F., Sambrook J. Molecular cloning: A
Èñïîëüçîâàíû êîíòðîëüíûå îáðàçöû ÄÍÊ ñ ñîîòâåòñòâóþùè- laboratory manual.–New York: Cold Spring Harbor Lab.
ìè ìóòàöèÿìè, èäåíòèôèöèðîâàííûå ìåòîäàìè ãåòåðîäóï- publ., 1982.–545 p.
ëåêñíîãî àíàëèçà è ÏÄÐÔ-àíàëèçà. Ðåçóëüòàòû. Ïðîâåäåí 10. Livshyts L. A. A molecular genetic analysis of the mutations
äèçàéí è îïòèìèçèðîâàíû óñëîâèÿ àëëåëü-ñïåöèôè÷åñêîé àì - in the exons of the CFTR gene in cystic fibrosis patients in
ïëèôèêàöèè äëÿ àíàëèçà ìóòàöèé dF508, W1282X, R117H, Ukraine // Cytology and Genetics.–2000.–34, N 4.–P. 6–9.
621 + 1G > T, 2143delT. Ðàçðàáîòàííûå ìåòîäèêè àíàëèçà ïîä- 11. Livshits L. A., Kravchenko S. A., Grishko V. I., Musienko S.
òâåðæäåíû ïðîâåðêîé êîíòðîëüíûõ îáðàçöîâ ÄÍÊ ñ ìóòàöèÿ - I., Ekshyyan O. Yu., Sopko N. I. Prenatal diagnosis of the most
ìè W1282X (n = 3), R117H (n = 2), 621 + 1G > T (n = 1), 2143delT common monogenic hereditary diseases in Ukraine // Cyto-
(n = 1). Äëÿ ïðîâåðêè òåñòà íà dF508 ïðîàíàëèçèðîâàíû 100 genet. Cell. Genet.–1997.–77.–P. 157.
íîñèòåëåé äàííîé ìóòàöèè â ãåòåðîçèãîòíîì ñîñòîÿíèè è 50 – 12. Ivaschenko T. E., Baranov V. S. Biochemical and molecular-
â ãîìîçèãîòíîì ñîñòîÿíèè. Ñ ïîìîùüþ ðàçðàáîòàííîé ìåòî - genetic basics of cystic fibrosis pathogenesis.–St.-Peters-
äèêè äåòåêöèè 2143delT ïðîàíàëèçèðîâàíû òàêæå 48 ïàöèåí- burg: Intermedika, 2002 – 256 p.
òîâ, áîëüíûõ ìóêîâèñöèäîçîì, ó êîòîðûõ ïåðâè÷íî âûÿâëåíî 13. Petrova N. V., Kapranov N. I., Ginter E. K. Detection of fre-
ëèøü ïî îäíîé ìóòàöèè âìåñòå ñ íåèçâåñòíûì ìóòàíòíûì âà- quent mutations of the CFTR gene in cystic fibrosis patients
ðèàíòîì.  ðåçóëüòàòå àíàëèçà ñðåäè íèõ îïðåäåëåíû åùå ÷å- from Central Russia // Genetika.–1997.–33, N 1.–P. 106–
òûðåå íîñèòåëÿ óêàçàííîé äåëåöèè â ãåòåðîçèãîòíîì ñîñòî- 109.
ÿíèè. Ïðè ýòîì íå íàéäåíî îòëè÷èé â äàí íûõ, ïîëó÷åííûõ ñ èñ-
ïîëüçîâàíèåì ñòàíäàðòíûõ ïðîòîêîëîâ àíàëèçà ýòèõ ìóòà -
UDC 575.11 + 577.21
öèé. Âûâî äû. Ïîêàçàíî, ÷òî ìåòîä àëëåëü-ñïåöèôè÷åñêîé
ÏÖÐ ÿâëÿåòñÿ áûñòðûì è îòíîñèòåëüíî íåäîðîãèì, åãî ìîæ- Recieved 12.04.10
íî ïðèìåíÿòü äëÿ äåòåêöèè èçâåñòíûõ ìóòàöèé â ãåíå ÒÐÁÌ.
Êëþ÷åâûå ñëîâà: àëëåëü-ñïåöèôè÷åñêàÿ ÏÖÐ, ÏÖÐ â ðåàëü -
íîì âðåìåíè, ìóêîâèñöèäîç, ãåí ÒÐÁÌ.

383

View publication stats