Electrophoresis Lab Report

Instructions: In this lab activity, you will examine the DNA evidence from the crime scene to
determine what may have happened to the victim. Using electrophoresis, you will create a DNA
“fingerprint” for each DNA sample in order to compare all samples more easily. Submit your
lab report to your instructor when completed.

Title: Electrophoresis Lab Report

Objective(s): using electrophoresis to analyze blood samples in order to ascertain the

individual's fate

Introduction-Restriction Enzymes

Scientists use restriction enzymes for many purposes. In the field of forensic science, they are
used to cleave and analyze DNA structure to identify an individual suspected of a crime.
Restriction enzymes digest DNA by cutting the molecule at specific locations called restriction
sites. These sites consist of a four- to 10-nucleotide base pair (bp) called a palindrome — a
sequence of DNA nucleotides that reads the same from either direction. Restriction enzymes cut
DNA strands between two bases within this palindrome. A cut exactly in the center of the
restriction site can create blunt ends. Cuts in other locations within the palindrome can create a
single-stranded overhanging piece or “sticky” end of unpaired nucleotides.

Many processes using biotechnology depend on combing DNA fragments from different sources.
Another enzyme, DNA ligase, can bond two pieces of DNA together when they are cut with the
same restriction enzyme.

Introduction-Restriction Enzymes Reflection Questions

1. You have a piece of DNA with the following template strand: 5’-
ATCGAATTCGTCGCTGAATTCGCCTAACTCCCGTGCCTATATATGGAATTC
GCT-3’

a) What is the sequence of the complementary DNA strand? Type it below. 3’-
TAGCTTACGTTGATTCGCCTTAACTCCCGCCTATATATAGCAATTCGGT-3
b.If you were creating a complementary strand of RNA instead, how would it differ from the
DNA strand? It would be exactly the same, except the base pair of T would be changed to C, and
the RNA base pairs would not contain any thymine. It would be exactly the same, except the
base pair of T would be changed to C, and the RNA base pairs would not contain any thymine.

C.How is DNA structure and composition different from RNA?

While RNA is often single stranded, DNA is double-stranded with phosphate to form a double
helix.

2. The DNA strand above is cut with a restriction enzyme at the restriction site 5’-
GAATTC-3’. The enzyme makes a staggered cut between the two T’s of the
restriction site. Based on this information, write the DNA sequences of the resulting
DNA fragments. 3’-CTTS-5’ 3’-CT-5’

Hypothesis: The victim suffered cuts and bleeding after being forced to smash a patio door. The
suspect says he had nothing to do with the victim's murder, yet he was at home when it
happened.

What do you think happened to the victim? Whose blood was on the floor? Who was responsible
for the state of the kitchen? Write a hypothesis to the scenario to reveal “whodunit” based on
motive, means, and opportunity.

Procedure:

Access the virtual lab and complete the electrophoresis procedure. Provide a brief summary of
the steps you followed during the experimental procedure.

Materials:

Electrophoresis Virtual Lab

Summary of Steps: 1. Prepare the agarose gel specified in the laboratory assignment.
2. Use a pipette to collect each DNA sample, yielding 10 ml.
3. Put five to ten microliters of DNA into each well.
4. Once the gel is in the electrophoresis, start the process.
Variables:

List your controlled variables, independent variable, and dependent variable of the process.
Explain why these are the variables.

Remember, controlled variables are factors that remain the same throughout the experiment. An
independent (test) variable changes so that the experimenter can see the effect on other variables.
The dependent (outcome) variable will change in response to the test variable.

Controlled variables: blood

Independent variable: the DNA samples

Dependent variable: The suspect

Data:

Complete the table to organize the data collected in this lab. Don’t forget to record measurements
with the correct number of significant figures.

Sample 1 Sample 2 Sample 3 Sample 4 Sample 5

Distance BP Distance BP Distance BP Distance BP Distance BP
Traveled length Traveled length Traveled length Traveled length Traveled length
(mm) (mm) (mm) (mm) (mm)
1.5 0 3.2 0 5 14000 2.5 0 2.5 0
2.6 0 7.2 11000 10 10000 4.9 14000 4.7 14000
10.3 7000 19.3 4000 15 6000 12 9000 12 9000
14.3 10000 28.7 6000 16.5 5000 15 3000 15 3000
25.3 300 30 2000 23.5 2300 25 2500 25 2500
39.2 900 35.1 2000 26.8 2500 37 1000 37 1000
Conclusion: After reviewing the events leading up to the victim's disappearance, I'm now certain
that her husband is to blame since he doesn't have a credible alibi and could have been motivated
by marital problems. As of right now, it is unknown whose blood was located at the crime site,
thus this is merely a growing suspicion. The information gathered demonstrates that two matched
samples exist, indicating the involvement of numerous individuals. This refutes my first theory
as it suggests that there could be more going on than just the victim's own carelessness.

Write a conclusion statement that addresses the following questions:

 Based on motive, means, opportunity, and DNA evidence, who do you think was
responsible for the disappearance of the victim and the scene in the kitchen.
 Does your data support or fail to support your hypothesis (include examples)?
 What additional evidence do you need to better explain your results?
  Discuss any possible sources of error that could have impacted the results of this lab.

Lab Reflection Questions

Answer the reflection questions using what you have learned from the lesson and your
experimental data. It will be helpful to refer to your class notes. Answer questions in complete
sentences.

1. Why is a quantitative method, such as using a standard curve to determine base pair
lengths, more appropriate than a visual (qualitative) comparison of the DNA profiles?

2. Genetic testing for the purposes of determining ancestry has increased dramatically over
the past five years. This has also increased the DNA databases that hold and control this
genetic commodity. Recently, a cold case was solved by genetically linking the suspect to
a distant cousin through one of these DNA databases.
a) Explain the social and ethical issues raised by using DNA, donated for the purposes of
ancestry information, as evidence to solve crimes.

b) Make a claim for or against using DNA databases in this way. DNA databases need
to be used in this way because it can give new and vital information to the investigators
to solve the cases give justice to the victims’ families.

C) Justify your claim with evidence and reasoning that supports your claim. The
investigators need to have access to this database, they can give them leads on the cases
that they have possible vital information that they don’t have access to beforehand.