Methods in

Molecular Biology 2279

Pedro G. Santiago-Cardona Editor

Lung Cancer
Methods and Protocols
METHODS IN MOLECULAR BIOLOGY

Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK

For further volumes:

http://www.springer.com/series/7651
For over 35 years, biological scientists have come to rely on the research protocols and
methodologies in the critically acclaimed Methods in Molecular Biology series. The series was
the first to introduce the step-by-step protocols approach that has become the standard in all
biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by-
step fashion, opening with an introductory overview, a list of the materials and reagents
needed to complete the experiment, and followed by a detailed procedure that is supported
with a helpful notes section offering tips and tricks of the trade as well as troubleshooting
advice. These hallmark features were introduced by series editor Dr. John Walker and
constitute the key ingredient in each and every volume of the Methods in Molecular Biology
series. Tested and trusted, comprehensive and reliable, all protocols from the series are
indexed in PubMed.
 Lung Cancer

Methods and Protocols

Edited by

Pedro G. Santiago-Cardona
Biochemistry and Cancer Biology Divisions, Ponce Health Sciences University-Ponce Research Institute,
Ponce, Puerto Rico
Editor
Pedro G. Santiago-Cardona
Biochemistry and Cancer Biology
Divisions
Ponce Health Sciences University-Ponce
Research Institute
Ponce, Puerto Rico

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-0716-1277-4 ISBN 978-1-0716-1278-1 (eBook)
https://doi.org/10.1007/978-1-0716-1278-1
© Springer Science+Business Media, LLC, part of Springer Nature 2021
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been
made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Cover Illustration Caption: For more information, see Figure 3 from Chapter 4

This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer
Nature.
The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.
Preface

Lung cancer is characterized by an aggressive nature and a poor patient survival. This is in
spite of the recent significant advances in the understanding of the genetics, histology, and
molecular and cellular biology of the disease, as well as its clinical aspects. These knowledge
gains have resulted in improved detection, diagnosis, and patient treatment. Treatment in
particular has evolved to include targeted therapies based on particular tumor genetics and
molecular biology. Yet, in spite of this progress, the prognosis for lung cancer patients
remains relatively poor, with still low 5-year survival rates when compared to other cancer
types. Therefore, research aimed at furthering our understanding of this fatal disease is more
than warranted, at the basic, translational, and clinical levels. Together, the chapters of this
book have the overarching goal to serve as a laboratory manual that contains protocols and
in-depth discussion for commonly used experimental approaches for the characterization of
several aspects of lung tumor biology.
In the handling of many lung cancers cases, information about diagnosis, tumor
grading, staging, and histological sub-classification is obtained from the analyses of tumor
biopsy or resection specimens. Characterization and detection of clinically informative
biomarkers in such biological specimens is thus a priority for lung cancer management.
Analysis of biomarkers in lung tumor tissues guides clinical interventions and helps to assess
the histological origin of the tumor, probability of response to targeted therapy, metastatic
potential, probability of disease recurrence, and probability of acquiring resistance to
therapy. Along these lines, Chapters 1–3 of this book describe the protocols for the
immunohistochemistry (IHC) detection of TTF-1, P40, and NAPSIN-A, respectively.
These three protein biomarkers have proven extremely useful in sub-classifying non–small
cell lung carcinomas (NSCLC) into adenocarcinomas or squamous cell carcinomas (SCC)
when detected by IHC in lung tumor biopsy samples. Another clinically valuable biomarker
is PD-L1. Assessing the expression of PD-L1 in tumoral tissue may help clinicians to
determine which patients can benefit from immunotherapy using immune checkpoint
inhibitors. Lung cancer patients with strong tumoral PD-L1 expression may show a better
response to immunotherapy, and therefore, assessing PD-L1 expression in tumor biopsies
by IHC can help clinicians to stratify patients based on the likelihood of favorable outcomes
from immunotherapy. Chapter 4 describes a detailed protocol for the IHC detection of
PD-L1 expression in clinical samples, while Chapter 5 describes a protocol that can be used
to validate the specificity of anti-PD-L1 antibodies by immunoblot analysis, a validation that
is extremely important to assess whether a particular PD-L1 antibody is suitable for clinical
applications. These chapters dealing with immunological detection of clinically relevant
biomarkers are followed by two chapters dealing with the optimization aspects of immuno-
logical detection of antigens. Chapter 6 describes the optimization of the immunohisto-
chemistry procedure using lung cancer cell line–derived tridimensional spheroids with a
tumor-like tissue architecture. Using these spheroids for protocol optimization purposes
will avoid the use of valuable human lung tumor tissue samples in the optimization stage.
Some clinically informative biomarkers are phosphorylation of specific proteins, and the
immunologic detection of these phospho-proteins presents the additional challenge of

v
vi Preface

ensuring that the used antibody is able to detect specifically the phosphorylated version of
the protein. Chapter 7 describes a method for the immunoblot validation of the phospho-
specificity of antibodies using lung cancer cell lines.
Chapters 8–12 are devoted to the topic of the genetic and molecular characterization of
lung cancer biological samples. This is a central topic in lung cancer biology due, first, to the
variety of mutated alleles that have been found to have a strong oncogenic driver effect in
lung cancer and, second, to the importance of tumor genetics in determining many aspects
of tumor biology, as well as many aspects of the clinical interventions and management of
lung cancer. Aspects such as response to targeted therapy, acquisition of resistance to anti-
cancer treatments, and disease prognosis can be strongly influenced by tumor genetics and
molecular biology. The experimental approaches in this group of chapters include the
detection of oncogenic gene fusions, splice variants, and abnormal gene expression profiles
using NanoString technology (Chapter 8), protocols for PCR-based approaches for the
detection of mutations in EGFR , KRAS , and BRAS genes (Chapters 9 and 10), a
PCR-based approach to detect MET exon skipping (Chapter 11), and an immunocytochem-
ical approach for detecting ALK and ROS1 rearrangements in lung cancer cytological
samples (Chapter 12).
The following group of chapters of this book switch their focus to protocols for the
generation of research tools and preclinical lung cancer models that can be extremely
valuable to achieve a better understanding of lung tumor biology. Chapter 13 describes a
procedure for the generation of patient-derived xenografts by implanting human lung
tumor tissue into immunodeficient mice. This mouse-humanized xenograft model can
prove extremely valuable as a preclinical model to study various aspects of lung tumor
biology. Chapter 14 describes the generation of carcinogen-induced mouse cell lines mim-
icking traits of lung adenocarcinomas. Being derived from mice exposed to tobacco smoke
carcinogens, these cell lines are extremely useful since their origin recapitulates the etiology
of the human disease. Many aspects of the aggressive nature of lung cancer, including relapse
and resistance against therapy, have been attributed to the presence of tumoral cancer stem
cells. Chapter 15 describes a procedure for the in vitro enrichment of mouse lung cancer
stem cells, together with a protocol for their characterization using a whole transcriptome
analysis. Chapter 16 describes an in vivo imaging procedure to monitor tumor growth and
progression in an orthotopic lung cancer model in mice. This chapter demonstrates the
power of such a model to monitor tumor response to chemotherapy. The disruption of
apoptotic pathways is one among the many traits associated with the cancer state, and
understanding how this breakdown occurs in cancer cells is still the topic of intense research.
Chapter 17 describes an annexin V/propidium iodide–based staining protocol to assess
apoptosis in lung cancer cells. It is generally accepted that aldehydes and carcinogens in
tobacco smoke have the capacity to react with DNA bases, creating mutagenic adducts. Such
mutagenic adducts play an important etiological role in lung cancer and can be considered
biomarkers for aldehyde exposure. Chapter 18 describes a high-performance liquid
chromatography-tandem mass spectrometry–based protocol to detect such DNA adducts
with specificity and sensitivity. Last but not least, the book closes with a chapter addressing
the very important topic of the effectivity of anti-cancer drug delivery. Chapter 19 describes
a method for cisplatin encapsulation in liposomes, with the aim of increasing drug delivery
while reducing toxicity.
Taken together, we hope the chapters of this book give the reader a global perspective of
the research efforts related to lung cancer, while allowing them to experimentally probe the
different aspects of lung cancer research in their laboratories, including the experimentally
 Preface vii

relevant tests used in the establishment of the diagnosis and prognosis of lung cancer. It is
hoped that the book serves as a guide to assist the molecular cancer biologists in their search
for the understanding of the molecular aspects of this disease.

Ponce, Puerto Rico Pedro G. Santiago-Cardona

Contents

Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi

1 Automated TTF-1 Immunohistochemistry Assay for the

Differentiation of Lung Adenocarcinoma Versus Lung
Squamous Cell Carcinoma . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
Rosa Vélez Cintro n, Andrés J. Martı́nez, Jo Ann Jusino,
Marı́a Conte-Miller, and Adalberto Mendoza
2 Immunohistochemical Detection of p40 Expression in Lung
Cancer Clinical Samples. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Aruna Nambirajan and Deepali Jain
3 Automated Immunohistochemistry Assay for the Detection of Napsin-A
in Formalin-Fixed Paraffin-Embedded Tissues from Lung Tumors . . . . . . . . . . . . 23
Rosa Vélez Cintro n, Jo Ann Jusino, Marı́a Conte-Miller,
Andrés J. Martı́nez, and Adalberto Mendoza
4 Detection of Programmed Cell Death Ligand 1 Expression in Lung
Cancer Clinical Samples by an Automated Immunohistochemistry System . . . . . 35
Edwin Roger Parra and Sharia Hernández Ruiz
5 Western Blot as a Support Technique for Immunohistochemistry
to Detect Programmed Cell Death Ligand 1 Expression . . . . . . . . . . . . . . . . . . . . . 49
Edwin Roger Parra and Sharia Hernández Ruiz
6 Creation of Formalin-Fixed, Paraffin-Embedded 3D Lung Cancer
Cellular Spheroids for the Optimization of Immunohistochemistry
Staining Procedures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
Jennifer Cabán-Rivera, Camille Chardon-Colon,
Alberto Pedraza-Torres, Yoan E. Rodrı́guez,
Raymond Quiñones-Alvarado,
and Pedro G. Santiago-Cardona
7 Immunoblot Validation of Phospho-Specific Antibodies Using
Lung Cancer Cell Lines. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
Wilfredo M. Pedreira-Garcı́a, Jaileene Pérez-Morales,
Camille Chardon-Colon, Jennifer Cabán-Rivera,
and Pedro G. Santiago-Cardona
8 Detection of Non-Small Lung Cell Carcinoma-Associated
Genetic Alterations Using a NanoString Gene Expression
Platform Approach . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91
Johan Staaf, Mats Jönsson, and Anna F. Karlsson
9 A PCR-Based Approach for Driver Mutation Analysis of
EGFR, KRAS, and BRAF Genes in Lung Cancer Tissue Sections. . . . . . . . . . . . . 109
Rodrigo de Oliveira Cavagna, Leticia Ferro Leal,
Flávia Escremim de Paula, Gustavo Noriz Bernardinelli,
and Rui Manuel Reis

ix
x Contents

10 6-Color Crystal Digital PCRTM for the High-Plex Detection

of EGFR Mutations in Non-Small Cell Lung Cancer . . . . . . . . . . . . . . . . . . . . . . . . 127
Jordan Madic, Cécile Jovelet, Imane Dehri, and Allison C. Mallory
11 Detection of MET Exon 14 Skipping Alterations in Lung
Cancer Clinical Samples Using a PCR-Based Approach . . . . . . . . . . . . . . . . . . . . . . 145
Jane S. Y. Sui, Stephen P. Finn, and Steven G. Gray
12 Immunocytochemical Detection of ALK and ROS1 Rearrangements
in Lung Cancer Cytological Samples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 157
Diane Frankel, Elise Kaspi, and Patrice Roll
13 A Method for the Establishment of Human Lung Adenocarcinoma
Patient-Derived Xenografts in Mice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 165
Joanne Lundy, Brendan J. Jenkins, and Mohamed I. Saad
14 A Method for the Establishment and Characterization of Mouse
Lung Adenocarcinoma Cell Lines that Mimic Traits of Human
Adenocarcinomas . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 175
Magda Spella, Ioannis Lilis, and Georgios T. Stathopoulos
15 Whole Transcriptome Sequencing Analysis of Cancer Stem/
Progenitor Cells Obtained from Mouse Lung Adenocarcinomas. . . . . . . . . . . . . . 187
Ansam Sinjab, Reem Daouk, Wassim Abou-Kheir,
and Humam Kadara
16 In Vivo Imaging of Orthotopic Lung Cancer Models in Mice . . . . . . . . . . . . . . . . 199
Peng Liu, Liwei Zhao, Laura Senovilla, Oliver Kepp,
and Guido Kroemer
17 An Annexin V-FITC—Propidium Iodide-Based Method for
Detecting Apoptosis in a Non-Small Cell Lung Cancer Cell Line . . . . . . . . . . . . . 213
Robin Kumar, Ankit Saneja, and Amulya K. Panda
18 Detection of DNA Adduct Formation in Rat Lungs by a
Micro-HPLC/MS/MS Approach. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225
Angélica B. Sanchez, Camila C. M. Garcia, Paolo Di Mascio,
and Marisa H. G. Medeiros
19 A Method for Liposome Co-encapsulation of Phenethyl Isothiocyanate
and Cisplatin and Determining Its Toxicity Against Lung and
Lung Cancer Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 241
Mengwei Sun and Anthony J. Di Pasqua

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 255
Contributors

WASSIM ABOU-KHEIR • Department of Anatomy, Cell Biology and Physiological Sciences,

Faculty of Medicine, American University of Beirut, Beirut, Lebanon
GUSTAVO NORIZ BERNARDINELLI • Center of Molecular Diagnoses, Barretos Cancer Hospital,
Barretos, Brazil
JENNIFER CABÁN-RIVERA • Epidemiology Program, School of Public Health, Ponce Health
Sciences University-Ponce Research Institute, Ponce, Puerto Rico
CAMILLE CHARDÓN-COLÓN • Biochemistry and Cancer Biology Divisions, Ponce Health
Sciences University-Ponce Research Institute, Ponce, Puerto Rico
ROSA VÉLEZ CINTRÓN • Southern Pathology Services Inc., Ponce, Puerto Rico; Pathology
Division, Ponce Health Science University, Ponce, Puerto Rico
MARÍA CONTE-MILLER • Southern Pathology Services Inc., Ponce, Puerto Rico; Pathology
Division, Ponce Health Science University, Ponce, Puerto Rico
REEM DAOUK • Department of Anatomy, Cell Biology and Physiological Sciences, Faculty of
Medicine, American University of Beirut, Beirut, Lebanon
RODRIGO DE OLIVEIRA CAVAGNA • Molecular Oncology Research Center, Barretos Cancer
Hospital, Barretos, Brazil
FLÁVIA ESCREMIM DE PAULA • Center of Molecular Diagnoses, Barretos Cancer Hospital,
Barretos, Brazil
IMANE DEHRI • Stilla Technologies, Villejuif, France
PAOLO DI MASCIO • Departamento de Bioquı́mica, Instituto de Quı́mica, Universidade de
São Paulo, São Paulo, SP, Brazil
ANTHONY J. DI PASQUA • Department of Pharmaceutical Sciences, School of Pharmacy and
Pharmaceutical Sciences, Binghamton University, Johnson City, NY, USA
STEPHEN P. FINN • Thoracic Oncology Research Group, Trinity Translational Medicine
Institute, St. James’s Hospital, Dublin, Ireland; Department of Histopathology, Cancer
Molecular Diagnostics, Labmed Directorate, St. James’s Hospital, Dublin, Ireland;
Department of Histopathology and Morbid Anatomy, Trinity College Dublin, Dublin,
Ireland
DIANE FRANKEL • Aix Marseille Univ, APHM, INSERM, MMG, Hôpital la Timone, Service
de Biologie Cellulaire, Marseille, France
CAMILA C. M. GARCIA • Departamento de Bioquı́mica, Instituto de Quı́mica, Universidade
de São Paulo, São Paulo, SP, Brazil; Núcleo de Pesquisas em Ciências Biologicas &
Departamento de Ciências Biologicas, Instituto de Ciências Exatas e Biologicas,
Universidade Federal de Ouro Preto, Ouro Preto, MG, Brazil
STEVEN G. GRAY • Thoracic Oncology Research Group, Trinity Translational Medicine
Institute, St. James’s Hospital, Dublin, Ireland; Department of Clinical Medicine, Trinity
College Dublin, Dublin, Ireland; School of Biological Sciences, Dublin Institute of
Technology, Dublin, Ireland
SHARIA HERNÁNDEZ RUIZ • Department of Translational Molecular Pathology,
Translational Molecular Pathology Immunoprofiling Laboratory, The University of Texas
MD Anderson Cancer Center, Houston, TX, USA
DEEPALI JAIN • Department of Pathology, All India Institute of Medical Sciences, New Delhi,
India

xi
xii Contributors

BRENDAN J. JENKINS • Centre for Innate Immunity and Infectious Diseases, Hudson Institute
of Medical Research, Clayton, VIC, Australia; Department of Molecular and
Translational Sciences, Faculty of Medicine, Nursing and Health Sciences, Monash
University, Clayton, VIC, Australia
MATS JÖNSSON • Division of Oncology and Pathology, Department of Clinical Sciences Lund,
Lund University, Lund, Sweden
CÉCILE JOVELET • Stilla Technologies, Villejuif, France
JO ANN JUSINO • Southern Pathology Services Inc., Ponce, Puerto Rico
HUMAM KADARA • Department of Translational Molecular Pathology, University of Texas
MD Anderson Cancer Center, Houston, TX, USA
ANNA F. KARLSSON • Division of Oncology and Pathology, Department of Clinical Sciences
Lund, Lund University, Lund, Sweden
ELISE KASPI • Aix Marseille Univ, APHM, INSERM, MMG, Hôpital la Timone, Service de
Biologie Cellulaire, Marseille, France
OLIVER KEPP • Metabolomics and Cell Biology Platforms, Gustave Roussy Comprehensive
Cancer Institute, Villejuif, France; Equipe 11 labellisée Ligue contre le Cancer, Centre de
Recherche des Cordeliers, INSERM UMR 1138, Paris, France; Sorbonne Université, Paris,
France; Université of Paris, Paris, France
GUIDO KROEMER • Metabolomics and Cell Biology Platforms, Gustave Roussy Comprehensive
Cancer Institute, Villejuif, France; Equipe 11 labellisée Ligue contre le Cancer, Centre de
Recherche des Cordeliers, INSERM UMR 1138, Paris, France; Sorbonne Université, Paris,
France; Université of Paris, Paris, France; Suzhou Institute for Systems Medicine, Chinese
Academy of Sciences, Suzhou, China; Department of Women’s and Children’s Health,
Karolinska Institute, Stockholm, Sweden; Pôle de Biologie, Hôpital Européen Georges
Pompidou, AP-HP, Paris, France
ROBIN KUMAR • Product Development Cell, National Institute of Immunology, New Delhi,
India
LETICIA FERRO LEAL • Molecular Oncology Research Center, Barretos Cancer Hospital,
Barretos, Brazil; Barretos School of Medicine Dr. Paulo Prata – FACISB, Barretos, Brazil
IOANNIS LILIS • Laboratory for Molecular Respiratory Carcinogenesis, Department of
Physiology, Faculty of Medicine, University of Patras, Rio, Greece
PENG LIU • Metabolomics and Cell Biology Platforms, Gustave Roussy Comprehensive Cancer
Institute, Villejuif, France; Equipe 11 labellisée Ligue contre le Cancer, Centre de Recherche
des Cordeliers, INSERM UMR 1138, Paris, France; Sorbonne Université, Paris, France;
Université of Paris, Paris, France
JOANNE LUNDY • Centre for Innate Immunity and Infectious Diseases, Hudson Institute of
Medical Research, Clayton, VIC, Australia; Department of Molecular and Translational
Sciences, Faculty of Medicine, Nursing and Health Sciences, Monash University, Clayton,
VIC, Australia; Department of Surgery, School of Clinical Sciences at Monash Health,
Monash University, Clayton, VIC, Australia
JORDAN MADIC • Stilla Technologies, Villejuif, France
ALLISON C. MALLORY • Stilla Technologies, Villejuif, France
ANDRÉS J. MARTÍNEZ • School of Public Health, Ponce Health Science University, Ponce,
Puerto Rico
MARISA H. G. MEDEIROS • Departamento de Bioquı́mica, Instituto de Quı́mica,
Universidade de São Paulo, São Paulo, SP, Brazil
ADALBERTO MENDOZA • Southern Pathology Services Inc., Ponce, Puerto Rico; Pathology
Division, Ponce Health Science University, Ponce, Puerto Rico
 Contributors xiii

ARUNA NAMBIRAJAN • Department of Pathology, All India Institute of Medical Sciences, New
Delhi, India
AMULYA K. PANDA • Product Development Cell, National Institute of Immunology, New
Delhi, India
EDWIN ROGER PARRA • Department of Translational Molecular Pathology, Translational
Molecular Pathology Immunoprofiling Laboratory, The University of Texas MD Anderson
Cancer Center, Houston, TX, USA
ALBERTO PEDRAZA-TORRES • Biochemistry and Cancer Biology Divisions, Ponce Health
Sciences University-Ponce Research Institute, Ponce, Puerto Rico
WILFREDO M. PEDREIRA-GARCÍA • Biochemistry and Cancer Biology Divisions, Ponce Health
Sciences University-Ponce Research Institute, Ponce, Puerto Rico
JAILEENE PÉREZ-MORALES • Biochemistry and Cancer Biology Divisions, Ponce Health
Sciences University-Ponce Research Institute, Ponce, Puerto Rico
RAYMOND QUIÑONES-ALVARADO • Biochemistry and Cancer Biology Divisions, Ponce Health
Sciences University-Ponce Research Institute, Ponce, Puerto Rico
RUI MANUEL REIS • Molecular Oncology Research Center, Barretos Cancer Hospital,
Barretos, Brazil; Center of Molecular Diagnoses, Barretos Cancer Hospital, Barretos,
Brazil; Life and Health Sciences Research Institute (ICVS), School of Health Sciences,
University of Minho, Braga, Portugal; ICVS/3B’s—PT Government Associate Laboratory,
Braga/Guimaraes, Portugal
YOAN E. RODRÍGUEZ • Biochemistry and Cancer Biology Divisions, Ponce Health Sciences
University-Ponce Research Institute, Ponce, Puerto Rico
PATRICE ROLL • Aix Marseille Univ, APHM, INSERM, MMG, Hôpital la Timone, Service
de Biologie Cellulaire, Marseille, France
MOHAMED I. SAAD • Centre for Innate Immunity and Infectious Diseases, Hudson Institute
of Medical Research, Clayton, VIC, Australia; Department of Molecular and
Translational Sciences, Faculty of Medicine, Nursing and Health Sciences, Monash
University, Clayton, VIC, Australia
ANGÉLICA B. SANCHEZ • Departamento de Bioquı́mica, Instituto de Quı́mica, Universidade
de São Paulo, São Paulo, SP, Brazil; Núcleo de Pesquisas em Ciências Biologicas &
Departamento de Ciências Biologicas, Instituto de Ciências Exatas e Biologicas,
Universidade Federal de Ouro Preto, Ouro Preto, MG, Brazil
ANKIT SANEJA • Product Development Cell, National Institute of Immunology, New Delhi,
India
PEDRO G. SANTIAGO-CARDONA • Biochemistry and Cancer Biology Divisions, Ponce Health
Sciences University-Ponce Research Institute, Ponce, Puerto Rico
LAURA SENOVILLA • Metabolomics and Cell Biology Platforms, Gustave Roussy Comprehensive
Cancer Institute, Villejuif, France; Equipe 11 labellisée Ligue contre le Cancer, Centre de
Recherche des Cordeliers, INSERM UMR 1138, Paris, France; Sorbonne Université, Paris,
France; Université of Paris, Paris, France
ANSAM SINJAB • Department of Translational Molecular Pathology, University of Texas MD
Anderson Cancer Center, Houston, TX, USA
MAGDA SPELLA • Laboratory for Molecular Respiratory Carcinogenesis, Department of
Physiology, Faculty of Medicine, University of Patras, Rio, Greece
JOHAN STAAF • Division of Oncology and Pathology, Department of Clinical Sciences Lund,
Lund University, Lund, Sweden
GEORGIOS T. STATHOPOULOS • Laboratory for Molecular Respiratory Carcinogenesis,
Department of Physiology, Faculty of Medicine, University of Patras, Rio, Greece;
xiv Contributors

Comprehensive Pneumology Center (CPC) and Institute for Lung Biology and Disease
(iLBD), University Hospital, Ludwig-Maximilians University and Helmholtz Center
Munich, Member of the German Center for Lung Research (DZL), Munich, Germany
JANE S. Y. SUI • Thoracic Oncology Research Group, Trinity Translational Medicine
Institute, St. James’s Hospital, Dublin, Ireland; Department of Medical Oncology, Mater
Misericordiae University Hospital, Dublin, Ireland
MENGWEI SUN • Department of Pharmaceutical Sciences, School of Pharmacy and
Pharmaceutical Sciences, Binghamton University, Johnson City, NY, USA
LIWEI ZHAO • Metabolomics and Cell Biology Platforms, Gustave Roussy Comprehensive
Cancer Institute, Villejuif, France; Equipe 11 labellisée Ligue contre le Cancer, Centre de
Recherche des Cordeliers, INSERM UMR 1138, Paris, France; Sorbonne Université, Paris,
France; Université of Paris, Paris, France; Université Paris-Saclay, Villejuif, France
 Chapter 1

Automated TTF-1 Immunohistochemistry Assay

for the Differentiation of Lung Adenocarcinoma Versus Lung
Squamous Cell Carcinoma
Rosa Vélez Cintrón, Andrés J. Martı́nez, Jo Ann Jusino,
Marı́a Conte-Miller, and Adalberto Mendoza

Abstract
Due to therapeutic advances, the subclassification of non-small cell lung carcinomas (NSCLC) between the
adenocarcinomas and squamous cell carcinomas subtypes is essential for the practice of personalized and
targeted medicine. The clinical management for these two NSCLC subtypes is different due to their
different molecular properties and histological origins. Immunohistochemistry (IHC) markers such is
TTF-1 play a key role in the differentiation of lung adenocarcinomas and squamous cell carcinomas.
However, immunohistochemistry is a complex process involving many critical steps and the reliability of
results depends on the standardization of the assay as well as the appropriate interpretation. Different
laboratories use different reagents and different IHC approaches for the detection of TTF-1 in lung cancer
tumors. Here we describe an automated IHC protocol used in our laboratory for the detection of TTF-1 in
formalin-fixed, paraffin-embedded (FFPE) tissue sections from lung tumors.

Key words Immunohistochemistry, Lung, Cancer, TTF-1, Adenocarcinoma, Squamous cell

carcinoma

1 Introduction

Lung cancer has been described as the second most diagnosed

cancer type around the world and one of the main causes of cancer
associated deaths [1, 2]. Approximately 85% of lung cancers are
non-small cell lung cancers (NSCLC) of which 40% are of the
adenocarcinoma subclassification and between 20% and 30% are
of the squamous cell carcinoma subtype [1]. In 2015 the World
Health Organization (WHO) reinforced the use of immunohisto-
chemistry (IHC) markers in the pathology practice for the subclas-
sification of NSCLC [3]. In view of therapeutic advances, NSCLC
subclassification between adenocarcinomas and squamous cell car-
cinomas is essential for the implementation of precision medicine; a

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021

1
2 Rosa Vélez Cintrón et al.

new form of medical practice where the treatment decisions are

based on the molecular and histological properties of the tumor
[3]. The clinical management of lung adenocarcinomas and squa-
mous cell carcinomas is different due to their molecular properties.
Molecular hallmarks found in lung adenocarcinomas such as the
presence of EGFR mutations and of ALK and ROS1 gene rearran-
gements, are associated to the patient’s positive response to existing
targeted therapies such as tyrosine kinase inhibitors (TKIs) [4–
6]. Targeted therapies against these alterations are efficient only in
advanced lung adenocarcinomas but they possess adverse effects
and are contraindicated in squamous cell carcinomas, hence the
importance of being able to distinguish between these two
NSCLC subtypes. On the other hand, targeted treatments specific
for squamous cell carcinomas are also available.
Two protein markers, Napsin-A and Thyroid Transcription
Factor 1 (TTF-1) have demonstrated a sensitivity of 80% in differ-
entiating lung adenocarcinomas from squamous cell carcinomas
[7–11], and they are both readily detectable by IHC of formalin-
fixed paraffin-embedded (FFPE) lung tumor tissue. The IHC tech-
nique involves the use of antibodies to detect specific protein
markers in FFPE tissue sections [12]. There are several variations
in the IHC procedure used among different laboratories. One of
the most commonly used IHC procedures for TTF-1 IHC detec-
tion in FFPE lung tumor tissues is described in this chapter. The
IHC reaction starts when a primary antibody binds the antigen of
interest. Then, a secondary antibody linked to an enzyme binds the
primary antibody. A substrate that reacts with the enzyme in the
secondary antibody is added at the end of the process to promote
the formation of a colored insoluble precipitate that is readily
observed under a bright light microscope (Fig. 1). In the post-
analytical phase of the IHC, the interpretation of the staining
intensity and localization is as important as the analytical phase,
which is performing the IHC per se. It is important to know the
expected localization and pattern of the signal. Immunohistochem-
istry is widely used by many clinical and research laboratories.
Different laboratories implement different IHC approaches for
the detection of TTF-1 based on the commercially available
reagents and antibodies. Here we describe an automated IHC
protocol used in our laboratory for the detection of TTF-1 in
FFPE lung tumor tissue sections, as part of our pathology workflow
to distinguish between the adenocarcinomas and squamous cell
carcinomas NSCLC subtypes.
 Automated TTF-1 Immunohistochemistry 3

Fig. 1 Summary of the workflow of the immunohistochemistry technique. (a) A primary antibody binds the
epitope in the target protein. (b) A secondary antibody linked to an enzyme binds to the primary antibody in a
highly specific way. (c, d) The enzyme substrate, when added to the tissue under study, is converted by the
enzyme into an insoluble, colored precipitate that may be visualized under a bright light microscope

2 Materials

Always follow the product manufacturer’s instructions regarding

storing conditions, reagent stability, safety procedures, and waste
disposal.

2.1 Ready to Use 1. Deionized and distilled water.

Reagents (see Note 1) 2. Ethanol 100%, and 70%, 85%, and 90% ethanol dilutions.
Dilutions can be prepared from 100% ethanol diluted with
water to the desired concentration.
3. Paraffin, pre-warmed at 60  C.
4. Xylene.
5. Clarify Clearing Agent Xylene Substitute (this procedure was
optimized using the American Master Tech; Cat. #
CACLELT).

2.2 Immuno- 1. TTF-1 Monoclonal Antibody (Dako, Cat. No. IR056).

histochemistry 2. Immunohistochemistry staining kit. We use the EnVision
and Histology FLEX, High pH Kit (Dako, Cat. No. K8000). The kit includes
Reagents all the reagents required for the procedure, including the
EnVision FLEX Peroxidase-Blocking Reagent, EnVision
FLEX/HRP, EnVision FLEX DAB + Chromogen, and the
EnVision FLEX Substrate Buffer. Some solutions from this
kit require preparation or dilution previous to starting the
IHC procedure (strictly follow the kits instructions, EnVision
4 Rosa Vélez Cintrón et al.

TM FLEX Package Insert from Agilent Technologies). Prepare

the 1 EnVision FLEX Target Retrieval High pH Solution
(Dako Omnis GV804) by diluting the concentrated 50 EnVi-
sion FLEX Target Retrieval Solution 1:50 in distilled or deio-
nized water. The resulting solution is 1.
3. Hematoxylin staining solution (this procedure was optimized
using Hematoxylin Dako Omnis, Dako; Cat. #GC808).
4. Eosin stain.
5. Neutral-Buffered 10% formalin solution (available ready to
use).
6. Wash buffer, we use the Dako Omnis 20 Wash Buffer (Dako;
Cat. No. GC807). Before use, prepare a 1 solution by dilut-
ing 1 mL of 20 Wash Buffer in 20 mL of distilled or deionized
water.

2.3 Additional 1. Water bath or flotation bath, set to 45  C, have a thermometer

Equipment at hand to monitor the temperature.
and Materials 2. Microtome.
3. Microscope slides, we use FLEX IHC Microscope Slides
(Dako; Cat. No. K8020), but other alternatives can be used.
4. Cover slipping Film. We use Tissue-Tek Sakura (Cat.
No. 4770), together with the Sakura Tissue-Tek Automatic
Cover slipper. Cover slipping can also be done manually if an
automatic cover slipper is not available.
5. Racks for histological slides.
6. Absorbent paper.
7. Cold plate or ice sheet.
8. Laboratory oven (capable of reaching 60  C).
9. Dako Omnis Automated IHC Staining System. This procedure
is optimized for this staining system. Other staining systems
can be used, such as the Dako Auto-Stainer Link 48, but some
procedure parameters will have to be optimized.
10. Standard bright light microscope.
11. Standard histology embedding cassettes with lids.
12. Embedding chamber, console or station. There are several
models available, all of them acceptable. Follow any instruc-
tions by the manufacturer.
13. Forceps or tweezers, for careful handling of tissues.
14. KP Marker plus pen, or equivalent, for delineating the tumor
are in the tissue.
 Automated TTF-1 Immunohistochemistry 5

3 Methods

3.1 Tissue Fixation 1. Fix lung tumor tissue biopsies for 6–72 h in the 10% neutral-
and Processing buffered formalin solution (see Note 2). After fixation of the
tissue, it is ready for paraffin embedding and creation of tissue
blocks, as described in the following steps. Tissue processing to
create the paraffin block can be done manually or in a tissue
processor.
2. Dehydrate tissues in a series of ethanol washes as follows, each
wash lasting 45 min: 70%, 85%, 90%, and 100% ethanol. The
final 100% ethanol wash must be performed three times.
3. Clear the tissue by incubating it in xylene for 3 min.
4. Infiltrate tissues by immersion in molten paraffin, this will
create the paraffin blocks that will be cut (see next section).
Immerse the tissues in paraffin at 60  C for 45 min. Do a
second immersion for 75 min.
5. Embed the tissues to form the paraffin blocks. For this, place
tissues in standard histology embedding cassettes and pour
molten paraffin into the embedding station. The paraffin
should be pre-warmed to 60  C for several hours. Submerge
the cassette containing the tissue into the molten paraffin in
the embedding station. Use pre-warmed forceps to handle the
tissue carefully inside the cassette. Place the tissue with the side
that was originally cut (during biopsy specimen collection)
facing downwards in the cassette, in such a manner that this
side of the tissue is the one closest to the surface of the paraffin
from which the first tissue sections will be produced. Ensure
that the paraffin, the embedding cassettes, the embedding
station and all tools to handle the tissue have all been
pre-warmed at 60  C. We recommend starting with the
pre-warming of all the materials early in the morning so that
when the embedding is started the paraffin and all materials
have reached the appropriate temperature. Maintain the tissues
in the cassettes immersed in paraffin for 5 min.
6. Place the embedded tissue in the cold plate to solidify the
paraffin.

3.2 Tissue 1. Set up the water bath to 45  C. Use a thermometer to monitor

Sectioning the temperature in the water.
2. Place the tissue block over a cold plate or ice sheet.
3. Using the microtome, cut tissue sections at 4μm thick (see Note
3 and Fig. 2).
4. As you cut with the microtome, carefully handle the resulting
paraffin ribbons containing the tissues with tweezers and float
them in the water bath immediately after cutting them. Always
6 Rosa Vélez Cintrón et al.

Fig. 2 Cutting of tissue sections from the paraffin block. (a) Tissue sections are cut to 4 microns thick tissue
sections using a microtome. (b) The cut ribbons containing the paraffin tissue sections are transferred to a
water bath to allow the sections to stretch. (c) Each tissue section is mounted on a slide

verify that the water in the water bath has reached 45  C prior
to transferring the tissue sections to it (see Notes 4 and 5 and
Fig. 2).
5. Allow the sections to stretch. If needed, use a stick to help
stretch the tissue. Select one tissue section from the ribbon and
place it over a FLEX IHC microscope slide (see Note 6 and
Fig. 2).
6. Drain the excess of water from the slide by pressing the edges of
the slide against an absorbent paper.
7. Place the slide in a rack for histological slides and oven-bake it
for 1 h at 60  C (see Note 7).

3.3 Immuno- All the steps in this section will be performed by placing the slides in
histochemistry the Dako Omnis IHC Staining System using the parameters
Staining in the Dako described in the appropriate step below.
Omnis IHC Staining 1. Deparaffinize the slides by allowing the slide to interact with
System the Xylene substitute at 25  C. Incubation time should be
between 10 s and 1 min (see Note 8). Perform this step twice.
2. Wash with deionized water for 5 s at room temperature. Per-
form this step twice.
3. Perform the antigen retrieval by incubating the slides 30 min at
97  C with the EnVision FLEX Target Retrieval High pH 1
Solution (see Note 9).
4. Wash the slides in 1 Wash Buffer Omnis during exactly
2.40 min at room temperature (see Note 10).
5. Incubate the slides with the primary antibody TTF-1 Mono-
clonal Antibody for 20 min at room temperature (see Note 11).
6. Wash the slides in 1 Wash Buffer Omnis during 2 min at
room temperature.
 Automated TTF-1 Immunohistochemistry 7

7. Incubate the slides for 3 min at room temperature with the

EnV FLEX Peroxidase-Blocking Reagent (see Note 12).
8. Wash the slides in 1 Wash Buffer Omnis for 2 min at room
temperature.
9. Incubate the slides for 2 min at room temperature with the
EnV FLEX + Mouse LINKER.
10. Incubate the slides for 20 min at room temperature with the
EnV FLEX/HRP.
11. Wash the slides in 1 Wash Buffer Omnis for 2 min at room
temperature. Repeat this wash a second time.
12. Wash the slides in deionized water during exactly 31 s at room
temperature.
13. Wash the slides in 1 Wash Buffer Omnis for 2 min at room
temperature.
14. Incubate the slides for 5 min with the EnV FLEX Substrate
Working Solution (containing the DAB chromogen) at room
temperature.
15. Wash the slides in 1 Wash Buffer Omnis for 2 min at room
temperature.
16. Wash the slides in deionized water for exactly 31 s at room
temperature.
17. Wash the slides in 1 Wash Buffer Omnis for 2 min at room
temperature.

3.4 Counterstaining 1. Incubate the slides for 6 min with Hematoxilin staining solu-
tion at room temperature (see Note 13).
2. Wash the slides in deionized water for 31 s at room
temperature.
3. Wash the slides in 1 Wash Buffer Omnis for 2 min at room
temperature.

3.5 Cover Slipping 1. Remove the slides from the Dako Omnis System, place them in
a rack for histological slides and allow them to air dry.
2. Place the rack with the slides in the SakuraTissue-Tek system
for automatic cover slipping. Alternatively, this step may be
performed manually if an automatic cover slipping device is
not available.

3.6 Staining 1. Under a bright light microscope, check out for a positive
Evaluation TTF-1 staining signal, which is characterized by a brown
and Interpretation nuclear staining similar to the one illustrated in Fig. 3.
2. It is important to evaluate the TTF-1 signal in the tumor cells
and not in the non-tumoral adjacent cells. It is recommended
that an experienced pathologist assists you in identifying the
tumor area within the tissue section.
8 Rosa Vélez Cintrón et al.

Fig. 3 Representative staining for TTF-1 in lung tumor tissue sections. (a)
Negative staining for TTF-1. (b) Positive staining for TTF-1 is characterized by
a brown signal in the nucleus (see arrows)

3. Stain an additional tissue section slide obtained from the same

tissue block under evaluation with Hematoxylin and Eosin
(H&E) routine staining, to identify the tumor or the region
of interest (i.e., apparent lesion). Mark the region with the
marker pen.
4. Superpose the IHC and the H&E slides to identify the region
of interest in the IHC slide.
5. Screen the entire slide at 10 to find the brown signal. If the
brown signal is present (Fig. 3) this may be indicative of TTF-1
positive expression.
6. Increase the magnification to 40 or 100 to confirm the
expected staining pattern for TTF-1 (nuclear staining). Use
quality control slides (Table 1) to distinguish nonspecific signal
or background from true signal. Quality control slides are
recommended to ensure the reliability of the results.
7. A positive expression of TTF-1 is indicative of a lung adenocar-
cinoma, as opposed to squamous cell carcinoma. Additional
IHC stains may be included to support the diagnosis.

4 Notes

1. Although ready to use reagents are usually more expensive,

they offer the benefit of obtaining consistent and reproducible
results even when the assays are performed by different labora-
tory technologists. Minimizing the reagents that need to be
prepared will also minimize the potential of errors and the
variability of results among the scientific population. Using
reagents classified as for In Vitro Diagnostic for research pur-
poses facilitates the transfer of the results obtained during
research studies to a clinical setting which is the goal of a
biomedical or a clinical investigation.
 Automated TTF-1 Immunohistochemistry 9

Table 1
Appropriate positive and negative controls recommended for the validation of TTF-1 staining in lung
tissue sections

Appropriate controls for Napsin-A immunohistochemistry

Control type Description Information provided

Positive A section of lung cancer adenocarcinoma This control will provide information about
control which is known to be positive for TTF-1 the appropriate performance of the assay
should be processed in exactly the same and the stability of the reagents. Any
way as described in the method’s section, technical problem in the assay can be
parallel to the unknown sample under identified if an unexpected result is
evaluation obtained in the positive control
Negative A section of the sample under evaluation This control will provide information about
reagent should be processed in exactly the same nonspecific staining or background
control way as described in the method’s section, signal. Comparing the signal obtained in
(NRC) except that the primary antibody is the section under evaluation against the
omitted signal obtained in the NRC will allow to
discriminate between the nonspecific and
the specific (true) signal for TTF-1
Positive A section of the sample under evaluation This control will specifically help to
internal should be processed in exactly the same distinguish a true negative from a false
control way as described in the method’s section, negative result caused by inappropriate
but the primary antibody must be directed pre-analytical conditions. The positive
against a protein known to be expressed in expression of the control protein will
the lung tissue confirm a true negative result in a tissue
that lacks TTF-1 expression

2. Fixation conditions are critical in IHC. The gold standard

fixative is the 10% neutral-buffered formalin solution with a
pH of 7.0—7.4. This fixative prevents autolysis, is a process in
which the tissue is degraded by the enzymes that are present in
the tissue. Fixation also preserves the tissue morphology. The
proportion of tissue to fixative should be between 1:1 and
1:20. Use of other types of fixatives may interfere with the
IHC staining and is usually contraindicated in IHC. The time
from the tissue collection (extraction from the patient) to the
tissue fixation is also critical. This time is known as ischemic
time and should be less than 1 h. Prolonged ischemic times
promote the irreversible degradation of the antigens in the
cells. This may result in absence of staining, nonspecific stain-
ing and poor definition of the IHC staining. The fixation time
is also critical during the fixation process. It is recommended a
fixation time between 6 and 72 h. In our experience, small
biopsies may be fixed between 6 and 48 h to avoid overfixation.
Insufficient fixation time as well as prolonged fixation time
(more than 72 h) interferes with the IHC reaction. Particularly,
the excess of fixation will mask the antigens in the cells avoiding
the detection of the target protein by the antibody.
10 Rosa Vélez Cintrón et al.

3. Thick tissue sections may yield high background making diffi-

cult the analysis and interpretation of the TTF-1 and other
IHC markers. The recommended thickness of the tissue sec-
tions to be used in IHC should be between 3 and 5μm. It is also
recommended to use freshly cut sections. Some antigens can be
lost after prolonged storage conditions (i.e., more than
2 months).
4. Floating the paraffin sections or ribbons in a water bath will
allows tissue to stretch. With these steps wrinkles and folds are
removed before placing the tissue sections on the slide. It is
very important to keep the temperature of the water in the
flotation bath within 5–10  C below the melting point of the
paraffin being used. Forty to fifty degrees Celsius (40–50  C) is
usually an optimal temperature for the majority of paraffin
types. Always verify the paraffin melting point to set up the
appropriate temperature for your flotation bath. Very low tem-
peratures will not remove the folds in the tissue section. Very
high temperatures (close to or above the paraffin melting tem-
perature) will melt the paraffin in the section causing alterations
in the morphology of the tissue.
5. It is important to use distilled water in the flotation bath. Tap
water or low-quality water usually contains impurities that may
affect the IHC reaction. It may also interfere in the adhesion of
the tissue section to the slide causing the tissue to detach. The
water reservoir must be emptied and cleaned daily using a
laboratory-grade wipe. Avoid the presence of particulate in
the flotation bath reservoir by covering it when not in use.
6. The quality of the slides is very important to allow the adher-
ence of the tissue to the slide. The FLEX IHC microscope
slides are coated with an additive that helps in this process.
Other type of slides may be used but its ability to keep the
tissue attached must be evaluated by the laboratory. Examples
of slides additives that may help in the tissue adherence to the
slide are those that add positive charges to the slide surface.
Positive charges in the slides react with the negative charges in
the tissue promoting adherence of the tissue to the slide.
7. Oven-baking slides is also very important to allow tissue adhe-
sion to the slide. The temperature of the oven must be equal or
slightly above the melting point of the paraffin. However, very
high temperatures or prolonged incubation time may destroy
the TTF-1 target antigen. This may yield false negative results.
8. Incomplete removal of paraffin may result in poor TTF-1 stain-
ing or lack of TTF-1 signal in positive control tissues, where
TTF-1 is expected to be expressed.
 Automated TTF-1 Immunohistochemistry 11

9. Antigen retrieval is necessary to unmask the TTF-1 antigens.

Tissue over-fixation may mask the antigens. If the antigen
retrieval step is not included in the procedure, the interaction
between the antibody and the TTF-1 antigen may fail and a
false negative result may be obtained. It is important to opti-
mize the antigen retrieval conditions (incubation time, temper-
ature, and pH according to the fixation conditions). The
temperature and the pH are important variables that need to
be well controlled during the retrieval process. High tempera-
tures are needed to unmask the antigens in the cells.
10. Washes are important to avoid nonspecific binding and back-
ground signal.
11. It is important to optimize the incubation time and tempera-
ture with the primary antibody. Also, the concentration of the
antibody must be determined by titration experiments in order
to obtain the conditions that fit better with the rest of your
protocol (particularly with the pre-analytical process).
12. This step will block the endogenous peroxidase activity to
eliminate the background staining caused by it. This step is
important when using horseradish peroxidase-conjugated
antibodies.
13. Hematoxylin and eosin counterstaining allows the visualization
of the morphology or architecture of the tissue. This process
allows the identification of the nucleus and other important
structures in the tissue. The counterstaining provides a visual
direction to the observer in order to determine the localization
of the IHC signal (i.e., nuclear vs. cytoplasmic).

References
1. American Cancer Society (2019) Key Statistics 5. Maemondo M, Inoue A, Kobayashi K et al
for Lung Cancer. https://www.cancer.org/can (2010) Gefitinib or chemotherapy for non-
cer/non-small-cell-lung-cancer/about/key- small-cell lung cancer with mutated EGFR. N
statistics.html. Accessed 10 July 2019 Engl J Med 362:2380–2388
2. Torre LA, Bray F, Siegel RL et al (2015) Global 6. Inamura K (2017) Lung cancer: understanding
cancer statistics 2012. CA Cancer J Clin 65 its molecular pathology and the 2015 WHO
(2):87–108 classification. Front Oncol 7:193
3. Travis WD, Brambilla E, Nicholson AG et al 7. Loo PS, Thomas SC, Nicolson MC et al (2010)
(2015) The 2015 World Health Organization Subtyping of undifferentiated non-small cell
classification of lung tumors: impact of genetic, carcinomas in bronchial biopsy specimens. J
clinical and radiologic advances since the 2004 Thorac Oncol 5:442–447
classification. J Thorac Oncol 10 8. Nicholson AG, Gonzalez D, Shah P et al
(9):1243–1260 (2010) Refining the diagnosis and EGFR sta-
4. Zhou C, Wu Y-L, Chen G et al (2010) Efficacy tus of non-small cell lung carcinoma in biopsy
results from the randomized phase III OPTI- and cytologic material, using a panel of mucin
MAL (CTONG 0802) study comparing first- staining, TTF-1, cytokeratin 5/6, and P63,
line erlotinib versus carboplatin (CBDCA) plus and EGFR mutation analysis. J Thorac Oncol
gemcitabine (GEM) in Chinese advanced 5:436–441
non-small cell lung cancer (NSCLC) patients 9. Travis WD, Rekhtman N, Riley GJ et al (2010)
(PTS) with EGFR activating mutations. Ann Pathologic diagnosis of advanced lung cancer
Oncol 21(Suppl. 8):viii1–viii12
12 Rosa Vélez Cintrón et al.

based on small biopsies and cytology: a para- 11. Gurdus D, Grigoras ML, Motoc AG et al
digm shift. J Thorac Oncol 5:411–414 (2019) Clinical relevance and accuracy of p63
10. Turner BM, Cagle PT, Sainz IM et al (2012) and TTF-1 for better approach of small cell
Napsin A, a new marker for lung adenocarci- lung carcinoma versus poorly differentiated
noma, is complementary and more sensitive nonkeratinizing squamous cell carcinoma.
and specific than thyroid transcription factor Romanian J Morphol Embryol 60(1):139–143
1 in the differential diagnosis of primary pul- 12. National Cancer Institute. NCI Dictionary of
monary carcinoma: evaluation of 1674 cases by Cancer Terms. https://www.cancer.gov/
tissue microarray. Arch Pathol Lab Med publications/dictionaries/cancer-terms/def/
136:163–171 immunohistochemistry. Accessed 20 July 2019
 Chapter 2

Immunohistochemical Detection of p40 Expression in Lung

Cancer Clinical Samples
Aruna Nambirajan and Deepali Jain

Abstract
Immunohistochemistry is the technique by which antigens in tissues are detected by means of antigen–anti-
body reaction. The p40 antibody is directed against the ΔN domain of the ΔNp63 isoform of p63 and is a
highly specific marker for the squamous cell carcinoma subtype of non-small cell lung carcinomas
(NSCLC). As such, immunohistochemical detection of this antigen in NSCLC biopsies is extremely
valuable to assess tumor histological subtype. Herein we describe a manual procedure for performing
p40 immunohistochemistry on formalin-fixed paraffin-embedded tissue sections by the indirect polymer-
based two-step technique using hydrogen peroxide and 3–3’diaminobenzidine detection system.

Key words p40, p40 antibody 5–17 clone, Lung squamous cell carcinoma, Immunohistochemistry,
Formalin-fixed paraffin-embedded tissue sections, Horse radish peroxidase, 3–30 diaminobenzidine

1 Introduction

Immunohistochemistry (IHC) is an immunological technique for

identifying antigens in tissues by their specific recognition and
binding with specific antibodies. IHC enables the detection and
cellular localization (i.e., nuclear, cytoplasmic, membranous, Golgi,
etc.) of the antigen of interest in tissue sections. The signal gener-
ated by the technique can be observed under a bright field micro-
scope. While the antigen is primarily bound by polyclonal or
monoclonal antibodies, the latter being more specific, the visuali-
zation by light microscopy is facilitated by the use of enzyme labels
conjugated with either the primary antibody itself (direct IHC
method) or with secondary antibodies directed against the primary
antibody (indirect IHC method). The conjugated enzymes react
with a chromogenic substrate to produce colored reaction products
that can be seen in tissues under the microscope. The most popular

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_2, © Springer Science+Business Media, LLC, part of Springer Nature 2021

13
14 Aruna Nambirajan and Deepali Jain

enzyme-substrate currently used in IHC applications is the enzyme

horseradish peroxidase (HRP), and its chromogen substrate, 3,3-
α-diaminobenzidine tetrahydrochloride (DAB), which produces a
stable brown insoluble reaction product readily visualized by light
microscopy [1].
The IHC method is suitable for the evaluation of lung cancer
clinical samples such as small biopsies, resection specimens and
cytology specimens, all of which can be used for IHC analysis
with appropriate technical modifications (see Note 1). In general,
tissue fixed in 10% neutral buffered formalin is preferred for IHC
due to better preservation of both antigen epitopes and tissue
morphology. The most popular technique for IHC currently estab-
lished in routine diagnostic practice on both automated and manual
platforms is the two-step indirect method utilizing polymer sec-
ondary antibodies, wherein a large number of immunoglobulins
and HRP molecules are conjugated on a dextran polymer backbone
[1]. The broad analytical steps of this method on formalin-fixed
paraffin-embedded (FFPE) tissue sections include:
(a) deparaffinization to remove paraffin and rehydration of sections,
(b) antigen retrieval, either by heat induced or proteolytic methods
or both, to break the crosslinking methylene bridges in tissue
elements induced by formalin fixation, and to facilitate access of
the primary antibody to the antigen of interest, (c) quenching of
endogenous enzymes in tissue (e.g., peroxidase in neutrophils) that
may act on chromogen substrates to produce nonspecific colored
reaction products, (d) serum blocking to prevent non-specific bind-
ing of primary and secondary antibodies with plasma proteins and
charged connective tissue components, (e) primary antibody incu-
bation, (f) polymer secondary antibody incubation, (g) chromogen
substrate application and reaction to generate the insoluble detect-
able product, (h) counterstaining with hematoxylin,
(i) dehydration and clearing, and (j) mounting and cover
slipping [1].
The p40 antibody is directed against the ΔN domain of the
ΔNp63 isoform of p63 [2, 3]. This isoform is specifically expressed
in the basal and progenitor cell layers of stratified epithelia, myoe-
pithelial cells, thymic epithelial cells, trophoblasts and is consis-
tently expressed in squamous cell carcinomas of various sites,
including those of lung [2, 3]. The antigen identified by p40
antibody is localized in the cell nucleus and is visualized as brown
homogenous nuclear staining in cells. In this chapter, we describe
in detail the manual two-step indirect IHC method using polymer
secondary antibodies and HRP-DAB enzyme-chromogen pair for
detecting p40 on FFPE tissue sections [4].
 p40 Immunohistochemistry in Lung Cancer 15

2 Materials

2.1 IHC Buffer When applicable, prepare solutions using distilled water, and always
Solutions use analytical grade reagents.
and Histology
1. 0.05 M Tris buffered saline (TBS). In 8 L of distilled water,
Reagents dissolve 85 g of NaCl and 60.5 g of Tris (hydroxymethyl)
aminomethane. Adjust pH to 7.6 with concentrated hydro-
chloric acid, and complete volume to 10 L with distilled water.
2. 1 Phosphate-Buffered Saline (PBS), pH 7.2. To prepare,
dissolve 8 g of NaCl, 0.2 g of KCl, 1.44 g of Na2HPO4.2
H2O, and 0.24 g of KH2PO4, in 800 mL of water. Adjust the
pH to 7.2 with HCl and add distilled water to complete the
volume to 1 L. Pre-made, ready-to-use PBS can also be
purchased.
3. Heat-mediated antigen retrieval (AR) solution. This is a triso-
dium citrate buffer. Prepare by dissolving 19.7 g of trisodium
citrate in 4 L of distilled water. Adjust pH to 6.0 with 1 M
hydrochloric acid and complete volume to 5 L.
4. Hydrogen peroxide (H2O2) endogenous enzyme quenching
solution. This solution eliminates tissue endogenous peroxi-
dase activity, thus minimizing background signal. To prepare,
mix 4 mL of 30% H2O2 with 96 mL of absolute methanol. You
must prepare this solution fresh before each procedure.
5. Xylene.
6. Alcohol 50%, 70% and 95% solutions. Prepare by diluting
absolute or 95% ethanol with distilled water.
7. Hematoxylin solution.
8. Coverslips.
9. Mounting medium (we use DPX mounting medium, but other
alternatives are acceptable).

2.2 Antibodies 1. p40 primary antibody. This protocol was optimized with the
and Detection Kits 5–17 clone (Calbiochem, Darmstadt, Germany) diluted
1:3000 in distilled water.
2. IHC detection reagents. There are many commercially avail-
able IHC HRP detection kits and reagents. This protocol was
optimized with the UltraVision™ Quanto Detection System
HRP (Thermo Fisher Scientific, United Kingdom). This kit
includes the following reagents: UltraVision™ protein block,
Primary antibody Amplifier Quanto, HRP Polymer Quanto,
and the DAB Quanto chromogen and substrate. These are all
the reagents needed to develop the IHC signal.
16 Aruna Nambirajan and Deepali Jain

2.3 Laboratory 1. Domestic microwave oven.

Equipment 2. Moist incubation chamber with capacity to hold tissue slides.
This can be commercially purchased, but it can also be prepared
in the laboratory. We use a lidded staining trough with Perspex
strips running along the length on which slides are placed
separated from each other. We use a wet sponge or a layer of
wet filter paper kept at the bottom of the chamber to maintain
moisture. We use a wax pen to outline the tissue sections on the
slide to ensure that reagents and solutions are retained on top
of the tissue section and does not spill outside the tissue area.
3. Slides holders or racks. You need at least one rack that should
be microwaveable to be used in the antigen retrieval step.
4. Slide staining jars.
5. Light microscope.

3 Methods

All individual steps, except the antigen retrieval procedure, are

carried out at room temperature. For handling and washing of
tissue sections, it is recommended that you place the tissue slides
that are going to be stained in a slide holder and use the staining jars
for all the washes (see Note 2). The indicated incubation steps are
carried out in a moist incubation chamber to avoid drying of
tissues.
1. Deparaffinise tissues by immersing them in xylene, 3 dips 
5 min each (see Note 3).
2. Rehydrate tissues with sequential ethanol washes of decreasing
ethanol concentrations as follows: do 95%, 70%, and 50% alco-
hol washes, 3 min each.
3. Wash slides with TBS 2–3 times.
4. Place slides in a microwave resistant staining rack, and place the
rack in a microwave resistant plastic container filled with an
adequate amount of Tris-sodium citrate antigen retrieval
(AR) solution (~600 mL for 25 slides). The amount of AR
solution should be sufficient to completely immerse the slides.
Heat the container in the microwave oven for 20 min at 800 W
with the lid sufficiently loose to ensure escape of steam. Check
the AR solution volume midway through the incubation and
add distilled water if the volume of AR solution has decreased
due to evaporation. Ensure that the sections do not dry out (see
Note 4).
5. Remove the container from the microwave oven and allow it to
cool to room temperature.
 p40 Immunohistochemistry in Lung Cancer 17

6. Transfer the slides from the cooled AR solution to the moist

incubation chamber.
7. Wash with PBS 2–3 times.
8. Incubate slides in the H2O2 quenching solution for 10 min.
9. Wash with PBS 2–3 times.
10. Incubate slides with UltraVision™ Protein Block for 5 min (see
Notes 5 and 6).
11. Remove excess blocking solution by gently blowing or by
slightly inclining the slide and absorbing the liquid by placing
an absorbent paper at the edge of the tissue section. Do not
wash with PBS.
12. Apply the diluted primary antibody on top of the tissue sec-
tions and incubate for 1 h (see Notes 7–9).
13. Wash with PBS 2–3 times.
14. Apply Primary Antibody Amplifier Quanto and incubate for
10 min (see Notes 10 and 11).
15. Wash with PBS 2–3 times.
16. Apply HRP Polymer Quanto and incubate for 10 min.
17. Wash with PBS 2–3 times.
18. Apply 1 drop of DAB Quanto Chromogen (30 μL) to 1 mL of
DAB Quanto Substrate, mix by swirling and apply to slide,
incubate for 5 min with monitoring (see next step).
19. Monitor the progression of the reaction by checking how the
colored precipitate forms under a light microscope. As soon as
a strong and distinct nuclear signal can be appreciated, stop the
reaction by incubating the slides in water. This incubation
should not exceed 7 min, in order to avoid background signal.
20. Wash with distilled water.
21. Counterstain with hematoxylin for 1 min and coverslip with
DPX mounting medium. Incubation time may be increased
when using older stocks of hematoxylin. A representative prep-
aration is shown in Fig. 1 (see Notes 12–14).

4 Notes

1. Among the pre-analytical factors that influence the success and

validity of IHC, adequate fixation of tissue in formalin is the
most important. For best results, fresh tissue removed from
patient should be immersed in ten times volume of neutral
buffered 10% formalin as soon as possible (delay of more than
1 h significantly deteriorates antigens and invalidates IHC
18 Aruna Nambirajan and Deepali Jain

Fig. 1 p40 immunohistochemistry in formalin fixed paraffin embedded sections. (a) Microphotograph of
hematoxylin and eosin stained section from an endobronchial biopsy showing features of a non-small cell lung
carcinoma. (b) p40 immunohistochemistry shows diffuse and strong nuclear staining in tumor cells diagnostic
of squamous cell carcinoma. Arrow shows nuclear staining in the basal cells of respiratory epithelium (internal
positive control)

results), and the recommended duration of fixation is between

6 and 24 h for small biopsies and 24–72 h for resections
[5]. The formalin fixed tissue is subject to subsequent dehydra-
tion, clearing, and infiltration during processing and is finally
embedded in tissue molds as paraffin blocks. Four-micron thick
tissue sections cut from these blocks are the standard samples
for IHC in routine diagnostic pathology practice [5].
2. Tissue sections may come off the slide due to the repeated
washing steps involved in IHC. It is therefore recommended
that the tissue sections are placed on charged or adhesive-
coated glass slides. To ensure good IHC staining, tissue sec-
tions should be preferably cut fresh, fixed overnight in a 37  C
incubator or placed in a hot oven (60  C) for 30 min [1].
3. Deparaffination of tissue sections is essential to ensure adequate
penetration of reagents into the sections. Incomplete deparaf-
fination can lead to false negative staining. Using xylene
pre-warmed to 37  C in an incubator for deparaffination
improves completeness of wax removal [1].
4. The pH of the antigen retrieval solution is important for suc-
cessful IHC. Alteration in the pH of the designated buffer
solution during antigen retrieval has been found to alter the
epitope structure leading to altered staining patterns or com-
plete absence of staining [1]. For p40 IHC using the 5–17
clone, heat mediated antigen retrieval at pH 6 (citrate) is
optimal.
 p40 Immunohistochemistry in Lung Cancer 19

5. Endogenous peroxidase blocking is performed by treating the

section to hydrogen peroxide in methanol. This step can be
performed at any stage prior to secondary antibody application,
although some authors prefer to perform this step after primary
antibody incubation as methanol may interfere with labile anti-
genic epitopes [1].
6. Serum block is primarily the application of an innocuous pro-
tein solution that neutralizes charged sites on the sections and
prevents the antibody from binding to non-antigenic sites such
as collagen, reticulin, or fibrinogen [1]. Following application
of serum block, the section should not be washed with PBS.
This step is performed prior to application of primary antibody.
7. The most commonly used p40 antibody is the 5–17 clone
(Calbiochem). This is a rabbit polyclonal IgG antibody raised
against a synthetic peptide corresponding to amino acids 5–17
of human p40 [6].
8. Among the different types of primary lung cancer, the p40
antibody labels tumor cells showing squamous differentiation
and is diffusely positive in lung squamous cell carcinoma
(>50% tumor cells), focally positive in the squamous compo-
nent of adenosquamous carcinoma, NUT (nuclear antigen in
testis) carcinoma, and thymic neoplasms. Focal weak staining
may be seen in adenocarcinoma and is usually interpreted as
negative [6].
9. Revalidation of IHC procedure using adequate number of
positive and negative controls is necessary whenever there is a
change in the clone or company of the primary antibody,
staining platforms or detection kits [6].
10. The sensitivity of IHC depends upon the degree of signal
amplification, which in turn depends upon the enzyme label:
antigen ratio. Indirect IHC methods are more sensitive than
direct methods due to an additional layer of secondary anti-
bodies which are conjugated with enzyme labels resulting in
higher enzyme label: antigen ratio. The use of polymer second-
ary antibodies (e.g., EnVisionTM, Dako), micropolymer sec-
ondary antibodies (e.g., Ultravision™ Quanto detection
system, ThermoScientific™) as in the method described
above, multimer secondary antibodies (e.g., ultraVIEW, Ven-
tana Medical Systems), tyramide treatment after secondary
antibody application (OptiView Amplifier, Ventana Medical
Systems), etc. are all improvements to the IHC technique
that increase the ratio of enzyme label: antigen resulting in
increased sensitivity. Primary antibody concentration and dura-
tion of incubation varies with different antibody clones and
detection systems and needs to be standardized
accordingly [1].
20 Aruna Nambirajan and Deepali Jain

11. The specificity of IHC is inversely proportional to the degree of

nonspecific and background staining seen in the tissue sections.
Nonspecific signals in IHC occur mainly due to any of the
following reasons: (a) primary antibody cross-reacting with
other antigens, (b) primary or secondary antibodies nonspecif-
ically binding to plasma proteins and charged connective tissue
components, (c) presence of endogenous enzymes in tissue
(e.g., peroxidase in neutrophils) that act on chromogen sub-
strates to produce colored reaction products, and (d) drying of
the tissue sections during the procedure, which leads to non-
specific antibody binding. The use of monoclonal primary
antibodies with single epitope specificity, blocking with serum
prior to primary antibody incubation to adsorb and neutralize
all charged plasma and connective tissue elements, quenching
of endogenous enzyme activity prior to secondary antibody
application, thorough washing with PBS to remove unbound
reagents after every step of IHC, and protecting sections from
drying out minimizes nonspecific staining and improves
specificity [1].
12. The use of controls that have been processed in the same way as
the test specimen under study is essential while performing
IHC for quality assurance [5]. Positive staining in the controls
indicates that the test is valid. Positive controls can be internal
in the form of positive staining elements within the test sec-
tions (e.g., basal cells of respiratory epithelium normally stain
strongly for p40 and serve as internal positive controls when
present, see Fig. 1) or external when a known positive control is
run as an extra section on the test slide itself or on a separate
slide. While internal positive controls are better in terms of
being subjected to similar pre-analytical processing conditions,
they may not always be present in the test section and running
an external positive control with a known pattern and intensity
of staining is recommended for quality control. A negative
control can be run by either omitting the application of the
primary antibody or by using an antibody directed against an
unrelated antigen [1].
13. Use of automated staining platforms improves uniformity in
IHC procedure and staining, this is particularly important to
ensure reproducibility across different laboratories [1].
14. Cytology specimens including alcohol-fixed smears may be
used for IHC, however, these will need to be validated with
adequate number of positive and negative controls prepared in
the same manner as the test sample. For instance, p40 immu-
nocytochemistry on alcohol fixed smears can be validated by
using alcohol fixed smears prepared from squamous cell carci-
noma aspirates as positive controls, and smears from lymphoma
and adenocarcinoma aspirates as negative controls. The
 p40 Immunohistochemistry in Lung Cancer 21

Fig. 2 p40 immunocytochemistry in alcohol-fixed cytology smears. (a, b) Papanicolaou stained smears from
lung aspirate shows fragments from a carcinoma. (c) p40 immunocytochemistry shows diffuse and strong
nuclear staining in tumor cells indicative of squamous differentiation

duration of antigen retrieval, primary antibody concentration

and duration of incubation may need to be modified for immu-
nocytochemistry [7]. In our laboratory, we are using the same
protocol for alcohol-fixed smears as for IHC on formalin-fixed
sections with excellent concordance (Fig. 2).

References

1. Sanderson T, Wild G, Cull AM et al (2019) immunohistochemistry: a useful panel to charac-

Immunohistochemical and immunofluorescent terize non-small cell lung carcinoma-not other-
techniques. In: Suvarna SK, Layton C, Bancroft wise specified (NSCLC-NOS) category. Indian J
JD (eds) Bancroft’s theory and practice of histo- Med Res 146:42–48
logical techniques, 8th edn. Elsevier, Amsterdam 5. Thunnissen E, Allen TC, Adam J et al (2018)
2. Bishop JA, Teruya-Feldstein J, Westra WH et al Immunohistochemistry of pulmonary biomar-
(2012) p40 (ΔNp63) is superior to p63 for the kers: a perspective from members of the pulmo-
diagnosis of pulmonary squamous cell carci- nary pathology society. Arch Pathol Lab Med
noma. Mod Pathol 25:405–415 142:408–419
3. Pelosi G, Fabbri A, Bianchi F et al (2012) 6. Hung YP, Sholl LM (2018) Diagnostic and pre-
ΔNp63 (p40) and thyroid transcription factor- dictive immunohistochemistry for non-small cell
1 immunoreactivity on small biopsies or cell- lung carcinomas. Adv Anat Pathol 25:374–386
blocks for typing non-small cell lung cancer: a 7. Jain D, Nambirajan A, Borczuk A et al (2019)
novel two-hit, sparing-material approach. J Immunocytochemistry for predictive biomarker
Thorac Oncol 7:281–290 testing in lung cancer cytology. Cancer Cyto-
4. Walia R, Jain D, Madan K et al (2017) p40 & pathol 127:325–339
thyroid transcription factor-1
 Chapter 3

Automated Immunohistochemistry Assay for the Detection

of Napsin-A in Formalin-Fixed Paraffin-Embedded Tissues
from Lung Tumors
Rosa Vélez Cintrón, Jo Ann Jusino, Marı́a Conte-Miller,
Andrés J. Martı́nez, and Adalberto Mendoza

Abstract
Immunohistochemistry (IHC) enables the selective detection of proteins in cells of formalin-fixed-paraffin-
embedded (FFPE) tissue sections. This technique plays a key role in the identification and classification of
primary lung cancer tumors through the evaluation of the expression of the aspartic proteinase Napsin-A.
However, immunohistochemistry is a complex process involving many critical steps and the lack of
standardization as well as inappropriate analytical conditions may contribute to inconsistent results between
laboratories. Automated immunohistochemistry addresses this issue by ensuring the quality and the
reproducibility of the results among different laboratories. Here we describe an automated IHC protocol
used in our laboratory for the detection of Napsin-A in FFPE lung tissue sections.

Key words Immunohistochemistry, Lung adenocarcinoma, Napsin-A, Biomarkers, Clinical pathol-

ogy, Lung cancer diagnosis

1 Introduction

Immunohistochemistry (IHC) is a laboratory technique that uses

antibodies to detect specific markers in formalin-fixed, paraffin-
embedded (FFPE) tissue sections [1]. There are several variations
of the IHC technique. The most commonly used IHC method
involves the utilization of a primary antibody that binds the epitope
or antigen (antibody’s target region) in the protein of interest
followed by the addition of a secondary antibody that binds to
the primary antibody in a highly specific way. The secondary anti-
body is usually linked to an enzyme or molecule that is activated
when the appropriate substrate is added. The interaction between
the enzyme and the substrate promotes the formation of a precipi-
tate that may be observed and scored through the microscope
(Fig. 1).

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_3, © Springer Science+Business Media, LLC, part of Springer Nature 2021

23
24 Rosa Vélez Cintrón et al.

Fig. 1 Steps in the process of immunohistochemistry. (a) A primary antibody binds to the epitope in the target
protein. (b) A secondary antibody linked to an enzyme binds to the primary antibody in a highly specific way.
(c, d) The enzyme substrate is converted by the enzyme into an insoluble product that precipitates in the tissue
and can be observed through the microscope

Immunohistochemistry is currently well accepted by many

pathology laboratories worldwide and it is also widely used in
research to analyze molecules of interest in order to study their
roles in both healthy and malignant cells [2, 3]. However, the
reliability of the results in the clinical and research settings depends
on the level of standardization and reproducibility among different
laboratories [4, 5]. Automated IHC propitiates a sufficiently con-
trolled environment allowing the reproducibility of the results [6].
IHC has contributed to tremendous advances in the clinical
pathology and oncology fields by promoting the discovery of target
biomarkers with diagnostic, therapeutic, or prognostic value
[7]. This is the case of the aspartic proteinase Napsin-A which is
expressed in the cytoplasm of the parenchyma cells in the lung.
Detection of Napsin-A through IHC has been demonstrated to be
an excellent tool to distinguish primary lung adenocarcinomas from
other carcinomas during the pathological diagnosis [8]. Also,
Napsin-A has demonstrated a sensitivity of 87.25% and a specificity
of 95.02% for lung adenocarcinomas [9]. Here we describe an
automated IHC protocol used in our laboratory for the detection
of Napsin-A in FFPE tissue sections from lung.

2 Materials

Always follow the manufacturer’s instructions regarding storing

conditions, reagent stability, safety procedures, and waste disposal.

2.1 Standard As much as possible, and when applicable, we recommend that you
Histology Reagents buy solutions that are ready-to-use, in commercially pre-made or
pre-mixed form (see Note 1).
 Automated Napsin-A Immunohistochemistry 25

1. Ethanol 100%, and 70%, 85%, and 90% ethanol dilutions.

Dilutions can be prepared from 100% ethanol diluted with
water to the desired concentration.
2. Paraffin, pre-warmed at 60  C.
3. Xylene.
4. Clarify Clearing Agent Xylene Substitute (this procedure was
optimized using the American Master Tech; Cat. #
CACLELT).
5. Hematoxylin stain (this procedure was optimized using Hema-
toxylin Dako Omnis, Dako; Cat. #GC808).
6. Eosin stain.
7. Dako Omnis IHC 20 wash buffer.
8. Neutral-buffered 10% formalin solution. (available ready to
use).
9. Deionized and distilled water.

2.2 Immuno- 1. Napsin-A Prediluted, ready-to-use, Polyclonal Antibody

histochemistry Kits, (we use Biocare Medical; Cat. # PP 434 AA).
Antibodies 2. Immunohistochemistry kit. There is a variety of products for
and Reagents developing the IHC, in our laboratory we optimized this pro-
cedure using the EnVision FLEX, High pH Kit (Dako, Cat. #
GV800). The EnVision FLEX Kit includes the peroxidase-
blocking reagent, the horse-radish peroxidase (HRP, this is an
HRP-conjugated a goat secondary antibody against rabbit or
mouse primary antibodies), the DAB + Chromogen, and the
substrate buffer. In order to prepare the substrate buffer work-
ing solution, mix the DAB and the substrate buffer following
the kit’s instruction (EnVision TM FLEX Package Insert from
Agilent Technologies).
3. EnVision FLEX Target Retrieval Low pH 50 X Solution
(Dako; Cat. # GV805).

2.3 Laboratory 1. Water bath or flotation bath. Have a thermometer at hand to

Equipment monitor the temperature.
and Consumables 2. Microtome.
3. Microscope slides.
4. Cover slipping film. We use Tissue-Tek (Sakura Cat. # 4770),
together with the Sakura Tissue-Tek Automatic Cover slipper.
Cover slipping can also be done manually if an automatic cover
slipper is not available.
5. Racks for histological slides.
6. Absorbent paper.
7. Cold plate or ice sheet.
26 Rosa Vélez Cintrón et al.

8. Laboratory oven, capable of reaching 60  C.

9. Dako Omnis Automated IHC Staining System (this procedure
is optimized for this system). Other staining systems can be
used, such as the Dako Auto Stainer Link 48, but some proce-
dure parameters will have to be optimized.
10. Standard bright light microscope.
11. Standard tissue embedding cassettes with lids.
12. Embedding chamber, console or station. There are several
models available, all of them acceptable. Follow any instruc-
tions by the manufacturer.
13. Forceps or tweezers, for careful handling of tissues.
14. KP Marker plus pen, or equivalent.

3 Methods

3.1 Reagent 1. Following the manufacturer’s instructions, dilute the EnVision

Preparation FLEX Target Retrieval Low pH 50 X Solution to 1:50 in
distilled or deionized water. The resulting solution is 1 and
its pH must be 6.0.
2. Following the manufacturer recommendations, prepare a 1
wash solution by diluting the 20 Dako Omnis Wash Buffer to
prepare a 1solution. Prepare this by diluting 1 mL of the 20
wash buffer in 20 mL of distilled or deionized water.

3.2 Tissue Fixation 1. Fix lung tissue biopsies in 10% Neutral-Buffered Formalin
and Processing solution for 6–72 h (see Note 2). After fixation of the tissue,
it is ready for paraffin embedding and creation of tissue blocks,
as described in the following steps. Tissue processing to create
the paraffin block can be done manually or in a tissue processor.
2. Dehydrate tissues in a series of ethanol washes as follows, each
wash lasting 45 min: 70%, 85%, 90%, and 100% ethanol. The
final 100% ethanol wash must be performed three times.
3. Clear the tissue by incubating it in xylene for 3 min.
4. Infiltrate tissues by immersion in molten paraffin, this will
create the paraffin blocks that will be cut (see next section).
Immerse the tissues in paraffin at 60  C for 45 min. Do a
second immersion for 75 min.
5. Embed the tissues to form the paraffin blocks. For this, place
tissues in standard histology embedding cassettes and pour
molten paraffin into the embedding station. The paraffin
should be pre-warmed to 60  C for several hours. Submerge
the cassette containing the tissue into the molten paraffin in the
embedding station. Use pre-warmed forceps to handle the
tissue carefully inside the cassette. Place the tissue with the
 Automated Napsin-A Immunohistochemistry 27

side that was originally cut (during biopsy specimen collection)

facing downwards in the cassette, in such a manner that this
side of the tissue is the one closest to the surface of the paraffin
from which the first tissue sections will be produced. Ensure
that the paraffin, the embedding cassettes, the embedding
station, and all tools to handle the tissue have all been
pre-warmed at 60  C. We recommend starting with the
pre-warming of all the materials early in the morning so that
when the embedding is done the paraffin and all materials have
reached the appropriate temperature. Maintain the tissues in
the cassettes immersed in paraffin for 5 min.
6. Place the embedded tissue in the cold plate to solidify the
paraffin.

3.3 Tissue 1. Set up the water bath to 45  C, using an external thermometer

Sectioning to monitor the water temperature.
2. Place the tissue block over a cold plate or ice sheet.
3. Using the microtome, cut tissue sections at 4 μm thick (see
Note 3 and Fig. 2).
4. As you cut with the microtome, carefully handle the resulting
paraffin ribbons containing the tissues with tweezers and float
them in the water bath immediately after cutting them. Always
verify that the water in the water bath has reached 45  C prior
to transferring the tissue sections to it (see Notes 4 and 5 and
Fig. 2).
5. Allow the sections to stretch. If needed, use a stick to stretch
the tissue. Select one tissue section from the ribbon and place it
over a microscope slide (see Note 6 and Fig. 2).

Fig. 2 Cutting tissue sections in the microtome. (a) Tissue sections are cut in the microtome to a thickness of
4 μm. (b) The cut ribbons containing the paraffin tissue sections are transferred to a water bath to allow the
sections to stretch. (c) Each tissue section is mounted in a slide
28 Rosa Vélez Cintrón et al.

6. Drain the excess water from the slide by pressing the edges of
the slide against an absorbent paper.
7. Place the slide in a rack for histological slides and bake it in the
oven for 1 h at 60  C (see Note 7).

3.4 Immuno- All the steps in this section will be performed by placing the slides in
histochemistry the Dako Omnis IHC Staining System using the parameters
Staining in the Dako described in the appropriate step below.
Omnis IHC Staining 1. Deparaffinize the slides by allowing the slide to interact with
System the Clarify Clearing Agent Xylene Substitute at 25  C for 10 s
(incubation top) and 1 min (incubation bottom) (see Note 8).
Perform this step twice.
2. Wash with deionized water for 5 s at room temperature. Repeat
this step twice.
3. For the antigen retrieval step, incubate the slides for 30 min at
97  C with the EnVision FLEX Target Retrieval Low pH 1
Solution (see Note 9).
4. Wash the slides in Wash Buffer Omnis 1 during exactly
2.40 min at room temperature (see Note 10).
5. Incubate the slides with the primary anti-Napsin-A Prediluted
Polyclonal Antibody for 25 min at room temperature (see Note
11). This incubation should be 30 min if using the Dako Auto
Stainer Link 48 and should be optimized if any other staining
system is used. We recommend that you prepare negative con-
trol tissue sections by having some sections incubated with an
irrelevant mouse monoclonal antibody (not expected to recog-
nize Napsin-A). Be sure to include 0.015 mol/L sodium azide
in the negative control solution.
6. Wash the slides in Wash Buffer Omnis 1 for 2 min at room
temperature.
7. Incubate the slides for 3 min at room temperature with the
EnVision FLEX Peroxidase-Blocking Reagent (see Note 12).
8. Wash the slides in Wash Buffer Omnis 1 for 2 min at room
temperature.
9. Incubate the slides for 20 min at room temperature with the
EnVision FLEX-HRP, or for 25 min if using the Dako Auto
Stainer Link 48.
10. Wash the slides in Wash Buffer Omnis 1 for 2 min at room
temperature, repeat wash for a second time.
11. Wash the slides in deionized water for exactly 31 s at room
temperature.
12. Wash the slides in Wash Buffer Omnis 1 for 2 min at room
temperature.
 Automated Napsin-A Immunohistochemistry 29

13. Incubate the slides for 5 min with the EnVision FLEX Sub-
strate Working Solution (containing the DAB chromogen) at
room temperature. Repeat this step one more time if using the
Dako Auto Stainer Link 48 system.
14. Wash the slides in Wash Buffer Omnis 1 for 2 min at room
temperature.
15. Wash the slides in deionized water for 31 s at room
temperature.
16. Wash the slides in Wash Buffer Omnis 1 for 2 min at room
temperature.
17. Counterstain the slides by incubating them for 6 min with
Hematoxylin Dako Omnis at room temperature.
18. Wash the slides in Wash Buffer Omnis 1 for 2 min at room
temperature.
19. Wash the slides in deionized water for exactly 31 s at room
temperature.

3.5 Cover Slipping 1. Remove the slides from the Dako Omnis System and place
them in a rack for histological slides and allow them to air dry.
2. Place the rack with the slides in the SakuraTissue-Tek system
for automatic cover slipping. Perform this step manually if an
automatic cover slipper is not available.

3.6 Staining The Napsin-A positive signal is characterized by a brown granular

Evaluation cytoplasmic staining (Fig. 3).
and Interpretation
1. Using a tissue section from the same paraffin block that has
been stained with hematoxylin and eosin (H&E) using a rou-
tine staining protocol, identify the tumor area or the region of
interest (i.e., apparent lesion) within the tissue. Mark the
region with the KP Marker Plus pen or equivalent.
2. Superpose the IHC-stained and the H&E-stained slides to
identify the region of interest in the IHC-stained slide, which
should be the tumor area.
3. Screen the entire slide under the microscope at 10to find the
brown signal (as shown in Fig. 3). If the brown signal is
present, this is indicative of a Napsin-A positive expression.
4. Increase the magnification to 40 or 100 to confirm that the
expected staining pattern for Napsin-A (granular cytoplasmic
staining) is present and to exclude the possibility of back-
ground or antibody nonspecific staining. The presence of non-
specific staining is suggested if there is a brown signal in the
negative control slides that were processed without the addi-
tion of the primary antibody.
30 Rosa Vélez Cintrón et al.

Fig. 3 IHC staining for Napsin-A. (a) Negative control in which the primary antibody was omitted from the
staining procedure. (b) Positive staining for Napsin-A is characterized by a brown cytoplasmic staining signal

5. A positive expression of Napsin-A in lung cancer tissue may

confirm the presence of a primary adenocarcinoma originated
in the lung. Additional IHC stains with other biomarkers may
be conducted to support the diagnosis. For quality control, in
addition to the negative control described above, Table 1
shows several control treatments that are recommended to
ensure the reliability of the results.

4 Notes

1. Although ready-to-use reagents are usually more expensive,

they offer the benefit of yielding reproducible results even
when the assays are performed by different laboratory technol-
ogists. Minimizing the reagents that need to be prepared will
also minimize the potential for errors and the variability of
results among laboratories and researchers. Using reagents
classified as For In Vitro Diagnostic for research purposes facil-
itates the transfer of the results obtained during research stud-
ies to a clinical setting, which is the goal of biomedical or
clinical investigations.
2. Fixation conditions are critical in IHC. The use of 10% Neutral
Formalin prevents autolysis and preserves the tissue morphol-
ogy. The proportion of tissue to fixative should be between 1:1
and 1:20. Use of other types of fixatives may interfere with the
IHC staining and is usually contraindicated in IHC.
3. Thick tissue sections may yield high background, making it
difficult to analyze and interpret the Napsin-A IHC staining.
It is also recommended to use freshly cut sections. Some anti-
gens can be lost after prolonged storage conditions (i.e., more
than 2 months).
 Automated Napsin-A Immunohistochemistry 31

Table 1
Positive and negative controls that can be used to ensure staining specificity

Appropriate controls in Napsin-A immunohistochemistry

Control type Description Information provided

Positive A section of lung cancer adenocarcinoma This control will provide information about
control which is known to be positive for Napsin- the appropriate performance of the assay
A should be processed in exactly the same and the stability of the reagents. Any
way as the unknown sample (sample under failure in the assay can be identified if an
evaluation) unexpected result is obtained in the
positive control
Negative A section of the sample under evaluation This control will provide information about
reagent should be processed in exactly the same nonspecific staining or background
control way as described in the method’s section signal. Comparing the signal obtained in
(NRC) but without adding the primary antibody the section under evaluation against the
signal obtained in the NRC will allow to
discriminate between the nonspecific and
the specific (true) signal for Napsin-A
Positive A section of the sample under evaluation This control will specifically help to
internal should be processed in exactly the same distinguish a true negative from a false
control way (as described in the method’s section) negative result caused by inappropriate
but the primary antibody must be directed pre-analytical conditions. The positive
against a protein known to be expressed in expression of the control protein will
the lung tissue confirm a true negative result in a tissue
with lack of Napsin-A expression

4. Floating the paraffin sections or ribbons in a water bath will

allows tissue to stretch by removing wrinkles and folds before
placing sections on slides. It is very important to keep the
temperature of the water in the floatation bath within
5–10  C below the melting point of the paraffin being used.
Forty to fifty degrees Celsius (40–50  C) is usually an optimal
temperature for the majority of paraffin types. Always verify the
paraffin melting point to set up the appropriate temperature for
your flotation bath. Very low temperatures will not remove the
folds in the tissue section. Very high temperatures (close to or
above the paraffin melting temperature) will melt the paraffin in
the section causing alterations in the morphology of the tissue.
5. It is important to use distilled water in the flotation bath. Tap
water or low-quality water usually contains impurities that may
affect the IHC reaction. It may also interfere in the adhesion of
the tissue section to the slide causing the tissue to detach from
the slide. The water reservoir must be emptied and cleaned
daily using a laboratory-grade wipe. Avoid the presence of
particulate in the flotation bath reservoir by covering it when
not in use.
32 Rosa Vélez Cintrón et al.

6. The quality of the slides is very important to allow the adher-

ence of the tissue to the slide. We use the FLEX IHC Micro-
scope slides which are coated with an additive that helps in this
process. Other types of slides may be used but their ability to
keep the tissue attached must be evaluated by the laboratory.
7. Baking the slide is also very important to allow tissue adhesion
to the slide. The temperature of the oven must be equal or
slightly above the melting point of the paraffin. However, very
high temperatures or prolonged incubation time may destroy
the Napsin-A target antigen. This may yield false negative
results.
8. Incomplete removal of paraffin may result in poor staining or
lack of Napsin-A expression when it is expected to be
expressed.
9. Antigen retrieval is necessary to unmask the epitope in the
Napsin-A antigen. The fixation of the tissue may mask the
target molecules. If an antigen retrieval step is not included,
the interaction between the antibody and the Napsin-A antigen
may fail and a false negative result may be obtained. It is
important to optimize the antigen retrieval conditions (incu-
bation time, temperature and pH according to the fixation
conditions) [10].
10. Wash steps are critical to avoid nonspecific binding and back-
ground staining.
11. A slight modification to the manufacturer’s recommended
protocol was performed. The manufacturer recommends an
incubation time of 30 min. Our protocol demonstrated a
better performance using an incubation of 25 min with the
Napsin-A primary antibody.
12. This step will block the endogenous peroxidase activity to
eliminate the background staining caused by it.

References
1. National Cancer Institute Dictionary of Cancer evaluation of strategies used for validation of
Terms. https://www.cancer.gov/ immunohistochemical biomarkers. Mol Oncol
publications/dictionaries/cancer-terms/def/ 8(4):783–798
immunohistochemistry. Accessed 20 July 2019 5. Gambella A, Porro L, Pigozzi S et al (2017)
2. Taylor CR (1986) Principles of immunomicro- Section detachment in immunohistochemistry:
scopy. In: Taylor CR, Cote RJ (eds) Immuno- causes, trouble-shooting and problem-solving.
microscopy: a diagnostic tool for the surgical Histochem Cell Biol 148(1):95–101
pathologist, 3rd edn. Saunders Elsevier, 6. Sukswai N, Khoury JD (2019) Immunohisto-
Philadelphia chemistry innovations for diagnosis and tissue-
3. Duraiyan J, Govindarajan R, Kaliyappan K et al based biomarker detection. Curr Hematol
(2012) Applications of immunohistochemistry. Malig Rep 14(5):368–375
J Pharm Bioall Sci 4(Suppl S2):307–309 7. Leong AS, Wright J (1987) The contribution
4. O’ Hurley G, Sjöstedt E, Rahman A et al of immunohistochemical staining in tumor
(2014) Garbage in, garbage out: a critical diagnosis. Histopathology 11:1295–1305
 Automated Napsin-A Immunohistochemistry 33

8. Bradley M, Turner PT, Cagle IM et al (2012) Napsin-A, TTF1, SPA and CK7 expression in
Napsin-A, a new marker for lung adenocarci- primary lung adenocarcinoma. Biotech Histo-
noma, is complementary and more sensitive chem 93(5):364–372
and specific than thyroid transcription factor 10. Shi SR, Key ME, Kalra KL (1991) Antigen
1 in the differential diagnosis of primary pul- retrieval in formalin-fixed, paraffin-embedded
monary carcinoma: evaluation of 1674 cases by tissues: an enhancement method for immuno-
tissue microarray. Arch Pathol Lab Med 136 histochemical staining based on microwave
(2):163–171 oven heating of tissue sections. J Histochem
9. Jin L, Liu Y, Wang X, Qi X (2018) Immuno- Cytochem 39(6):741–748
histochemical analysis and comparison of
 Chapter 4

Detection of Programmed Cell Death Ligand 1 Expression

in Lung Cancer Clinical Samples by an Automated
Immunohistochemistry System
Edwin Roger Parra and Sharia Hernández Ruiz

Abstract
Programmed cell death 1 (PD-1) plays an important role in subsiding immune responses, in promoting
self-tolerance through suppressing the activity of T-cells, and in promoting differentiation of regulatory
T-cells. One of its ligands, programmed cell death ligand 1 (PD-L1) acts as a checkpoint regulator in
immune cells and is also expressed in a wide range of cancer types. Anti-PD therapy modulates immune
responses at the tumor site, targets tumor-induced immune defects, and repairs ongoing immune
responses. Since drugs that target the PD-1/PD-L1 pathways became available as a cancer treatment,
there is need for the use of different antibodies to detect the presence of these proteins in tumoral samples
by immunohistochemistry or other assays. Because the detection of these antigens in tumor samples is
highly clinically informative for guiding treatment decisions, especially to establish the aptness of a patient
to receive anti-PD therapy, it is necessary to have a validation process that guaranties that the test results
obtained when using antibodies against these proteins are specific, selective, reproducible, and conducive to
quantification of antigen abundance in cancer tissue sections. Here we describe an automated immunohis-
tochemistry staining procedure that can be applied for the validation of multiple anti-PD-L1 antibody
clones when used for the staining of formalin-fixed, paraffin-embedded lung cancer tissue sections.

Key words PD-L1, Antibody optimization, Cell lines, Immune cell expression,
Immunohistochemistry

1 Introduction

The PD-1 receptor is a transmembrane protein expressed in a

variety of activated immune cells such as helper T-cells CD4+,
cytotoxic T-cells CD8+, B-cells, natural killer T-cells, and double
negative T-cells CD4–CD8, present in the thymus, activated
monocytes, dendritic cells (DCs), macrophages, and immature
Langerhans cells [1, 2]. This receptor has two ligands called pro-
grammed cell death
1 and
2 (PD-L1 and PD-L2), and when the
T-cell PD-1 receptor binds to its ligands on antigen presenting cells
(APCs), an immune inhibitory pathway is activated leading to

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_4, © Springer Science+Business Media, LLC, part of Springer Nature 2021

35
36 Edwin Roger Parra and Sharia Hernández Ruiz

T-cells suppression [3]. Both PD-1 and PD-L1 expression can be

detected in a broad number of cells such as hematopoietic cells
including T-cells, B-cells, macrophages, DCs, and mast cells, and
non-hematopoietic healthy tissue cells such as vascular endothelial
cells, keratinocytes, pancreatic islet cells, astrocytes, placenta syncy-
tiotrophoblast cells, and corneal epithelial and endothelial cells
[4]. Multiple solid tumor types including melanoma, renal cell
carcinoma, sarcomas, non-small cell lung carcinomas, thymomas,
ovarian, and colorectal cancers co-opt this immune shield by
expressing PD-L1 to generate an immunosuppressive tumor
microenvironment and avoid T-cell cytolysis [5–8].
Historically, immunohistochemistry (IHC) has been used to
determine the presence or absence of a given protein antigen in a
tissue [9]. In clinical pathology, assessing the presence of an antigen
by IHC serves as a diagnostic, prognostic, and predictive tool, and
IHC signal intensity quantification directly influences the manage-
ment of patients in the clinical setting. For example, the assessment
of estrogen receptor-α (ER- α), and human epidermal growth
factor receptor 2 (HER2) by IHC in breast cancer tumors is the
definitive test to determine whether or not a patient will receive
targeted therapies that can cost as much as $100,000 per year
[10, 11]. IHC assays using different primary antibodies, and
antibody-specific scoring pathology approaches (1%, 5%, 10%,
50%, H-score or combined malignant cells and lymphocytes expres-
sion) have been reported to assess the prevalence of PD-L1 positiv-
ity expression thought different tumor types as non-small cell lung
cancer (NSCLC), melanomas, sarcomas, renal cell carcinomas,
bladder carcinomas, pancreatic, colorectal, and thymic tumors
[11–14].
Evaluation of PD-L1 immunohistochemical staining may be
difficult. Macrophages often exhibit membranous staining and may
be misinterpreted as cancer cells in tissue samples if they infiltrate
cancer cells. Also, unspecific cytoplasmic staining may occur, and
weak partial membranous staining of tumors cells count as positive
but may be difficult to interpret as positive expression. The men-
tioned difficulties are especially troublesome when a very limited
proportion of tumor cells such as 1% is sufficient for a positive test,
as is the case when using some PD-L1 clones such as the 28-8
clone, a situation that may lead to significant interobserver varia-
tion [15]. Also, several factors such as the quantity of tissue or
cellular material available from small biopsies or cytology samples,
how stable are the epitopes detected by the various antibodies, use
of stored, pre-cut sections, and pre-analytical issues such as tissue
fixation and processing, can have a major impact on the outcomes
of immunohistochemical reactions, thus contributing to difficulties
in the assessment of PD-L1 expression [16]. PD-L1 induction in
tumors results from either oncogenic signaling, leading to consti-
tutive widespread expression, or in response to IFN-γ release by
 PD-L1 Immunohistochemistry in Lung Cancer 37

effector T-cells during their immune response to the tumor, leading

to variable PD-L1 expression observed across different cells and
tissues [17].
As PD-L1 IHC protocols have been independently developed
for specific anti–PD-1/PD-L1 therapies using different PD-L1
diagnostic assays (primary antibody clone plus immunostaining
platform/protocol), each clone potentially can demonstrate dis-
tinct staining properties, which could prohibit the inter-
changeability of their clinical use. This would pose a significant
challenge for pathology laboratories to offer PD-L1 testing, both
from the laboratory resources and the budgetary points of
view [18].
Recent publications have revealed both significant concordance
and discordance between different PD-L1 diagnostic clones
[15]. Seeking to harmonize the use of different anti-PD-L1 anti-
body clones, the blueprint study and a German ring trial showed
varying degrees of tumor proportion score (TPS) concordance
between the PD-L1 IHC clone 22C3 pharmDx kit and three
other companion or complementary kits [18, 19].
To ensure that treatment decisions based on PD-L1 expression
are consistent and objective, standards for PD-L1 testing need to
be established [20] and there is a need to harmonize the staining
procedures for analysis proposes. The automated IHC procedure
described in this chapter can be used to optimize, validate, and
compare different available commercial anti-PD-L1 antibody
clones and to identify which ones can be reliably used by surgical
pathologists to evaluate the PD-L1 expression on formalin-fixed,
paraffin-embedded (FFPE) tumor samples, using an IHC
workflow.

2 Materials

We have optimized the procedure described below using Leica

Biosystems Bond™ Tissue Staining Platform, which is a fully auto-
mated IHC staining system that improves efficiency, quality and
speed of the IHC staining procedure. This is of great importance to
ensure standardization of the procedure and reproducibility of the
results. We are providing the catalog numbers for specific products
that have been tested to perform optimally with Leica Bond™
automated platforms. Unless otherwise specified, all products
below are from Leica Biosystems, and are designed to be compati-
ble with the Leica Bond™ automated platforms. We also provide
the catalog numbers of the specific anti-PD-L1 antibody clones
that have been optimized with this automated platform, these are
from different companies and sources as indicated after the
antibody.
38 Edwin Roger Parra and Sharia Hernández Ruiz

2.1 IHC Reagents 1. Bond™ Dewax Solution, supplied as ready-to-use (Cat.

and Antibody Clones No. AR9222).
2. Bond™ Epitope Retrieval 1 (supplied as ready-to-use, citrate-
based pH 6.0) (Cat. No. AR9961).
3. Bond™ Epitope Retrieval 2 (EDTA-based pH 9.0) (Cat.
No. AR9640).
4. Bond™ Wash Solution, supplied as 10 concentrate, dilute to
1 with distilled water before use (Cat. No. AR9590).
5. Bond™ Polymer Refine Detection kit, which includes the
peroxide block, post primary (polymer-HRP anti-mouse),
polymer reagent, DAB Refine chromogen and hematoxylin
counterstain (Cat. No. DS9800).
6. Anti PD-L1 antibody clones (see Note 1): EPR1161-2-
(dilution 1:100; Epitomics-Abcam Burlingame, CA,
cat#ab174838); E1L3N (dilution 1:100; Cell Signaling Tech-
nology, cat#13684); clone E1J2J (dilution 1:100; Cell Signal-
ing Technology, cat#15165); 7G11 (dilution 1:40; Gordon
Freeman Laboratory, Boston University, Boston, MA, 1 aliquot
kindly donated by the Gordon Freeman Laboratory); SP142
(dilution 1:100; Spring Bioscience, cat#M4424); rabbit poly-
clonal ab58810 (dilution 1:200; Abcam, cat#ab58810); 28-8
(dilution 1:400; Abcam, cat#ab205921).
7. PowerVision Poly-HRP Anti-Rabbit IgG (Cat. No. PV6121)
(see Note 2).

2.2 IHC Equipment 1. Leica Biosystems BOND-MAX™ fully automated, advanced

staining system.
2. BOND™ Universal Covertiles (Cat. Nos. S21.2001,
S21.4583 or S21.4611).
3. BOND™ Mixing Stations (Cat. No. S21.1971).
4. Leica Biosystems Aperio ScanScope AT2 slide scanner.
5. Aperio ImageScope Pathology Slide Viewing Software, down-
loadable from the Leica Biosystem webpage.
6. Aperio Image Toolbox analysis software, Leica Biosystems
webpage.
7. Leica BOND™ Plus Slides (Cat. No. S21.2113).
8. BOND™ Slide Label and Print Ribbon (Cat. No. S21.4564).

2.3 Standard The following reagents are standard solutions used in immunohis-
Reagents tochemistry and do not need to be purchased from a specific
and Additional vendor.
Equipment 1. Ethanol, absolute and 75% and 95%.
2. Xylene (or xylene substitutes).
 PD-L1 Immunohistochemistry in Lung Cancer 39

3. Hydrogen peroxide, 3%solution.

4. Distilled or deionized water.
5. Basic histology glassware and staining jars.
6. Drying oven capable of maintaining 60  C stable temperature.
7. Cover glasses, 24  40 mm.
8. Mounting medium, we use Thermo Fisher Cytoseal, but equiv-
alent products are acceptable.

3 Methods

3.1 Automated For IHC staining, we cut 4-μm-thick sections and stain them with
PD-L1 Immuno- the Leica BOND-MAX™ system. This is the procedure described
histochemistry in this section, which we perform exactly as described in the sys-
Staining tem’s instruction manual [21].
1. On the BOND-MAX™ instrument, ensure the bulk and haz-
ardous waste containers have enough capacity to perform the
required staining runs.
2. Ensure there is adequate alcohol, distilled or deionized water,
BOND™ Dewax Solution, BOND™ Epitope Retrieval Solu-
tion 1 and BOND™ Wash Solution in the bulk reagent con-
tainers to perform the required staining runs.
3. Install a clean BOND™ Mixing Station.
4. Turn on the BOND-MAX™ fully automated, advanced stain-
ing system.
5. Turn on the BOND™ Controller attached to the BOND-
MAX™ system, open the BOND™ software.
6. Program the staining system using the parameters shown in
Table 1. Ensure to add all the solutions indicated in the table in
the proper reservoir in the staining system. Note from Table 1
that while steps 1 to 20 are performed in automated form in the
staining system, steps 22 to 24 are manually performed. Use
alcohol 100% for the alcohol rinse step 3. For the dehydration
step (Step 24), use ethanol washes as follows: 2 washes with
75% ethanol, 2 min each; 2 washes with 95% ethanol, 2 min
each; 2 washes with 100% absolute ethanol, 2 min each.
7. After performing all steps in Table 1, perform three changes in
xylene or xylene substitute, 1 min each.

3.2 Image 1. Using the Leica Biosystems Aperio ScanScope AT2 slide scan-
Acquisition, Digital ner, digitally scan the stained slides from positive and negative
Analysis and Staining controls (see Note 3) and tumor microarray (TMA) cases (see
Analysis Note 4). Perform the digital scanning capturing the image
40 Edwin Roger Parra and Sharia Hernández Ruiz

Table 1
Parameters used to program the automated staining system

Step Reagent Time Temp ( C)

1 Bake (in oven, no reagent) 30 min 60
2 Bond Dewax solution 3 72
3 Alcohol rinse 3
4 Bond wash 3 (5 min each)
5 Epitope retrieval #1 (citrate buffer ph 6) 20 min 100
Epitope retrieval #2 (Tris-EDTA buffer) 100
6 Bond wash 4 (3 min each) 35
7 Peroxide block (3.0% hydrogen peroxide) 5 min
8 Bond wash 5
Pretreatment (protein block, enzyme treatment)
9 PD-L1 antibody 15 min RT
10 Bond wash 5
11 Post primary (polymer-HRP anti-mouse) 8 min
12 Bond wash 5 (2 min each)
13 Polymer (poly-HRP anti-rabbit IgG) 8 min
14 Bond wash 5
15 Deionized water 1
16 DAB refine 10 min
17 Deionized water 3
18 Hematoxylin 8 min
19 Deionized water 1
20 Bond wash 2
22 Print label and place on slides (Manual)
23 Remove covertiles and rinse with deionized water (Manual) 10 dips  3
24 Dehydrate slides and coverslip with cytoseal (Manual)
X: indicates the number of times the step is done by the machine. RT: Room temperature

with a 20 objective. After scanning, the images are visualized

using ImageScope software, and analyzed using the Aperio
Image Toolbox analysis software.
2. Separately analyze membranous PD-L1 expression in the tumor
compartment and in tumor-associated inflammatory cells
(TAICs) in the stroma compartment, using the same cell mem-
brane algorithm for each antibody clone (see Notes 5 and 6).
 PD-L1 Immunohistochemistry in Lung Cancer 41

3. Score the staining intensity as 0 (no staining), 1+ (weak stain-

ing), 2+ (moderate staining), or 3+ (strong staining). Deter-
mine extension (percentage) of expression in both the tumor
and stroma compartments (see Note 7).

4 Notes

1. During the antibody optimization, the optimal antibody con-

centration, which gives the best staining with minimum back-
ground, must be determined experimentally for each clone,
and it is usually determined by using a series of dilutions in a
titration experiment. For example, if the antibody product
datasheet suggests using a 1:200 dilution, it is recommended
to make dilutions of lower than recommended, 1:50, 1:100,
and higher than the recommend 1:400 and 1:500 [22]. Fig-
ure 1 shows IHC staining using different dilutions of the anti-
PD-L1 clone 22C3.
2. The conventional method of developing humanized monoclo-
nal antibodies (mAbs) uses proprietary antibodies sourced
from mice or rabbits. Table 2 shows a comparison between
poly-, monoclonal, and recombinant antibodies. The charac-
teristics of the antibody are important, since, depending on
their origin, their performance could be different and this must
be considered at the time of optimization [23].

Fig. 1 Microphotographs of representative IHC staining with different dilutions of PD-L1 clone 22C3 (DAKO,
Cat. No. AS480) in commercial HDLM-2 control cell lines (a, b) and in placenta (c, d). Dilutions are 1:50 (a, c)
and 1:100 (b, d). Magnification is 200
42 Edwin Roger Parra and Sharia Hernández Ruiz

Table 2
Comparison of characteristics between polyclonal vs monoclonal and recombinant antibodies

Properties Monoclonal antibody Polyclonal antibody Recombinant antibody

Epitope Generated by a single B-cell Mixture of antibodies that all Antibodies crated to
selectivity line and thus recognize recognize different recognize a specific
only a single epitope of a epitopes of the protein of epitope of a protein of
protein of interest. interest. Less sensible to interest
Changes in epitopes affect changes in the epitopes
the function of the Ab
Source Mice or rabbit Variety of species including Entirely animal-free
mice, rabbit, goat, sheep, production process
and donkey
Reproducibility More reproducible Prone to batch to batch High reproducibility and
generated immortal B-cell variability (produced from guaranteed continuity
hybridomas which are animal sera). Quantity of of availability without
constant and renewable Abs obtained is limited by any dependence on
resources the size of the animal and animal immunization
its lifespan
Cross-reactivity Less likely to cross-react with May contain nonspecific No background staining
other proteins, yields antibodies and
lower background background staining
Specificity/ Highly specific due to single More sensitive due to Highly specific and
sensitivity target epitope but less targeting multiple sensitivity
sensitive because often epitopes of an antigen but
unable to detect masked less specific than
antigen monoclonal antibodies
Challenges More challenging to work Generated much more Last resort due to their
with when looking at rapidly, at less expense, higher cost
low-abundance proteins and with less technical skill
or proteins that show (months) but poor choice
variability. More expense for long-running studies.
and time (up to a year). More stable (pH and salt
Highly susceptible concentration)

3. The use of cell lines can also prove beneficial for validating
antibodies by IHC. Cells can be allowed to grow to confluence
in a cell plate and then detached, centrifuged to form a cell
pellet, and the cell pellet can be processed by fixation, embed-
ding, and sectioning just like a piece of tissue. Validation of
antibodies and protocol optimization using cell pellets is bene-
ficial in particular since it saves valuable tissues. Antibody vali-
dation using cells is particularly advantageous when cells can be
manipulated by transfection to introduce different ‘dose’ levels
of the target protein in otherwise weakly positive or negative
cell lines as controls [24]. Transfection efficiency rarely reaches
100%, a proportion of the cells should remain negative or
weakly stained for the target in question which can be useful
 PD-L1 Immunohistochemistry in Lung Cancer 43

Fig. 2 Microphotographs of representative examples of PD-L1 IHC marker in tonsil tissue. (a) PD-L1 stained
tonsil at low magnification. (b) Superficial epithelium used as an internal negative control. (c) Positive
reticulated epithelium. (d) Positive macrophages of a germinal center

in differentiating IHC signal from background noise. How-

ever, as protein expression levels are often modulated in dis-
ease, it may be important to include a range of pathologies and,
preferably, matched normal tissue [25]. In our experience we
have found sample tissues from placenta and tonsil to be useful
controls [26]. As can be seen in Fig. 2, IHC staining of com-
mercial control samples and cell lines is becoming increasingly
available, and these can be used as alternatives to control tissue
samples. In our experience, as an example, we have used the
HEK293 cell line as negative control, and HEK293-
transfected with PD-L1 human gene as positive controls (the
presence of absence of PD-L1 expression is confirmed by west-
ern blots after transfection). In addition, cell signaling com-
mercializes the cell line HDLM-2 as PD-L1 positive, and PC3
cells as PD-L1 negative, (SignalSlide #13747; Cell Signaling
Technology, Danvers, MA) [27]. Properly validated cell lines
may, in fact, be superior to histological tissue as controls in
some cases for quantitative IHC assays, especially if combined
with image analysis [28]. Commercial controls should also be
cut onto the same slide for IHC processing as the clinical
samples [20].
4. In addition, for validation purposes and based on the titers for
the specifics antibodies obtained with the IHC validations, we
have also stained a TMA set of 9 slides containing non–small
44 Edwin Roger Parra and Sharia Hernández Ruiz

cell lung carcinomas (NSCLC), staged I to III without neoad-

juvant therapy administered to the patient, (n ¼ 185; 122 ade-
nocarcinomas or ADCs and 63 squamous cell carcinomas or
SCCs) to compare PD-L1 IHC expression between different
anti-PD-L1 clones. The TMA sections were prepared using
three 1.0 mm tissue cores obtained from the center, middle,
and periphery of the tumor.
5. In the last years, supporting evidence for the value of identify-
ing multiple markers in the same tissue section using double
IHC [29] or multiplex immunofluorescence (mIF) staining
[30–32] have emerged as potential tools to help a deeper
understanding of the distribution of these molecules, providing
a unique insight into spatial, cell-type, and even phenotype
co-localization–type specific distribution, trying to avoid the
confusions observed when using a simple staining method.
Our experience has shown that mIF staining performed in
clinical specimens paraffin sections, using the same tissue sec-
tion to probe for several targets, provides a useful tool to
identify PD-L1 expression in a variety of cells in the tumor
microenvironment (Fig. 3), minimizing the error observed
when using a single IHC staining. The implementation of
mIF in the same tissue section and the flexibility to create
panels to different targets, offers many opportunities for inno-
vative digital image analysis approaches (such as inflammatory
tumor infiltration, cell phenotyping, proximity,
3D-reconstruction), increasing the novelty of this methodol-
ogy [32]. In addition, we believe that application of this type of
methodology to answer scientific research question or testing
hypothesis of clinical importance could provide answers to
different questions [33].
6. In order to make an accurate evaluation of the performance of
the different antibody clones in the tissue and cell line controls,
it is important to assess the correct staining by the clones, a
positive staining being defined as tumoral cells exhibiting par-
tial or complete membranous staining [34] as defined in the
Blueprint Phase 2 Project [18].
7. We consider the uniformity and a clearly defined membrane
staining pattern within tissues and cell lines to be accurate and
positive. The staining pattern is comparable to the noncom-
mercial clone 5H1 (dilution 1:40; generated by Lieping Chen,
Yale University), to the PD-L1 antibody clone 22C3 (Code
AS480, DAKO, shown in Fig. 1) stained with the DAKO
Autostainer Link 48, and the SP263 (ready to use, Ventana
Medical System Inc.); using previously optimized IHC condi-
tions and performed according to the standard automated
protocols, as references of well-validated antibodies in the
literature.
 PD-L1 Immunohistochemistry in Lung Cancer 45

Fig. 3 Microphotograph of multiplex immunofluorescence using a panel of

immune marker antibodies, with the Opal7 color Kit (Akoya/PerkinElmer, Wal-
tham, MA) in the same tissue section. Lung adenocarcinoma tissue showing
PD-L1 expression by tumor cells (white arrow) and negative in malignant cells
(yellow arrow). Pancytokeratin indicates malignant cells (Cyan). PD-L1 (Orange);
40 ,6-Diamidino-2-Phenylindole (DAPI), nuclear staining (Blue); CD68 (yellow);
CD3 (Red); CD8 (pink); and PD-1 (green). Multiplex immunofluorescence magni-
fication is 200

Acknowledgments

The authors would like to acknowledge the people that work in the
Translational Molecular Pathology Immunoprofiling Laboratory,
Luisa Solı́s, Mei Jang, Tong Li, Auriole Tamegnon, Barbara Mino,
Wei Lu, and Jianling Zhou and the pathologists team that works in
the image analysis, for their dedication to provide high quality data.
46 Edwin Roger Parra and Sharia Hernández Ruiz

References
1. Okazaki T, Honjo T (2007) PD-1 and PD-1 score for programmed death ligand-1 expres-
ligands: from discovery to clinical application. sion and the approval of Pembrolizumab for
Int Immunol 19(7):813–824 treatment of gastric cancer. Arch Pathol Lab
2. Salmaninejad A, Valilou SF, Shabgah AG et al Med 143(3):330–337
(2019) PD-1/PD-L1 pathway: basic biology 14. Sunshine JC, Nguyen PL, Kaunitz GJ et al
and role in cancer immunotherapy. J Cell (2017) PD-L1 expression in melanoma: a
Physiol 234(10):16824–16837 quantitative immunohistochemical antibody
3. Callea M, Pedica F, Doglioni C (2016) Pro- comparison. Clin Cancer Res 23
grammed death 1 (PD-1) and its ligand (16):4938–4944
(PD-L1) as a new frontier in cancer immuno- 15. Brunnstrom H, Johansson A, Westbom-
therapy and challenges for the pathologist: Fremer S et al (2017) PD-L1 immunohisto-
state of the art. Pathologica 108(2):48–58 chemistry in clinical diagnostics of lung cancer:
4. Sun C, Mezzadra R, Schumacher TN (2018) inter-pathologist variability is higher than assay
Regulation and function of the PD-L1 check- variability. Mod Pathol 30(10):1411–1421
point. Immunity 48(3):434–452 16. Kerr KM, Tsao MS, Nicholson AG et al (2015)
5. Blank C, Gajewski TF, Mackensen A (2005) Programmed death-ligand 1 immunohisto-
Interaction of PD-L1 on tumor cells with chemistry in lung cancer: in what state is this
PD-1 on tumor-specific T cells as a mechanism art? J Thorac Oncol 10(7):985–989
of immune evasion: implications for tumor 17. Koppel C, Schwellenbach H, Zielinski D et al
immunotherapy. Cancer Immunol Immun- (2018) Optimization and validation of PD-L1
other 54(4):307–314 immunohistochemistry staining protocols
6. Iwai Y, Ishida M, Tanaka Y (2002) Involve- using the antibody clone 28-8 on different
ment of PD-L1 on tumor cells in the escape staining platforms. Mod Pathol 31
from host immune system and tumor immuno- (11):1630–1644
therapy by PD-L1 blockade. Proc Natl Acad 18. Tsao MS, Kerr KM, Kockx M et al (2018)
Sci U S A 99(19):12293–12297 PD-L1 immunohistochemistry comparability
7. Blank C, Mackensen A (2007) Contribution of study in real-life clinical samples: results of
the PD-L1/PD-1 pathway to T-cell exhaus- blueprint phase 2 project. J Thorac Oncol 13
tion: an update on implications for chronic (9):1302–1311
infections and tumor evasion. Cancer Immunol 19. Roge R, Vyberg M, Nielsen S (2017) Accurate
Immunother 56(5):739–745 PD-L1 protocols for non-small cell lung cancer
8. Patel SP, Kurzrock R (2015) PD-L1 expression can be developed for automated staining plat-
as a predictive biomarker in cancer immuno- forms with clone 22C3. Appl Immunohisto-
therapy. Mol Cancer Ther 14(4):847–856 chem Mol Morphol 25(6):381–385
9. Rimm DL, Han G, Taube JM et al (2017) A 20. Cree IA, Booton R, Cane P et al (2016) PD-L1
prospective, multi-institutional, pathologist- testing for lung cancer in the UK: recognizing
based assessment of 4 immunohistochemistry the challenges for implementation. Histopa-
assays for PD-L1 expression in non-small cell thology 69(2):177–186
lung cancer. JAMA Oncol 3(8):1051–1058 21. Biosystems L. Bond™ Oracle™ HER2 IHC
10. Wolff AC, Hammond ME, Schwartz JN et al System for Leica BOND-MAX System Instruc-
(2007) American Society of Clinical Oncol- tions For Use 2014 [Manual for use on Leica
ogy/College of American Pathologists guide- Biosystems’ BOND-MAX fully automated,
line recommendations for human epidermal advanced staining system.]. https://
growth factor receptor 2 testing in breast can- drp8p5tqcb2p5.cloudfront.net/fileadmin/
cer. J Clin Oncol 25(1):118–145 downloads_lbs/Oracle_HER2_Bond_IHC_
11. Bordeaux J, Welsh A, Agarwal S et al (2010) System_USA_Breast_Only/User_Manuals_
Antibody validation. BioTechniques 48 IFUs/Bond_Oracle_HER2_IHC_System_
(3):197–209 TA9145_EN-US_Rev_B.pdf
12. Igarashi T, Teramoto K, Ishida M et al (2016) 22. Abcam. Antibody dilutions and titer. https://
Scoring of PD-L1 expression intensity on pul- www.abcam.com/protocols/antibody-
monary adenocarcinomas and the correlations dilutions-and-titer
with clinicopathological factors. ESMO Open 23. Lipman NS, Jackson LR, Trudel LJ et al (2005)
1(4):e000083 Monoclonal versus polyclonal antibodies: dis-
13. Kulangara K, Zhang N, Corigliano E et al tinguishing characteristics, applications, and
(2019) Clinical utility of the combined positive information resources. ILAR J 46(3):258–268
 PD-L1 Immunohistochemistry in Lung Cancer 47

24. Stadler C, Hjelmare M, Neumann B et al 29. Taylor CR (2014) Predictive biomarkers and
(2012) Systematic validation of antibody bind- companion diagnostics. The future of immu-
ing and protein subcellular localization using nohistochemistry: “in situ proteomics,” or just
siRNA and confocal microscopy. J Proteome a “stain”? Appl Immunohistochem Mol Mor-
75(7):2236–2251 phol 22(8):555–561
25. Howat WJ, Lewis A, Jones P et al (2014) Anti- 30. Nghiem PT, Bhatia S, Lipson EJ et al (2016)
body validation of immunohistochemistry for PD-1 blockade with Pembrolizumab in
biomarker discovery: recommendations of a advanced Merkel-cell carcinoma. N Engl J
consortium of academic and pharmaceutical Med 374(26):2542–2552
based histopathology researchers. Methods 70 31. Yuan J, Hegde PS, Clynes R et al (2016) Novel
(1):34–38 technologies and emerging biomarkers for per-
26. Parra ER, Uraoka N, Jiang M et al (2017) sonalized cancer immunotherapy. J Immun-
Validation of multiplex immunofluorescence other Cancer 4:3
panels using multispectral microscopy for 32. Parra ER, Francisco-Cruz A, Wistuba I (2019)
immune-profiling of formalin-fixed and State-of-the-art of profiling immune contex-
paraffin-embedded human tumor tissues. Sci ture in the era of multiplexed staining and digi-
Rep 7(1):13380 tal analysis to study paraffin tumor tissues.
27. Parra ER, Villalobos P, Mino B (2018) Com- Cancers 11(2):247
parison of different antibody clones for immu- 33. Parra ER (2018) Novel technology to assess
nohistochemistry detection of programmed programmed death-ligand 1 expression by
cell death ligand 1 (PD-L1) on non-small cell multiplex immunofluorescence and image
lung carcinoma. Appl Immunohistochem Mol analysis. Appl Immunohistochem Mol Mor-
Morphol 26(2):83–93 phol 26(2):e22–ee4
28. Torlakovic EE, Nielsen S, Vyberg M et al 34. Hirsch FR, McElhinny A, Stanforth D et al
(2015) Getting controls under control: the (2017) PD-L1 immunohistochemistry assays
time is now for immunohistochemistry. J Clin for lung cancer: results from phase 1 of the
Pathol 68(11):879–882 blueprint PD-L1 IHC assay comparison proj-
ect. J Thorac Oncol 12(2):208–222
 Chapter 5

Western Blot as a Support Technique

for Immunohistochemistry to Detect Programmed Cell
Death Ligand 1 Expression
Edwin Roger Parra and Sharia Hernández Ruiz

Abstract
Antibody selection and optimization are crucial to guarantee accurate and reproducible results when using
such antibodies for applications such as western blot analysis and immunohistochemistry (IHC). This is
especially important when selecting good candidate antibodies that will be used for cancer immunotherapy
diagnostics and research. In this chapter, we describe a Western Blot technique as support methodology for
the selection and validation of Programmed Cell Death Ligand 1 (PD-L1) antibodies that can be subse-
quently used in immunohistochemistry applications. Western Blot is a sensitive, specific, and widely
available protein characterization technique, used for the detection of specific antigens. PD-L1 is a major
immune checkpoint protein that mediates antitumor immune suppression and response, which is routinely
detected using IHC in formalin-fixed and paraffin-embedded tissues as part of cancer clinical diagnostic
workflows. For this reason, it is critical to define and select the best antibody clones and validate them using
different techniques in order to have a reliable detection of positive staining when these antibodies are used
in IHC.

Key words Western Blot, PD-L1, Antibody optimization, Cell lines, Immune cell expression,
Immunohistochemistry

1 Introduction

Western blot (sometimes called immunoblot) is a widely employed

analytical technique used for analysis and detection of specific pro-
teins in a complex mixture extracted form cells. It uses gel electro-
phoresis to separate the proteins by size and charge. The proteins
are then transferred and immobilized to a carrier membrane (typi-
cally nitrocellulose, nylon, or PVDF). The target protein of interest
is then detected by a primary antibody, which in turn is detected by
a secondary antibody conjugated to a fluorescent label or to an
enzyme which generates an insoluble precipitate upon addition of
its substrate. The detected bands become visible through color or
emission of light, after a reaction with an applied reagent [1, 2].

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_5, © Springer Science+Business Media, LLC, part of Springer Nature 2021

49
50 Edwin Roger Parra and Sharia Hernández Ruiz

Western blots are in wide use across a broad range of scientific

and clinical disciplines. This method is a powerful tool to detect and
characterize a multitude of proteins, especially those that are of low
abundance, thanks to the great sensitivity of the technique. It is able
to show the presence of a specific protein through the binding of an
antibody, which is useful to identify the expression of that protein
from various tissues, or for monitoring how protein expression
changes as a response to disease progression or drug treatment
[3, 4].
Immunoblotting is very valuable, especially for testing the
specificity of antibodies that are to be subsequently used in immu-
nohistochemistry (IHC) experiments. This is due to the immuno-
blot’s ability to provide simultaneous resolution of multiple
immunogenic antigens. Moreover, since IHC is a semi quantitative
technique, quantitative assessment of protein expression can be
better accomplished by Western blot analysis [3, 5].
An appropriate validation and evaluation of PD-L1 expression
on tissues is important, since there are different PD-L1 clones
developed in different assays, as target for immunotherapy. Using
lung cancer as a model, the procedure described below can be used
to compare commercially available PD-L1 clones by Western Blot
analysis, and thus to identify which ones can be reliably used by
IHC in formalin-fixed paraffin-embedded (FFPE) tissues to sup-
port the surgical pathologist in the evaluation by IHC PD-L1
expression.

2 Materials

2.1 Gel 1. Sample buffer, 4. This buffer can be obtained commercially as
Electrophoresis a ready-to-use solution. We use NuPAGE™ LDS 4 Sample
Separation Buffer, but equivalents are acceptable.
2. 20 NuPAGE™ MES SDS Running Buffer. We buy this
buffer as a commercially available pre-mixed, ready-to-use
solution. Alternatively, you can also use 20 MOPS SDS run-
ning buffer, also commercially available from many vendors.
Before using, dilute to 1 by mixing 50 mL of 20
NuPAGE™ MES or 20 MOPS SDS running buffer with
950 mL of deionized water.
3. Precast NuPAGE™ Novex 4–12% Bis-Tris polyacrylamide gra-
dient electrophoresis gel cassettes. We use precast gels, but gels
prepared in the laboratory can also be used.
4. Mini gel electrophoresis apparatus, including power supply. We
routinely conduct this protocol using the XCell SureLock™
Mini-Cell system. But other electrophoresis systems can be
used following the manufacturer’s instructions.
 Immunoblot Detection of PD-L1 51

5. Protein marker ladder. Be sure the marker of choice provides

good resolution in the size range in which your protein of
interest is expected to migrate. In this case, for PD-L1 you
should choose a marker that provides good resolution in the
40–50 kDa range.

2.2 Protein Transfer 1. Transfer buffer. We use the NuPAGE™ 20 Bis-Tris transfer
buffer. Dilute to 1 with distilled water before using.
2. Gel transfer apparatus with its components, including power
supply. Follow manufacturer’s instructions on how to assemble
the transfer apparatus.
3. Nitrocellulose western blot transfer membranes, 0.45 μm
pore size.

2.3 Membrane 1. Tris Buffered Saline with Tween-20® (TBST) buffer, 1:
Blocking, 50 mM Tris–HCl, 150 mM NaCl, 0.05% Tween-20, pH 7.4.
Immunolabeling, To prepare 1 L, dissolve in 800 mL of distilled water 8.8 g of
Washing NaCl, 0.2 g of KCl, and 3.0 g of Tris base. Add 500 μL of
and Development Tween-20®. Adjust the pH to 7.4 with HCl and complete the
volume to 1 L with distilled water. Sterilize by filtration or
autoclaving.
2. Blocking solution. To prepare, add 5 g of non-fat dry milk
powder to 100 mL of the TBST buffer described above. This
is also called NFDM buffer, and it is 5% (w/v) milk.
3. Wash buffer. This is TBST 1 prepared as described above, but
with 0.1% Tween-20®.
4. Antibody incubation buffer. This is TBST with 5% (w/v)
bovine serum albumin (BSA).
5. Primary antibodies. We have tested this procedure with the
following PD-L1 antibodies and dilutions: EPR1161-2, dilu-
tion 1:2000 (Epitomics-Abcam, Burlingame, CA,
cat#ab174838); E1L3N, dilution 1:2000 (Cell Signaling
Technology, Beverly, MA, cat#13684); clone E1J2J, dilution
1:2000 (Cell Signaling Technology, cat#15165); 7G11, dilu-
tion 1:2000 (generated in the Gordon Freeman Laboratory,
Boston University, Boston, MA); SP142, dilution 1:2000
(Spring Bioscience, Pleasanton, CA, cat#M4424); PD-L1 rab-
bit polyclonal, dilution 1:2000 (Abcam, cat#ab58810); 28–8,
dilution 1:2000 (Abcam, Cambridge, MA, cat#ab205921);
SP263, dilution 1:500 (Ventana Medical System Inc., Tucson,
AZ, cat#790-4905); 1H5, dilution1:1000 (generated in the
Lieping Chen Laboratory, Yale University, New Haven, CT).
All these antibodies should generate a band between of
40–50 kDa molecular weight. As a control load antibody, we
use β actin at a dilution of 1:2000 (Chemicon International,
Temecula, CA).
52 Edwin Roger Parra and Sharia Hernández Ruiz

6. Secondary antibody. Use an anti-mouse or an anti-rabbit sec-

ondary antibody, depending of the primary antibody. In our
case, we use a secondary antibody conjugated to horseradish
peroxidase, which is provided in the SuperSignal Chemilumi-
nescence Kit (see item 8 below).
7. Stripping solution. We use the Re-Blot Plus stripping solution
from Chemicon International, but equivalents from other ven-
dors are acceptable. This is required when re-blotting the same
membrane with a different antibody, and the first antibody
needs to be stripped from the membrane.
8. Signal development kit. We use SuperSignal Chemilumines-
cence Kit from Pierce Biotechnology, but other kits can be
used as well, following manufacturer’s instructions. Regarding
the SuperSignal Chemiluminescence kit, there are separate kits
for detection of mouse and rabbit secondary antibodies. The
kit contains all the reagents required for signal development,
including a luminol enhancer solution for increased sensitivity.

2.4 Cell Lines For this procedure you need previously prepared protein extracts
and Tissues from tissues and cell lines, using your extraction and lysis method of
choice (see Note 1). Protein concentration in the extracts should
have been previously determined by the method of your choice.
1. Tissues. We usually include in this protocol a human tonsil
tissue lysate as a positive control.
2. We use the following human lung-derived or lung adenocarci-
nomas cell lines: H23, H157, H461, H4006, H1171,
and H193.
3. HEK293 cells, a human embryonic kidney cell line. This is a
highly transfectable cell line, and we use non-transfected cells as
well as cells transfected with the PD-L1 gene, as negative and
positive controls, respectively.

2.5 Additional 1. X-ray films. We use Kodak Biomax MR X-ray films.

Materials 2. Micro-pipettes with tips, different volumes.
3. Screw cap tubes, or sealable plastic bags (for membrane block-
ing and incubating the membranes with antibodies).
4. Rotor or shaker platform.
5. Plastic wrap.
6. Film casette.
 Immunoblot Detection of PD-L1 53

3 Methods

3.1 Sample 1. . Using 2 μg of protein from the lysates from cell lines or
Preparation, tissues, prepare the sample by mixing 2.5 μL of the 4
Electrophoresis, NuPAGE™ LDS Sample Buffer, the volume of protein sample
and Transfer required for 2 μg of protein, and deionized water to complete a
final volume of 10 μL.
2. Assemble the gel electrophoresis apparatus following manufac-
turer’s instructions, including the precast gels. At this point
you need to remove the combs and the white tape that seals the
bottom of the gel cassette. Place the gels in the tank, and add
1 running buffer to the gel tank, this will take approximately
400 mL of running buffer to completely fill each chamber. If
using the XCell SureLock™ Mini-Cell, add 600 mL of running
buffer to the lower chamber and 200 mL of running buffer to
the upper chamber (for reduced samples, use running buffer
with antioxidant in the upper chamber). Rinse the gel wells
three times using 1 running buffer. Ensure that the gel,
including its lanes, are fully submerged in the running buffer.
3. Load your 10 μL samples into the wells, including the protein
ladder marker. Avoid overloading the wells in order to avoid
cross- contamination of the samples (see Note 2).
4. Start the gel run. Optimal run times vary depending on gel
percentage and power supply used for electrophoresis. How-
ever, when using the XCell SureLock™ Mini-Cell set-up with
MES running buffer, we run the gel for 35 min at 200 V
constant voltage. If using the MOPS running buffer, we run
the gel for 50 min at 200 V constant (see Note 3).
5. After the electrophoresis, disassemble the electrophoresis appa-
ratus. Carefully retrieve the gel, and use it to assemble the
transfer set-up, including the nitrocellulose membrane, accord-
ing to the manufacturer’s instructions. Fill the transfer tank in
1 Bis-Tris transfer buffer, and transfer following the transfer
apparatus instructions.

3.2 Immunolabeling 1. Disassemble the transfer apparatus, carefully removing the

and Signal membranes. Handle the membranes with gloves or tweezers,
Development never allowing contact with bare hands.
2. Place the membranes in conical tubes or sealable plastic bags.
Keep membranes moist at all times. Block membranes in block-
ing solution (NFDM buffer) for 1 h at room temperature. Use
continuous shaking or rotation.
3. Briefly rinse membranes with wash buffer.
54 Edwin Roger Parra and Sharia Hernández Ruiz

4. Incubate membranes overnight at 4  C in the antibody incuba-

tion buffer using any of the anti-PD-L1 primary antibodies
described in the previous section at the indicated dilution.
Dilute the antibody first into the antibody incubation buffer
before adding the membrane. Use continuous shaking or rota-
tion for the incubation.
5. Wash the membranes in wash buffer, 2–3 times, 5 min
per wash.
6. Incubate membranes in the secondary antibody at a dilution of
10 ng/mL in the antibody incubation buffer. Incubate for
20 min at room temperature with continuous shaking or
rotation.
7. Wash the membranes in wash buffer, 3 times, 5 min per wash.
8. Develop the western blot signal on the membrane using the
SuperSignal Chemiluminescence kit (Pierce Biotechnology), or
any other kit of your choice, strictly adhering to the kit’s
instructions. When incubating the membrane with the Work-
ing Solution (provided with the kit), we use approximately
0.1 mL per cm3 of membrane area, and incubate for 5 min.
9. After completing the steps indicated in the signal detection kit,
drain excess liquid from the membrane (but keep it moist), and
place the membrane in a plastic sealable bag or cover with clear
plastic wrap, avoiding bubbles between the membrane and the
plastic.
10. Place the wrapped membrane inside the film cassette. Fixing it
to the cassette with tape is recommended to avoid displace-
ment of the film during exposure.
11. In a dark room, insert an X-ray film inside the cassette and
tightly close the cassette. Never expose films to white light (see
Notes 4 and 5). Expose the film for 1 min (this time can be
optimized) and proceed to develop the film with the method of
choice, ensuring it is compatible with the film type.
12. If needed, the same membrane can be re-probed with another
antibody. In this case, the previous antibody needs to be
stripped from the membrane. For this purpose, we use the
Re-Blot Plus stripping solution (Chemicon International)
according to the manufacturer’s protocols [6, 7], but other
solutions and methods can be used. It is recommended that the
membrane is exposed to a film after stripping to ensure com-
plete removal of the previously bound antibodies (see Note 6).
 Immunoblot Detection of PD-L1 55

4 Notes

1. A wide selection of samples is very important for antibody

validation. Your selection of samples can vary from the one
we use for this protocol, however, it is always important to
include samples that you know express high levels of PD-L1, to
be used as positive controls, as well as samples in which PD-L1
protein expression is absent, to be used as negative controls.
2. Always load your protein ladder in the same sequence in the
appropriate well from your gel to avoid mistakes during the
analysis of your antibodies.
3. Depending on whether we use MES or MOPS running buffer,
we need to check the time and the volts to obtain good results
with all your antibodies tested.
4. Detection of signals is the last step and the molecular weight of
the protein can be estimated by comparison with marker pro-
teins, and the amount of protein can be determined as this is
related to band intensity. In most applications, it is enough to
confirm protein presence and roughly estimate the amount.
5. Depending on the antibody used and its dilution, we observed
that we need to test several exposure times to detect the signal.
In general, we start short exposure times (a few seconds), and if
band intensity is inadequate, we progressively increase expo-
sure time until band intensity is satisfactory, being careful never
to expose the film for more than 1 min.
6. While antibody optimization for western blots is useful as a first
step to select the best antibodies, it only guarantees that the
chosen antibody will provide accurate results for western blot
analysis. If the goal is to use the antibody for IHC, for example,
then the user must demonstrate that the antibody is also able to
specifically recognize its target when used in those other appli-
cation [8]. Figure 1 shows representative western blot results
when different PD-L1 antibody clones are tested in a panel of
lung cancer cell lines.

Acknowledgments

The authors would like to acknowledge the people that work in the
Translational Molecular Pathology Immunoprofiling Laboratory
for their dedication to provide high quality data.
56 Edwin Roger Parra and Sharia Hernández Ruiz

A E
PD-L1 (E1L3N) PD-L1 (22C3)

HEK293Trans. (+)
HEK293Trans. (+)
MW MW

HEK293
HEK293

H4006

H1171
Tonsil
H4006
H1171

H157
H461

H193
Tonsil

H157
H461

H193

H23
H23

50KDa 50KDa
40KDa 40KDa

B F
PD-L1 (E1J2J) PD-L1 (SP263)
HEK293Trans. (+)

HEK293Trans. (+)
MW MW
HEK293

HEK293
H4006

H1171
Tonsil

H4006
H1171
H157
H461

H193

Tonsil

H157
H461

H193
H23

H23
50KDa 50KDa
40KDa 40KDa

C G

PD-L1 (SP142) PD-L1 (5H1)

HEK293Trans. (+)
HEK293Trans. (+)

MW MW

HEK293
HEK293

H4006
H1171
H4006
H1171

Tonsil
Tonsil

H157
H461

H193
H157
H461

H193

H23
H23

50KDa 50KDa
40KDa 40KDa

D H
PD-L1 (28-8)
HEK293Trans. (+)

β actin
HEK293Trans. (+)

MW MW
HEK293
HEK293

H4006
H1171
Tonsil

H193
H157
H461
H4006
H1171
Tonsil

H23
H157
H461

H193
H23

50KDa
50KDa 40KDa
40KDa

Fig. 1 Representative western blots using different anti-PD-L1 antibody clones tested in a panel of human lung
cancer cell lines. Cell lines tested were H23, H157, H461, H4006, H1171, and H193. Human tonsil extracts are
used in all the blots as a positive control. Untransfected HEK293 cells served in all panels as negative controls,
while the HEK293-PD-L1-transfected cells were used as positive controls. Notice the absence of signal in the
untransfected HEK293 cells, while there is a very strong band in the HEK293-PD-L1-transfected cells. The
anti-PD-L1 clones used were the E1L3N (a), E1J2J (b), SP142 (c), 28-8 (d), 22C3 (e, this is from Dako,
Carpinteria, CA, Kit cat#SK006), SP263 (f), and 5H1 (g). Membranes were also probed with β actin to show
protein loading in the lanes (h). The PD-L1 molecular weight (MW) looks similar with all the PD-L1 clones. The
22C3 clone (e) did not show any bands when tested in western blots
 Immunoblot Detection of PD-L1 57

References
1. Eslami A, Lujan J (2010) Western blotting: sam- Blot analysis of the MIF receptor, CD74, in
ple preparation to detection. J Vis Exp 44:e2359 formalin-fixed, paraffin-embedded tissue. Meth-
2. Kramer DK. Western blotting (immunoblot): ods Mol Biol 2080:123–134
Gel electrophoresis for proteins 2013. https:// 6. Thermo Fisher Scentific. NuPAGE Bis-Tris Gels
www.antibodies-online.com/resources/17/ 2019 [Pub. No. MAN0007891:[Manual].
1224/western-blotting-immunoblot-gel-elec https://assets.thermofisher.com/TFS-Assets/
trophoresis-for-proteins/ LSG/manuals/MAN0007891_NuPAGE_
3. Kurien BT, Dorri Y, Dillon S et al (2011) An BisTris_MiniGels.pdf
overview of Western blotting for determining 7. Parra ER, Villalobos P, Mino B et al (2018)
antibody specificities for immunohistochemistry. Comparison of different antibody clones for
Methods Mol Biol 717:55–67 immunohistochemistry detection of pro-
4. Moore C. Introduction to Western Blotting grammed cell death ligand 1 (PD-L1) on
Endeavour House, Langford Business Park, non-small cell lung carcinoma. Appl Immuno-
Langford Lane, Kidlington, Oxford OX5 1GE, histochem Mol Morphol 26(2):83–93
UK.: MorphoSys UK Ltd; 2009. http://www. 8. Bordeaux J, Welsh A, Agarwal S et al (2010)
spacesrl.com/wp-content/uploads/2011/03/ Antibody validation. BioTechniques 48
WesternBlottingBrochure.pdf (3):197–209
5. Graham A, Nothnick WB (2020) Concurrent
immunohistochemical localization and Western
 Chapter 6

Creation of Formalin-Fixed, Paraffin-Embedded 3D Lung

Cancer Cellular Spheroids for the Optimization
of Immunohistochemistry Staining Procedures
Jennifer Cabán-Rivera, Camille Chardón-Colón, Alberto Pedraza-Torres,
Yoan E. Rodrı́guez, Raymond Quiñones-Alvarado,
and Pedro G. Santiago-Cardona

Abstract
In an era of precision medicine important treatment decisions are dictated by expression of clinically
informative tumor protein biomarkers. These biomarkers can be detected by immunohistochemistry
(IHC) performed in tumor tissue sections obtained from biopsies or resections. Like all experimental
procedures, IHC needs optimization for several of its steps. However, the investigator must avoid optimiz-
ing the IHC procedure using valuable human biopsy samples which may be difficult to obtain. Ideally,
valuable biopsy samples should only be subjected to IHC once the IHC protocol has been optimized. In
this chapter, we describe a procedure for IHC optimization using tri-dimensional (3D) cellular spheroids
created from cultured cells. In this approach, cultured cells are pelleted into 3D spheroids, which are then
processed just like a tissue sample, namely, fixed, embedded, sectioned, mounted on slides, and stained with
IHC just like a human tissue sample. These 3D cellular spheroids have a tissue-like architecture and
cellularity resembling a tumor section, and both cellular and antigen structure are preserved. This method
is therefore acceptable for IHC optimization before proceeding to the IHC staining of human tumor
samples.

Key words Spheroids block, Immunohistochemistry optimization, p39, Lung cancer, Cell lines,
Formalin-fixed-paraffin-embedded tissues

1 Introduction

Clinically relevant protein biomarkers are needed to improve lung

cancer management. Many important clinical decisions regarding
disease management are guided by the detection by immunohisto-
chemistry (IHC) staining of these biomarkers in tumor tissue

Jennifer Cabán-Rivera, Camille Chardón-Colón, Alberto Pedraza-Torres, and Yoan E. Rodrı́guez contributed
equally to the protocol optimization.

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_6, © Springer Science+Business Media, LLC, part of Springer Nature 2021

59
60 Jennifer Cabán-Rivera et al.

obtained from biopsies or resections. For example, expression of

several isoforms of cytokeratin, as detected by IHC, have diagnostic
value for non-small cell lung carcinomas (NSCLC) [1]. As another
example, a panel of IHC markers is routinely used in pathology
laboratories for the subclassification of NSCLC into squamous cell
carcinomas or adenocarcinomas subtypes [2, 3].
In the context of basic and translational cancer research, IHC
staining for any given protein should ideally be preceded by exten-
sive optimization of the IHC workflow in order to ensure a strong
staining signal that is specific, reproducible and of sufficient quality
for publication. This involves optimizing parameters such as anti-
body concentration and incubation time, conditions for effective
antigen retrieval, blocking to minimize background, number and
duration of washes, signal development conditions, etc. Even when
these parameters are optimized, they may still have to be re-checked
when changing the batch of the antibody or of any other IHC
reagent.
The optimization stage may involve a certain degree of trial and
error. Therefore, it is strongly recommended that valuable human
tumor tissue samples are not used during this stage. Pre-made
tumor microarrays (TMAs) are commercially available for many
cancer types, but these can be too expensive and also too valuable
to be used for optimization purposes. Therefore, regardless of their
origin, valuable human samples should ideally only be subjected to
IHC analysis once the IHC protocol has been optimized.
In this chapter, we describe a procedure for IHC optimization
using tridimensional (3D) cellular spheroids created from cultured
cells. This approach is relatively inexpensive since it starts with
cultured cells. Briefly, cells are grown in culture to form confluent
monolayers, then they are detached from culture plates, centri-
fuged, and pelleted. The cell pellet is then processed like a tissue
biopsy would normally be, namely, fixed, embedded, sectioned into
tissue sections, and mounted on glass slides that can then be used
for IHC staining just like any other tissue biopsy. The resulting 3D
cellular spheroids have a tissue-like architecture and cellularity
resembling a tumor section, and the cellular structure and antigen
availability are preserved during their preparation. They are there-
fore acceptable as an inexpensive biological material that can be
used for IHC optimization.
We have successfully used the protocol described in this chapter
to optimize an IHC staining procedure to detect p39 protein
expression in lung cancer cell culture-derived tridimensional
(3D) spheroids. We have previously reported elevated p39 expres-
sion as a biomarker for advanced stage lung squamous cell carcino-
mas (SCC) [4], and slides prepared from 3D spheroids have been
instrumental in our laboratory to optimize the IHC protocol for
p39 and for other antigens. After optimizing the p39 IHC staining
with the 3D spheroids, we successfully used the optimized protocol
 3D Spheroids for Immunohistochemistry Optimization 61

to stain lung cancer TMAs for p39 expression by IHC [4]. It is

important that the cell line chosen to prepare the 3D spheroids
matches the tumor tissue type that will be eventually studied. In our
case, we created the 3D spheroids using the NSCLC cell line H520.
This cell line is of the SCC NSCLC subtype and is patient-derived
from SCC tumors. We have identified p39 as part of a metastasis-
associated proteomic biomarker signature in SCC [4] and therefore
we optimized the IHC procedure using H520 3D spheroids before
actually conducting the IHC p39 analyses using human lung
TMAs. Therefore, choice of the appropriate cell line to prepare
the 3D spheroids is of great importance.
It is important to keep in mind that 3D spheroid models may
not be suitable if preserving the heterogeneity of the tumor micro-
environment is of the essence. The spheroids produced with the
procedure herein described are relatively homogeneous in terms of
cellular composition and lack the cellular variety that typically
represents the complex interactions between the tumor and its
microenvironment. Therefore, these spheroid structures may not
be ideal to reliably assess protein expression that is strongly affected
by intercellular signaling events. Neither they provide a suitable
model to address the issue of tumor multiclonal heterogeneity.
However, it must be kept in mind that the purpose of this approach
is not to study oncogenesis-related biological process, but it is
rather aimed at the optimization of the immunological detection
of an epitope within the context of a 3D tumor-like tissue architec-
ture, and to mimic as much as possible the mechanical aspects of
antigen accessibility in the context of 3D tissue structures. This
chapter describes the complete procedure, from the formation of
the 3D spheroids from cell cultures, preparation of spheroid sec-
tions, staining of the sections with hematoxylin and eosin to verify
their cellular density, and finally, IHC staining of the spheroid
sections for p39 protein expression.

2 Materials

All the solutions should be prepared using distilled water, unless

otherwise specified. Reagents and solutions should be stored at
room temperature, unless otherwise specified. Follow all waste
disposal regulations for waste materials.

2.1 Cell Lines 1. Cell lines. We optimized this protocol using the H520
and Cell Culture non-small cell lung carcinoma (NSCLC) cell line, which is of
Reagents the squamous cell carcinoma subtype. Keep in mind that the
purpose of the procedure described in this chapter is to use cell
lines to optimize the IHC protocol that will then be applied to
formalin-fixed, paraffin-embedded (FFPE) tissue sections.
Therefore, the cell lines for the optimization of the IHC
62 Jennifer Cabán-Rivera et al.

protocol should be as histologically equivalent as possible to

the tumor tissue that will be subsequently tested. For example,
H520 and H1666 cell lines originated from squamous cell lung
carcinomas and from lung adenocarcinomas, respectively,
therefore they can be used for IHC optimization for these
lung tumor types. We culture cells in 100 mm culture plates
or T75 flasks.
2. Cell culture medium. This depends of the cell type of your
choice. We culture H520 cells in RPMI medium supplemented
with 10% heat-inactivated fetal bovine serum (FBS) and 1%
penicillin-streptomycin.
3. Phosphate-Buffered Saline (PBS), 1. You can prepare 1 PBS
as follows: dissolve 8.0 g of NaCl, 0.2 g of KCl, 1.44 g of
Na2HPO4.2 H2O and 0.24 g of KH2PO4, in of 800 mL of
water. Adjust the pH to 7.2 with HCl (start with concentrated
HCL and then use more diluted HCL as you approach the
desired pH) and add distilled water to complete the volume to
1 L. Alternatively, ready-to-use commercially available PBS is
also acceptable. Use cold.
4. 0.25% Trypsin-EDTA solution. We buy in ready-to-use
pre-mixed form. We use this solution to detach cells from the
culture flasks or plates. Alternatively, you can scrape cells with a
rubber scraper or spatula.

2.2 Histology 1. Histology tissue embedding and processing cassettes.

Reagents and Supplies 2. 10% neutral buffered formaldehyde solution. We purchase this
as a ready-to-use pre-mixed solution, it is available from several
vendors.
3. Ethanol. You need absolute (100%) ethanol, anhydrous, histo-
logical grade, and you also need 95%, 90%, 85%, 80%, and 70%
ethanol dilutions in distilled water (dH2O).
4. Xylene or xylene substitute.
5. Paraffin or tissue embedding medium, we use Paraplast
X-TRA®, but other alternatives are acceptable. Check the man-
ufacturer’s instruction for melting temperature.
6. Tissue embedding base metal molds, with dimensions of
32  25  12 mm.
7. Embedding rings, be sure they fit into the embedding base
molds.
8. Microscope glass slides, 25  75 mm, including coverslips of
the appropriate size.
9. Bluing reagent solution, ready-to-use solution.
 3D Spheroids for Immunohistochemistry Optimization 63

10. Acid alcohol, 1%. Prepare a solution that is 1% hydrochloric

acid in 70% ethanol. You can dilute 2 mL of concentrated
12.1 M HCl in 200 mL 70% ethanol.
11. Eosin staining solution, we use Eosin Y solution 1%, alcoholic,
ready-to-use.
12. Hematoxylin stain, we use Harris Modified Hematoxylin.
13. Mounting medium, we use Cytoseal 60, but other alternatives
can be used.
14. Standard slide racks and histology staining and washing jars.
15. HistoCore Arcadia C-Cold Plate from Leica Biosystems, or any
other histology cold plate.
16. HistoCore Arcadia H-Heated Paraffin Embedding Station, or
any other heated histology embedding station.
17. Microtome with blade (follow all necessary precautions when
handling sharp microtome blades).

2.3 Immuno- 1. Citrate antigen retrieval solution. Prepare by dissolving 1.92 g

histochemistry of trisodium citrate dehydrate and 0.74 g of EDTA in 800 ml
Reagents of H2O, adjust pH to 6.2 with 1 N HCl, add 0.5 ml of Tween
20® and complete to a final volume of 1 L. This solution can be
stored at 4  C for up to 6 months.
2. Hydrogen peroxide solution, 3%. Start with 30% hydrogen
peroxide (H2O2) and dilute to 3% with distilled water.
3. PAP pen, or any other hydrophobic pen or marker, this is
needed for drawing hydrophobic barriers around the 3D spher-
oid section in microscope slides.
4. Primary antibody of your choice, depending on the antigen
you want to test. We optimized this protocol using a rabbit
monoclonal antibody against p39, clone EPR5074 from
Abcam. (Cat. No. 124896) (see Note 1). For a 1:50 dilution
add 20 μL of antibody to 980 μL of 1 PBS.
5. Super sensitive Link-Label IHC kit from BioGenex (LP000-
ULE). This immunohistochemistry kit includes a biotin-
labeled anti-rabbit secondary antibody and a streptavidin con-
jugated horseradish peroxidase (HRP). Use a 1:20 dilution for
the secondary antibody and a 1:10 dilution for the streptavidin.
Other immunohistochemistry detection kits are acceptable but
be sure to use according to manufacturer’s instructions, and
that the secondary antibody should be compatible with your
primary antibody (see Note 2).
6. Diaminobenzidine (DAB) reagent. This is the substrate for the
HRP, it produces a dark brown precipitate when it is oxidized
by the HRP. We use the BioGenex Two Components
DAB-Pack (HK542-XAKE), following product instructions.
64 Jennifer Cabán-Rivera et al.

To prepare 1 mL of DAB reagent solution, add 2 drops of DAB

reagents to 1 mL of DAB buffer, vortex the solution, and store
at 4  C (see Note 3).

2.4 General 1. Incubator set at 37  C, 5% CO2.

Laboratory Equipment 2. Humid chamber. This is to prevent the slides from drying up
due to evaporation during antibody incubations. It can be
commercially purchased or can be prepared in the laboratory
using a tight sealing container. Humidity inside the chamber
can be maintained by including absorbent paper soaked in
distilled water.
3. Microscope with camera, and suitable image acquisition
software.
4. Lint-free tissue paper.
5. Water bath, set to 80–85  C.
6. Tabletop centrifuge with a rotor capable of holding 50 mL
tubes, preferably refrigerated. We use an Eppendorf 5810R,
but equivalents are acceptable.
7. Conical tubes, 50 mL.
8. Filter paper, 180 μm.
9. Lens paper. Wax paper or weighting paper can also be used.
10. Oven, set to 37  C, then to 64  C.

3 Methods

3.1 Spheroid For the preparation of 3D spheroid blocks with tissue-like organi-
Preparation from Cell zation from lung cancer H520 cell line (or the cell line of your
Cultures choice), you should start with at least 5–6 confluent T75 flasks or
100 mm cell culture plates for each cell line in order to obtain a
good-sized cell pellet from which the spheroid will be formed.
Procedures related to spheroid fixation and preparation of the
spheroid blocks (described in detail in Subheadings 3.1 and 3.2)
are adaptations of previously published protocols [5, 6].
1. Collect cells by scraping them from the culture plate in 5 mL of
1 PBS. We recommend this volume for T75 flasks; you
should adjust the volume of 1 PBS when using plates. It is
important that the entire surface of the bottom of the flask or
plate is covered with thin layer of 1 PBS. Alternatively, detach
cells from the plate by incubating the cultures with a 0.25%
Trypsin-EDTA solution at 37  C for 5–10 min.
2. Transfer the cell suspension to a 50 mL tube and pellet the cells
by centrifugation (up to 300  g) for 5 min, at room tempera-
ture (RT). If the cells were detached by trypsinization, dilute
 3D Spheroids for Immunohistochemistry Optimization 65

the trypsin solution 1:10 with fresh culture medium to ensure

inactivation of the trypsin. Do this dilution before the centri-
fugation step. Keep in mind that at this point the size of the
pellet will affect the cellularity of the spheroid. If you end up
with spheroid tissue sections in which cells are sparse, you need
to increase the number of culture plates in order to obtain a
larger pellet.
3. Carefully remove the supernatant after the centrifugation,
being careful not to disrupt the cell pellet.
4. Resuspend the cell pellet in 20–25 mL cold 1 PBS and
centrifuge at 300  g for 10 min at RT.
5. Remove the supernatant, then carefully add 20–25 mL of the
10% neutral buffered formalin (NBF). Pour the NBF down the
tube’s inner wall to avoid disrupting the cell pellet which will
constitute the spheroid.
6. To produce the fixed spheroid, fix the cell pellet by incubating
in NBF overnight at 4  C.
7. After overnight fixation carefully remove the NBF (see Note 4).
8. Resuspend the spheroid in 10–15 mL cold 1 PBS and centri-
fuge at 300  g for 10 min at RT. Repeat this step for a total of
three 1 cold PBS washes.

3.2 Preparation 1. Carefully transfer the spheroids from 50 mL tube to a piece of

of Spheroid Paraffin filter paper. You can use a spatula or a pipette, as long as you do
Blocks not break the spheroid. Allow the spheroids to air-dry on the
filter paper. During this step the filter paper will remove the
excess moisture from the spheroid. If there are any remnants of
cells in the tube you can wash the tube with cold 1 PBS using
a pipette and deposit the wash in the filter paper.
2. Collect spheroids from the filter paper by gently scraping the
paper with a flat spatula. Be careful not to break the filter paper
to avoid losing sample, or to scrape too hard that pieces of the
filter paper could detach together with the spheroid.
3. Prepare a small envelope or pocket using lens paper (Fig. 1),
prepare one of these for each spheroid. You can also use wax
paper or weighing paper. Carefully transfer the dry spheroid to
the lens paper envelope and place it into a tissue processing
cassette.
4. Dehydrate and clear the spheroids by following the schedule
shown in Table 1. Use glass jars for the washes indicated in the
table. Carefully label each glass jars with each solution. Place
the tissue cassette into the corresponding glass jar for the
indicated time. Proceed to the following paraffin embedding
steps below in this section.
66 Jennifer Cabán-Rivera et al.

Fig. 1 Paraffin embedding of the cell spheroid. The spheroid cell pellet is placed inside an envelope made of
lens paper (the envelope can be appreciated inside the paraffin in the mold in the left panel), which in turn is
submerged in the molten paraffin in the metal mold. After a few minutes at room temperature the paraffin
solidifies in the mold. The spheroid can be seen in the paraffin block (arrow in the right panel)

Table 1
Steps for the dehydration and clearing of cell 3D spheroids formed from cell pellets. All these steps
are performed at room temperature

Procedure Steps Solution Time

Dehydration 1 70% alcohol 15
2 80% alcohol 15
3 95% alcohol 15
4 100% alcohol 15
Clearing 1 Xylene 10
2 Xylene 10
3 Xylene 10
4 Xylene 10

5. Heat the HistoCore Paraffin Embedding station. To determine

the appropriate temperature, look for the melting temperature
recommended for the specific paraffin or embedding medium
of your choice, as indicated in the product instructions. Melt
the paraffin or embedding medium and add to a heated metal
mold, ensuring to cover the entire bottom of the mold. Place
and keep the mold in the hot surface.
6. Using tweezers, carefully remove the spheroid from the cas-
sette (leave it in the paper envelope) and place it in the molten
paraffin within the metal mold. Allow it to cool down.
7. Once the paraffin solidifies (Fig. 1, left panel), remove the
block from the metal mold and cut around the spheroid using
a scalpel, in such way that you obtain a piece of paraffin contain-
ing inside the embedded cell spheroid.
8. Using the trimmed embedded spheroid, repeat step 6 (immer-
sion in molten paraffin) and let the paraffin to slightly cool
down, but not to become entirely solid (Fig. 1. center and
right panels).
 3D Spheroids for Immunohistochemistry Optimization 67

Fig. 2 Final embedding set-up of the cell spheroid to obtain the paraffin block that will be subsequently cut.
The block is put again in molten paraffin (left), and before the paraffin solidifies the O-ring or an embedding
cassette without the lid is placed (center), and the whole set-up is allowed to solidify to create the final block
that will be cut in the microtome (right)

9. Before the paraffin entirely solidifies, place a tissue embedding

cassette without the lid (or use an O-ring) over the metal mold
and fill with molten paraffin. This will create a paraffin block in
which the cassette encases and holds the embedded spheroid
together. This set-up is illustrated in Fig. 2.
10. Allow the paraffin block to solidify by placing it in the cold
plate for 1–2 min.
11. Leave the block to continue solidification at room temperature
overnight (see Note 5).

3.3 Microtome 1. Carefully remove the spheroid block from the metal mold.
Sectioning of Spheroid Keep the paraffin-embedded spheroid block on ice at all times
Paraffin Blocks before sectioning (see Note 6).
2. Using a microtome, cut the spheroid blocks to get ribbon
spheroid sections (Fig. 3). The sections should have a thickness
of 5 μm (see Note 7).
3. Mount the spheroid sections on glass slides.

3.4 Hematoxylin The spheroid sections generated in Subheading 3.3 will be used for
and Eosin (H&E) immunohistochemistry (IHC) staining as described in Subheading
Staining 3.5 below. However, before proceeding with the IHC some of the
sections must first be stained with Hematoxylin & Eosin (H&E).
The purpose of the H&E staining is to allow you to observe under
the microscope if the spheroid sections have the appropriate cellular
density and architecture to resemble a tumor tissue section. Do not
proceed to the IHC staining steps described in Subheading 3.5
until you have achieved spheroid sections with sufficient cellularity.
1. Place slides in a slide rack and incubate at 37  C overnight in an
oven or incubator.
2. Next day, and right before staining, incubate the slides at 64  C
for 1 h.
68 Jennifer Cabán-Rivera et al.

Fig. 3 The final block shown in Fig. 2 is cut into paraffin ribbons 5 μm thick

3. Inside a fume hood, submerge the slide rack in xylene substi-

tute for 2 min. Do two additional xylene substitute submer-
sions, also 2 min each, for a total of 3. Use fresh xylene for each
submersion. This and the remaining steps in this section must
be performed inside the fume hood.
4. Hydrate the slides by submerging the slide rack into the jars
that contain a series of ethanol solutions as follows: two con-
secutive washes in 100% alcohol, 1 min each; one 95% ethanol,
1 min; and a final rinse in tap water for 30 s. Do this rinse
carefully to avoid the spheroid sections to detach from the
slide.
5. Submerge the slide rack in the jar that contains hematoxylin for
2–4 min.
6. Rinse the slides with tap water for 30 s. Do this rinse carefully
to avoid the spheroid sections to detach from the slide.
7. Submerge the slide rack into a jar containing 1% acid alcohol
for 15–20 s.
8. Rinse slides with tap water for 30 s. Do this rinse carefully to
avoid the spheroid sections to detach from the slide.
9. Submerge the slide rack in a jar containing Bluing reagent for
30 s.
10. Carefully rinse the slides with tap water for 30 s, always avoid-
ing direct contact with the tissue section.
11. Dehydrate the spheroid sections by submerging the slide rack
into jars with ethanol washes as follows: 70% alcohol for 1 min,
then 95% alcohol for 1 min.
12. Submerge the slide rack into a jar that contains the Eosin
solution for 2 min.
13. Submerge the slide rack into a jar with 95% alcohol for 10 s,
followed by a 100% alcohol wash for 1 min.
 3D Spheroids for Immunohistochemistry Optimization 69

Fig. 4 H&E staining of a spheroid slide prepared from H520 cells, observed under
light microscope at magnification of 100. The figure shows the preservation of
cellular structure with intact nuclei and cell membranes, and a monolayer that
resembles a tissue-like organization

14. Submerge the slide rack into a jar containing xylene substitute
for 2 min. Repeat this step a second time.
15. Drain the xylene from the slides and allow the slides to dry
inside the hood.
16. Add 2–3 drops of mounting media on top of each spheroid
section and carefully place a cover glass on top of the section,
avoiding the formation of air bubbles (see Note 8).
17. Analyze the slides under a light microscope. Capture images at
various magnifications. Figure 4 illustrates a spheroid section
with good cellular density. The cellular density should be as
similar as possible to the cellularity of a tumor tissue and should
have similar architecture in terms of cell-to-cell contacts.

3.5 Immuno- Once the H&E staining has allowed you to determine that the
histochemistry (IHC) spheroid sections are of sufficient cellularity, you can proceed to
of Spheroid Sections stain with IHC some of the slides generated in Subheading 3.3.
1. Place the slides in a slide rack and incubate at 37  C overnight.
Omit this step if you have performed this previously as
described in step 1 of Subheading 3.4.
2. Incubate slides at 64  C for 1 h. Omit this step if you have
performed this previously as described in step 2 of Subheading
3.4.
3. Remove the paraffin from the spheroid sections by submerging
slides in a slide rack in xylene for 5 min. Remember that this
step involving xylene and all volatile solvents should be per-
formed inside the fume hood.
70 Jennifer Cabán-Rivera et al.

4. Hydrate slides by performing the following ethanol washes:

100% alcohol for 3 min, 95% ethanol for 3 min, and 70%
ethanol for 2 min.
5. Perform a 1-h antigen retrieval step with the antigen retrieval
citrate buffer heated to 80–85  C. The slides should be
completely submerged in the buffer, and the jar should in
turn be tightly covered and submerged into a water bath set
at 80–85  C (see Note 9).
6. Remove the whole jar from the water bath and allow it to cool
down to room temperature for 20–30 min (see Note 10).
7. Transfer the slides to 1 PBS, incubate for 10 min.
8. Place slides flat in the humid chamber. From this point for-
ward, prevent the slides form drying out. In the subsequent
steps, ensure that the tissue sections are completely soaked in
indicated solutions.
9. Cover the spheroid sections in the slides with a layer of 3%
hydrogen peroxide block to inactivate endogenous peroxide
activity. Incubate for 30 min at room temperature.
10. Rinse sections with 1 PBS for 10 min.
11. Carefully dry the slides with a lint-free absorbent paper. Dry
only in the areas surrounding the spheroid sections, do not
touch directly the sections with the absorbent paper.
12. After drying the areas surrounding the sections, use the PAP
pen or any hydrophobic pen to make a hydrophobic barrier
surrounding the sections. Again, be careful not to damage the
spheroid sections.
13. Apply the primary antibody solution by adding a drop suffi-
ciently large cover the entire area of the spheroid section. At
this step the slides should be in the humid chamber.
14. Incubate with the primary antibody overnight or between
12 and 18 h at 4–8  C. Remember to perform negative control
sections in which the primary antibody is omitted. The nega-
tive control sections are incubated in 1 PBS instead of the
antibody solution.
15. Remove the primary antibody and rinse the slides in 1 PBS
for 5 min. Remove excess PBS with a lint-free absorbent paper.
Remember that sections must never be allowed to get dry.
16. Incubate slides in the secondary antibody solution, ensuring
you cover the whole section area with antibody solution. Incu-
bation should be in the humid chamber at room temperature
for 30 min.
17. Remove the secondary antibody solution and wash the slides in
1 PBS for 5 min. Remove the excess liquid with an absorbent
paper.
 3D Spheroids for Immunohistochemistry Optimization 71

18. Add the streptavidin-HRP mix to each section and incubate in

the humid chamber for 30 min at room temperature.
19. Remove the streptavidin-HRP mix and wash the slides with 1
PBS for 5 min. Remove excess PBS with an absorbent paper.
20. Prepare the DAB solution and add a drop of solution to each
section. Incubate for a maximum of 2 min (see Note 11).
21. Stop the DAB reaction by submerging the slides in two con-
secutive washes with distilled water.
22. Place the slides under running tap water for 5 min, being
careful that the water does not directly touch the sections.
23. Dehydrate the slides with ethanol washes in the following
order: 85%, 90%, 95%, and absolute 100% ethanol for 2 min
each wash.
24. Incubate the slides in xylene for 2 min, inside the fume hood.
25. Drain the xylene from the slides and let them to air-dry inside
the fume hood.
26. Add 3 drops of mounting media on top of each section and
carefully place a cover glass on top of the section, avoiding the
formation of air bubbles inside the sample (see Note 8).
27. Analyze the slides under a light microscope. Take images at
10, 20, 40 up to 100 magnification. A positive p39 staining
signal is appreciated as a brown precipitate (Fig. 5). The locali-
zation of the staining (nuclear, cytoplasmic, membrane, etc.)
depends on the cellular localization of the antigen you are
studying.

Fig. 5 Spheroid section from H520 cells immunohistochemically stained using an anti-p39 antibody. (a)
Negative control section in which the primary antibody was omitted. (b) Primary antibody at a 1:50 dilution and
at 40 magnification. (c) Primary antibody at a 1:50 dilution and at 100 magnification. Staining is observed
as a strong brown signal (b and c), which is absent from the negative control (a)
72 Jennifer Cabán-Rivera et al.

4 Notes

1. The appropriate dilution or concentration should be empiri-

cally determined for each antibody. We recommend that you
start using the dilution or concentration recommended by the
manufacturer, and depending on the results, you can use the
antibody more concentrated if the staining is too weak, or more
diluted, if background staining is too strong. When using anti-
bodies against phosphorylated proteins, it is recommended
that you use freshly cut tissue sections.
2. Many immunohistochemistry kits are commercially available.
You have to ensure that the secondary antibody that is included
with the kit matches the primary antibody that you are using
(e.g., a goat anti-rabbit secondary antibody if you are using a
rabbit polyclonal primary antibody, or a goat anti-mouse when
using a mouse monoclonal primary antibody).
3. The DAB reagent and solution are photosensitive, prepare the
solution in amber colored tubes or bottles, or wrap the tube
with aluminum foil to avoid its exposure to light. Solution
should be prepared right before using it and used fresh for
the procedure to work optimally. Using a DAB solution that
has been stored for days or weeks can result in poor staining
intensity. When troubleshooting for weak staining signal, pre-
paring a fresh DAB solution may be a good place to start.
4. Make sure you carefully remove the NBF, preferably by decant-
ing or by slowly suctioning with a pipette. Try not to disrupt
the spheroid. If the spheroid breaks apart during the removal of
the NBF, spin again at 300  g for 10 min at RT.
5. If the block is placed at 20  C for storage or to speed up
solidification, cracks might form in the paraffin. This could
complicate the sectioning process. Therefore, complete solidi-
fication is best conducted at room temperature overnight.
6. Try not to cover the blocks with the ice. Instead, place them
with the paraffin facing down just over the ice. This will keep
the surface cool and humid.
7. If the sections are to be placed in a water bath, make sure the
temperature is not too high. If the water bath is too hot, the
cell spheroid could detach from the paraffin resulting in loss of
the sample. We used a room temperature water bath.
8. Gently slide the tip of a pencil into the cover glass to remove
any air bubbles that might have formed over the sample
section.
9. Citrate buffer should be pre-heated in a water bath
(or microwave). Pre-heat the buffer before initiating the anti-
gen retrieval step, do not submerge the slides in the buffer until
it has reached the desired temperature.
 3D Spheroids for Immunohistochemistry Optimization 73

10. At this point the jar can be slightly opened to allow the vapors
to be released and ensure the buffer is cooled down to room
temperature. Do this step inside a fume hood.
11. When we use the anti-p39 primary antibody diluted to 1:50,
we noticed that the optimal DAB incubation time is around
1 min. You must determine the optimal DAB incubation time
for your cell lines and antibody of choice but bear in mind that
prolonged reaction times can lead to high background.

Acknowledgments

Work in our laboratory is supported by the U54 Moffitt Cancer

Center-Ponce Health Sciences University Partnership NIH-NCI
(#2U54CA163071-06), the NIMHD- NIAID funded Puerto
Rico Clinical & Translational Research Consortium
(#U54MD007587), the Molecular Genomics (MAGIC) Core
(MBCL-RCMI Grant RR003050 MD007579) and its staff, the
PHSU RCMI Program (Award Number #5G12MD007579-33
from The National Institute on Minority Health and Health Dis-
parities), the PHSU-Moffitt Cancer Center Summer Research Pro-
gram 2U54CA163071.07, and the PHSU RISE program under
NIH Grant 2R25GM096955. Jennifer Cabán-Rivera, Camille
Chardón-Colón, Alberto Pedraza-Torres, and Yoan E. Rodrı́guez
all contributed equally to the protocol optimization.

References

1. Chen Y, Cui T, Yang L et al (2011) The diag- Rb S249 together with CDK5R2/p39 overex-
nostic value of cytokeratin 5/6, 14, 17, and pression are associated with impaired cell adhe-
18 expression in human non-small cell lung can- sion and epithelial-to-mesenchymal transition:
cer. Oncology 80(5–6):333–340 implications as a potential lung cancer grading
2. Rekhtman N, Ang DC, Sima CS et al (2011) and staging biomarker. PLoS One 13(11):
Immunohistochemical algorithm for differentia- e0207483. https://doi.org/10.1371/journal.
tion of lung adenocarcinoma and squamous cell pone.0207483
carcinoma based on large series of whole-tissue 5. Mathew EP, Nair V (2017) Role of cell block in
sections with validation in small specimens. Mod cytopathologic evaluation of image-guided fine
Pathol 24(10):1348–1359 needle aspiration cytology. J Cytol 34
3. Righi L, Vavalà T, Rapa I et al (2014) Impact of (3):133–138
non–small-cell lung cancer-not otherwise speci- 6. Poojan S, Han-Seong K, Ji-Woon Y et al (2018)
fied immunophenotyping on treatment out- Determination of protein expression level in
come. J Thorac Oncol 9(10):1540–1546 cultured cells by immunocytochemistry on
4. Pérez-Morales J, Mejı́as-Morales D, Rivera- paraffin-embedded cell blocks. J Vis Exp 135:
Rivera S et al (2018) Hyper-phosphorylation of E57369. https://doi.org/10.3791/57369
 Chapter 7

Immunoblot Validation of Phospho-Specific Antibodies

Using Lung Cancer Cell Lines
Wilfredo M. Pedreira-Garcı́a, Jaileene Pérez-Morales,
Camille Chardón-Colón, Jennifer Cabán-Rivera,
and Pedro G. Santiago-Cardona

Abstract
The cancer phenotype is usually characterized by deregulated activity of a variety of cellular kinases, with
consequent abnormal hyper-phosphorylation of their target proteins. Therefore, antibodies that allow the
detection of phosphorylated versions of proteins have become important tools both preclinically in
molecular cancer research, and at the clinical level by serving as tools in pathological analyses of tumors.
In order to ensure reliable results, validation of the phospho-specificity of these antibodies is extremely
important, since this ensures that they are indeed able to discriminate between the phosphorylated and
unphosphorylated versions of the protein of interest, specifically recognizing the phosphorylated variant. A
recommended validation approach consists in dephosphorylating the target protein and assessing if such
dephosphorylation abrogates antigen immunoreactivity when using the phospho-specific antibody. In this
chapter, we describe a protocol to validate the specificity of a phospho-specific antibody that recognizes a
phosphorylated variant of the Retinoblastoma (Rb) protein in lung cancer cell lines. The protocol consists
in the dephosphorylation of the Rb-containing protein lysates by treating them with bovine intestinal
phosphatase, followed by assessment of the dephosphorylation by immunoblot.

Key words Retinoblastoma protein, Phospho-protein, Immunoblot, Lung cancer, Cell lines, Phos-
phorylation, Bovine intestinal phosphatase

1 Introduction

The cancer phenotype is usually characterized by overactivation of

signal transduction pathways that include components with kinase
activity. As a consequence of the overactivation of such pathways,
abnormally high levels of phosphorylation of several intracellular
proteins occurs, and this hyper-phosphorylation usually has a dis-
ruptive effect on the normal regulation of protein function, which
is in turn conducive to the cancer state. For example, the MAPK
pathway can be abnormally overactive in cancer cells, an overactiva-
tion that can arise as a consequence of several mutational events,

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_7, © Springer Science+Business Media, LLC, part of Springer Nature 2021

75
76 Wilfredo M. Pedreira-Garcı́a et al.

such as amplification or activation of receptor tyrosine kinases or

gain-of-function mutations in the Ras protein [1–3]. Overactivation
of the MAPK pathway in the context of cancer or of rapidly diving
cells, results in phosphorylation and activation of MAPK interme-
diaries such as Erk as part of an aberrant cancer-associated signaling
that leads to uncontrolled cell proliferation [4]. As another exam-
ple, the retinoblastoma (Rb) protein, one of the most important
cellular tumor suppressors, is inactivated by hyper-phosphorylation
in rapidly dividing cells, including cancer cells [5–8]. These, and
many other examples of proteins whose function is regulated by
phosphorylation has created a need to develop phospho-specific
antibodies to specifically detect the phosphorylated variants of
proteins whose function is regulated at the phosphorylation level.
Expectedly, these phospho-specific antibodies have become impor-
tant tools for molecular studies of cancer cells and tissues, especially
when hyper-phosphorylation of key proteins is associated with the
cancer phenotype, as well as in the clinic in the context of patho-
logical assessment of tumors.
Phospho-specific antibodies can be used to detect phosphory-
lated proteins in tissue sections by immunohistochemistry and by
immunoblotting of protein lysates from cancer cell lines and cancer
tissue biopsies. Obtaining reproducible results with these antibo-
dies relies in great measure on their preliminary validation, includ-
ing ensuring that they are indeed able to discriminate between the
phosphorylated and unphosphorylated versions of the protein of
interest, specifically recognizing the phosphorylated variant. Deter-
mining this can be relatively straightforward, and the approach
consists in dephosphorylating the target protein and assessing if
such dephosphorylation abrogates immunoreactivity in either an
immunoblot or in an immunohistochemistry assay, or if it generates
an electrophoretic mobility shift consistent with dephosphorylation
as visualized in an immunoblot.
In this chapter, we describe a protocol to dephosphorylate
protein lysates obtained from lung cancer cell lines by treating
them with a phosphatase enzyme, specifically with bovine intestinal
phosphatase. This is followed by subjecting such dephosphorylated
lysates to immunoblot analyses using a phospho-specific antibody,
in our case against Rb phosphorylated in Serine 249 (S249). We
have recently identified this phosphorylation as a biomarker pre-
dicting poor prognosis in lung cancer [9]. In an immunoblot assay,
successful dephosphorylation should be observed in the form of an
altered electrophoretic mobility of the protein of interest, since
removal of phosphate groups affect a protein’s molecular weight,
or as a complete abrogation of immunoreactivity when using the
phospho-specific antibody in either immunoblots or
immunohistochemistry.
 Validation of Rb Phospho-Specific Antibodies 77

2 Materials

All the solutions were prepared using distilled water, unless other-
wise stated. Reagents and solutions were stored at room tempera-
ture, unless specified. Follow all waste disposal regulations when
disposing waste materials.

2.1 Cell Lysis 1. Cell lines of your choice. The procedure described below
and Protein Extraction requires that the user has cell cultures ready for protein extrac-
and Quantification tion. We optimized the procedure using a variety of lung cancer
cell lines to detect total and phosphorylated Rb in them, but
this protocol is adaptable to any cell line that expresses the
phospho-protein of interest. It is important that you grow
your cell cultures in the appropriate medium such that they
are at approximately 90–95% confluence at the moment of
protein extraction.
2. 1
Phosphate-Buffered Saline (PBS), pH 7.2. To prepare,
dissolve 8.0 g of NaCl, 0.2 g of KCl, 1.44 g of Na2HPO4.2
H2O and 0.24 g of KH2PO4, in 800 mL of water. Adjust the
pH to 7.2 with HCl and add distilled water to complete the
volume to 1 L. Premade, ready-to-use PBS can also be
purchased.
3. Trypsin-EDTA solution. This is for detaching cells from cul-
ture plates. We purchase this solution in premixed, ready-to-
use form. Alternatively, cells can also be mechanically detached
using a rubber scraper.
4. RIPA lysis buffer. For convenience, we use a commercially
available premixed 10
RIPA buffer, which is diluted to 1

when using. This solution can also be prepared in the labora-
tory using the standard recipe, which consists of 10 mM Tris–
HCL, pH 8.0, 1 mM EDTA, 0.5 mM EGTA, 1% (v/v) NP-40
(or 1% Triton X-100, if NP-40 is not available), 0.5% (v/v)
sodium deoxycholate, 0.1% (v/v) SDS, and 150 mM NaCl.
5. Broad specificity protease inhibitor cocktail, use according to
manufacturer’s specifications (see Note 1).
6. Protein concentration determination assay reagents. We per-
form a standard protein quantification using Bradford Assay,
following its instructions, and using BSA as a quantification
standard. We use Bio-Rad’s Protein Assay Dye Reagent Con-
centrate, but other substitute assays can be used.

2.2 Alkaline Bovine 1. Alkaline phosphatase from bovine intestinal mucosa (bovine
Intestinal Phosphatase intestinal phosphatase or BIP). We have optimized this proto-
(BIP) Treatment col with the one provided by Sigma-Aldrich (Cat. No. P0114-
of Protein Lysates 10KU), provided at a specific activity of 6694 DEA Units/mg
78 Wilfredo M. Pedreira-Garcı́a et al.

protein, and at a concentration of 123 Units/μL. Other com-

mercially available phosphatases can be used as long as the
manufacturer’s indications are followed.
2. 10
Dephosphorylation Buffer. This is the buffer for the BIP
reaction. To prepare, dissolve 6.07 g of Tris base (50 mM),
5.84 g of NaCl (100 mM), 0.97 g of MgCl2 (10 mM) and
0.16 g of DTT (1 mM) in 800 mL distilled water, stir the
solution until the reagents are dissolved. Adjust the pH to 7.9
and complete to a final volume of 1 L with distilled water.
Numbers in parentheses are the molar concentrations of each
component in the final solution. Use Table 1 as a reference for
the components and their final concentrations in the working
solution.
3. 2
BIP inhibitor cocktail. To prepare, dissolve 0.042 g of
sodium fluoride (NaF), 0.092 g of sodium orthovanadate
(Na3VO4) and 0.013 g of sodium pyrophosphate decahydrate
99% (NaPP) in 4 mL of distilled water in a 15 mL conical tube.
Vortex the contents to ensure complete dissolution of the
components, complete volume with distilled H2O to 5 mL.
Use Table 2 as a reference for the components and their final
concentrations in the working solution. This should be a
2
solution with concentrations of 50 mM Na3VO4, 5 mM

Table 1
Amounts and final working concentrations of each of the reagents used for the preparation of the
10
dephosphorylation buffer

Molecular Amount to Expected final

Reagent weight (g/mol) weight (g) concentration (mmol/L)
Tris 121.14 6.07 50
NaCl 58.44 5.84 100
MgCl2 95.21 0.97 10
DTT 154.25 0.16 1

Table 2
Amounts and final working concentrations of each of the reagents used for the preparation of the 2

phosphatase inhibitors solution

Molecular Amount to Expected final

Reagent weight (g/mol) weight (g) concentration (mmol/L)
Sodium fluoride 42.0 0.042 200
Sodium orthovanadate 265.9 0.092 100
Sodium pyrophosphate 183.9 0.013 10
 Validation of Rb Phospho-Specific Antibodies 79

NaPP, and 100 mM NaF that, when brought down to 1
in

the final reaction mixture should be enough to inhibit the
activity of 100 Units of BIP [10–14].

2.3 SDS 1. 1.5 M Tris–HCl, pH 8.8. Dissolve 181.7 g of Tris base in

Polyacrylamide Gel 800 mL H2O. Adjust pH to 8.8 with concentrated HCl (use
Electrophoresis less concentrated HCL as you approach the desired pH). Add
H2O to complete the volume to 1 L. Store at 4  C.
2. 0.5 M Tris–HCl, pH 6.8. To prepare, dissolve 60.6 g of Tris
base in 800 mL H2O. Adjust pH to 6.8 with concentrated HCl
(use less concentrated HCL as you approach the desired pH).
Add H2O to complete the volume to 1 L. Store at 4  C.
3. 30% acrylamide/Bis-acrylamide solution, can be purchased in
ready-to-use form (see Note 2).
4. Ammonium persulfate (APS) 10% (w/v) in water (see Note 3).
Prepare by dissolving 0.5 g of ammonium persulfate in 5 mL of
H2O.
5. Tetramethylethylenediamine (TEMED).
6. 10% SDS. Dissolve 10 g of SDS in 80 ml H2O. Complete
volume to 100 mL. This solution can be kept at room temper-
ature for up to 6 months.
7. 2
SDS sample loading buffer: 100 mM Tris–HCl pH 6.8, 4%
(w/v) sodium dodecyl sulfate (or SDS, electrophoresis grade),
0.2% bromophenol blue, 20% (v/v) glycerol and 200 mM
dithiothreitol (DTT).
8. 10
SDS-PAGE running buffer. Dissolve 30.0 g of Tris base,
144.0 g of glycine and 10.0 g of SDS in 1 L of H2O. Check that
the pH is 8.3 but is expected that minimal or no pH adjustment
will be required. Store the running buffer at room temperature
and dilute to 1
before use.
9. Ethanol 70% (for cleaning electrophoresis glass plates).
10. Protein ladder molecular weight marker. When blotting for
Rb, we use Bio-Rad Precision Plus Protein Kaleidoscope
(Cat. No. 1610-375). You can use any other protein ladder
provided it has sufficient markers in the molecular weight range
of your protein of interest, in our case, around 110 kDa, which
is the molecular weight of Rb.

2.4 Transfer 1. Nitrocellulose blotting membranes. We use 0.45 μm pore size

for immunoblotting Rb, but a smaller pore size may be recom-
mended should you want to adapt this protocol for low molec-
ular weight proteins. Choose membrane pore size according to
the molecular weight of the protein of interest.
80 Wilfredo M. Pedreira-Garcı́a et al.

2. 1
transfer buffer: Dissolve 3.03 g of Tris base and 14.4 g of

glycine in 500 ml of H2O. Add 200 ml of methanol, and
complete to a final volume of 1 L with H2O.
3. Tris-buffered saline with Tween-20 (TBST): First prepare a
10
TBS stock by dissolving 24.2 g of Tris base and 87.6 g
of NaCl in 800 ml of H2O, adjust to pH 7.6 with 1 M HCL,
and complete to a final volume of 1 L. To prepare the TBST,
add 1 mL of Tween-20 to 1 L of 1
TBS.
4. Ponceau-S membrane staining solution. We recommend that
you use this dye to stain the membrane after transfer to verify
the presence of protein in the membrane. This gives an indica-
tion of how effective the transfer was. Prepare a 0.5% (w/v) of
Ponceau-S in a 1% acetic acid solution. To remove the
Ponceau-S stain from the membrane before blotting, you
need TBST with 5% dry milk.
5. Filter paper.

2.5 Immunoblotting The protocols described in this chapter were optimized specifically
Reagents for the antibodies described below and using lung cancer cell lines.
The protocol can be adaptable to other phospho-specific antibo-
dies, but additional optimization could be required, specifically in
the antibody dilution and incubation times.
1. Blocking solution. Dissolve 0.5 g of bovine serum albumin
(BSA) in 10 mL of 1
TBST.
2. Primary antibody against phosphorylated serine 249 in Rb
(anti-Rb Phospho-Ser249). We purchase this rabbit polyclonal
antibody from Sigma-Aldrich (Cat. No. SAB1305397) and use
it at a dilution of 1:500 in TBST. We usually prepare primary
antibody solutions in TBST that can be stored for several
months at 4  C. To prepare such antibody solutions, first
dissolve 0.5 g of BSA in 10 ml of TBST and add 30 μL of a
20% Sodium azide stock solution. Mix well and add the anti-
body at the indicated dilution (see Note 4).
3. Primary antibody against total Rb (mouse monoclonal 4H1,
Cell Signaling Cat. No. 9309). In order to validate a phosphor-
antibody, you need to blot the protein lysate with both anti-
bodies, one against the phosphorylated form of the protein and
the other against the total protein. We use this antibody at a
dilution of 1:1000 in TBST, and we prepare it exactly as
described above for the antibody against phospho-S249. It is
important to blot for total Rb, as the extent of Rb phosphory-
lation is assessed as the ratio of phosphorylated Rb to total Rb
protein.
4. Secondary antibodies: we use horse-radish peroxidase (HRP)-
conjugated secondary antibodies. For mouse monoclonal pri-
mary antibodies, we use an HRP-conjugated, affinity-purified
 Validation of Rb Phospho-Specific Antibodies 81

horse anti-mouse IgG (Cell Signaling, Cat. No. 7076S). For

rabbit polyclonal primary antibodies, we use an
HRP-conjugated, affinity-purified goat anti-rabbit IgG (Cell
Signaling, Cat. No. 7074S). For both of these secondary anti-
bodies, we prepare a TBST solution of the antibody exactly as
described above for primary antibodies (except that we omit
the sodium azide since we prepare fresh for each use), with the
antibody diluted to 1:5000.
5. Supersignal West Pico Plus™ Chemilumiscent Kit. This kit is
compatible with HRP-conjugated secondary antibodies. The
selection of the kit to develop the chemiluminescent signal is
dictated by the enzyme conjugated to the secondary antibody
(HRP, versus alkaline phosphatase, for example). Other avail-
able kits are acceptable, provided they are compatible with your
choice of antibodies. Use strictly following the kit’s
instructions.
6. ChemiDoc imaging system and software, or other equivalent
imaging system compatible with chemiluminescent signals.

2.6 Additional 1. Tabletop centrifuge with capacity for 15 mL tubes, preferably

Laboratory Equipment refrigerated.
and Plasticware 2. Conical tubes, 15 and 50 mL volumes.
3. Culture plates or bottles, 35 mm or other of your preference.
4. Gel electrophoresis system, including power source. Assemble
and use as per manufacturer’s instructions.
5. Transfer system, including power source. Assemble and use as
per manufacturer’s instructions.
6. 1.5 mL microcentrifuge tubes.
7. Refrigerated centrifuge for microcentrifuge tubes.
8. Ice bucket, ice.
9. Heat plate, with capacity to hold 1.5 mL microcentrifuge
tubes. To be used at 30  C, 70  C, and 95–100  C.
10. Glass or plastic Pasteur pipettes.

3 Methods

3.1 Cell Lysis 1. Ensure that you start with cells cultured at approximately
and Preparation 90–95% confluence. Collect cells by scraping them from the
of Protein Extracts culture plate in 1–2 mL of 1
PBS. We culture cells in 35 mm
culture plates, you should adjust the volume of PBS depending
on your culture plate, but it is important to use the minimum
volume of PBS to cover the entire plate surface with a thin PBS
layer. Alternatively, detach cells from the plate by incubating in
trypsin-EDTA solution at 37  C for 5 min (see Note 5).
82 Wilfredo M. Pedreira-Garcı́a et al.

2. Transfer the cell suspension to a 15 ml tube and pellet cells by

low speed centrifugation (5 min at 300–400
g). If you detach
the cells using the trypsin-EDTA solution, before the centrifu-
gation step you need to dilute it 1:10 with culture medium to
ensure inactivation of trypsin. Remove the supernatant after
the centrifugation.
3. Lyse cells by resuspending the cell pellet in RIPA buffer sup-
plemented with the protease inhibitor cocktail (ensure that the
cocktail does not include phosphatase inhibitors, since these
will inhibit subsequent steps). Use the minimal possible vol-
ume of RIPA buffer to ensure adequate protein concentration
in the lysate. Transfer the cell suspension to a 1.5 mL
microcentrifuge tube.
4. Incubate at 4  C or on ice for 30 min to allow lysis to proceed.
5. Centrifuge tube for 10 min at 1400
g at 4  C. Transfer
supernatant to a fresh microcentrifuge tube.
6. Quantify the protein in your cell lysate using your method of
choice, using a BSA concentration curve to determine protein
concentration in your sample (see Note 6).

3.2 Protein Lysate 1. Once the amount of protein in the lysate has been quantified,
Dephosphorylation proceed to prepare the dephosphorylation reaction in a 1.5 mL
with Alkaline Bovine microcentrifuge tube, following the indications shown in
Intestinal Phosphatase Table 3. Notice that you need to prepare three reactions for
(BIP) each protein lysate you wish to analyze: one reaction with
protein lysate with only the BIP buffer (this acts as a negative
control since the phosphorylation of lysate proteins should
remain unaffected); a second reaction with protein lysate, BIP
buffer and the BIP enzyme; and a third reaction to which you
will add the BIP inhibitor cocktail in addition to the compo-
nents of the second reaction. You can dephosphorylate
between 400–500 μg of total protein with 100 Units of BIP
[10–13]. Given the 123 U/μL activity of the BIP enzyme we
use, we can use 1 μL of enzyme to treat 400–500 μg of total
protein. You can prepare a final reaction volume of 50 μL. It is
recommended that you aim to obtain highly concentrated
protein extracts (at least 50 μg/μL) in order to be able to
perform the reaction in such a small volume.

2. Incubate reaction mixtures for 30 min at 30 C (if using the
Sigma-Aldrich BIP), or as indicated by the manufacturer if
using a BIP from other vendors (see Note 7).
3. Stop the reaction by transferring the reaction mixture to ice.
4. Take an aliquot from each reaction mixture, the volume should
contain 20–30 μg of total dephosphorylated protein. Mix with
an equal volume of 2
SDS-PAGE sample loading buffer. The
remaining reaction mixture can be stored at -20  C.
 Validation of Rb Phospho-Specific Antibodies 83

Table 3
Amounts of the components used in the setup of the BIP dephosphorylation reaction

Amount of Amount of 10
Amount of Amount of

Protein Dephosphorylation Phosphatase 2
Phosphatase
Reaction (400–500 μg) Buffer (123 Units/μL) Inhibitor H2 O
Protein lysate + 10 μL 5 μL – – 35 μL
buffer
Protein lysate + 10 μL 5 μL 1 μL – 34 μL
buffer + BIPa
Protein lysate + 10 μL 5 μL 1 μL 25 μL 9 μL
buffer +
BIPa + BIP
Inh.b
Final reaction volume can be 50 μL. Try to obtain concentrated protein lysates with a protein concentration of at least
50 μg/μL. This will allow you to use a volume of approximately 10 μL in the final 50 μL reaction
a
BIP ¼ Bovine Intestinal Alkaline Phosphatase
b
BIP Inh. ¼ Bovine Intestinal Alkaline Phosphatase Inhibitor

5. Denature proteins by heating the sample at 95–100  C for

5 min, or at 70  C for 30 min. Proceed to the SDS-PAGE
separation of the sample described in the next section.

3.3 SDS 1. Assemble your gel electrophoresis apparatus following manu-

Polyacrylamide Gel facturer’s instructions. At this point you will only need to
Electrophoresis assemble the gel casting system needed to pour the gels. We
and Transfer use a standard Bio-Rad gel electrophoresis apparatus with its
accompanying gel casting system. Be sure to clean thoroughly
all glass plates with 70% ethanol. This will decrease the risk of
forming air bubbles while pouring the gel into the glass plates.
2. Prepare the separating gel as follows: in a 50 mL conical tube,
mix 7.9 mL of distilled H2O, 7 mL of the 30% acrylamide,
bis-acrylamide mix, 5.0 mL of 1.5 M Tris–HCl pH 8.8 and
0.2 mL of 10% SDS. Add then 200 μL of 10% APS and 8 μL of
TEMED. Gently mix avoiding the formation of bubbles. The
gel will start rapidly polymerizing after the addition of APS and
TEMED, therefore these two reagents should be the very last
to be added to the mix, and the gel should be poured immedi-
ately after their addition. Maintaining the mix on ice will retard
the polymerization (see Notes 8 and 9).
3. Allow the gel to completely polymerize for 30–60 min at room
temperature (see Note 10). Be sure to always use freshly
prepared or thawed APS (avoid re-freezing of leftovers, discard
them). Loss of APS activity is manifested in abnormally long
polymerization times.
84 Wilfredo M. Pedreira-Garcı́a et al.

4. Prepare the upper stacking gel as follows: in a 15 mL conical

tube, mix 4.1 mL of distilled H2O, 1.0 mL of 30% acrylamide/
bis-acrylamide mix, 750 μL of 0.5 M Tris–HCl pH 6.8, and
60 μL of 10% SDS. Mix gently avoiding foam and bubbles.
When ready to pour, add 60 μL of 10% APS and 6 μL of
TEMED. Mix and add it to the glass plates (see Note 11).
5. Immediately after pouring the stacking gel, insert comb being
careful not to form any bubbles at the base of the wells. Allow
the stacking gel to polymerize for 30–60 min at room
temperature.
6. Carefully remove the comb and the bottom spacer. We do not
recommend that you remove the comb straight out of the dry
gel. Rather, we recommend that first you assemble the whole
electrophoresis apparatus, including inserting the gel inside it,
fill the liquid reservoir with running buffer, and then remove
the comb. We use a standard protein gel electrophoresis appa-
ratus from Bio-Rad. Dilute the 10
SDS-PAGE running
buffer to 1
with distilled water and fill the assembled appara-
tus with it until you cover the gel. Only then we recommend
that you slowly and carefully remove the comb (see Note 12).
Using a glass or plastic Pasteur pipette, rinse the wells with
running buffer to remove excess acrylamide.
7. After denaturing the protein samples as indicated in Subhead-
ing 3.2, steps 4 and 5, load them into the wells, being careful
not to over flood the wells (if this happens, you risk having a
protein sample over flooding into an adjacent lane). Remember
also to load the protein ladder.
8. Place the lid on the electrophoresis apparatus, connect to a
power supply, and run the gel at 160 V for 60 min (do not
set a limit for Amperes). Monitor the run by following the
bromophenol blue dye (from the sample loading buffer)
front. Stop the run when the dye front reaches about
two-thirds of the length of the frontal glass plate.

3.4 Transfer 1. Disassemble the electrophoresis apparatus and remove the gel
of Proteins assembly. Very gently and carefully separate the glass plates
to Nitrocellulose from the gel inserting a fine spatula in between the glass plates,
Membranes and slowly twisting the spatula until the plates start to separate
from the gel. Use a razor blade to carefully remove the stacking
gel without damaging the separating gel. Rinse the gel with
transfer buffer, keep it submerged in transfer buffer, never let
the gel dry.
2. Cut a piece of nitrocellulose membrane of the approximate size
of the gel (a little bit larger so you can handle it by the edges
without touching the gel) and immerse in cold transfer buffer
for 2–5 min. Always handle the membrane with gloves or with
tweezers. Never touch the membrane with bare hands, this may
 Validation of Rb Phospho-Specific Antibodies 85

leave fingerprints oils on the membrane and this in turn will

prevent even wetting of the membrane. This usually results in
areas in the membrane where transfer of proteins is impaired.
3. Pre-wet several pieces of filter paper (cut in a size similar to the
gel) in cold transfer buffer by submerging one side of the paper
first and then slowly lowering it into the buffer.
4. Assemble the gel electro-transfer cassette following the manu-
facturers´ instructions. Avoid bubbles being trapped between
the gel and the membrane, as protein transfer will not occur
adequately at these sites.
5. Insert the transfer cassette into the electro-transfer unit. It is
usual for electro-transfer units to have a special compartment
for an ice block or any other cooling device. As the transfer
process generates heat and the transfer buffer can get warm
(or even hot), it is recommended that the ice block/cooling
devices are used. The transfer can be done in a cold room, or
the whole transfer apparatus can be inserted in a tray and
surrounded with ice during the transfer process.
6. Transfer for 60 min at 100 V (do not set a limit for Amperes).
7. After the transfer is completed, disassemble the unit. Wash the
membrane in TBST to remove residual SDS and potential gel
fragments.
8. Check the efficiency of transfer by staining the membrane in
Ponceau-S solution for 5 min at room temperature. Record an
image of the Ponceau-stained membrane using a document
scanner or camera. Even transfer (no air bubbles) of equal
amount of proteins per lane should be seen in the Ponceau-
stained membrane. Never allow the membrane to get dry. Keep
it moist during the documentation process by wrapping it in
plastic wrap after soaking in transfer buffer. See Notes 13–15
for transfer troubleshooting tips.

3.5 Immunoblotting, 1. Remove the Ponceau-S staining from the membrane by incu-
Image Development, bating in TBST containing 5% milk. You will notice the milk
and Capture solution turning red. Discard and rinse the membrane with
TBST (no milk). Repeat until no trace of the red Ponceau-S
stain remains in the membrane. At this point you should only
see the rainbow-colored protein markers. Repeat a final rinse
with TBST (see Note 16).
2. Block membranes in TBST with BSA (see Note 16). You can
block for 2 h at room temperature or overnight at 4  C. Use
constant rotation to ensure that the membrane is constantly
bathed by the solution.
3. Incubate membranes with the primary antibody. Like the
blocking step, primary antibody incubation can be done either
2 h at room temperature, or overnight at 4  C. Use constant
motion during this step as well (see Note 17).
86 Wilfredo M. Pedreira-Garcı́a et al.

4. Wash three times in TBST.

5. Incubate with secondary antibody for 1 h at room temperature
while agitating.
6. For development of the membrane chemiluminescence, we use
the Supersignal West Pico Plus™ Chemilumiscent Kit
(Thermo Scientific Cat. No. 34580), following the procedures
exactly as described by the manufacturer. We add 1 mL of
substrate solution per membrane. Do not leave it for more
than 3 min (see Note 18).
7. Capture the chemiluminescent signal using a ChemiDoc imag-
ing system or its equivalent (we use ChemiDoc XRS+), using
the accompanying image software for image capturing and
quantification of signal intensity.

3.6 Interpretation We usually run in parallel immunoblots using the phosphor-specific

of Results antibodies as well as antibodies recognizing total Rb protein. You
need to assess phosphorylation of your protein of interest in partic-
ular residues, relative to the total amount of that specific protein. In
our case, we document protein Rb phosphorylation as the ratio of
phosphorylated Rb to total Rb [9, 14]. When using an antibody
against the total protein, usually phospho-proteins can be appre-
ciated in western blots as a doublet consisting of two bands migrat-
ing close to each other [9, 14]. In that doublet, the upper band
usually corresponds to the phosphorylated form of the protein
(as phosphorylation increases the protein’s molecular weight),
while the lower band corresponds to the unphosphorylated form.
Alternatively, if a doublet is not apparent, the phosphorylated form
may appear as a single band but of higher molecular weight relative
to the unphosphorylated form. You should still be able to see this
doublet (or the higher weight band) in the sample treated with BIP
buffer alone, since this is your negative control reaction. However,
in the sample treated with BIP, the doublet should disappear (only
the lower band should remain), or the higher molecular weight
form should be displaced to a lower molecular weight position in
the gel. When using the antibody that recognizes only the phos-
phorylated form, BIP treatment should eliminate immunoreactivity
of the slower migrating higher molecular weight bands, confirming
that these bands correspond to phosphorylated versions of the
protein. This change is indicative of the removal of the phosphate
groups from the protein, which translates into a faster electropho-
retic mobility. This change should be reversed when the sample is
treated with both the BIP and the phosphatase inhibitor cocktail, so
that the band pattern in this sample is comparable to untreated
samples or to samples treated with BIP buffer alone without
enzyme.
 Validation of Rb Phospho-Specific Antibodies 87

4 Notes

1. Protease inhibitors in the cell lysis buffer, combined with main-

taining the protein lysate on ice at all times, minimize protein
degradation during extraction and handling of the lysate. We
use a broad specificity protease inhibitor cocktail from Sigma-
Aldrich (Cat. No. P8340-5ML). Other alternatives are accept-
able, follow manufacturer’s instructions regarding working
concentration and handling. Be sure that the inhibitor cocktail
does not contain phosphatase inhibitors, as these will inhibit
BIP activity.
2. We use the premixed Bio-Rad acrylamide solution. Store at
4  C. Please be aware that polyacrylamide is toxic. Carefully
read the accompanying Materials Safety Data Sheet for specific
instructions on how to handle and dispose polyacrylamide
solutions.
3. Make small volume aliquots and store at 20  C. Avoid
repeated freezing and thawing cycles. Do not use leftovers for
future experiments, a fresh aliquot should be thawed for each
experiment.
4. Sodium azide is used as a preservative to prevent bacterial
growth in the solution. This is highly recommended if you
plan to reuse the primary antibody solution and store it for
long term use. This solution can be stored and reused for
several months, but you need to be attentive for signs of
bacterial and fungi contamination such as a strong odor or
cloudiness in the solution. In such case, discard and prepare a
fresh solution. Use of contaminated antibody solution usually
yields high background in western blots, meaning that it is time
to replace the solution with a fresh one.
5. Avoid over-trypsinization as it may kill cells. Fresh trypsin
solution should detach cells in under 5 min. If you find that
5 min under trypsin-EDTA are not enough to detach cells from
the plate, it is better to get a fresh trypsin-EDTA batch than
prolonging the trypsinization time. Avoid trypsin when study-
ing membrane proteins.
6. We perform a standard protein quantification assay using Brad-
ford Assay, following its instructions, and using BSA as a quan-
tification standard. Other substitute assays can be used. After
quantification, protein lysates that will not be used immediately
can be stored at 20  C for up to 3 months (protein integrity
cannot be ensured beyond that).
7. This treatment should eliminate immunoreactivity if the anti-
body is indeed recognizing a phosphorylated form of the pro-
tein of interest. This will be observed after western blot
88 Wilfredo M. Pedreira-Garcı́a et al.

evaluation. Remember also run in the SDS-PAGE the controls

treated with phosphatase buffer alone, as well as a control with
phosphatase in the presence of phosphatase inhibitors.
8. It is recommended that you add a thin layer of isopropanol on
top of the separating gel solution immediately after pouring
it. Isopropanol is not miscible in water thus it will form a
distinct layer. Adding isopropanol eliminates any bubbles on
the surface of the separating gel solution and will produce a
smooth surface.
9. For Rb, which has a molecular weight of approximately
110 kDa, we use a 10% polyacrylamide separating gel. The %
of polyacrylamide you will choose depends on the molecular
weight range in which you want to have good resolution. Take
this into consideration if you wish to adapt this protocol to
other phosphor-proteins.
10. After 45 min, you can verify if the gel has polymerized by gently
tilting the casting apparatus sideways. Only the isopropanol
layer should move while the underlying separating gel should
be static if it has polymerized.
11. To save time, you can start preparing the stacking gel while
the separating gel is polymerizing. However, do not add the
TEMED and the APS until immediately before adding the
stacking gel to the casting apparatus. The stacking gel without
APS and TEMED can be kept on ice until pouring. The % of
acrylamide of the stacking gel is usually smaller (4–6%) than
that of the separating gel.
12. If you slowly remove the comb having the gel submerged in
running buffer, you will notice that as you remove the comb
the empty well space is immediately filled with buffer. This will
avoid the collapse of the well that is experienced if you remove
the comb out of the dry gel, as a vacuum is formed inside the
well as the comb is retrieved.
13. Do not exceed the transfer time as this leads to gel shrinkage
and distortion of the membrane. In case of poor transfer
efficiency, opt for making thinner gels, rather that prolonging
transfer time.
14. If there are unstained “white spots” on the membrane seen
after Ponceau-S staining, this may have been caused by air
bubbles trapped between the gel and the membrane. Make
sure to remove all the bubbles when preparing the transfer
cassette. An air bubble does not necessarily ruin an experiment,
it depends on its size and on the molecular weight range in
which it formed. If your protein of interest is not in this range,
you may choose to proceed with the subsequent steps.
 Validation of Rb Phospho-Specific Antibodies 89

15. Ponceau-S staining may also help you to spot degraded pro-
teins, which are appreciated as a diffuse smear in the lower half
on the membrane. In this case, ensure that you are taking all
the precautions necessary to deal with protein degradation,
such as not using protein samples that have been stored for
prolonged times (or repeatedly frozen-thawed), ensuring that
cell lysis was done on ice and the samples were kept cold or
refrigerated all the times, and that you added protease inhibi-
tors to the RIPA buffer.
16. When doing a western blot using antibodies against phos-
phorylated residues, it is important that you thoroughly
remove any traces on milk from the membrane. Casein (milk
protein) is heavily phosphorylated and any traces of milk in the
membrane can lead to high background due to nonspecific
antibody binding. For the same reason, the blocking solution
must not contain milk. The blocking step is usually one of the
steps in which you can make adjustments in case you experience
high background levels.
17. Longer incubation periods are recommended if you are having
trouble obtaining strong signals. However, be aware that lon-
ger incubation times also increase the likelihood of obtaining a
strong background. The length of the incubation time (with
primary antibody) is one of the factors that affect signal
strength. Dilution of antibody also usually affects background
noise. If you are obtaining too much background, in addition
to extending blocking time, you can try diluting the primary
antibody. Conversely, try concentrating the primary antibody if
you obtain weak signals.
18. This step can be performed for 30 s to 3 min. If you are
experiencing weak signals, in addition to using more concen-
trated primary antibody and/or increasing incubation time,
you can try developing the membrane for longer (but do not
exceed 3 min, as this may blacken the membrane). Some anti-
bodies give a very strong signal and in such cases 30 s to 1 min
is sufficient.

Acknowledgments

Our work is supported by the U54 Moffitt Cancer Center-Ponce

Health Sciences University Partnership (NIH-NCI
#2U54CA163071-06), the PHSU-MCC Partnership Pre-doc to
Post-doc Transition program (NIH-NCI #2U54CA163071-06
and 2U54CA163068-06), the NIGMS-RISE Program support
(R25GM082406), the NIMHD- NIAID funded Puerto Rico Clin-
ical & Translational Research Consortium (#U54MD007587), the
Molecular Genomics (MAGIC) Core (MBCL-RCMI Grant
90 Wilfredo M. Pedreira-Garcı́a et al.

RR003050 MD007579) and its staff, the PHSU RCMI Program

(Award Number #5G12MD007579-33 from The National Insti-
tute on Minority Health and Health Disparities), the University of
Puerto Rico at Ponce RISE Program (#R25GM082406), and the
Post Hurricane Marı́a Aid for Researchers Grant Continuity Track
Program.

References

1. Downward J (2003) Targeting RAS signalling adhesion and epithelial-to-mesenchymal tran-

pathways in cancer therapy. Nat Rev Cancer sition: implications as a potential lung cancer
3:11–22 grading and staging biomarker. PLoS One 13
2. Biankin AV, Waddell N, Kassahn KS et al (11):e0207483
(2012) Pancreatic cancer genomes reveal aber- 10. Sigma-Aldrich. Procedures for
rations in axon guidance pathway genes. Dephosphorylation|Sigma-Aldrich. https://
Nature 491:399–405 www.sigmaaldrich.com/life-science/met
3. Hodis E, Watson IR, Kryukov GV et al (2012) abolomics/enzyme-explorer/analytical-
A landscape of driver mutations in melanoma. enzymes/alkaline-phosphatase/dephosphory
Cell 150:251–263 lation.html#protein. Published 2018. Accessed
4. Eblen ST (2018) Extracellular-regulated 11 June 2018
kinases: signaling from Ras to ERK substrates 11. PhosphoSolutions. Protocols – Phosphatase
to control biological outcomes. Adv Cancer Treatments|PhosphoSolutions. https://www.
Res 138:99–142 phosphosolutions.com/protocols-phospha
5. Rubin SM (2013) Deciphering the retinoblas- tase-treatments/#cellproteins. Accessed
toma protein phosphorylation code. Trends 11 June 2018
Biochem Sci 38(1):12–19 12. Brumbaugh K, Johnson W, Liao W-C et al
6. Hatakeyama M, Weinberg RA (1995) The role (2011) Overview of the generation, validation,
of RB in cell cycle control. Prog Cell Cycle Res and application of Phosphosite-specific antibo-
1:9–19 dies. Methods Mol Biol 717:3–43. https://doi.
org/10.1007/978-1-61779-024-9_1
7. Burkhart DL, Sage J (2008) Cellular mechan-
isms of tumour suppression by the retinoblas- 13. Bordeaux J, Welsh A, Agarwal S et al (2010)
toma gene. Nat Rev Cancer 8(9):671–682 Antibody validation. BioTechniques 48
(3):197–209
8. MacDonald JI, Dick FA (2012) Posttransla-
tional modifications of the retinoblastoma 14. Santiago-Cardona PG, Pérez-Morales J, Gon-
tumor suppressor protein as determinants of zález-Flores J (2018) Detection of retinoblas-
function. Genes Cancer 3(11–12):619–633 toma protein phosphorylation by Immunoblot
analysis. Methods Mol Biol 1726:49–64.
9. Pérez-Morales J, Mejı́as-Morales D, Rivera- https://doi.org/10.1007/978-1-4939-7565-
Rivera S et al (2018) Hyper-phosphorylation 5_6
of Rb S249 together with CDK5R2/p39 over-
expression are associated with impaired cell
 Chapter 8

Detection of Non-Small Lung Cell Carcinoma-Associated

Genetic Alterations Using a NanoString Gene Expression
Platform Approach
Johan Staaf, Mats Jönsson, and Anna F. Karlsson

Abstract
In non-small cell lung cancer (NSCLC), mutation detection and fusion gene status are treatment predictive
and, hence, key factors in clinical management. Lately, alternate splicing variants of MET have gained focus
as NSCLC tumors harboring a MET exon 14 skipping event have proven sensitive toward targeted therapy.
Reliable methods for detection of genetic alterations in NSCLC have proven to be of increased importance.
This chapter provides with hands-on experience of the NanoString gene expression platform for detection
of genetic alterations in NSCLC.

Key words NanoString, Gene expression, Fusion gene, Non-small cell lung carcinoma

1 Introduction

Lung cancer accounts for 1.3 million deaths annually with an

incidence rate of 1.6 million per year [1]. The majority of lung
cancer patients are being diagnosed with advanced disease limiting
the curative treatment options (mainly surgery). Lung cancer is
broadly divided into small cell carcinoma (SCLC) and non-small
cell carcinoma (NSCLC). NSCLC accounts for 80-85% of all lung
cancers and is further subdivided into adenocarcinoma (AC), squa-
mous cell carcinoma (SqCC), large cell carcinoma (LCC), and large
cell neuroendocrine carcinoma (LCNEC) which represent the four
main histological subtypes [2]. Histological prediction is made on
the basis of morphology, growth pattern, and cell of origin. Histol-
ogy is an important treatment predictive factor as, e.g., SqCC
tumors have proved less sensitive toward specific cytotoxic agents
like pemetrexed [3, 4]. Histological assessment of tumor material
has traditionally been performed using morphological evaluation of
hematoxylin and eosin (H&E) staining combined with immuno-
histochemical (IHC) analysis of protein markers associated with the

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_8, © Springer Science+Business Media, LLC, part of Springer Nature 2021

91
92 Johan Staaf et al.

histological subtypes [2]. These methods are well established and

relatively cheap but require skilled trained personnel and patholo-
gists. Occasionally, the methods require a lot of material as multiple
stains need to be performed in order to conclusively assess tumor
histology. This is a major issue in a disease such as lung cancer
where the majority of patients are diagnosed on the basis of small
biopsies and cytology specimens obtained from e.g., bronchoscopy.
For patients diagnosed with advanced disease, treatment
options vary depending on histology, stage, tumor localization,
and more recently molecular alterations. In total, about 50% of
NSCLC cases have been associated with activating mutations in
specific proto-oncogenes (typically different tyrosine kinases)
including EGFR , KRAS , MET, BRAF, and HER2, as well as
gene fusions involving ALK, RET, ROS1, and NTRK and FGFR
families. Lately, a splicing variant involving translational skipping of
exon 14 in MET has gained focus as tumors harboring this alter-
ation have proven sensitive toward targeted therapy (i.e., crizoti-
nib) [5]. Activating mutations and rearrangements in these genes
represent highly desirable therapeutic targets due to: (1) the con-
cept of oncogene addiction, i.e., genetic alterations that governs
the oncogenic potential of malignant cells that are crucial for tumor
survival, and (2) that these alterations are mutually exclusive to
other driver events [6–11]. Based on the successful development
of targeted therapy, e.g., tyrosine kinase inhibitors (TKIs), against
activating alterations that prolong the progression free survival of
patients, clinical management of lung cancer today requires meth-
ods for accurately assessing mutation, and gene fusion status for
deciding first line therapy. In a clinical context, for NSCLC man-
agement there are several demands on such methods: (1) quick
turn-around-time, (2) the ability to perform analysis on scarce
amounts of tissue, (3) no technical restrictions on using degraded
DNA or RNA (which often is the case when using archival tumor
tissue such as formalin-fixed paraffin-embedded, FFPE, tissue), and
(4) result reproducibility and stability. For gene fusion detection,
the current standard procedure is still often IHC in combination
with fluorescence in situ hybridization (FISH), which is labor
intensive and highly dependent on skilled personnel for correct
interpretation.
To minimize turnaround time, simultaneous analysis of muta-
tion status and gene fusion status would be preferable. Combined
DNA and RNA methods are available such as the Foundation One
[12] or the MSK-IMPACT [13] assays, but these methods are
often non-accessible in a clinical setting where treatment predictive
molecular tests are performed on local pathology departments.
Although targeted assays for simultaneous mutation detection
and gene fusion status are available through the Illumina (AmpliSeq
Focus Panel) [14] and the Ion Torrent (Oncomine assays through
ThermoFisher Scientific) [15] platforms (two commonly used
 Genetic Alterations Detection using NanoString 93

sequencing platforms in local pathology departments), these com-

bined assays often struggle with low sample processing success rates
for the RNA-based fusion gene detection module. Fusion gene
detection and splice variants such as MET exon 14 skipping events
can be detected using a DNA-based approach but requires deep
sequencing and have proven less sensitive compared with
RNA-based methods [16]. One platform for simultaneous gene
expression profiling, gene fusion detection, and detection of splice
variants applicable to small amounts of FFPE-derived RNA is the
NanoString technology [17]. This multiplexed gene expression
platform has several advantages in a clinical context, as stated here
before, including quick turnaround time, the ability to perform
analysis on small amounts of degraded RNA and high reproducibil-
ity [18]. The NanoString platform is highly flexible regarding
which genes to analyze, as the technique is based on custom
designed probes that span the exon-exon junction of the fusion
gene, a second probe that recognizes the target and a protector
probe that utilizes the toehold exchange technology to create a
thermodynamic balance to prevent off-target hybridization and
ensure signal only when there is a perfect match between probes
and target sequence (Fig. 1a) [19, 20]. NanoString is a
hybridization-based technique where total RNA is hybridized to
the custom designed probes, labeled, and counted. Elevated probe
counts indicate highly expressed genes for which the probe in focus
corresponds to. Specifically designed fusion probes indicate which
specific fusion partner is involved (Fig. 1b). Designing probes so
that they correspond to the 50 and 30 part of oncogenes known to
be involved in fusion events gives the benefit of detecting fusions
with novel partners (for which no fusion specific probe exists).
Counts are used through a 30 /50 imbalance ratio where elevated
30 expression in a specific gene indicates fusion [21] (Fig. 1c). By
this design, the user retrieves fusion gene status as well as gaining
knowledge on gene expression profiles of the genes defined in one
single, multiplexed assay. The flexibility of the platform also allows a
user to combine different analysis modules. For instance, we have
shown using the nCounter Elements chemistry that an assay can be
created that provides both fusion gene status of therapeutically
targetable genes and histological subtype prediction in a single
experiment [22]. This chapter provides hands-on experience and
pointers on detection of NSCLC associated genetic alterations such
as fusion genes, splice variants, and gene expression profiling using
the NanoString technology, including wet-lab protocols and data
analysis.
94 Johan Staaf et al.

Fig. 1 NanoString probe design and example of fusion gene detection of the ALK gene. (a, b) NanoString
probes are designed to span the exons of the ALK gene as well as to target specific fusions. Both cartoons in
(c) represent the same results visualized in two different manners. The exon spanning probes are visualized in
a 30 /50 fashion. Hence, calculating the ratio between the counts representing the 30 spanning probes and the 50
spanning probes of the ALK gene indicates fusion events involving ALK. The left pane visualizes the calculated
ratio of the 30 and 50 probes of the ALK gene on the x-axis and fusion specific probe counts on the y-axis.
Fusion negative samples appear in the lower left quadrant while fusion specific samples appear in the upper
right quadrant. A fusion event involving the ALK gene with a novel partner would appear in the lower right
quadrant. The right pane illustrates probe counts representing the 30 and 50 exons as well as fusion specific
probes. Elevated bars representing the 30 probes and low bars representing the 50 of the ALK gene indicate
fusion of the ALK gene. Elevated bar corresponding a fusion specific probe reveals that the specific fusion is
EML4-ALK. ((a) is re-printed from [21] with permission from Elsevier through Copyright Clearance Center. (b)
is re-printed from [17] with permission from NanoString Technologies)

2 Materials

RNA and DNA from FFPE tissue can be extracted in many differ-
ent ways and there are multiple vendors on the market that offer
extraction kits. The extraction guidelines below have proven suit-
able for small amounts of fixated tumor material. Revising the
protocol may be of importance (see Note 1). Extracted RNA should
be stored at 80 ˚C and extracted DNA should be stored at 20 ˚C
until further use in downstream applications.

2.1 Tumor Cell Previous to the procedure, you need to have the following prepared
Content Assessment beforehand.
1. You need to already have performed an H&E stain of the block of
interest and to have assessed tumor cell rich areas (see Note 2).
2. You also need to have sectioned the tissue (see Note 3) and have
the tissue sections stored in RNase/DNase-free safe-lock
1.5 mL tubes.
 Genetic Alterations Detection using NanoString 95

2.2 DNA/RNA 1. We use the AllPrep DNA/RNA FFPE kit (QIAGEN, Hilden,
Extraction Germany). After evaluation of multiple methods and kits, we
selected the AllPrep DNA/RNA FFPE Kit for this procedure.

2.3 NanoString 1. nCounter Elements TagSet 72-plex (NanoString Technolo-

Fusion Gene Detection gies, Inc., Seattle, WA, USA).
2. Custom designed probes synthesized by IDT (Integrated DNA
Technologies, Coralville, IA, USA) and provided through
NanoString (see Note 4).
3. NanoString SPRINT instrument (NanoString Technologies).
4. TE-Tween® buffer. We buy a premixed, ready-to-use 10 mM
Tris–HCl, pH 8.0, 1 mM EDTA (or 10 mM Tris–EDTA
pH 8.8 solution), and to this we add Tween® 20 to a final
concentration of 0.1%.
5. Thermal cycler with possibility to adjust the lid temperature.
6. Cell line pool or any other RNA reference material of choice.
7. Download and install R from https://cran.r-project.org/.
8. Install nSolver Analysis Software provided by NanoString.
Installation packages are available through the NanoString
website. (http://www.nanostring.com/products/nSolver
requires registration).

2.4 NanoString Gene 1. nCounter XT CodeSet Gene Expression Assays (NanoString

Expression Technologies, Inc., Seattle, WA, USA).
2. Custom designed probes synthesized by IDT (Integrated DNA
Technologies, Coralville, IA, USA) and provided through
NanoString (see Note 4).
3. NanoString SPRINT instrument (NanoString Technologies).
4. Thermal cycler with possibility to adjust the lid temperature.
5. Cell line pool or any other RNA reference material of choice.
6. Download and install R from https://cran.r-project.org/.
7. Install nSolver Analysis Software provided by NanoString.
Installation packages are available through the NanoString
website. (http://www.nanostring.com/products/nSolver
requires registration).

2.5 General 1. Micro-pipettes of different volumes, tips.

Laboratory Equipment, 2. Benchtop microcentrifuge.
Supplies and Reagents
3. Ice bucket with ice.
4. Thermal cycle strip tubes.
5. DNase/RNase free H2O.
96 Johan Staaf et al.

3 Methods

Fusion gene detection requires the use of the NanoString nCoun-

ter Elements chemistry. By using the Elements chemistry, fusion
gene status in combination with gene expression status of many
different genes can be retrieved simultaneously. This allows creation
of a single assay that can assess both gene fusions and expression of
genes associated with NSCLC histological subtypes [22]. The
nCounter XT chemistry is suitable for mRNA gene expression
profiling only.

3.1 RNA/DNA After evaluation of multiple methods and kits the AllPrep
Extraction DNA/RNA FFPE Kit was selected, and we have optimized this
procedure using DNA/RNA extracted with this kit. We recom-
mend that you strictly follow the kits instructions for the extraction
step. Using this protocol, you will retrieve DNA as well as RNA
from the same FFPE sections (see Note 1) (Fig. 2).

3.2 Fusion Gene This section describes sample hybridization and further processing
Detection Using on the NanoString instruments (see Note 5). Although this section
the NanoString is a step-by-step process of the NanoString hybridization process
Technology and data generation, it is highly recommended to always follow the
manufacturer’s instructions primarily by using the supplied proto-
col by NanoString when purchasing the NanoString products. It is
recommended to process 11 RNA samples and one reference RNA
in a single experiment. The recommended RNA input varies from
100 ng to 500 ng. In our experience, 500 ng RNA input is to be
preferred (see Note 6). We strongly recommend that you include an
RNA reference (see Note 7).

3.2.1 Hybridization Using 1. Program a thermal cycler to 24 h at 67  C followed by a 4  C

the nCounter Elements indefinite step. The lid temperature should be set to 72  C. The
Chemistry (Combined Gene decrease from 67  C to 4  C should be performed ramping
Expression and Fusion down 1  C per second to increase hybridization efficiency.
Gene Detection) 2. Remove aliquots of TagSet, Probe A, Probe B, and Protector
Probe from the freezer and thaw at room temperature. Invert
several times to mix well and spin down reagents.
3. Start the thermal cycler and pause the program in order to keep
the thermal cycler at 67  C.
4. Using strip tubes, dilute your reference RNA (100 ng) and
sample RNA (500 ng) in 3μL DNase/RNase free H2O. Keep
on ice.
5. Always create separate 30 working pools for Probe As, Probe
Bs, and Protector Probes.
 Genetic Alterations Detection using NanoString 97

Fig. 2 DNA and RNA extraction. Workflow of routine sample processing for nucleic acid extraction using the
Qiagen AllPrep DNA/RNA FFPE kit

6. Make sure you have ready the TE-Tween® buffer, prepare it as

described in Subheading 2.3. Due to the low concentration of
the final probe pools, NanoString suggests using the TE-Tw-
een® buffer when preparing probe pool dilutions.
7. Mix 4μL Probe A with 29μL of the TE-Tween® buffer. Mix
well and quick spin to bring contents to the bottom of the
tube. The final concentration of each Probe A in the working
pool will be 0.6 nM. The final concentration of each Probe A in
the 30μL hybridization assay will be 20 pM.
8. Mix 4μL Probe B with 29 of the TE-Tween® buffer. Mix well
and spin to bring contents to the bottom of the tube. The final
concentration of each Probe B in the working pool will be
3 nM. The final concentration of each Probe B in the 30μL
hybridization assay will be 100 pM.
98 Johan Staaf et al.

9. Mix 4μL Protector Probe with 29μL of the TE-Tween® buffer.

Mix well and spin to bring contents to the bottom of the tube.
The final concentration of each protector probe in the working
pool will be 1.2 nM. The final concentration of each protector
probe in the 30μL hybridization assay will be 40 pM.
10. Add 70μL of hybridization buffer to the TagSet tube.
11. Add 7μL each of the 30 Working Probe A Pool and 30
Working Protector Probe Pool. Mix well by flicking the tube
and briefly spin down.
12. Add 7μL of the 30 Working Probe B Pool to complete the
master mix. Mix well by flicking the tube and briefly spin down
again.
13. Keep the master mix on ice.
14. On ice, add 12μL of master mix to each of the 12 tubes con-
taining the 3μL of RNA prepared in step 4 using a fresh pipette
tip for each tube. Slowly pipette the master mix to avoid
mechanically disrupting the TagSets.
15. Mix the reagents by inverting the strip tubes several times.
Briefly spin down the hybridization reactions.
16. Transfer the strip tube containing RNA and master mix to the
preheated thermal cycler to initiate hybridization.
17. Proceed to Subheading 3.2.3.

3.2.2 Hybridization Using 1. Program a thermal cycler to 24 h at 65  C followed by a 4  C

the nCounter XT Chemistry indefinite step. Lid temperature should be set to 70  C. The
(Gene Expression Only) decrease from 65  C to 4  C should be performed ramping
down 1  C/s to increase hybridization efficiency.
2. Remove aliquots of both Reporter CodeSet and Capture Pro-
beSet reagent from the freezer and thaw at room temperature.
Invert several times to mix well and spin down reagent (see
Note 8).
3. Start the thermal cycler and pause the program in order to keep
the thermal cycler at 65  C.
4. Using strip tubes, dilute your reference RNA (100 ng) and
sample RNA (500 ng) in 5μL DNase/RNase free H2O. Keep
on ice.
5. Create a master mix by adding 70μL of hybridization buffer to
the tube containing the Reporter CodeSet. Do not remove the
Reporter CodeSet from this tube. Do not add the Capture
ProbeSet to the master mix. Invert repeatedly to mix and spin
down master mix.
6. Add 8μL of master mix to each of the 5μL pre-aliquoted RNA
samples from step 4. Use a fresh tip for each pipetting step to
accurately measure the correct volume.
 Genetic Alterations Detection using NanoString 99

7. Invert the Capture ProbeSet tube to mix and spin down the
contents. Add 2μL of Capture ProbeSet to each tube immedi-
ately before placing at 65  C. Cap tubes and mix the reagents
by inverting the tubes several times and flicking with a finger to
ensure complete mixing. Briefly spin down and immediately
place the tubes in the preheated 65  C thermal cycler (see
Note 9).
8. Incubate reactions for 16 h (minimum) to 24 h. Maximum
hybridization time should not exceed 48 h. Ramp reactions
down to 4  C and process the following day. Do not leave the
reactions at 4  C for more than 24 h or increased background
may result (see Note 10).
9. Proceed to Subheading 3.2.3.

3.2.3 Operating 1. Make sure to have the run prepared with sample names and
the NanoString SPRINT correct RLF file.
Instrument 2. Bring out the cartridge for at least 30 min in room
temperature.
3. Remove the strip from the thermal cycler and keep on ice or ice
cooler until ready to load the samples on to the cartridge.
4. Spin down carefully the strip and add extra H2O, from 15μL to
30μL. Normally there is a volume loss during the hybridization
process. Adding 17μL of H2O to each sample is normally
sufficient but this can vary.
5. Transfer the samples with a pipette starting with sample nr:1 in
well 1 on the cartridge.
6. Seal the wells/ports with provided transparent sealer.
7. Remove green seal.
8. Initiate run.
9. After the run is finished, remove the used cartridge, and pro-
ceed to Subheading 3.2.4.

3.2.4 NanoString Data The development of the analysis tools described below has been
Processing done based on a published method [21] and is applicable to data
produced using the nCounter Elements chemistry as well as the
nCounter XT chemistry (see Notes 11 and 12).
1. Output data files from the NanoString instrument (RCC files)
and load them into the nSolver Analysis software (see Notes 12
and 13).
2. Load the exported csv file from the nSolver Analysis Software
to R using the command: data<-read.csv2("My NanoString
nSolver Analysis file.csv",header¼F,as.is¼T).
100 Johan Staaf et al.

A) 100 B)
Negative control probes 12

mean Bg Counts
80
10
8
Counts

60
6
40 4
2
20 0

Reference
0
Samples 1-11

NEG A NEG B NEG C NEG D NEG E NEG F

70000

60000

Positive control probes

Counts

50000
1.0

S/Si scale factor

40000
0.8
30000
0.6
20000
0.4
10000
0.2
0 0.0

Reference
POS A POS B POS C POS D POS E POS F Samples 1-11

Log10 counts across samples for

4.5 positive controls

4.0
log10(counts)

3.5 5

H/Hi scale factor

4
3.0 3
2
2.5 1
0

Reference
2.0
Samples 1-11
1.5
POS A POS B POS C POS D POS E POS F
Positive controls

Fig. 3 Quality control of NanoString data. (a) NanoString includes several internal controls for technical
variations, both within a run and between runs. There are several negative and positive control spike-ins that
should be revised. Negative controls should generate low counts. Positive controls are provided in six different
concentrations and should generate counts in a declining, linear scale where POS A accounts for the highest
concentration and POS F represents the lowest concentration, here visualized in raw counts as well as log10
transformed values. (b) Background signal should be low to reduce true signal noise. Scaling factors are
generated in the normalization process. S/Si values are generated when scaling the sample counts to the
spike-in positive controls provided by NanoString while H/Hi scale factors are produced by scaling individual
samples to counts from housekeeping probes available in the probe set and can be designed by the user. H/Hi
scale factor is in particular a good indicator for good vs. bad sample quality as these counts are more
dependent on sample performance than strict technical performance as S/Si scale factor would indicate

3. Perform data quality control before further data processing (see

Note 14) (Fig. 3) as described in the commands below. The
first five columns are technical information used in the quality
assessment (here referred to as fData. Define fData by: fData-
<-data[,1:5].

fData<-apply(fData,c(1,2),as.character)
data<-as.matrix(data[,-c(1:5)])
rownames(data)<-fData[,1]
data<-apply(data,c(1,2),as.numeric)
ll<-which(fData[,1]=="")
if(length(ll)>0){ fData<-fData[-ll,]
data<-data[-ll,]}
 Genetic Alterations Detection using NanoString 101

4. Perform background calculation: inds<-grep("NEG_",fData

[,1]).

x<-data[inds,]
bg.mean<-apply(x,2,mean,na.rm=T)
bg.sd<-apply(x,2,sd,na.rm=T)
B<-bg.mean+2*bg.sd

5. Calculating proposed scaling factors is used based on positive

controls (S/Si) vs. housekeeping genes (H/Hi) (see Note 15)
(Fig. 3). Scaling using S/Si is performed by: inds<-grep
("POS_",fData[,1]).

x<-data[inds,]
Si<-apply(x,2,sum,na.rm=T)
S<-mean(Si)
S_Si_scale_factor<-S/Si

6. Perform scaling using H/Hi: my.genes<-c("name of all my

housekeeping genes”).

inds<-match(my.genes,rownames(data))
x<-data[inds,]
Hi<-apply(x,2,gm_mean)
H<-mean(Hi)
H_Hi_scale_factor<-H/Hi

7. Visualize the quality metrics by plotting them (Fig. 3).

8. Adjust the data based on scaling factors:

#1: S_Si_scale_factor
for(i in 1:ncol(data)){
tmp<-data[,i]
tmp<-tmp*S_Si_scale_factor[i]
data[,i]<-tmp #reassign
}
#2: H_Hi_scale_factor
for(i in 1:ncol(data)){
tmp<-data[,i]
tmp<-tmp*H_Hi_scale_factor[i]
data[,i]<-tmp #reassign
}
102 Johan Staaf et al.

9. Filter out missing values by only using counts that are present
exceeding 2sd+bg.mean:

data.present<-data
data.present[]<-1
for(i in 1:ncol(data)){
tmp<-data[,i]
nans<-which(tmp<(bg.mean[i]+bg.sd[i]*2))
if(length(nans)>0) data.present[nans,i]<-0
#data.present[,i]<-tmp #reassign}

10. Fusion analysis is performed using analysis methods [21]

implemented in the R statistical language. Figure 1c demon-
strates visualization of a detected fusion.
11. For each fusion gene, calculate: (1) biological background
B5—one value per gene & A5 as median for 50 probes per
patient and gene, and (2) E3 for each fusion gene per sample
(in this example ALK, RET, ROS1, NRG1, NTRK1).
12. Define your fusion genes: genes<-c
("ALK","ROS1","RET","NRG1","NTRK1").
13. Calculate B5 as follows:

b5.vector<-rep(NA,length(genes))
a5.matrix<-matrix(nrow=ncol(data),ncol=length(genes),NA)
colnames(a5.matrix)<-genes
rownames(a5.matrix)<-colnames(data)
names(b5.vector)<-genes
for(i in 1:length(genes)){
lz<-b5.bg.calculation(genes[i],data)
b5.vector[i]<-lz$B5
a5.matrix[,i]<-lz$A5}

14. Calculate E3 as follows:

e3.matrix<-matrix(nrow=ncol(data),ncol=length(genes),NA)
colnames(e3.matrix)<-genes
rownames(e3.matrix)<-colnames(data)
for(i in 1:length(genes)){
e3.matrix[,i]<-e3.calculation(genes[i],data)}

15. Set background threshold (Bt) for each sample:

 Genetic Alterations Detection using NanoString 103

Bt.matrix<-matrix(nrow=ncol(data),ncol=length(genes),NA)
colnames(Bt.matrix)<-genes
rownames(Bt.matrix)<-colnames(data)
for(j in 1:length(genes)){
for(i in 1:ncol(data)){
Bt.matrix[i,j]<-max(c(b5.vector[j],B[i]))}}

16. Calculate 30 /50 ratio for each gene and sample:

R35.matrix<-matrix(nrow=ncol(data),ncol=length(genes),NA)
colnames(R35.matrix)<-genes
rownames(R35.matrix)<-colnames(data)
for(j in 1:length(genes)){
for(i in 1:ncol(data)){
R35.matrix[i,j]<-e3.matrix[i,j]/(max(a5.matrix[i,j],Bt.ma-
trix[i,j]))}}

17. Calculate Fusion probe background (FB):

inds<-grep(":",rownames(data),fixed=TRUE)
FB<-rep(NA,nrow(data))
names(FB)<-rownames(data)
for(i in 1:length(inds)){
FB[inds[i]]<-max(c(median(data[inds[i],])+2*1.4826*mad(data
[inds[i],]),B))}

18. Visualize your analysis results by plotting as illustrated in

Fig. 3.

3.3 Final Report Fusion detection in clinical samples is often performed with immu-
of NanoString Fusion nohistochemical (IHC) stains in combination with FISH. Using
Gene Detection NanoString as a diagnostic tool is to date not considered a clinically
and Gene Expression validated method by most routine diagnostic laboratories. Novel
Profiling techniques require new equipment, staff training and some bioin-
formatics skills. In spite of this, we observed high concordance
between the combination of IHC and FISH and NanoString fusion
detection using thresholds previously defined [18, 21, 22]. The
high concordance between the routine clinical analyses and the
NanoString technology empowers this new technique, making it
a candidate for being one of the future’s better alternatives to
present methodologies. Combining directed gene expression
profiling with fusion gene detection allows two separate routine
analyses to be combined into a single assay [22].
104 Johan Staaf et al.

4 Notes

1. You should follow the manufacturer’s instructions. But we

have made minor changes to the manufacturer’s protocol,
such as adding ethanol to the xylene deparaffinization step to
be able to better visualize the tissue [18].
2. Macro-dissect the block prior to sectioning for extraction. Use
the H&E slide for guidance and scratch the block so that tumor
cell rich areas can be obtained. Use gloves and clean the instru-
ment used for scratching between blocks with RNase Away
(Cat No. 83891, Sigma-Aldrich, Saint-Louis, MO, USA).
3. We noticed that thinner sections (5μm) and a maximum
amount of 10, increased yield. Use gloves during sectioning
and clean the microtome knife with RNase Away between
blocks. To prevent instant RNA degradation after sectioning,
the sections should be stored at 20 ˚C in safe-lock tubes until
transport. It should be noted, though, that starting extraction
immediately after sectioning is preferred.
4. NanoString and IDT provide with quality check of the desired
probe design prior to synthesis. Use the required template
provided by NanoString/IDT and follow the instructions.
5. It should be noted that changes in NanoString protocols might
have been made, thus always consult manufacturer’s most up to
date protocols. (https://www.nanostring.com/support/prod
uct-support/support-documentation).
6. It should be noted that the same RNA input for all samples is
preferable, not only in the same experiment, but also from time
to time if results are to be compared. The NanoString technol-
ogy does not include a PCR step, hence the input amount has a
direct effect on the number of counts. Always quantify your
RNA using the NanoDrop, Qubit, or other quantification
method of preference before starting the hybridization.
7. In a clinical context, it would be advisable to reserve one well in
the NanoString cartridge to a reference of choice. This refer-
ence could be any sample with known fusions that are present
in the probe set. But it should also be noticed that the reference
should not be a limited RNA source as you will repeat your
analysis multiple times. In our case, we used a pool of RNA
extracted from four commercially available cell lines with
known fusions that also were present in our NanoString
probe set [23]. We pooled equal amounts of RNA from the
four cell lines in a new tube and quantified the pooled RNA.
This pool served as a reference and was included in all Nano-
String runs. For the pool reference, 100 ng RNA was used in
 Genetic Alterations Detection using NanoString 105

the hybridization process. The use of a reference allows for

monitoring of technical performance, system drift, and reagent
variations over time.
8. After it has thawed, inspect the tube of Reporter CodeSet to
make sure no colored precipitate is present. If you see a colored
precipitate, heat the entire tube to 75  C for 10 min and cool at
room temperature before using.
9. Minimizing the time between addition of the Capture Probe-
Set and incubation at 65  C will increase assay sensitivity.
10. The purpose of selecting a fixed hybridization time followed by
a ramp down to 4  C is to ensure equivalent hybridization
times of all assays being directly compared in the same series
of experiments. Counts continue to accumulate with time,
with total counts typically increasing 5% per hour between
16 and 24 h. Although a 16-h incubation is adequate for
most purposes, a longer incubation will increase sensitivity by
increasing counts without significantly increasing background.
11. Basic principles involve normalization, calculation of 30 over-
expression score and calculation of fusion probe expression.
Fusion prediction is made based on both the 30 /50 ratio and
fusion probe expression. Calculating the ratio of 30 /50 counts
will indicate whether a fusion is present, while counts from
fusion specific probes will account for which specific fusion is
expressed. If no fusion is present, 30 probes and 50 probes will
produce counts in a similar range and counts representing
fusion specific probes will be low. If a fusion is present, over-
expression of 30 probes and low expression of 50 probes will
indicate fusion and high counts from a fusion specific probe
will reveal the particular fusion (Fig. 1c).
12. The implementation of the data analysis is applicable to the
nCounter Elements chemistry as well as the nCounter XT
chemistry although the XT chemistry will not allow for fusion
gene status as this does not contain either the fusion specific
probes or the protector probe. Therefore, data produced using
the XT chemistry is recommended for quality control and
normalization of the data only.
13. The software decodes the RCC file using a pre-specified Code-
Set file specific for the assay (RLF file). The RLF file is delivered
together with the designed probe set. When importing data,
make sure to subtract mean of Negative Controls + 2 standard
deviations.
14. We do not conduct processing of data in the nSolver software.
Instead, the raw data is exported in csv file format and normal-
ization and visualization of the data are performed using R.
106 Johan Staaf et al.

15. NanoString provides several quality control (QC) metrics

included in the assay. It is important to make a proper QC
control before interpreting any fusion results. Make sure all
negative controls are low in expression and the positive con-
trols are high in comparison to the negative controls (Fig. 3a).
Make sure the average background of your samples is low and
review the H/Hi scale factor and S/Si scale factor. S/Si values
are generated when scaling the sample counts to the spike-in
positive controls provided by NanoString while H/Hi scale
factors are produced by scaling individual samples to counts
from housekeeping probes available in the probe set. Hence,
the housekeeping probes used in H/Hi scaling can be user-
defined while the spike-in controls used in S/Si scaling are
predefined by NanoString. We found the H/Hi scale factor
to be a particularly good indicator for good vs. poor sample
quality as this metric is more dependent on sample character-
istics (like level of RNA degradation) than strict technical
performance as the S/Si scale factor (Fig. 3b). Typically, a
high H/Hi scale factor value indicates bad sample quality.
NanoString has built-in cut-off values for when a sample is
considered to be of bad quality and is flagged in the nSolver
analysis software.

References
1. Torre LA, Siegel RL, Jemal A (2016) Lung forthcoming 8th edition of the TNM classifica-
cancer statistics. Adv Exp Med Biol 893:1–19 tion of malignant tumors. J Thorac Oncol 9
2. Travis WD (2014) The 2015 WHO classifica- (9 Suppl 2):S88–S96. https://doi.org/10.
tion of lung tumors. Pathologe 35(Suppl 1097/JTO.0000000000000293
2):188 7. Imielinski M, Berger AH, Hammerman PS et al
3. Scagliotti G, Brodowicz T, Shepherd FA et al (2012) Mapping the hallmarks of lung adeno-
(2011) Treatment-by-histology interaction carcinoma with massively parallel sequencing.
analyses in three phase III trials show superior- Cell 150(6):1107–1120
ity of pemetrexed in nonsquamous non-small 8. Suda K, Tomizawa K, Yatabe Y et al (2011)
cell lung cancer. J Thorac Oncol 6(1):64–70 Lung cancers unrelated to smoking: character-
4. Scagliotti GV, Parikh P, von Pawel J et al ized by single oncogene addiction? Int J Clin
(2008) Phase III study comparing cisplatin Oncol 16(4):294–305
plus gemcitabine with cisplatin plus peme- 9. Dogan S, Shen R, Ang DC et al (2012) Molec-
trexed in chemotherapy-naive patients with ular epidemiology of EGFR and KRAS muta-
advanced-stage non-small-cell lung cancer. J tions in 3,026 lung adenocarcinomas: higher
Clin Oncol 26(21):3543–3551 susceptibility of women to smoking-related
5. Tong JH, Yeung SF, Chan AW et al (2016) KRAS-mutant cancers. Clin Cancer Res 18
MET amplification and exon 14 splice site (22):6169–6177
mutation define unique molecular subgroups 10. Herbst RS, Heymach JV, Lippman SM (2008)
of non-small cell lung carcinoma with poor Lung cancer. N Engl J Med 359
prognosis. Clin Cancer Res 22 (13):1367–1380
(12):3048–3056 11. Luo SY, Lam DC (2013) Oncogenic driver
6. Bhora FY, Chen DJ, Detterbeck FC et al mutations in lung cancer. Transl Respir Med 1
(2014) Staging, prognostic factors C, advisory (1):6
B (2014) the ITMIG/IASLC Thymic epithe- 12. Foundation Medicine. https://www.
lial tumors staging project: a proposed lymph foundationmedicine.com/genomic-testing/
node map for Thymic epithelial tumors in the foundation-one
 Genetic Alterations Detection using NanoString 107

13. Cheng DT, Mitchell TN, Zehir A et al (2015) detection in non-small cell lung cancer. Onco-
Memorial Sloan Kettering-integrated mutation target 8(21):34796–34810
profiling of actionable cancer targets 19. Zhang DY, Chen SX, Yin P (2012) Optimizing
(MSK-IMPACT): a hybridization capture- the specificity of nucleic acid hybridization. Nat
based next-generation sequencing clinical Chem 4(3):208–214
assay for solid tumor molecular oncology. J 20. Wu LR, Wang JS, Fang JZ et al (2015) Con-
Mol Diagn 17(3):251–264 tinuously tunable nucleic acid hybridization
14. https://emea.illumina.com/?langsel¼/se/ probes. Nat Methods 12(12):1191–1196
15. ThermoFisher Scientific. https://www. 21. Lira ME, Choi YL, Lim SM et al (2014) A
thermofisher.com/se/en/home/clinical/pre single-tube multiplexed assay for detecting
clinical-companion-diagnostic-development/ ALK, ROS1, and RET fusions in lung cancer.
oncomine-oncology.html J Mol Diagn 16(2):229–243
16. Davies KD, Lomboy A, Lawrence CA et al 22. Karlsson A, Cirenajwis H, Ericson-Lindquist K
(2019) DNA-based versus RNA-based detec- et al (2019) A combined gene expression tool
tion of MET exon 14 skipping events in lung for parallel histological prediction and gene
cancer. J Thorac Oncol 14(4):737–741 fusion detection in non-small cell lung cancer.
17. NanoString. https://www.nanostring.com/ Sci Rep 9(1):5207
18. Lindquist KE, Karlsson A, Leveen P et al 23. Karlsson A, Brunnstrom H, Lindquist KE et al
(2017) Clinical framework for next generation (2015) Mutational and gene fusion analyses of
sequencing based analysis of treatment predic- primary large cell and large cell neuroendocrine
tive mutations and multiplexed gene fusion lung cancer. Oncotarget 6(26):22028–22037
 Chapter 9

A PCR-Based Approach for Driver Mutation Analysis

of EGFR, KRAS, and BRAF Genes in Lung Cancer Tissue
Sections
Rodrigo de Oliveira Cavagna, Leticia Ferro Leal, Flávia Escremim de Paula,
Gustavo Noriz Bernardinelli, and Rui Manuel Reis

Abstract
Driver mutations in non-small cell lung cancer (NSCLC) have a relevant significance for clinical manage-
ment. EGFR mutations are the most important predictive biomarkers for NSCLC, although KRAS and
BRAF mutations can also be prognostic and predictive biomarkers, respectively. PCR-based approaches
followed by sequencing are useful for EGFR, KRAS, and BRAF mutational analysis. Herein, all steps for a
PCR-based technique, from DNA isolation from tumor tissue sections to DNA sequencing for genetic
analysis of EGFR, KRAS, and BRAF hotspot regions are described.

Key words NSCLC, PCR-based approach, Mutational Analysis, EGFR, KRAS, BRAF

1 Introduction

1.1 Driver Genes In lung cancer, mutations in driver genes have a relevant signifi-
in Lung Cancer: Focus cance for clinical management of the patients. EGFR mutations are
on Personalized some of the most important driver alterations in lung adenocarci-
Medicine noma, and these mutations have a predictive value for targeted
therapies with tyrosine kinase inhibitors (TKi) [1, 2]. The most
common EGFR mutations for sensitizing to TKi are p.Leu858Arg
(located at exon 21) and deletions in exon 19 (p.Glu746_Ala750-
del and p.Leu747_Pro753del), while p.Thr790Met (located at
exon 20) is the most frequent mutation associated with resistance
to TKi. In addition to predictive mutations, prognostic mutations
are also clinically relevant for the management of lung adenocarci-
noma patients. The most important prognostic mutations are
KRAS mutations located at codons 12 and 13, which are associated
with worse prognosis [3–6]. Although KRAS mutations have no
predictive value, significant efforts have been done by the scientific
community to develop targeted therapies against those mutations

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_9, © Springer Science+Business Media, LLC, part of Springer Nature 2021

109
110 Rodrigo de Oliveira Cavagna et al.

[4, 5]. Of note, KRAS and EGFR mutations are mutually exclusive.
Less commonly found in lung adenocarcinoma are BRAF muta-
tions. Although the BRAF codon 600 mutations are recurrently
found in several cancer types, in lung adenocarcinoma is very
uncommon but they still may guide tailored treatment with anti-
BRAF targeted therapy [7, 8]. Nonetheless, the BRAF non-codon
600 mutations are more frequent in lung adenocarcinoma and they
also play an important role in disease progression when concomi-
tant with KRAS mutations [8–11]. Additional driver alterations
such as ALK, RET, ROS1 rearrangements are clinically relevant for
lung adenocarcinoma patients but the techniques required for
evaluation of these alterations will not be contemplated in this
topic.

1.2 The Polymerase Polymerase chain reaction (PCR) is a technique that aims to expo-
Chain Reaction nentially amplify the amount of a target DNA sequenced based on
Technique: Basis enzymatic DNA amplification by a DNA polymerase. PCR is
and Principles divided in three major stages: denaturation, annealing, and exten-
sion. Suitable balance of the PCR reaction mix including pH,
temperatures, template, and reagent concentrations are essential
for a maximum efficiency of amplification. Basically, PCR requires
the following reagents: a reaction buffer, MgCl2, deoxyribonucleo-
tides (dNTPs), primers (forward and reverse), DNA polymerase
(mainly Taq), a DNA template and water. Primers, which are
DNA sequences of oligonucleotides that delimit the sequence to
be amplified by complementarity, need to be specific to the target
sequence of interest. PCR bench work must be performed in a
sterilized area to avoid contamination of the reactions and also
the templates leading to an unreliable result.

1.3 PCR-Based There are some techniques used for mutational analysis of genes in
Approach lung adenocarcinoma, from PCR followed by Direct Sanger
for Mutational Sequencing, to new approaches based on next generation sequenc-
Analysis of EGFR, ing (NGS). Some allele-specific real-time PCR systems, such as the
KRAS, and BRAF COBAS® assay, may also be used for mutational analysis. Other
Genes techniques such as digital PCR and NGS panels (TruSight panel—
Illumina; Cancer Hotspot—Ion Torrent, etc.) are also alternative
approaches for mutational analysis of lung cancer samples. Cur-
rently, PCR followed by direct sequencing and NGS panels are
the most used tools for mutations analysis. The major steps for
mutational analysis by a PCR approach followed by direct sequenc-
ing used in the routine practice consist of the isolation and quanti-
fication of DNA (from lung cancer tissue sections, in the case of the
procedure herein described), PCR performance, purification of
PCR products, setting-up of the sequencing reaction, and purifica-
tion of the sequencing reaction. The procedures for these are
described below.
 PCR Detection of Lung Cancer Driver Mutations 111

2 Materials

2.1 Histology This section includes the materials needed to purify DNA from
Reagents paraffin-embedded, formalin-fixed (PEFF) tissue sections.
and Materials
1. Slides with lung tumor tissue sections. These should have been
previously stained with hematoxylin/eosin (H&E). Also, the
H&E-stained slides must have been previously delimited
(tumor versus non-tumor tissue areas) by a pathologist for
tumor area location. This is important to ensure DNA extrac-
tion from tumor areas only.
2. Xylene (xylol).
3. Slide racks.
4. Slide staining and washing in Koplin jars.
5. Ethanol, 50%, 70%, and absolute 100%.
6. Milli-Q® Ultrapure water.

2.2 Reagents 1. Commercial kit for DNA isolation. We routinely use the
and Kits for DNA QiAmp Kit (Qiagen), but other commercially available DNA
Extraction, PCR, extraction kits are acceptable. Strictly follow the kits
and Sequencing instructions.
2. DNA polymerase and Hot Start Master Mix. Use according to
manufacturer’s instruction. For the EGFR and KRAS PCRs,
the DNA polymerase is included in the Hot Start Master
Mix (Tables 1 and 2). For the BRAF PCR, we use the Taq
Platinum polymerase (Table 3).
3. Deoxyribonucleotides (dNTPs) mix. For the EGFR and KRAS
PCRs (Tables 1 and 2), the dNTPs are included in the Hot
Start Master Mix. For the BRAF PCR (Table 3), the dNTP
mix, is purchased and added separately.
4. Specific primers, these must be a forward and a reverse primer
and should specifically target the regions flanking the DNA
sequence or exons (hotspot mutations) you wish to amplify in
the EGFR , KRAS , and BRAF genes. Detailed information
about the primers, including sequences, are shown in Tables 4,
5, and 6, for EGFR, KRAS, and BRAF, respectively.
5. Standard PCR buffer, for the BRAF PCR reaction mix
(Table 3). This is the buffer that will be used to prepare the
PCR mix.
6. Sequencing kit. We use the BigDye® Direct Sanger Sequencing
Kit by Thermofisher, using it strictly following the kit’s instruc-
tions. Table 7 shows the sequencing reaction mixture, the
Buffer 5
shown in the table is included in the sequencing kit.
112 Rodrigo de Oliveira Cavagna et al.

Table 1
PCR reagents for EGFR mutational status PCR reaction mix

Reagents Volume (μL)

Sterile nuclease-free water 5.6
HotStar Taq master mix 7.2
Primer forward 10 μM 0.3
Primer reverse 10 μM 0.3
Magnesium chloride 5 Millimolar 0.6
Total 14

Table 2
PCR reagents for KRAS exon 2 mutational status PCR reaction mix

Reagents Volume (μL)

Sterile nuclease-free water 5.6
HotStar Taq master mix 7.2
Primer forward 10 μM 0.3
Primer reverse 10 μM 0.3
Magnesium chloride 5 mM 0.6
Total 14

Table 3
PCR reagents to BRAF exon 11 and 15 mutational status PCR reaction mix

Reagents Volume (μL)

Sterile nuclease-free water 18.95
PCR buffer 2.5
MgCl2 0.75
Dntp 0.5
Primer forward 10 μM 0.6
Primer reverse 10 μM 0.6
Taq platinum 0.1
Total 24
Table 4
Detailed primer information for EGFR PCR amplification

Primers Size GC TM Annealing Product

sense Sequencing (50 !30 ) (bp) (%) ( C) Genomic Coordinates Concentration T ( C) size (bp)
Exon Forward TGG GCC ATG TCT 20 65.0 63.2 Chromosome 7: 55.086.794- Storage: 100 μM 58 282
18 GGC ACT GC 55.279.321 forward strand. Working: 10 μM
Reverse ACA GCT TGC AAG 20 55.0 57.6 Exon18: ENSE00001778519 Sequencing:3.2 μM
GAC TCT GG
Exon Forward TCA CTG GGC AGC 20 60.0 62.4 Chromosome 7: Storage: 100 μM 58 241
19 ATG TGG CA 55,086,794–55,279,321 forward Working: 10 μM
Reverse CAG CTG CCA GAC 20 50.0 55.3 strand. Sequencing:
ATG AGA AA Exon19: ENSE00001756460 3.2 μM
Exon Forward CCT TCT GGC CAC 20 60.0 60.5 Chromosome 7: Storage: 100 μM 58 295
20 CAT GCG AA 55.086.794–55.279.321 forward Working: 10 μM
Reverse CGC ATG TGA GGA 20 60.0 59.8 strand. Sequencing:
TCC TGG CT Exon 20: ENSE00001601336 3.2 μM
Exon Forward ATT CGG ATG CAG 20 45.0 54.3 Chromosome 7: Storage: 100 μM 58 265
21 AGC TTC TT 55.086.794–55.279.321 forward working: 10 μM
Reverse CCT GGT GTC AGG 20 50.0 55.3 strand. Sequencing:
AAA ATG CT Exon 21: ENSE00001681524 3.2 μM
Primers are designed to amplify individually exons 18, 19, 20, and 21. Notice that the primer concentrations are included for the stock (storage) solution, as well as the working
concentrations for PCR and sequencing. Sequences for both the forward and reverse primers are provided, as well as corresponding relevant information such as Tm, %GC,
annealing temperature, anticipated PCR product size, etc
PCR Detection of Lung Cancer Driver Mutations
113
 114

Table 5
Detailed primer information for KRAS exon 2 PCR amplification

Primers Size GC Annealing Size

Rodrigo de Oliveira Cavagna et al.

TM
sense Sequencing (50 ! 30 ) (bp) (%) ( C) Genomic coordinates Concentration T ( C) (bp)
Codon Forward GTG TGA CAT GTT CTA 24 33.3 50.2 Chromosome 12: Storage: 100 μM 56.5 265
12/13 ATA TAG TCA 25.358.182–25.403.854 Working: 10 μM
Reverse GAA TGG TCC TGC ACC 20 50.0 54.8 reverse strand. Sequencing: 3.2 μM
AGT AA Exon 2: ENSE00000936617
Notice that the primer concentrations are included for the stock (storage) solution, as well as the working concentrations for PCR and sequencing. Sequences for both the forward
and reverse primers are provided, and corresponding relevant information such as Tm, %GC, annealing temperature, anticipated PCR product size, etc
Table 6
Detailed primer information for BRAF exons 11 and 15 PCR amplification

Primers Size GC TM Annealing Size

sense Sequencing (50 ! 30 ) (bp) (%) ( C) Genomic coordinates Concentration T ( C) (bp)
Exon Forward ATA AGG TTT TCT TTT 25 32 63.2 Chromosome 7: Storage: 100 μM 58 168
11 TCT—GTTTGGC 40,719,327–140,924,928 Working: 10 μM
Reverse ACT TGT CAC AAT GTC ACC- 25 40 63.7 reverse Strand Sequencing: 3.2 μM
ACATTAC Exon 11: ENSE00003559218
Exon Forward TCA TAA TGC TTG CTC 23 39.1 62.5 Chromosome Storage: 100 μM 60 164
15 TGA—TAGGA 7:140,719,327–140,924,928 Working: 10 μM
Reverse GGC CAA AA A TTT AAT 22 36.3 63.6 reverse Strand Sequencing: 3.2 μM
CAG-TGGA Exon 15: ENSE00003485507
Notice that the primer concentrations are included for the stock (storage) solution, as well as the working concentrations for PCR and sequencing. Sequences for both the forward
and reverse primers are provided, and corresponding relevant information such as Tm, %GC, annealing temperature, anticipated PCR product size, etc
PCR Detection of Lung Cancer Driver Mutations
115
116 Rodrigo de Oliveira Cavagna et al.

Table 7
Reagents for the preparation of the direct sequencing reaction mixture

Reagentsa Volume (μL)

Buffer 5
BigDye terminator v3.1 2
Primer (forward or reverse) 1
BigDye terminator v3.1 0.3
Total 3.3
a
Optimized protocol

7. Sequencing primers (forward and reverse). See Tables 4, 5, and

6 for information about primers for sequencing for EGFR ,
KRAS and BRAF respectively.
8. BigDye X-Terminator® Purification kit (Thermofisher). This is
not included in the sequencing kit and must be bought
separately.
9. SAM Solution (Thermofisher), also bought separately.
10. ExoSap-IT (Thermofisher). This is a PCR product cleanup
reagent that is used for cleaning excess primers and nucleotides
from amplified DNA.
11. Proteinase K solution. Supplied in the QiAmp Kit, comes in
ready-to-use form.
12. Nuclease-free water (DNAse/RNAse free).
13. DNA ladder marker.
14. 2% agarose gel in 1
TAE buffer. Prepare a 50
TAE buffer
stock which is 2.0 M Tris-acetate, 50 mM EDTA, pH 8.0. To
prepare, weigh 242 g of Tris base and transfer to a 1 L glass
bottle containing approximately 500 mL of water. Add
57.1 mL of glacial acetic acid and 100 mL of 0.5 M EDTA
(pH 8.0) buffer. Place a magnetic stir bar (flea) into the bottle
and place atop of a magnetic stirrer on a medium speed for
approximately 30 min until all of the Tris base has dissolved.
Transfer into a graduated cylinder make up to 1 L with water,
and transfer to a 1 L storage bottle. To prepare the gel, dilute
the 50
TAE to 1
, and add agarose powder to a final con-
centration of 2%, heat in a microwave to melt the agarose.

2.3 General 1. Spectrophotometer, for nucleic acid quantification.

Laboratory Equipment 2. Benchtop microcentrifuge.
3. Vortex mixer.
4. Micro-pipettes, different volumes.
5. Thermocycler machine.
 PCR Detection of Lung Cancer Driver Mutations 117

6. Sequencer machine.
7. Heat block with shaking and rotating capacity, capable of hold-
ing Eppendorf tubes, pre-heated to 56  C and to 98  C. We use
the Eppendorf® Thermomixer R Dry Block Heating and Cool-
ing Shaker (Eppendorf®, 022670107 (USA), but any appara-
tus with similar capabilities can be used.
8. Oven, preheated to 80–85  C.
9. Ice buckets, ice.
10. Laminar flow hood.
11. DNA electrophoresis apparatus, including power supply.

2.4 General Use 1. Pipette tips.

Laboratory 2. Eppendorf tubes (0.2, 0.6, and 1.5 mL).
Consumables
3. Sequencing plates, 96-wells.
4. Syringe needles, for removal of tumor area from tissues.

3 Methods

Carry out all procedures at room temperature unless otherwise

specified.

3.1 DNA Isolation The complete workflow of the procedures described in Subheading
from Lung Tumor 3.1 is summarized in Fig. 1.
Tissue Sections


3.1.1 Deparaffinization 1. Incubate the tissue slides for 20 min at 80 C to 85  C for
of Tissues paraffin to get melted.
2. To remove the molten paraffin, submerge the slides in a xylol
bath in a Coplin jar for 5 min. This will remove all the remain-
ing paraffin. Perform this submersion twice, followed by 1 min
of a 100% ethanol bath, 1 min of a 70% ethanol bath, and 1 min
of a 50% ethanol bath. Deparaffinized slides should be kept in
Milli-Q® ultrapure water before moving forward to the
next step.
3. As described in Subheading 2, the H&E-stained slides must
have been previously examined by a pathologist to locate the
tumor area. Using this as a guide, dissect tumor area from
deparaffinized slide using a needle. Keep the dissected tumor
tissue in an eppendorf tube (1.5 mL) that has been previously
filled with 30–80 μL of ATL buffer and 1 μL of RNA carrier,
both supplied in the QiAmp kit (see Note 1). Proceed to the
next section for DNA extraction.
118 Rodrigo de Oliveira Cavagna et al.

Fig. 1 Summarized workflow of FFPE tissue deparaffinization (top row), dissection of the tumor area from the
tissue section and Proteinase K digestion (middle row), and DNA isolation from the tumor tissue area (bottom
panel). Illustrations were created using biorender.com

3.1.2 Tissue Digestion Unless otherwise specified, reagents and solutions in this section
and DNA Extraction from are included in the QiAmp kit.
Tumor Tissue Sections
1. For tissue digestion, add 15 μL of Proteinase K to the tube,
followed by homogenization by pipetting the sample up
and down.
2. Incubate the samples with Proteinase K overnight at 56  C in
the heating block, applying 700 RPM rotation. Incubation
time should be between 14 and 16 h.
3. After this first Proteinase K incubation, homogenize samples in
a vortex for 10 s, followed by a brief spin down in a benchtop
microcentrifuge. Add another 15 μL of Proteinase K, followed
by pipetting the sample up and down.
4. Perform a second incubation at 56  C in a heating block
applying 700 RPM rotation, for at least 1 h. Homogenize all
samples vigorously in a vortex for 10 s, and briefly spin down
the samples.
5. Incubate samples at 98  C in a heating block for 20 min
applying 600 RPM rotation. You must wait until the heating
block reaches 98  C before placing the samples. You must not
 PCR Detection of Lung Cancer Driver Mutations 119

exceed the 20 min or DNA can be degraded. After 20 min,

briefly spin down the samples in the microcentrifuge, and allow
to cool down to room temperature for approximately 5 min.
6. Add 110 μL of AL Buffer, responsible for the cell lysis (also
provided in the QiAmp kit), and 110 μL of 100% ethanol to
precipitate the DNA from the samples. Incubate samples for
5 min at room temperature and then briefly spin them down.
7. Transfer the total sample volume to a QiAmp Mini spin column
and place the column in a collector tube.
8. Spin down the samples in the benchtop microcentrifuge at
6,000
g for 1 min, discard the collector tube with the flow-
through solution.
9. Place the spin columns in a new collector tube and add 500 μL
of AW1 buffer to each sample, followed by another spin down
at 6,000
g for 1 min. Discard the collector tube with the
flow-through solution.
10. Place the spin columns in a new collector tube and add 500 μL
of AW2 buffer to each sample, followed by a spin down at
20,000
g for 1 min. Discard the collector tube with the flow-
through solution.
11. Place the spin columns in a new collector tube and spin down
the samples at 20,000
g for 3 min. Discard the collector tube
with the flow-through solution.
12. Place the spin column in a new 1.5 mL Eppendorf tube and
add 30 μL of nuclease-free water to each sample. Nuclease-free
water should be pipetted in the middle of the column avoiding
touching the column filter with the pipette tip. Incubate 5 min
at room temperature. Spin down the samples at 20,000
g for
2 min. This time the flow-through will contain the
extracted DNA.
13. Determine DNA concentration by spectrophotometry or fluo-
rometry. Assess the 260/280 absorbance ratio, which should
be close to 2, indicating high purity DNA.
14. Dilute the DNA sample to 50 ng/μL in a new eppendorf tube.
DNA should be stored at 20  C until used.

3.2 PCR For molecular analysis, DNA is firstly PCR amplified for hotspot
Amplification of EGFR, regions within the EGFR, KRAS, and BRAF genes according to
KRAS, and BRAF the following steps. Workflow for this section is summarized in
Hotspot Regions Fig. 2.
1. Before starting all procedures in this section, thaw all PCR
reagents in ice. Refer to Tables 1, 2, 3, 4, 5, and 6 for the
recommended reagents and primer sequences for the PCR
amplification procedure. These tables include information
120 Rodrigo de Oliveira Cavagna et al.

Fig. 2 Summarized workflow for PCR protocol. Reagents are mixed with the DNA template (top, left); the three
phases of PCR process: annealing, denaturation, and extension (top, right); analysis of PCR products by
agarose gel to confirm DNA amplification (bottom, right). Illustrations were created using biorender.com

pertaining to PCR amplification of EGFR, KRAS, and BRAF.

Information about primer design and concentrations for the
three genes is included in Tables 4, 5, and 6.
2. The PCR mix should be prepared in a laminar flow hood to
avoid contamination of the sample with foreign DNA. Clean
the interior surfaces of the laminar flow with 70% ethanol. We
recommend that as a sterilizing measure, you turn on the UV
light inside the hood for 15 min before you start to prepare the
PCR mix. Eppendorf tubes (0.2 and 1.5 mL), pipettes, and
pipette tips should be into the laminar flow hood while UV
light is on. DNA samples must never be placed into the laminar
flow hood while the UV light is on.
3. Prepare a PCR mix in a 1.5 mL Eppendorf tube. Prepare the
PCR mix using the reagents and concentrations listed in
Tables 1, 2, and 3 for EGFR, KRAS, and BRAF, respectively.
When preparing the PCR mix it is recommended to firstly add
water and lastly the DNA polymerase. Refer to Tables 1, 2, and
3 for the recommended DNA polymerase to be used.
 PCR Detection of Lung Cancer Driver Mutations 121

4. Vortex and spin down the PCR mix for 15 s.

5. Add 14 μL for EGFR and KRAS/24 μL for BRAF of PCR mix
to 0.2 mL Eppendorf tubes.
6. Add 1 μL of the diluted DNA to each of these tubes. Include a
positive and a negative control for all reactions. No DNA
template must be added to negative controls; instead ultrapure
water should be added to replace the volume corresponding to
the DNA template (see Note 2).
7. Spin down the tubes. Check that no remaining liquid is in the
tube’s lid. Place the tubes into a programmed thermocycler for
PCR cycling conditions, using the parameters described in
Table 8 (for EGFR ), 9 (for KRAS ) 10, and (BRAF exon
11 and exon 15). Ensure that the thermocycler lid is heated
to 105  C.
8. To confirm the PCR amplification of DNA products, run a
5 μL sample from the PCR reaction in a 2% agarose gel. A
DNA ladder must be used for all electrophoresis separation of
PCR products (see Note 3).
9. If the amplification is confirmed, proceed to sequencing reac-
tion as described in the next section.

3.3 Direct Sanger The Sanger sequencing method is dived into three major steps:
Sequencing purification of PCR yield (in this case, the PCR product obtained in
Subheading 3.2); using this PCR product in the sequencing reac-
tion itself; and purification of sequencing reaction. Sequencing
reactions must be performed according to the following steps.
The workflow described in this section is summarized in Fig. 3.

3.3.1 Purification 1. Dilute the PCR product generated in Subheading 3.2 using
of the PCR Product ultrapure water. The dilution factor chosen will depend on the
for Sequencing intensity of the PCR bands as assessed in the DNA gel electro-
phoresis after staining with ethidium bromide. Samples with
too faint PCR product bands should not be diluted. Samples
with too intense bands should be diluted in 1:4.
2. Vortex for 2 min and add 1 μL of ExoSap-IT to 5 μL of the
diluted PCR product.
3. Place the tubes with this mix in a programmed thermocycler
programmed to heat the sample at 37  C for 30 min and then at
80  C for 15 min.

3.3.2 Assembly 1. Before starting, thaw the BigDye terminator reagent and pri-
of the Sequencing Reaction mers in ice and dilute the PCR primers (forward or reverse) to a
3.2 μM final concentration. For example, mix 3.2 μL of ultra-
pure H2O and 6.8 μL of primer to produce 10 μL of final
volume with a primer concentration of 3.2 μM concentration
(see Tables 4, 5 and 6 for primer information for EGFR, KRAS
and BRAF, respectively).
122 Rodrigo de Oliveira Cavagna et al.

Table 8
PCR parameters to be programmed into the thermocycler for EGFR exon
PCR amplification

Steps Temperature ( C) Time Cycles

Initial denaturation 96 15 min 1

Denaturation 96 45 s 40

Annealing 58 45 s
Extension 72 45 s
Final extension 72 10 min 1

Final 4 1

Table 9
PCR parameters to be programmed into the thermocycler for KRAS exon
2 PCR amplification

Steps Temperature Time Cycles

Initial 96  C 15 min 1

Denaturation 96  C 45 s 40


Annealing 56.5 C 45 s

Extension 72 C 45 s
Final extension 72  C 10 min 1

Final 4 C 1

Table 10
PCR parameters to be programmed into the thermocycler for BRAF exons
11/15 PCR amplification

Steps Temperature ( C) Time Cycles

Initial denaturation 95 15 min 1

Denaturation 95 45 s 38

Annealing 58/60 45 s
Extension 72 45 s
Final extension 72 10 min 1

Final 4 1
 PCR Detection of Lung Cancer Driver Mutations 123

Fig. 3 Summarized workflow for Direct Sanger Sequencing. Major steps are shown (1–4). Illustrations were
created using biorender.com

3.3.3 Sequencing 1. Prepare the sequencing reaction mix according to Table 7. You
Reaction Steps must prepare the sequencing reaction mix in a dark room.
Sequencing primers are fluorescently labeled and therefore
photosensitive, and exposure to bright light will decrease the
intensity of fluorescence in the sequencing reaction.
2. Spin down the sequencing mix and add 3.3 μL of the sequenc-
ing mix to each of the wells in the sequencing plate, or to
0.6 mL Eppendorf tubes, then add up to 5 μL of the DNA
sample to be sequenced to each well or tube. Place the lids on
the tubes or seal the sequencing plate.
3. Spin down the contents and place tubes/plates in a pro-
grammed thermocycler according to the sequencing para-
meters described in Table 11.

3.3.4 Purification 1. If samples were placed in Eppendorf tubes in the previous

of Sequencing Yield steps, transfer them now to the 96-well sequencing plate.
Allow both the sequencing plate and the X-terminator reagent
124 Rodrigo de Oliveira Cavagna et al.

Table 11
Programing of sequencing step

Steps Temperature ( C) Time Cycles

Denature 96 10 s 1

Anneal 50 5s 30

Extend 60 4 min 1

Final 4 1

to reach room temperature for 30 min. For pipetting the

X-terminator reagent, the tip of the pipette tips should be cut
out to avoiding clogging of the pipette tips. The X-terminator
reagent must be shaken frequently to avoid precipitation.
2. Add 45 μL of SamSolution and 10 μL of X-terminator reagent
to each well with sample.
3. Seal the plate and shake it for 30 min at 10,000 rpm in an orbital
shaker. Correct time and rotation are essential for an optimal
reaction performance avoiding background (see Note 4).
4. Spin down the plate and place the plate on the DNA sequencer
machine, run the sequencing procedure according to the
model of the sequencer.

3.3.5 Genetic Analysis After all the sequencing steps are conducted, the DNA sequencer
release files from the electropherograms for each case. All electro-
pherograms must be checked manually and/or applying a sequenc-
ing analysis software employing always the consensus sequencing
(see Note 5).

4 Notes

1. The ATL buffer is responsible for the cell lysis, and its volume is
proportional to the tissue fragment size according to manufac-
ture protocol. ATL buffer and RNA carrier should be added
and mixed to the Eppendorf tube before the tumor section
sample is added. Adding ATL buffer and RNA carrier sepa-
rately may result in decreased DNA yield.
2. Generation of a PCR product in the negative control reactions
is a common problem in PCR-based approaches, which is
mainly due to contamination of the reaction with foreign
DNA. To avoid contamination, assembling the PCR reactions
in a sterile environment is mandatory. Molecules of DNA in
instruments or even in the air are enough for PCR contamina-
tion. Thorough cleaning of instruments and pipettes is also
 PCR Detection of Lung Cancer Driver Mutations 125

extremely important. Cleaning the working surfaces with 70%

alcohol and the use of sterile and nuclease-free tubes and tips
may avoid PCR reagents contamination. On the other hand,
appearance of PCR bands of 50 bp or less in the negative
controls may correspond to primers dimers. If any band
appears on negative control and its size is greater than 50 bp,
PCR must be repeated as this may indicate contamination with
foreign DNA.
3. If no bands appear on the agarose gel for any of the samples, it
may be due to fragmented DNA or low amount of DNA. In
this case, increase DNA concentration or check DNA integrity.
If PCR still does not produce any PCR products, DNA is
probably too degraded to be amplified. In case DNA is not
degraded, checked by DNA integrity assessment by gel electro-
phoresis (degraded DNA may look like a smear), troubleshoot-
ing then should consist of adjusting the PCR parameters and
conditions such as decreasing the annealing temperature,
decreasing the MgCl2 concentration, increasing primer
concentration, etc.
4. Sequencing electropherograms presenting high background is
probably a result from a poor purification and/or due to PCR
smear. In this case, repeat ExoSap-IT purification in a new PCR
product and/or repeat X-terminator purification. Do not use
an expired ExoSap-IT and/or an expired X-terminator, expired
consumables may result in decrease of purification perfor-
mance. Sequencing electropherograms presenting high back-
ground can also be due to cross-contamination at the PCR
amplification step (to avoid PCR cross-contamination, see
Note 2).
5. When any alteration related to the consensus sequence is iden-
tified on the electropherogram, it is necessary to repeat all
process from DNA isolation (if available) to sequencing reac-
tion for that specific “altered” sample. PCR amplification may
lead to sequence errors; thus, repetition ensures it is a true
alteration (mutation) and not only a technical artifact.

References
1. Thomas A, Liu SV, Subramaniam DS et al clinical perspectives on the treatment of an old
(2015) Refining the treatment of NSCLC target. Mol Cancer 17:1–14
according to histological and molecular sub- 4. Guibert N, Ilie M, Long E et al (2015) KRAS
types. Nat Rev Clin Oncol 12:511–526 mutations in lung adenocarcinoma: molecular
2. Normanno N, De Luca A, Bianco C et al and epidemiological characteristics, methods
(2006) Epidermal growth factor receptor for detection, and therapeutic strategy perspec-
(EGFR) signaling in cancer. Gene 366:2–16 tives. Curr Mol Med 15:418–432
3. Nadal E, López I, Gil-Bazo I et al (2018) 5. Sanclemente M, Francoz S, Esteban-Burgos L
KRAS oncogene in non-small cell lung cancer: et al (2018) c-RAF ablation induces regression
126 Rodrigo de Oliveira Cavagna et al.

of advanced Kras/Trp53 mutant lung adeno- 8. Cancer Genome Atlas Research Network
carcinomas by a mechanism independent of (2014) Comprehensive molecular profiling of
MAPK signaling. Cancer Cell 33:217–228 lung adenocarcinoma. Nature 511
6. Leal LF, de Paula FE, De Marchi P et al (2019) (7511):543–550
Mutational profile of Brazilian lung adenocar- 9. Carter J, Tseng LH, Zheng G et al (2015)
cinoma unveils association of EGFR mutations Non-p.V600E BRAF mutations are common
with high Asian ancestry and independent using a more sensitive and broad detection
prognostic role of KRAS mutations. Sci Rep tool. Am J Clin Pathol 144:620–628
9:3209 10. Nieto P, Ambrogio C, Esteban-Burgos L et al
7. Carneiro JG, Couto PG, Bastos-Rodrigues L (2017) A Braf kinase-inactive mutant induces
et al (2014) Spectrum of somatic EGFR, lung adenocarcinoma. Nature 548
KRAS, BRAF, PTEN mutations and TTF-1 (7666):239–243
expression in Brazilian lung cancer patients. 11. Heidorn SJ, Milagre C, Whittaker S et al
Genet Res (Camb) 96:e002. https://doi.org/ (2010) Kinase-dead BRAF and oncogenic
10.1017/S0016672314000032 RAS cooperate to drive tumor progression
through CRAF. Cell 140:209–221
 Chapter 10

6-Color Crystal Digital PCRTM for the High-Plex Detection

of EGFR Mutations in Non-Small Cell Lung Cancer
Jordan Madic, Cécile Jovelet, Imane Dehri, and Allison C. Mallory

Abstract
The profiling of EGFR mutations, the most common genetic alterations in non-small cell lung cancer
(NSCLC) predictive of targeted therapy efficacy, is crucial to anticipate the patient response to EGFR
tyrosine kinase inhibitors. Here, we introduce the naica® system for 6-color Crystal Digital PCRTM and
describe in detail a standardized workflow for the multiplexed, single-assay detection of the 19 most
prevalent sensitizing and resistance EGFR mutations in both tumor and circulating tumor DNA
(ctDNA) samples. Two major advantages of the 6-color multiplexing system over current digital PCR
systems are the rapid time to results, and the large quantity of mutational information obtained per patient
sample, rendering the 6-color system highly cost effective. The 6-color Crystal Digital PCRTM technology
enables highly sensitive and efficient therapeutic monitoring through liquid biopsy, resulting in the early
detection of treatment resistance. While the assay presented here specifically addresses EGFR mutation
status monitoring in NSCLC patients, 6-color Crystal Digital PCRTM assays are flexible and evolutive in
design. As such, 6-color detection assays can be optimized to monitor mutations associated with a range of
cancers and other genetic diseases, as well as to detect genetic changes beyond the oncology and human
health domains.

Key words Crystal Digital PCRTM, EGFR , 6-color multiplexing, NSCLC , Mutation monitoring,
Naica® system, Circulating tumor DNA, Liquid biopsy

1 Introduction

1.1 Genetic In non-small cell lung cancer (NSCLC), the detection and quanti-
Mutations Commonly fication of EGFR genetic alterations in tumor-derived DNA can
Associated guide the therapeutic care of patients. EGFR activating mutations
with Non-small Cell (occurring in 11% of NSCLC patients) are generally associated with
Lung Cancer increased sensitivity to EGFR inhibitors [1]. The most common of
these genetic lesions, accounting for more than 90% of all EGFR
mutations, results either from deletions in Exon 19 (48%) or a p.
L858R substitution in Exon 21 (43%) [2]. Other less common
mutations such as p.G719X (X ¼ A, C, S) in exon 18 and p.
L861Q in exon 21 are also observed. Multiple randomized con-
trolled trials have demonstrated improved progression-free survival

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_10, © Springer Science+Business Media, LLC, part of Springer Nature 2021

127
128 Jordan Madic et al.

with the EGFR tyrosine kinase inhibitors erlotinib, gefitinib, and

afatinib compared to chemotherapy [3]. However, patients treated
with targeted therapies frequently develop resistance due to the
appearance of secondary molecular alterations in the tumor cells.
EGFR mutations are a central contributor to resistance in lung
cancer patients. The Exon 20 p.T790M mutation observed in
approximately half of the patients undergoing treatment, has been
shown to confer resistance to first- and second-generation tyrosine
kinase inhibitors [4]. Consequently, Osimertinib (Tagrisso®) was
developed to be effective against tumors bearing this acquired
resistance EGFR mutation. However, resistance to this third-
generation treatment has also been documented by the appearance
of the p.C797S EGFR mutation [5]. Given the evolutive nature of
EGFR mutations during treatment, monitoring patients for the
appearance of resistance mutations is imperative to adapt rapidly the
ongoing and future therapies.

1.2 The Naica® Due to factors frequently limiting tumor tissue sampling such as
system Enables tumor location, size and patient health complications, minimally
Robust Tumor-Derived invasive liquid biopsies (for example a blood sample) represent a
DNA Analysis valuable source of ctDNA from which the mutational status of a
patient’s tumor can be determined [6]. Indeed, tumors release
nucleic acids (DNA or RNA) into the blood stream, which can be
recovered from plasma and used as a surrogate source of tumor
DNA. However, because tumor DNA is found within the total free
circulating DNA plasma population, highly robust and selective
techniques are required to detect reliably mutations of clinical
relevance. Digital PCR (dPCR) is a promising clinical tool as it
combines high sensitivity and absolute quantification with a short
time to results. With the ability to partition samples into thousands
of individual reactions, dPCR enables superior target detection and
quantification, allowing the accurate detection of rare mutations in
low concentration liquid biopsy ctDNA samples and opening new
clinical opportunities for this complex mixture of DNA [7].

1.3 The Naica® Stilla Technologies previously developed the 3-color naica® system
system 6-Color Digital consisting of the naica® Geode, the naica® Prism3, and a single
PCR EGFR Assay consumable, the Sapphire microfluidic chip. The naica® Geode
generates and thermocycles in the Sapphire chip stable arrays of
monodispersed droplets, also known as droplet crystals, which are
subsequently imaged by the naica® Prism 3-color reader instrument
and analyzed using the Crystal Miner Software. The current 3-color
naica® system has a time to results of 2 h 30 min with a minimum
hands-on time (for details on the naica® System Crystal Digital
PCRTM workflow, see https://www.stillatechnologies.com/naica-
system-workflow/). We have designed two 3-color multiplex assays
for the concomitant detection and quantification of wild-type
(WT) and EGFR insertion-deletion (indels) in exon 19, p.L858R,
 High-Plex Detection of EGFR Mutations in NSCLC 129

Fig. 1 The naica® 6-color Crystal Digital PCRTM prototype system. (a) Sapphire chips in which the samples are
loaded and partitioned into droplet emulsions in Sapphire’s wells using (b) the naica® Geode, a pressurized
thermocycler. (c) The naica® 6-color prototype reader, an automated fluorescent microscope for the acquisi-
tion of droplet fluorescence in six distinct channels, and (d) the Crystal Miner analysis software extended to six
dimensions for automated data extraction and quantification

p.L861Q, or p.T790M mutations (for more details about these

assays please see https://www.stillatechnologies.com/application-
notes/). Here, we detail a protocol for multiplexed detection of
the 19 most prevalent sensitizing and resistance EGFR mutations in
NSCLC using our 6-color Crystal Digital PCRTM prototype plat-
form (Fig. 1) (see Note 1). Building on our previously developed
triplex EGFR assays, we incorporated additional EGFR mutations
relevant to NSCLC patient monitoring to optimize a single multi-
plexed assay (Fig. 2a) capable of detecting five sensitizing mutations
(p.L858R, p.L861Q, p.G719S, p.G719A, p.G719C), 12 different
indels in exon 19, and two resistance mutations (p.T790M and p.
C797S) in both tumor tissue and ctDNA from NSCLC patients
[7]. The multiplexed assay was characterized on serial dilutions of
nine DNAs, each bearing one of the targeted EGFR mutation in a
background of WT DNA. Mutant allele fractions ranging from
2.5% to 0.1% were detected with an excellent linearity (Fig. 2b).
This increase in the number of detection channels, combined with
the sensitivity and precision of digital PCR, and a multiplexing
strategy based on clinician diagnostic needs advance the current
limits of tumor genotyping and liquid biopsy monitoring in
oncology.

2 Materials

2.1 General 1. Barrier/filter tips (sterile and aerosol resistant).

Plasticware 2. Micropipettes.
and Laboratory
3. Powder-free gloves.
Equipment
4. Benchtop microcentrifuge and 1.5 mL microcentrifuge tubes.
5. Vortex.
6. PCR reaction microtubes (sterile, 1.5 mL).
130 Jordan Madic et al.

Fig. 2 (a) Genomic localization of the primers and probes, and size of the amplicons in the EGFR 6-color digital
PCR assay. The length of all amplicons was maintained as short as possible (<108 bp) to ensure their
detection compatibility in fragmented DNA populations typical of ctDNA extracted from plasma and FFPE-
extracted DNA. This 6-color EGFR assay includes seven probes targeting G719A/C/S, L858R and L861Q
sensitizing, and T790M and C797S resistance mutations. Because Exon 19 indels display variable genomic
sequences, they are detected using a drop-off assay comprised of a reference probe complementary to both
the mutant and the wild-type allele, and a second drop-off probe that spans the mutation site but is uniquely
complementary to the wild-type sequence. In the presence of a wild-type allele, both probes hybridize with
their target leading to a double positive signal. However, in the presence of a mutant allele, only the reference
probe but not the drop-off probe will anneal to its target leading to a simple positive signal. For more details
about drop-off assays, see https://www.stillatechnologies.com/application-notes/. (b) Evaluation of the per-
formance of the EGFR 6-color Crystal Digital PCRTM assays. The mutations were detected with a 95%
confidence level in serial dilutions ranging from 2.5% to 0.1% of mutant DNA in a background of 104 copies of
wild-type DNA and 400 copies of the internal positive control DNA (ΦX174 bacteriophage) per 25μL reaction.
N ¼ 3 replicates were performed for each dilution point. The displayed confidence intervals are the means of
the theoretical confidence intervals accounting for sampling and partitioning error at a 95% confidence level.
The coefficients of determination of linear regressions performed between input and measured copies per
reaction ranged from R2 ¼ 0.9917 to R2 ¼ 1, depending on the mutation targeted
 High-Plex Detection of EGFR Mutations in NSCLC 131

7. Sterile laminar flow hood for PCR mix assembly and for DNA
template addition.
8. NanoDrop ND-3300 Spectrophotometer or Qubit fluorome-
ter (Thermo Scientific) or real-time thermocycler.

2.2 PCR Equipment Crystal Digital PCRTM, Crystal Miner, Crystal Reader and naica®
and Software are registered trademarks of Stilla Technologies.
1. Stilla®’s digital PCR Sapphire chips.
2. Stilla®’s pressurized Geode thermocycler.
3. Stilla®’s 6-color digital PCR prototype reader.
4. Stilla®’s Crystal Miner Software extended to 6 colors (Crystal
Miner prototype) and Crystal Reader software.

2.3 DNA Extraction The 6-color digital PCR assay for EGFR mutation is compatible
and Quantification with DNA extracted from frozen tumor tissue, from formaldehyde-
fixed paraffin embedded (FFPE) tissue and from plasma. For tumor
DNA, the Qiagen AllPrep DNA/RNA Mini Kit is currently com-
patible with Stilla®’s naica® system. For formalin-fixed paraffin-
embedded (FFPE) tissue DNA extraction, Promega’s Maxwell®
RSC DNA FFPE Kit and Qiagen’s QIAamp DNA FFPE Tissue
Kit are both suitable. For plasma DNA extraction, Qiagen’s
QIAamp circulating nucleic acid kit and Qiagen’s QIAamp MinE-
lute Virus Spin Kit are suitable.

2.4 PCR Reagents 1. Quanta Biosciences PerfeCTa Multiplex qPCR ToughMix 5,
and Solutions containing DNA Hot Start polymerase with 50 –30 exonuclease
activity, DNA polymerase buffer and optimized concentrations
of deoxynucleoside triphosphate (dNTPs) and magnesium
chloride (MgCl2).
2. 1μM Fluorescein working solution.
3. Thermo Scientific Fastdigest MunI restriction enzyme 10 U/μ
L (see Note 2).
4. Primers and TaqMan® oligoprobes in 100μM stock solution
(Table 1) (see Note 3).
5. DNA template.
6. ΦX174 RF I DNA.
7. Commercially available genomic DNA bearing each the follow-
ing EGFR mutations: in-frame deletion-insertions (or indels)
in exon 19, p.L858R or p.L861Q or p.G719X, p.T790M and
p.C797S.
8. Molecular biology grade H2O.
132 Jordan Madic et al.

Table 1
Primers and probes of the EGFR 6-color digital PCR assay

Primers/ Targeted genomic 50 30

Probes variant Fluorophore Sequence modification
Del19- – – GTGAGAAAGTTAAAA
Forward TTCCCG
Del19- – – CACACAGCAAAGCAGAAAC –
Reverse
L858R- – – GCAGCATGTCAAGA –
Forward TCACAGATT
L858R- – – CCTCCTTCTGCATGGTATTC –
Reverse TTTCT
G719A- – – CCAACCAAGCTCTCTTGAGG –
Forward
G719A- – – CCTTATACACCGTGCCGAAC –
Reverse
T790M- – – GCAGGTACTGGGAGCCAAT –
Forward
T790M- – – GCATCTGCCTCACCTCCA –
Reverse
ΦX174- – – TCTTTCCAAGCAACAGCAG –
Forward
ΦX174- – – AATACTGACCAGCCGTTTGA –
Reverse
Del19ref- – FAM CACATCGAGGATTTCCTTG BHQ-1
probe TTGGC
Del19WT- E19-delins ATTOTM700 AGGAATT A{A}GA{G}AAG{C} BHQ-3
probe AACATC
L858R- c.2573T>G Cy®5 AGTTTGGC{C}C{G}CCCAA BHQ-3
probe
L861Q- c.2582T>A Cy®5 ACCCAG{C}T {G}TTTGGCCA BHQ-3
probe
G719A- c.2156G>C Cy®5 TGCTG{G}CCTCCGGTG BHQ-3
probe
G719C- c.2155G>T Cy®5 TG{C}TGTG{C}TCCGGTG BHQ-3
probe
G719S-probe c.2155G>A Cy®5 TG{C}TGAG{C}TCCGGTG BHQ-3
C797S- c.2389 T>A ROX CTTCGGCAGCCTCCTG MGB
probe1 eclipse®

(continued)
 High-Plex Detection of EGFR Mutations in NSCLC 133

Table 1
(continued)

Primers/ Targeted genomic 50 30

Probes variant Fluorophore Sequence modification
C797S- c.2390 G>C ROX CTTCGGCTCCCTCCTG MGB
probe2 eclipse®
T790M- c.2369C>T Yakima TGAGCT{G}{C}A{T}GATG BHQ-1
probe yellow®
ΦX174- – Cy®3 TCCGAGATTATGCGCCAAA BHQ2
probe TGC
Bases between {} are Locked Nucleic Acid (LNA) bases

9. 10 mM Tris–EDTA: prepare from stock solutions of 1 M Tris–

HCl pH 8.0 and of 0.5 M EDTA pH 8.0. To prepare 100 mL,
mix 1 mL of the 1 M Tris–HCl and 200μL of the 0.5 M EDTA,
and complete to 100 mL with 98.8 mL of water.
10. Carrier DNA or RNA.

3 Methods

Implement the following general recommendations to prevent

DNA carry-over contamination that can lead to false positives: All
reagents and plastic consumables must be sterile, DNA- and
DNAse-free, and of molecular biology grade. Always wear gloves
while handling reagents, materials, and equipment. Use commer-
cially available DNA decontamination solutions to clean all surfaces
dedicated to protocol handling. Areas dedicated to sample extrac-
tion, digital PCR mixture assembly, and digital PCR amplification
must be separated. As PCR products are the leading cause of
contamination, reagents and consumables brought in the post-
amplification area must not be reintroduced in the
pre-amplification areas.

3.1 DNA Template DNA for the 6-color Crystal Digital PCRTM assay for EGFR
Preparation mutation detection can be resuspended in molecular grade water
and PCR Setup or in 10 mM Tris-EDTA (TE). High quality DNA templates suit-
able for PCR amplification must be obtained using a standard
phenol/chloroform extraction method or one of the extraction
kits listed on Subheading 2.3. Regardless of the extraction method,
the DNA quantity and quality obtained must be assessed prior to
digital PCR amplification, and control samples should first be
assessed to ensure compatibility with the naica® system.
134 Jordan Madic et al.

1. Quantify the DNA templates using a NanoDropTM ND-3300

Spectrophotometer or a Qubit fluorometer or using real-time
PCR quantification, and check for DNA quality. A DNA tem-
plate is deemed as high quality when a 260 nm/280 nm absor-
bance ratio of ~1.8–2 and a 260 nm/230 nm absorbance ratio
in the range of 2.0–2.2 are obtained.
2. Use DNA quantities compatible within the detection range of
the naica® system, which is 0.0165 to 1650 ng of human DNA
per digital PCR reaction for the Sapphire chip (equivalent to
5 to 500,000 copies of DNA per 25μL reaction).
3. Prepare the 6-color digital PCR assay controls according to the
following guidelines: An internal control (IC) to monitor the
effect of PCR inhibition (most often due to sample impurity) is
highly recommended. This can be done through the addition
of 1μL of exogenous DNA from bacteriophage ΦX174 at a low
concentration (<500 copies per μL stock solution), and the
recommended ΦX174 primer and probe sequences (Table 1).
To stabilize the ΦX174 DNA stock solution, use carrier DNA
or RNA. Prepare the positive control DNA mix to assess assay
robustness by combining commercial genomic DNAs contain-
ing the following EGFR mutations: Exon 19 deletion, p.
L858R or pL861Q or p.G719X, p.T790M, p.C797S (either
c.2389 T>A or c.2390 G>C) and ΦX174 DNA. For optimal
results, the final concentration of each genomic DNA in the
solution should not exceed 5 ng per μL. The concentration of
ΦX174 DNA should not exceed 500 copies per μL in stock
solution (see Note 4).
4. Prepare a negative control DNA mix to assess the presence of
mutant DNA contaminants using WT DNA at a final concen-
tration of 33 ng per μL.
5. To start setting up the digital PCR reaction, thaw reagents on
ice, mix thoroughly before use and return unused reagents to
20  C.
6. In the designated pre-PCR clean area, prepare the primer pool
by mixing all the forward and the reverse primers at 100μM in a
stock solution to obtain a 10 working solution in which
primers will have the final concentrations indicated in Table 2.
7. Prepare individual working solutions of 20μM for each probe.
8. In a clean 1.5 mL microcentrifuge tube, prepare the digital
PCR reaction mix by assembling the reagents (5 PerfeCTa
ToughMix, Fluorescein, Primers, Probes, and MunI) as out-
lined in Table 3. Prepare enough master mix for all samples
including one positive control and one negative control per run
(i.e., for every 10 reactions).
 High-Plex Detection of EGFR Mutations in NSCLC 135

Table 2
Setup of the 10 primers/probes mix

Concentration Concentration
Primer/probes in 10 working in digital PCR
(100 μM stock solution) Volume (μL) solution (μM) reaction mix (μM)
L858R-Forward 1.5 1.5 0.15
L858R-Reverse 1.5 1.5 0.15
T790M-Forward 7.5 7.5 0.75
T790M-Reverse 7.5 7.5 0.75
Del19-Forward 5 5 0.5
Del19-Reverse 5 5 0.5
G719A-Forward 5 5 0.5
G719A-Reverse 5 5 0.5
ΦX174-Forward 2.5 2.5 0.25
ΦX174-Reverse 2.5 2.5 0.25
Del19ref-probe (FAM) 5 5 0.5
TM
Del19WT-probe (ATTO 700) 10 10 1
®
L858R-probe (Cy 5) 0.75 0.75 0.075
®
L861Q-probe (Cy 5) 0.75 0.75 0.075
G719A-probe (Cy®5) 1.25 1.25 0.125
®
G719C-probe (Cy 5) 1.25 1.25 0.125
®
G719S-probe (Cy 5) 1.25 1.25 0.125
C797S-probe1 (ROX) 7.5 7.5 0.75
C797S-probe2 (ROX) 7.5 7.5 0.75
®
T790M-probe (Yakima yellow ) 7.5 7.5 0.75
®
ΦX174-probe (Cy 3) 7.5 7.5 0.75
H2O qsp 100μL 6.75 – –

9. Dispense the digital PCR reaction mix in separate microcen-

trifuge tubes and close the lids.
10. Open only one tube at a time to avoid cross-contamination,
add the DNA template individually to each reaction tube (1μL
for positive and negative controls, 0.5μL for the IC ΦX174
DNA and from 1.0 to 13.5μL for the samples) and complete
each tube with water to a final reaction volume of 25μL.
11. Close the lids and vortex the tubes thoroughly.
136 Jordan Madic et al.

Table 3
6-color Crystal Digital PCRTM assay setup for one reaction

Reagents Volume (μL) Final concentration

PerfeCTa Multiplex qPCR ToughMix 5 1
Fluorescein 1μM 2.5 100 nM
Primers/probes mix 10 2.5 1
Fastdigest MunI 10 U/μL 0.5 0.2 U/μL
ΦX174 DNA 500 cp/μL 0.5 10 cp/μL
DNA template 1–13.5
To 25μL with H2O

Fig. 3 Layout of the consumable Sapphire chip. (a) Sapphire chip with the white sealing caps to be removed
from the inlet ports. The arrows point to the white inlet port caps and the blue outlet port caps. (b) Pipetting of
the sample in the inlet port. (c) Sapphire chip during preparation for thermocycling showing the tall PCR-ready
white cap being placed on each inlet port

12. Briefly centrifuge the microcentrifuge tubes to collect the

entire volume at the bottom of each tube.
13. Remove the white caps of the inlet ports of the Sapphire chip
(Fig. 3a) and gently pipette 25μL of the reaction mixture over
the oil phase in each inlet port (Fig. 3b), being extremely
careful not to introduce air bubbles. Place a tall PCR-ready
white cap on each inlet port (Fig. 3c). Avoid preparing more
than 3 chips at a time to prevent evaporation of the oil
contained within the chips.
14. Position the chips on the thermal plate of the Geode.
15. Close the lid of the Geode and run the thermocycling program
detailed in Table 4.
 High-Plex Detection of EGFR Mutations in NSCLC 137

Table 4
EGFR 6-color Cystal Digital PCRTM thermocycling program

Step Temperature ( C) Pressure (mbar) Duration (min)

Partition 40 AP to +950 12
Initial denaturation 95 +950 3
PCR (50 cycles) 95 +950 0.5
64 +950 0.5
Release Down to 25 Down to AP 33
AP ambient pressure

3.2 Setting 1. In order to detect a unique fluorophore per fluorescence chan-

up the Fluorescence nel, signal spillover from adjacent channels must be deduced
Spillover for each channel using a color compensation matrix unique to
Compensation Matrix each assay.
Using Control Samples 2. The color compensation matrix is automatically calculated by
the Crystal Miner software following a monocolor control
experiment where only one fluorescent channel at a time has
positive droplets.
3. In the pre-PCR clean designated area, prepare the primer pool
by mixing the indicated amounts of each forward and reverse
primer 100μM stock solution to obtain a 20 working solution
in which each primer has the indicated final concentration
(Table 5) (see Note 5).
4. For the FAM mono control, which detects the EGFR Del19
reference sequence, assemble the digital PCR reaction by com-
bining all reagents in a clean 1.5 mL microcentrifuge tube as
indicated in Table 6.
5. For each of the Yakima Yellow®, Cy®3, ROX, and Cy®5 mono-
color controls, assemble the digital PCR reaction by combining
the reagents (PerfeCTa ToughMix, Fluorescein, Primers,
Probes, and MunI) as outlined in Table 7.
6. Divide the reaction mixture in four reaction tubes (Yakima
Yellow®, Cy®3, ROX, and Cy®5) and add the corresponding
genomic DNA individually to each reaction tube: p.T790M for
Yakima Yellow®, ΦX174 for Cy®3, p.C797S for ROX and p.
L858R or p.L861Q or p.G719X for Cy®5 and complete each
tube with water to a final volume of 25μL.
7. For the ATTOTM700 monocolor control, assemble the digital
PCR reaction as outlined in Table 8.
8. Prepare an additional non template control (NTC) by mixing
all reagents but omitting the DNA template.
138 Jordan Madic et al.

Table 5
Setup of the 20 primer mix

Concentration Final concentration

in 20 working in digital PCR
Primer (100 μM stock solution) Volume (μL) solution (μM) reaction mix (μM)
L858R-Forward 3 3 0.15
L858R-Reverse 3 3 0.15
T790M-Forward 15 15 0.75
T790M-Reverse 15 15 0.75
Del19-Forward 10 10 0.5
Del19-Reverse 10 10 0.5
G719A-Forward 10 10 0.5
G719A-Reverse 10 10 0.5
ΦX174-Forward 5 5 0.25
ΦX174-Reverse 5 5 0.25
H2O 14 – –

Table 6
Crystal Digital PCRTM composition of the FAM mono control experiment

Reagents Volume (μL) Final concentration

PerfeCTa Multiplex qPCR ToughMix 5 5 1
Fluorescein 1μM 2.5 100 nM
Primer mix 20 (from Table 5) 1.25 1
®
L858R-probe (Cy 5) 20μM 0.09 75 nM
L861Q-probe (Cy®5) 20μM 0.09 75 nM
®
T790M-probe (Yakima yellow ) 20μM 0.93 750 nM
Del19ref-probe (FAM) 20μM 0.62 500 nM
®
G719A-probe (Cy 5) 20μM 0.15 125 nM
G719C-probe (Cy®5) 20μM 0.15 125 nM
®
G719S-probe (Cy 5) 20μM 0.15 125 nM
C797S-probe1 (ROX) 20μM 0.93 750 nM
C797S-probe2 (ROX) 20μM 0.93 750 nM
ΦX174-probe (Cy®3) 20μM 0.31 250 nM
Fastdigest MunI 10 U/μL 0.5 0.2 U/μL
Wild-type DNA 1–9
To 25μL with H2O
 High-Plex Detection of EGFR Mutations in NSCLC 139

Table 7
Crystal Digital PCRTM composition of the Yakima Yellow®, Cy®3, ROX, and Cy®5 mono control
experiments

Reagents Volume (μL) Final concentration

PerfeCTa Multiplex qPCR ToughMix 5 5 1
Fluorescein 1μM 2.5 100 nM
Primer mix 20 1.25 1
®
L858R-probe (Cy 5) 20μM 0.09 75 nM
®
L861Q-probe (Cy 5) 20μM 0.09 75 nM
®
T790M-probe (Yakima yellow ) 20μM 0.93 750 nM
G719A-probe (Cy®5) 20μM 0.15 125 nM
®
G719C-probe (Cy 5) 20μM 0.15 125 nM
®
G719S-probe (Cy 5) 20μM 0.15 125 nM
C797S c.2389 T>A-probe (ROX) 20μM 0.93 750 nM
C797S c.2390 G>C-probe (ROX) 20μM 0.93 750 nM
®
ΦX174-probe (Cy 3) 20μM 0.31 250 nM
Fastdigest muni 10 U/μL 0.5 0.2 U/μL
DNA positive control 1–9
To 25μL with H2O

9. Place the chips containing the monocolor control experiment

on the Geode and run the thermocycling program (Table 4).
10. Place the chips in the naica® 6-color prototype reader and
launch the reading program.
11. After the reading step, open the ‘ncx’ files with the Crystal
Miner software.
12. Generate the full color compensation matrix via the automated
method based on the NTC and the monocolor controls, as
outlined in the naica® system user manual.

3.3 Data Acquisition 1. Following digital PCR amplification and Geode depressuriza-
and Analysis of Test tion, place the Sapphire chips in the naica® 6-color prototype
Samples reader and launch the reading program.
2. After the reading step, open the ‘ncx’ files with the Crystal
Miner software.
3. Load the already generated full color compensation matrix,
then apply the compensation to eliminate the spillover signal
between fluorescence channels in the sample experiments.
4. Set up the fluorescence threshold separating positive and nega-
tive clusters of droplets for each fluorescence channel according
140 Jordan Madic et al.

Table 8
Crystal Digital PCRTM composition of the ATTOTM700 monocolor control experiment

Reagents Volume (μL) Final concentration

PerfeCTa Multiplex qPCR ToughMix 5 5 1
Fluorescein 1μM 2.5 100 nM
Primer mix 20 1.25 1
®
L858R-probe (Cy 5) 20μM 0.09 75 nM
®
L861Q-probe (Cy 5) 20μM 0.09 75 nM
®
T790M-probe (Yakima yellow ) 20μM 0.93 750 nM
Del19WT-probe (FAM) 20μM 1.25 1μM
®
G719A-probe (Cy 5) 20μM 0.15 125 nM
®
G719C-probe (Cy 5) 20μM 0.15 125 nM
®
G719S-probe (Cy 5) 20μM 0.15 125 nM
C797S c.2389 T>A-probe (ROX) 20μM 0.93 750 nM
C797S c.2390 G>C-probe (ROX)20μM 0.93 750 nM
®
ΦX174-probe (Cy 3) 20μM 0.31 250 nM
Fastdigest MunI 10 U/μL 0.5 0.2 U/μL
Wild-type DNA 1–9
To 25μL with H2O

to the indication given in Fig. 4. To set up the threshold, the

dot-plot images of positive and negative controls should be
pooled with that of the samples. Make sure that following
threshold setting, the positive clusters of droplets in the posi-
tive control are counted as positive. Automated threshold
values are proposed by the software; however, if necessary,
adjust the threshold manually for each well.
5. EGFR Exon 19 deletions are detected using a drop-off assay
where wild-type alleles display a double positive signal
(FAM/ATTOTM700) and mutant alleles display a simple posi-
tive signal in the FAM channel. For threshold setting, it is
advised to use the polygon mode in the 2D dot plots to circle
the double positive droplets for wild-type quantification, the
FAM simple positive droplets for exon 19 deletion quantifica-
tion, and the double negative droplets to normalize exon
19 deletion quantification (Fig. 4).
6. For EGFR Exon 19 deletion quantification, all double positive
populations should be excluded from the analysis to minimize
 High-Plex Detection of EGFR Mutations in NSCLC 141

Fig. 4 Threshold setting using the FAM channel (x axis) for: (a) wild-type DNA and exon 19 deletion
(ATTOTM700 channel), (b) L858R, L861Q and G719X mutations (Cy®5 channel), (c) T790M mutations (YY®
channel), (d) C797S mutations (ROX channel), and (e) internal control (Cy®3 channel)

underestimating the mutant allele concentration (see https://

www.stillatechnologies.com/technical-notes/).
7. The concentrations of WT and mutant species in the samples
are calculated by multiplying the concentration in copies/μL
provided by the software by the dilution factor (see Note 6).

3.4 Limit of Blank 1. As false positives are assay-dependent and may arise from poly-
(LOB) Determination merase error, DNA contamination, or non-stringent PCR or
and Data probe conditions, it is necessary to determine a LOB for each of
Interpretation the target detection channels (for further information, see the
LOB Technical Note How to characterize the Limit of Blank
for digital PCR at https://www.stillatechnologies.com/techni
cal-notes/).
2. In our naica® 6-color Crystal digital PCRTM assay for EGFR
mutation detection, we recommend performing N  30 repli-
cate reactions in which the target template is excluded and
containing 33 ng (10,000 copies) of wild-type DNA per reac-
tion. Include at least one positive control for further threshold
settings.
3. For each of the targeted channels of detection, set the fluores-
cence threshold (Fig. 4) and report the number of false positive
events observed in each replicate.
4. Calculate the mean μ and the standard deviation σ of the false
positive distribution per detection channel using the following
formula: μcorr ¼μ + 1.645 σ√N where N is the number of
experiments performed. The LOB with a 95% confidence level
in number of false positive partitions per reaction is determined
142 Jordan Madic et al.

Table 9
Determination of the LOB of the 6-color Crystal Digital PCRTM assay for  mutations. Detection assays
were performed on 30 replicate reactions containing only wild-type DNA. The number of false positive
droplets was reported in detection channels corresponding to each of the targeted EGFR mutations.
The false positive distribution is fitted on Normal law approximation and Chernoff’s inequality to
determine a LOB expressed in number of droplets per channel of detection

No tests with No tests with No tests with

No tests with 2 false 3 false 4 false LOB
EGFR 1 false positive positives positives positives (No droplets)
T790M (Yakima 6 1 1 0 4
yellow®)
L858R/ 15 2 3 1 6
L861Q/
G719
(Cy®5)
E19-Dels 5 1 0 0 3
(FAM)
C797S (ROX) 8 0 0 0 3

by fitting the calculated μcorr on Normal Law approximation

and Chernoff’s inequality (Table 9). For further explanations,
see the following link: https://www.gene-pi.com/wp-content/
uploads/2018/03/Memo_LOB_calculation_method.pdf.
5. Once the LOB is determined for each target, a given target is
said to be detected if the number of observed positive events
for the target is strictly greater than the target-specific LOB.
6. Ensure that the negative controls included in every sample
assessing experiment should display in 95% of the cases either
no false positive droplets or a quantity of false positives num-
bering less than the LOB. If the number of false positives is
superior to the LOB, it may signal the presence of contami-
nants in the experiment. In this case, it is preferable to repeat
the entire experiment after taking measures to remove potential
contaminants in the workflow (surface cleaning, renewing all
stock solutions, etc.).
7. Assess the presence of PCR inhibitors by comparing the signal
given by the internal control in the samples with the signal
given by the internal control in the positive control. In the
presence of inhibitors, the separation of positive and negative
clusters is diminished, and it is advised to dilute the DNA
template and redo the experiment.
 High-Plex Detection of EGFR Mutations in NSCLC 143

4 Notes

1. Currently, Stilla® offers a 3-color naica® Prism3 reader and the

Crystal Miner software. The optimization of the 6-color digital
PCR assay for EGFR mutation detection has been performed
on a prototype 6-color reader instrument and a prototype of
6-dimensional Crystal Miner software. A commercial version of
this 6-color reader instrument and analysis software will be
available in 2021. For further information on our 3-Color
Crystal Digital PCRTM assays for EGFR mutation detection,
see our Application Note at https://www.stillatechnologies.
com/application-notes/.
2. Fragmentation of DNA using MunI restriction enzyme is
advised when assessing high molecular weight DNA (genomic
DNA), as spatial competition between closely located primer
pairs may occur and result in unexpected double positive clus-
ters. However, in the presence of FFPE and plasma samples
(sample in which the DNA is naturally fragmented), the use of
MunI enzyme for digestion is not necessary. In any new assay, it
is important to always verify that the chosen restriction enzyme
does not cut the targeted amplicons. Alternatively, fragmented
DNA obtained following sonication can be used for high
molecular weight DNA testing. However, as over fragmenta-
tion may skew the quantitation results, the DNA population
should not be overly sonicated.
3. The fluorophores proposed in this version of the assay have
been validated on Stilla®’s digital PCR platform and are com-
patible with Stilla®’s digital PCR oil chemistry and detection
instrument. Changing the fluorophores may result in subopti-
mal fluorescence intensity or excessive spillover.
4. The positive control DNA mix includes a limited amount of
genomic DNA in order to avoid droplet “rain” (droplets from
which the signal is located between the positive and the nega-
tive clusters), which can render the threshold setting ambigu-
ous. The internal positive control ΦX174 DNA is included at a
low concentration in order to limit the occurrence of competi-
tion in the multiplex PCR.
5. Because the fluorescence spillover is dependent on the fluoro-
phores used and on the efficiency of the PCR reaction, the
monocolor control experiments must be performed using the
same primers and probes used for the final 6-color digital PCR
EGFR assay.
6. The quantitation results for the mutant and the wild-type
alleles are given in absolute number of copies/μL. It is possible
to derive a mutant allele fraction (MAF) from these values by
dividing the quantity of mutant EGFR fragments measured in
144 Jordan Madic et al.

each of the detection channel by the quantity of the wild-type

EGFR fragments measured in FAM and ATTOTM700 chan-
nels. It should also be noted that there is an exception for
measuring the MAF of Exon 19 deletion where the quantity
of mutant fragments should be divided by the sum of the
mutant fragments and the wild-type fragments.

References

1. Barlesi F, Mazieres J, Merlio J et al (2016) Rou- acquired resistance to EGFR-TKI therapy in

tine molecular profiling of patients with 155 patients with EGFR-mutant lung cancers.
advanced non-small-cell lung cancer: results of Clin Cancer Res 19(8):2240–2247
a 1-year nationwide programme of the French 5. Wang S, Tsui ST, Liu C et al (2016) EGFR
cooperative thoracic intergroup (IFCT). Lancet C797S mutation mediates resistance to third-
387(10026):1415–1426 generation inhibitors in T790M-positive non--
2. Reguart N, Remon J (2015) Common EGFR- small cell lung cancer. J Hematol Oncol 9(1):59
mutated subgroups (Del19/L858R) in 6. Jovelet C, Ileana E, Le Deley MC et al (2016)
advanced non-small-cell lung cancer: chasing Circulating cell-free tumor DNA analysis of
better outcomes with tyrosine kinase inhibitors. 50 genes by next-generation sequencing in the
Future Oncol 11(8):1245–1257 prospective MOSCATO trial. Clin Cancer Res
3. Lee CK, Davies L, Wu YL et al (2017) Gefitinib 22(12):2960–2968
or erlotinib vs chemotherapy for EGFR 7. Madic J, Jovelet C, Lopez J et al (2019) Correc-
mutation-positive lung cancer: individual patient tion: EGFR C797S, EGFR T790M and EGFR
data meta-analysis of overall survival. J Natl Can- sensitizing mutations in non-small cell lung can-
cer Inst 109(6) cer revealed by six-color crystal digital PCR.
4. Helena AY, Arcila ME, Rekhtman N et al (2013) Oncotarget 10(13):1345
Analysis of tumor specimens at the time of
 Chapter 11

Detection of MET Exon 14 Skipping Alterations in Lung

Cancer Clinical Samples Using a PCR-Based Approach
Jane S. Y. Sui, Stephen P. Finn, and Steven G. Gray

Abstract
The receptor tyrosine kinase (RTK) c-MET plays important roles in cancer, yet despite being frequently
overexpressed, clinical responses to targeting this receptor have been limited in the clinical setting. A
singular significant challenge has been the accurate identification of biomarkers for the selection of
responsive patients. However, recently mutations which result in the loss of exon 14 (called METex14
skipping) have emerged as novel biomarkers in non-small cell lung carcinomas (NSCLC) to predict for
responsiveness to targeted therapy with c-MET inhibitors. Currently, the diverse genomic alterations
responsible for METex14 skipping pose a challenge for routine clinical diagnostic testing. Next generation
sequencing (NGS) is the current gold standard for identifying the diverse mutations associated with
METex14, but the cost for such a procedure remains to some degree prohibitive as often NGS is requested
on a case-by-case basis, and many hospitals may not even have the capacity or resources to conduct NGS.
However, PCR-based approaches to detect METex14 have been developed which can be conducted in
most routine hospital laboratories and may therefore allow a cost-effective approach to pre-screen patients
that may respond to c-MET inhibitors prior to conducting NGS, or until all patients will have NGS
conducted as routine practise. In this chapter, we describe one such PCR-based approach for screening
samples for the detection of METex14 in NSCLC.

Key words Met Exon 14 Skipping, Diagnostic Assay, PCR, Non-Small Cell Lung Cancer, Screening

1 Introduction

c-MET is a receptor tyrosine kinase (RTK) which plays a role in

tissue remodeling and morphogenesis. Its only known ligand is
hepatocyte growth factor/scatter factor (HGF/SF), and binding
of this ligand to c-MET results in hetero-dimerization of this RTK
with subsequent activation resulting in downstream induction of
PI3K/mTOR, STAT, and MAPK pathways [1]. When c-MET is
abnormally activated this results in increased cell survival, cell pro-
liferation, epithelial-mesenchymal transition (EMT), invasion and
angio-invasion, ultimately promoting oncogenesis. Alterations of
c-MET, such as protein overexpression, gene amplification and
mutations in c-MET gene juxtamembrane and semaphorin

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_11, © Springer Science+Business Media, LLC, part of Springer Nature 2021

145
146 Jane S. Y. Sui et al.

domains have been described in lung cancer [2] and are associated
with a poor prognosis in the non-small cell lung carcinomas
(NSCLC) subtype [3].
Despite the demonstration that c-MET is significantly altered
in NSCLC, clinical trials targeting this receptor in unselected
patients have overall proved disappointing [2, 4]. More recently
two subgroups of patients have been identified that may benefit
from therapies that target c-MET. The first subgroup involves
patients with the adenocarcinoma histological subtype who exhibit
high level amplification of the c-MET gene (and represent only
2.0–2.4% of adenocarcinoma patients) [2, 5, 6]. The second sub-
group involves splicing mutations which result in the loss of exon
14 (called METex14). These mutations result in an in-frame dele-
tion of the c-MET juxtamembrane domain of the c-MET receptor,
which contains the CBL E3-ubiquitin ligase-binding site leading to
inhibition of degradation of the receptor, and as a consequence
prolonging its activity [7].
METex14 alterations have also been identified in up to 3–4% of
NSCLC [2], most frequently in the adenocarcinoma subtype but
also in squamous cell carcinoma subtype. METex14 skipping is also
associated with varying clinical phenotypes depending on the his-
tologic subtype of the tumor encountered. Generally speaking,
patients with METex14 are significantly older than those without
c-MET mutations, less likely to have a history of tobacco use, and
predominantly female [8, 9]. Interestingly, a high incidence of Met
exon 14 skipping has been reported in sarcomatoid carcinoma of
the lung, although the incidence varies between studies (ranging
from 3% up to 31.8% of cases) [3, 9–16].
The increased sensitivity of METex14 skipped patients to
c-MET inhibitors is now well established from several case studies
[2], and various clinical trials of c-MET tyrosine kinase targeted
therapies in METex14 mutated NSCLC are currently ongoing
[4]. As such detecting METex14 skipped patients is emerging as a
novel biomarker for treatment decision-making. However, the
diverse genomic alterations responsible for METex14 skipping
pose a challenge for routine clinical diagnostic testing
[17, 18]. Next generation sequencing (NGS) is the current gold
standard for identifying these diverse mutations associated with
METex14, but the cost for such a procedure remains to some
degree prohibitive as often NGS is requested on a case by case
basis, and many hospitals may not even have the capacity or
resources to conduct NGS [19].
To this end, several groups have developed PCR-based
approaches to screen patients for the presence of METex14
[19, 20]. In this chapter, we describe a PCR-based technique for
screening samples for the detection of METex14 in NSCLC.
 PCR Based Detection of METex14 147

2 Materials

The reagents and chemicals used should be of analytical grade and

stored in accordance with the manufacturers’ instructions. Buffers
and solutions should be prepared using distilled water and stored at
room temperature unless stated otherwise. Use appropriate per-
sonal protective equipment at all times. All local regulations in
relation to the handling and disposal of reagents and chemicals
must be followed.

2.1 Isolation of Total 1. Qiagen TissueLyser.

RNA from Fresh Tissue 2. TRI reagent® for nucleic acid and protein isolation.
3. 1-Bromo-3-chloro-propane (BCP).
4. Isopropanol (2-isopropanol).
5. Molecular Biology Grade water (0.03 micron filtered, DNase,
RNase and Protease not detected).
6. Ethanol (EtOH) wash buffer: 70% solution in molecular biol-
ogy grade water.
7. NanoDrop spectrophotometer, or equivalent, to measure qual-
ity and purity of DNA/RNA/proteins.

2.2 Isolation of Total 1. Xylene Substitute.

RNA from Formalin 2. Qiagen RNeasy FFPE Kit.
Fixed Paraffin
3. Sterile, RNase-free pipette tips.
Embedded (FFPE)
Sections 4. 1.5 mL or 2 mL centrifuge tubes (PCR Performance Tested
and certified DNA/DNase/RNase/PCR inhibitor free).
5. Microcentrifuge (with rotor for 2 mL tubes).
6. Vortex.
7. 96% ethanol (EtOH).
8. Disposable gloves.
9. Heating block or water bath capable of incubation at 80
C.
10. NanoDrop spectrophotometer, or equivalent, to measure
quality and purity of DNA/RNA/proteins.

2.3 PCR Detection 1. Verso 1-Step RT-PCR kit: Comprising proprietary Verso
of METex14 Skipped Enzyme Mix, 2 1-Step PCR ReddyMix and RT Enhancer
Samples (see Note 1).
2. 0.2 mL PCR tubes (PCR Performance Tested and certified
DNA/DNase/RNase/PCR inhibitor free).
3. gBlocks Gene Fragments for positive controls and constructing
standard curves.
4. DNA primers (standard desalting purified):
148 Jane S. Y. Sui et al.

METex14 FWD: 50 -TTGGGTTTTTCCTGTGGCTG-30 .

METex14 REV: 50 -GGATACTGCACTTGTCGGCA-30 .
5. 50 TAE buffer: 2.0 M Tris–acetate, 50 mM EDTA, pH 8.0.
Weigh 242 g of Tris base and transfer to a 1 L glass bottle
containing approximately 500 mL of water. Add 57.1 mL of
glacial acetic acid and 100 mL of 0.5 M EDTA (pH 8.0) buffer.
Place a magnetic stir bar (flea) into the bottle and place atop of
a magnetic stirrer on a medium speed for approximately 30 min
until all of the Tris base has dissolved. Transfer into a graduated
cylinder make up to 1 L with water, and transfer to a 1 L
storage bottle (see Note 2).
6. Molecular biology grade agarose.
7. DNA ladder.
8. Electrophoresis set.

3 Methods

Care must be taken when working with RNA. Designate a special

area for RNA work only. Treat all surfaces with an RNase inactivat-
ing agent, use RNase-free plastic and molecular biology grade
water. Use appropriate personal protective equipment.

3.1 RNA Isolation 1. Homogenize tissue samples in TRI Reagent (1 mL/

from Fresh Tissues 50–100 mg tissue) in a 1.5 or 2 mL microfuge tube using the
TissueLyser (see Note 3).
2. Store the homogenate for 5 min at room temperature to permit
the complete dissociation of nucleoprotein complexes.
3. Add 100 μL BCP to each sample (see Note 4), invert for 15 s,
and incubate for 10 min. Centrifuge samples at 13,500  g for
15 min.
4. Transfer colorless upper aqueous phase (containing RNA) to a
clean 1.5 mL microfuge tube and discard the remaining phases
(see Note 5).
5. Add 500 μL isopropanol (2-propanol) to each sample. Mix by
inversion and incubate for 10 min. Centrifuge at 13,500  g
for 8 min.
6. Decant supernatant and add 1 mL EtOH wash buffer to RNA
pellet. Incubate for 5 min.
7. Centrifuge at 13,500  g for 5 min and decant EtOH wash.
Air-dry pellet for 5 min and resuspend in 50 μL water (see
Notes 6 and 7).
8. Quantify the RNA using a NanoDrop (see Notes 8 and 9).
9. Proceed to Subheading 3.3 or store at 20
C (short-term) or
80
C (long-term) until required.
 PCR Based Detection of METex14 149

3.2 RNA Isolation 1. The starting material for RNA purification should be freshly
from FFPE Tissues cut sections of FFPE tissue, each with a thickness of up to
20 μm. Thicker sections may result in lower nucleic acid yields,
even after prolonged incubation with proteinase K. Up to
4 sections, each with a thickness of up to 10 μm and a surface
area of up to 250 mm2 can be combined in one preparation.
2. Follow the detailed instructions provided by Qiagen in their
instructions for RNeasy FFPE Kit isolation of RNA for depar-
affinization of sections using xylene substitute (Page 22, Appen-
dix A) (For FFPE sections provided on slides see Note 10).
3. Complete isolation of total RNA using the detailed instructions
provided for the RNeasy FFPE Kit protocol.
4. Quantify the amount of total RNA isolated using a Nanodrop
(see Notes 8 and 9).
5. Proceed to Subheading 3.3 or store at 20
C (short-term) or
80
C (long-term) until required.

3.3 Detection 1. Follow the detailed instructions provided by Thermo Scientific

of METex14 Skipped in their protocol for use of the Verso 1-Step RT-PCR kit. Use
Samples Using PCR 100 ng of total RNA per reaction for 1-step RT-PCR using the
primers described in Subheading 2.3 above (see Note 11).
2. The PCR cycling conditions for 1-step RT-PCR are as follows:
cDNA synthesis step 50
C—15 min; followed by Verso
Enzyme inactivation 95
C—2 min; then 45 cycles of amplifi-
cation with denaturation 95
C—20 s; annealing 60
C—30 s;
extension 72
C—60 s, and a final extension step of 72
C—
5 min.
3. Include gBlocks as internal controls (see Notes 12–14).
4. Proceed to Subheading 3.4 to analyze results by electrophore-
sis on 2% agarose gels.

3.4 Agarose Gel 1. All PCR products are resolved by electrophoresis on a 2%

Electrophoresis agarose gel (see Note 15) containing ethidium bromide (see
Note 16).
2. Weigh 2 g of agarose and dissolve in 100 mL 1 TAE by
boiling in a microwave for 2–3 min on a medium heat setting.
Check periodically and swirl repeatedly until all agarose has
dissolved.
3. Allow solution to cool to 37
C (hand hot), before the addition
of ethidium bromide, to achieve a final concentration of 1 μg/
mL.
4. Pour the 2% agarose solution into a gel tray with well-forming
combs to a depth of 3–5 mm and allow solidification (approxi-
mately 20–30 min). Once solidified pour sufficient 1 TAE
buffer to the preferred level as indicated on gel rig. Remove
combs.
150 Jane S. Y. Sui et al.

5. Load a 10 μL aliquot of each PCR product (including negative

control) to individual wells. Load an appropriate DNA ladder.
Keep voltage constant and allow electrophoresis to run for
approximately 30–40 min (depending on voltage) until dye
front is approximately ¾ of the way down the gel and visualize
under a UV gel system (see Note 17).
6. Figure 1 is provided for illustration purposes and shows suc-
cessful detection of METex14 skipped PCR product.

Fig. 1 End-point PCR detection of METex14 in NSCLC. (a) Amplification of wildtype amplicon is limited
primarily to high-quality RNA. Samples from snap-frozen tumor tissues versus a sample isolated from an FFPE
embedded specimen show that the integrity/quality of RNA is important for detecting WT MET in FFPE
embedded samples. WT MET can be detected in total RNA isolated from snap-frozen tumor tissues but not in
total RNA isolated from FFPE samples. In contrast, METex14 can be detected in total RNA isolated from FFPE
samples. A subset of FFPE samples were subsequently examined for expression of 18S rRNA. Amplification
was observed across all FFPE specimens, suggesting that the size of the amplicon is critical for detection and
that the amplicon for WT MET is at the limit of detection in FFPE samples. (b) Confirmation of the specificity of
the MetEx14 assay on FFPE extracted RNA from known METex14 skipped or MET WT FFPE NSCLC cases.
Patient samples were provided from three centers as follows: St James’s Hospital (SJH); St Vincent’s
University Hospital (SVUH) and St Gallen (SG). Positive controls used are as follows: A549 is a cell line with
a known WT MET, H59 (NCI-H596) is a cell line with a known MetEx14 MET. (This figure is derived from one
published originally in O’Brien et al. [19]). (© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This
article is an open access article distributed under the terms and conditions of the Creative Commons
Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/))
 PCR Based Detection of METex14 151

4 Notes

1. (From the original protocol). Verso™ Enzyme Mix includes

RNase inhibitor to protect RNA templates from degradation
and Verso Reverse Transcriptase, which is highly sensitive and
active at high temperatures. Verso is an RNA-dependent DNA
polymerase with a significantly attenuated RNase H activity.
Verso can synthesize long cDNA strands, up to 11 kb, at a
temperature range of 42
C to 57
C. Verso can reverse tran-
scribe total RNA from 1 pg to 1 g. The recommended amount
of total RNA template to use in 1-step kits is between 1 pg and
100 ng.
2 1-Step PCR ReddyMix is a proprietary reaction buffer
which has been optimized to allow both reverse transcription
and PCR amplification to occur in the same reaction across a
wide range of templates. It contains Thermo Scientific Ther-
moPrime DNA Polymerase stable at high temperature. Ther-
moPrime has 50 to 30 polymerization and exonuclease activity
but lacks 30 to 50 exonuclease activity (proofreading). Reddy-
Mix includes a dye and precipitant to facilitate the visualization
and gel loading.
RT Enhancer is included to remove contaminating DNA,
eliminating the need for DNase I treatment. It degrades double
stranded DNA during the transcription of RNA and is inacti-
vated after 2 min at 95
C.
2. It is more convenient to make a 50 stock of Tris–Acetate–
EDTA (TAE) buffer and dilute to 1 as required (20 mL of
50 stock in 1 L of water). We also routinely purchase a
commercial stock of 0.5 M EDTA pH 8.0.
3. Alternative means of homogenization are completely accept-
able and include glass-Teflon homogenizers, tissue pulverizers
(e.g., Bessman Tissue Pulverizer; BioSpec Tissue Pulverizer),
Bioruptor or similar sonication devices.
4. On occasion we have found that using 150 μL BCP may
improve isolation.
5. TRI reagent® can be used for the isolation of RNA, DNA, and
protein from one sample. After the initial centrifugation step
(following addition of BCP), the sample separates into three
phases. The upper (colorless) aqueous phase contains the RNA,
while the interphase (middle) contains the DNA and the
organic lower phase (pink) contains the protein. For the pur-
poses of isolating RNA, we find that it is best leave some of the
colorless phase behind to avoid/reduce contaminating the
RNA. If isolating DNA and protein, please follow the detailed
protocol provided by the manufacturer.
152 Jane S. Y. Sui et al.

6. The volume of molecular grade water will vary depending on

the size of the RNA pellet. For smaller pellets use approxi-
mately 20 μL water for solubilisation.
7. To ensure full solubilisation it is recommended to incubate the
samples at 55–60
C for 10–15 min.
8. The optical density OD 260:280 purity ratio should be approx-
imately between 1.8 and 2. If this ratio is lower, this may
represent to protein and/or phenol contamination, which
may require additional purification.
9. The use of alternative measurement devices for small volumes is
also acceptable (e.g., Qubit Fluorometer or Agilent
Bioanalyzer)
10. Treat slides by covering the sections with Xylene substitute.
Leave for 1–2 min, tip off excess liquid onto tissue paper, then
using a disposable scalpel scrape the deparaffinized tissue sec-
tion into a 1.5 or 2 mL tube and continue with the protocol as
outlined in Appendix A.
11. Especially with regard to RNA isolated from FFPE samples, it is
useful to include an internal control to ensure that RNA is
present in the extracted sample. We use 18S ribosomal RNA
as such a control. The primers are as follows:
18S rRNA FWD: 50 -GATGGGCGGCGGAAAATAG-30 .
18S rRNA REV: 50 -GCGTGGATTCTGCATAATGGT-30
The same PCR amplification conditions as described in
Subheading 3.3 are used.
12. gBlocks engineered to exactly mimic the c-MET wildtype and
METex14 sequences can be used as internal positive controls,
or to assess the sensitivity of detection using the described
assay. An example is shown in Fig. 2.
The sequences for the individual gBlocks are as follows:
c-MET Wildtype (50 ! 30 ).
TGATTGCTGGTGTTGTCTCAATATCAACAGCACTGT-
TATTACTACTTGGGTTTTTCCTGTGGCTGAAAAA-
GAGAAAGCAAATTAAAGATCTGGGCAGTGAAT-
TAGTTCGCTACGATGCAAGAGTACACACTCCT-
CATTTGGATAGGCTTGTAAGTGCCCGAAGTG-
TAAGCCCAACTACAGAAATGGTTTCAAAT-
GAATCTGTAGACTACCGAGCTACTTTTCCAGAA-
GATCAGTTTCCTAATTCATCTCAGAACGGTT-
CATGCCGACAAGTGCAGTATCCTCTGACAGA-
CATGTCCCCCATCCTAACTAGTGGGGACTCTGA-
TATATCCAGTCCATTACTGCAAAATAC.
METex14 (50 ! 30 ).
 PCR Based Detection of METex14 153

Fig. 2 Assay Sensitivity for end-point PCR detection of METex14 skipping. Sensitivity to detect MetEx14 was
measured using GBlocks with limiting amounts/percentages of WT/MET Exon 14 as indicated. The limit of
detection was found to be 10%. (This Figure is derived from one published originally in O’Brien et al. [19]).
(© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed
under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.
org/licenses/by/4.0/))

TGGAAGCAAGCAATTTCTTCAACCGTCCTTG-
GAAAAGTAATAGTTCAACCAGATCAGAATTTCA-
CAGGATTGATTGCTGGTGTTGTCTCAATATCAA-
CAGCACTGTTATTAC-
TACTTGGGTTTTTCCTGTGGCTGAAAAAGA-
GAAAGCAAATTAAAGATCAGTTTCCTAATTCATCT-
CAGAACGGTTCATGCCGACAAGTGCAG-
TATCCTCTGACAGACATGTCCCCCATCCTAAC-
TAGTGGGGACTCTGATATATCCAGTCCATTACTG-
CAAAATACTGTCCACATTGACCTCAGTGCTC-
TAAATCCAGAGCTGGTCCAGGCAGTGCAGCATG-
TAGTGATTGGGCCCA.
13. For use in assays, gBlocks are reconstituted to a final concen-
tration of 10 ng/μL and mixed in the following proportions to
create the following standard curve (Table 1).
14. The Verso 1-Step RT-PCR kit also has a 1-step RT-qPCR
option, and so conceivably the current protocol could be
adapted to allow for real-time quantitative PCR detection of
METex14 skipped patients.
15. The percentage of agarose gel used depends on the size of the
PCR product, and in this instance we suggest the use of a
2% gel.
154 Jane S. Y. Sui et al.

Table 1
GBlock dilution for assays

METex14 MetWT
GBlock GBlock
(10 ng/μL) (10 ng/μL) Total DNA
Standard % METex14 (μL) (μL) (ng)
1 100 5 0 50
2 75 3.75 1.25 50
3 50 2.5 2.5 50
4 25 1.25 3.75 50
5 10 0.5 4.5 50
6 5 0.25 4.75 50
7 0 0 0 50

16. Ethidium bromide is a carcinogenic agent and requires careful

handling and proper disposal. Use appropriate personal protec-
tive equipment at all times. Compliance with all local rules
regarding its use and disposal is mandatory. Alternative dyes
such as GelRed® and GelGreen® etc., can be substituted.
17. PCR products were visualized and photographed under UV
light using a Vilber Lourmat Fusion Fx Imaging System in our
laboratory, but any similar gel documentation system can be
utilized. The expected PCR products using these primers are as
follows; c-Met WT: 235 bases; METex14: 94 bases; 18S
rRNA: 165 bases.

References
1. Van Der Steen N, Giovannetti E, Pauwels P the why, the how, the who, the unknown, and
et al (2016) cMET exon 14 skipping: from the inevitable. Lung Cancer 103:27–37
the structure to the clinic. J Thorac Oncol 11 5. Camidge DR, Ou S-HI, Shapiro G et al (2014)
(9):1423–1432 Efficacy and safety of crizotinib in patients with
2. Pilotto S, Carbognin L, Karachaliou N et al advanced c-MET-amplified non-small cell lung
(2017) Tracking MET de-addiction in lung cancer (NSCLC). J Clin Oncol 32
cancer: a road towards the oncogenic target. (15_suppl):8001–8001
Cancer Treat Rev 60:1–11 6. Ou SH, Kwak EL, Siwak-Tapp C et al (2011)
3. Tong JH, Yeung SF, Chan AW et al (2016) Activity of crizotinib (PF02341066), a dual
MET amplification and exon 14 splice site mesenchymal-epithelial transition (MET) and
mutation define unique molecular subgroups anaplastic lymphoma kinase (ALK) inhibitor, in
of non-small cell lung carcinoma with poor a non-small cell lung cancer patient with de
prognosis. Clin Cancer Res 22 novo MET amplification. J Thorac Oncol 6
(12):3048–3056 (5):942–946
4. Reungwetwattana T, Liang Y, Zhu V et al 7. Pilotto S, Gkountakos A, Carbognin L et al
(2017) The race to target MET exon 14 skip- (2017) MET exon 14 juxtamembrane splicing
ping alterations in non-small cell lung cancer:
 PCR Based Detection of METex14 155

mutations: clinical and therapeutical perspec- cancer harboring MET exon 14 skipping altera-
tives for cancer therapy. Ann Transl Med 5(1):2 tions. J Thorac Oncol 11(9):1493–1502
8. Kwon D, Koh J, Kim S et al (2017) MET exon 15. Awad MM, Oxnard GR, Jackman DM et al
14 skipping mutation in triple-negative pulmo- (2016) MET exon 14 mutations in non-small-
nary adenocarcinomas and pleomorphic carci- cell lung cancer are associated with advanced
nomas: an analysis of intratumoral MET status age and stage-dependent MET genomic ampli-
heterogeneity and clinicopathological charac- fication and c-met overexpression. J Clin Oncol
teristics. Lung Cancer 106:131–137 34(7):721–730
9. Vuong HG, Ho ATN, Altibi AMA et al (2018) 16. Liu X, Jia Y, Stoopler MB et al (2016) Next-
Clinicopathological implications of MET exon generation sequencing of pulmonary Sarcoma-
14 mutations in non-small cell lung cancer—A toid carcinoma reveals high frequency of
systematic review and meta-analysis. Lung actionable MET gene mutations. J Clin Oncol
Cancer 123:76–82 34(8):794–802
10. Mignard X, Ruppert AM, Antoine M et al 17. Frampton GM, Ali SM, Rosenzweig M et al
(2018) C-MET overexpression as a poor pre- (2015) Activation of MET via diverse exon
dictor of MET amplifications or exon 14 muta- 14 splicing alterations occurs in multiple
tions in lung sarcomatoid carcinomas. J Thorac tumor types and confers clinical sensitivity to
Oncol 13(12):1962–1967 MET inhibitors. Cancer Discov 5(8):850–859
11. Saigi M, McLeer-Florin A, Pros E et al (2018) 18. Cortot AB, Kherrouche Z, Descarpentries C
Genetic screening and molecular characteriza- et al (2017) Exon 14 deleted MET receptor
tion of MET alterations in non-small cell lung as a new biomarker and target in cancers. J
cancer. Clin Transl Oncol 20(7):881–888 Natl Cancer Inst 109(5):1–12
12. Saffroy R, Fallet V, Girard N et al (2017) MET 19. O’Brien O, Wright MC, O’Brien C et al (2019)
exon 14 mutations as targets in routine molec- Cost-efficient and easy to perform PCR-based
ular analysis of primary sarcomatoid carcinoma assay to identify met exon 14 skipping in
of the lung. Oncotarget 8(26):42428–42437 formalin-fixed paraffin-embedded (FFPE)
13. Schrock AB, Li SD, Frampton GM et al (2017) non-small cell lung cancer (NSCLC) samples.
Pulmonary sarcomatoid carcinomas commonly Diagnostics (Basel) 9(1):1–15
harbor either potentially targetable genomic 20. Kim EK, Kim KA, Lee CY et al (2019) Molec-
alterations or high tumor mutational burden ular diagnostic assays and clinicopathologic
as observed by comprehensive genomic implications of MET exon 14 skipping muta-
profiling. J Thorac Oncol 12(6):932–942 tion in non-small-cell lung cancer. Clin Lung
14. Schrock AB, Frampton GM, Suh J et al (2016) Cancer 20(1):e123–e132
Characterization of 298 patients with lung
 Chapter 12

Immunocytochemical Detection of ALK and ROS1

Rearrangements in Lung Cancer Cytological Samples
Diane Frankel, Elise Kaspi, and Patrice Roll

Abstract
The detection of molecular alterations such as ROS1 and ALK rearrangements is performed as part of the
diagnosis of advanced-stage lung adenocarcinoma. These alterations allow the treatments with tyrosine
kinase inhibitors. Cytological samples are very useful as up to 40% patients are diagnosed with this type of
sample. Here we describe the immunocytochemistry technique usable to reveal the overexpression of ALK
or ROS1 tyrosine kinase receptors secondary to ALK and ROS1 rearrangements, respectively.

Key words Immunocytochemistry, ALK, ROS1, Lung cancer, Adenocarcinoma, Cytology

1 Introduction

The emergence of tyrosine kinase inhibitors (TKI) has changed the

diagnostic and therapeutic management of non-small cell lung
cancer (NSCLC). When advanced-stage disease is diagnosed,
assessment of EGFR mutational status and ALK and ROS1 rear-
rangement are now routinely performed in the anatomy and
pathology laboratory [1–3]. As up to 40% of lung cancers are
diagnosed on cytological samples [4] (i.e., pleural or pericardial
effusion, bronchoalveolar lavage, bronchial brush of the nodule,
endobronchial ultrasound-guided transbronchial needle aspirates
or (EBUS-TBNA), these types of sample are very useful for the
evaluation of ALK and ROS1 rearrangements. Immunocytochem-
istry (ICC) revealing ALK and ROS1 proteins could be used to
detect an overexpression of these tyrosine kinase receptors second-
ary to ALK or ROS1 rearrangement [5].
The last guideline updated for molecular testing from the
College of American Pathologists, the International Association
for the Study of Lung Cancer, and the Association for Molecular
Pathology [1] approves the use of cytological samples with

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_12, © Springer Science+Business Media, LLC, part of Springer Nature 2021

157
158 Diane Frankel et al.

adequate cellularity for diagnostic purposes and highlights the

performance of smear preparations.
ROS1 rearrangements in NSCLC are rare, accounting for 2–3%
of NSCLC [6–8]. ROS1 ICC may be used as a screening test in
advanced-stage lung adenocarcinoma. A positive result should be
confirmed by a molecular or cytogenetic testing [1]. ALK rear-
rangement is found in 3–7% of NSCLC [9, 10]. Numerous pub-
lications have established the performance on ALK
immunohistochemistry (IHC) and it is now an acceptable alterna-
tive to Fluorescent In Situ Hybridization (FISH), a high positivity
is enough to start the treatment with TKI [1, 11–13].
This chapter provides the materials and the protocol that will
allow investigators to successfully identify ALK or ROS1 rear-
ranged cells by immunocytochemistry (see Notes 1 and 2).

2 Materials

The following materials are for ICC protocol that we use to label
rearranged ALK or ROS1 cells using monoclonal antibodies
against ALK or ROS1.

2.1 Laboratory 1. Cell culture hood (if working on cell culture).

Equipment 2. Laboratory fume hood.
3. Cytospin™ centrifuge (any benchtop cytocentrifuge can
be used).
4. Pipettes (P10, P20, P200, P1000) and tips.
5. Freezer (
20  C).
6. Kova® slides (or any slide system that can be used for cell
counting).
7. Cytospin™ slides (see Note 3).
8. Bright field microscope.
9. Slide staining jars.

2.2 General 1. 4% Paraformaldehyde (PFA) solution. In a fume hood, prepare

Reagents the solution by adding 40 g of PFA powder to 500 mL of
and Solutions sterile water that has been heated to 60  C. Agitate the solution
and Immuno- for 1 h. Add 1–2 mL of 1 M NaOH until the solution starts to
histochemistry clear. After completely clearing, allow the solution to reach
Reagents room temperature. Add 500 mL of a 2 PBS solution (diluted
from commercially available 10 stock solution) and adjust the
pH to 7.2. Store at
20  C until use (see Note 4).
2. Peroxidase blocking solution. To prepare, mix 10 mL of 3%
H2O2 (10 V) with 90 mL of ethanol (see Note 5).
 ALK and ROS1 Rearrangements in Cytological Samples 159

3. SensiTEK HRP (ScyTek) Super Block Kit, to block the

non-specific immunoreactivity. This kit also includes the bioti-
nylated secondary antibody (mouse, rat, guinea pig, or rabbit),
and the streptavidin/HRP label (see Note 6).
4. Primary antibodies: anti-ALK antibody and Anti-ROS1 anti-
body (see Note 7). Use the primary antibodies diluted in 1
PBS. For anti-ALK antibody, if using the 5A4, ab17127 from
Abcam, the dilution is 1:25; for the anti-ROS1 antibody
D4D6, #3287 from Cell signaling, the dilution is 1:250.
5. DAB Quanto from Thermo Fisher Scientific, contains the 3,3-
0
-diaminobenzidine (DAB) chromogen and substrate solutions
(see Note 6). Before use, this reagent must be diluted by mixing
30 μL of chromogen in 1 mL of the commercial buffer
included in the kit.
6. Positive control. We recommend that you process in parallel a
cell line such as HCC78 for ROS1 rearrangement or H2228 for
ALK rearrangement to be used as a positive control to validate
each experiment you perform. Alternatively, you can use as
positive control a patient’s cytological sample that has
already been tested positive for ROS1 or ALK rearrangement.
7. Total non-immune mouse or rabbit IgG. A negative control
should be performed in each experiment to confirm the
absence of nonspecific staining. We recommend using a total
non-immune mouse or rabbit IgG instead of the primary anti-
body, depending on the species of your ALK and ROS1 pri-
mary antibody. The dilution of the negative control should be
adjusted to have the same final concentration as the ALK or
ROS1 primary antibody.
8. Sterile water.
9. Aquatex® or another aqueous mounting medium.
10. 1 PBS, for washes. Dilute a 10 pre-made PBS stock to a
final 1 concentration.
11. Mayer’s Hemalun solution, or equivalent for histologic hema-
toxylin nuclear counterstaining.

3 Methods

The same ICC protocol is used to label ALK and ROS1 rearranged
cells. Cells can be obtained from a patient’s cytological sample or
from cell cultures. If working with patient’s cytological sample
containing precipitated proteins, you can prewash the sample in
1 PBS or other isotonic saline solution, this helps to decrease
background staining. If working with cultured cells, you should
resuspend and wash them twice in 1 PBS before the next step to
remove residual culture medium.
160 Diane Frankel et al.

3.1 Slide Preparation 1. Evaluate the cell count with a Kova® slide. Adjust the volume
(you can concentrate or dilute) to obtain  1000 cells/μL and
prepare a cytospin slide (or equivalent) using a volume of cell
suspension of 200 μL (see Note 8).
2. Spin in the cytospin centrifuge at 450  g for 3 min.
3. If you do not perform the immunocytochemistry (Subheading
3.2) the same day you prepare the slides, freeze them at
20  C
until their utilization.

3.2 Immuno- Every step in this section is performed at room temperature. As the
cytochemistry signal generated and the detection method for this technique is
chemical in nature, not fluorescent, there is no need to perform the
steps in a dark room. Remember to process the positive and nega-
tive controls in parallel to the experimental sample.
1. If the cytospin slides were stored at
20  C, defrost them for
10 min.
2. Under a laboratory fume hood, fix cells in 4% PFA for 10 min
(see Note 9).
3. Remove the 4% PFA from slides by turning the slides vertically
and allowing the PFA solution to run off the slide.
4. Wash slides twice in 1 PBS for 5 min. At this point, you can
prepare the peroxide blocking solution as described in Sub-
heading 2.2 (see Notes 5 and 10).
5. Under the laboratory fume hood, incubate slides in the perox-
idase blocking solution for 30 min in a slide staining jar.
6. Wash slides twice in 1 PBS for 5 min.
7. Add 100 μL of Super Block from the SensiTEK HRP kit and
incubate for 10 min.
8. Wash slides in 1 PBS for 5 min.
9. Add 100 μL of the diluted primary antibody to the cell spots in
each slide and incubate for 30 min (see Note 11).
10. Wash slides in 1 PBS for 5 min.
11. Add 100 μL of biotinylated secondary antibody provided in the
SensiTEK HRP kit and incubate for 15 min.
12. Wash the slide in 1 PBS for 5 min.
13. Add 100 μL of streptavidin/HRP provided in the SensiTEK
HRP kit and incubate for 20 min.
14. Wash the slide in 1 PBS for 5 min.
15. Add 16 μL of the diluted DAB Quanto chromogen and incu-
bate for 5 min.
16. Wash slides in 1 PBS for 5 min.
17. Wash slides in sterile water for 1 min.
 ALK and ROS1 Rearrangements in Cytological Samples 161

18. Add Mayer’s Hemalun solution for nucleus counterstaining for

few seconds.
19. Wash the slide in sterile water.
20. Add a cover slip with Aquatex® or another aqueous mounting
agent.
21. Slides can be conserved at room temperature in a closed
slide box.

3.3 Data Analysis A typical result for ICC staining for ALK and ROS1 is shown in
Fig. 1. Slides can be observed under a bright field microscope as
soon as the mounting agent is dry.
1. Assess the positive controls, which should have a strong brown
extranuclear staining.

Fig. 1 Representative immunocytochemical staining for ALK and ROS1, including positive and negative
controls. (a) HCC78 cell line showing a positive staining against anti-ROS1 antibody (positive control). (b)
Adenocarcinoma cells from an EBUS-TBNA patient sample showing a negative staining against anti-rabbit IgG
(negative control for ROS1 antibody). (c) Adenocarcinoma cells from a patient’s pleural effusion showing a
positive staining using anti-ALK antibody. (d) Adenocarcinoma cells from an EBUS-TBNA patient sample
showing a negative staining against anti-mouse IgG (negative control for ALK antibody). (b), (c) and (d) are
from three different patients. Magnification is 40. Scale bar represents 10 μm
162 Diane Frankel et al.

2. Assess the negative controls. These were incubated with mouse

or rabbit non-immune IgG and should be white or beige with
an absence of the brown signal observed in the positive controls
with anti-ALK or anti-ROS1 primary antibody.
3. For ROS1, a positive staining, if it is weak or present in only a
few neoplastic cells, may require confirmation by a second
method such as fluorescent in situ hybridization (FISH) or
next generation sequencing (NGS) [14–20] (see Note 12).
4. For ALK, the range of intensity staining, as scored by a pathol-
ogist, can be graded from 0 to 3+, and a 3+ score does not need
a confirmation with another technique and should lead to the
treatment with TKI. Weaker intensities with scores of 1+ and 2
+ should be confirmed by FISH or NGS [1].

4 Notes

1. This technique works on cytological material, either from cell

culture or from patient’s cytological samples (e.g., pleural
effusion).
2. This technique can be used with other antibodies against other
antigens (e.g., anti-cytokeratin antibodies).
3. You can use cytospin slides or regular ones. If you use regular
slides, we recommend circling the cell spot obtained after
cytocentrifugation with an immunostaining guard pen to help
to visualize the cytocentrifugation spot.
4. Once the 4% PFA is thawed, you must use it within a week.
5. Peroxidase blocking solution should be prepared just before
the immunocytochemistry.
6. Several companies offer equivalent ICC products for this
purpose.
7. Several companies offer similar primary antibodies against
these target proteins. However, for the anti-ALK antibody,
the international recommendation is to use the 5A4 or D5F3
clone [14–16]. Likewise, for the anti-ROS1 antibody, the
international recommendation is to use the D4D6 clone [17–
19].
8. You may confirm the slide cellularity before performing the
immunocytochemistry. You can stain one slide with Papanico-
laou or May Grunwald-Giemsa. Cell preparations should be of
sufficient cellularity in order to obtain a robust staining signal
but avoid very high cellular densities that would impede iden-
tification of individual cells. There must be enough neoplastic
cells per preparation (more than 50) for adequate analysis [20].
 ALK and ROS1 Rearrangements in Cytological Samples 163

9. If using the cytospin slides, you can overlay the cell spot with
4% PFA when placing your cytospin horizontally.
10. As the detection kit uses exogenous peroxidase activity and as
cells can contain endogenous peroxidase, we recommend a step
to inhibit endogenous peroxidase by incubating cells with
H2O2. This process reduces the nonspecific background stain-
ing due to endogenous peroxidase.
11. Incubation time can be modified depending on the manufac-
turer instruction if you use another primary antibody.
12. Weak staining can be caused by the presence of gene amplifica-
tion and therefore must be confirmed by FISH.

References
1. Lindeman NI, Cagle PT, Aisner DL et al mutations in east Asian populations. J Thorac
(2018) Updated molecular testing guideline Oncol 9:1171–1179
for the selection of lung cancer patients for 9. Rodig SJ, Mino-Kenudson M, Dacic S et al
treatment with targeted tyrosine kinase inhibi- (2009) Unique clinicopathologic features char-
tors: guideline from the College of American acterize ALK-rearranged lung adenocarcinoma
Pathologists, the International Association for in the western population. Clin Cancer Res
the Study of Lung Cancer, and the Association 15:5216–5223
for Molecular Pathology. Arch Pathol Lab Med 10. Soda M, Choi YL, Enomoto M et al (2007)
142:321–346 Identification of the transforming EML4-ALK
2. Travis WD, Brambilla E, Nicholson AG et al fusion gene in non-small-cell lung cancer.
(2015) The 2015 World Health Organization Nature 448:561–566
classification of lung tumors: impact of genetic, 11. Bozzetti C, Nizzoli R, Tiseo M et al (2015)
clinical and radiologic advances since the 2004 ALK and ROS1 rearrangements tested by fluo-
classification. J Thorac Oncol 10:1243–1260 rescence in situ hybridization in cytological
3. Shea M, Costa DB, Rangachari D (2016) Man- smears from advanced non-small cell lung can-
agement of advanced non-small cell lung can- cer patients. Diagn Cytopathol 43:941–946
cers with known mutations or rearrangements: 12. Rogers T-M, Russell PA, Wright G et al (2015)
latest evidence and treatment approaches. Ther Comparison of methods in the detection of
Adv Respir Dis 10:113–129 ALK and ROS1 rearrangements in lung cancer.
4. Yatabe Y, Dacic S, Borczuk AC et al (2019) J Thorac Oncol 10:611–618
Best practices recommendations for diagnostic 13. Marchetti A, Di Lorito A, Pace MV et al (2016)
immunohistochemistry in lung cancer. J ALK protein analysis by IHC staining after
Thorac Oncol 14:377–407 recent regulatory changes: a comparison of
5. Pisapia P, Lozano MD, Vigliar E et al (2017) two widely used approaches, revision of the
ALK and ROS1 testing on lung cancer cyto- literature, and a new testing algorithm. J
logic samples: perspectives. Cancer Cytopathol Thorac Oncol 11:487–495
125:817–830 14. Wynes MW, Sholl LM, Dietel M et al (2014)
6. Bergethon K, Shaw AT, S-HI O et al (2012) An international interpretation study using the
ROS1 rearrangements define a unique molecu- ALK IHC antibody D5F3 and a sensitive
lar class of lung cancers. J Clin Oncol detection kit demonstrates high concordance
30:863–870 between ALK IHC and ALK FISH and
7. Cai W, Li X, Su C et al (2013) ROS1 fusions in between evaluators. J Thorac Oncol
Chinese patients with non-small-cell lung can- 9:631–638
cer. Ann Oncol 24:1822–1827 15. Lantuejoul S, Rouquette I, Blons H et al
8. Chen Y-F, Hsieh M-S, Wu S-G et al (2014) (2015) French multicentric validation of ALK
Clinical and the prognostic characteristics of rearrangement diagnostic in 547 lung adeno-
lung adenocarcinoma patients with ROS1 carcinomas. Eur Respir J 46:207–218
fusion in comparison with other driver
164 Diane Frankel et al.

16. Savic S, Bode B, Diebold J et al (2013) Detec- ROS1-rearranged lung adenocarcinomas. Am J

tion of ALK-positive non-small-cell lung can- Surg Pathol 37:1441–1449
cers on cytological specimens: high accuracy of 19. Hofman V, Rouquette I, Long-Mira E et al
immunocytochemistry with the 5A4 clone. J (2019) Multicenter evaluation of a novel
Thorac Oncol 8:1004–1011 ROS1 immunohistochemistry assay (SP384)
17. Vlajnic T, Savic S, Barascud A et al (2018) for detection of ROS1 rearrangements in a
Detection of ROS1-positive non-small cell large cohort of lung adenocarcinoma patients.
lung cancer on cytological specimens using J Thorac Oncol 14:1204–1212
immunocytochemistry. Cancer Cytopathol 20. Jain D, Nambirajan A, Borczuk A et al (2019)
126(6):421–429 Immunocytochemistry for predictive bio-
18. Sholl LM, Sun H, Butaney M et al (2013) marker testing in lung cancer cytology. Cancer
ROS1 immunohistochemistry for detection of Cytopathol 127:325–339
 Chapter 13

A Method for the Establishment of Human Lung

Adenocarcinoma Patient-Derived Xenografts in Mice
Joanne Lundy, Brendan J. Jenkins, and Mohamed I. Saad

Abstract
Patient-derived xenografts (PDXs) are created by implanting human tumor tissue or cells into immunode-
ficent mice, and enable the study of tumor biology, biomarkers and response to therapy in vivo. This chapter
describes a method for lung adenocarcinoma (LAC) PDX generation using subcutaneous implantation of
tumor tissue and cell suspensions and incorporating the humanization of PDX models by reconstitution
with human immune cells.

Key words Patient-derived xenograft, Non-small cell lung cancer, Lung adenocarcinoma, NOD scid
gamma mouse, Humanization

1 Introduction

Patient-derived xenografts (PDXs) are valuable preclinical models

in oncology research, allowing for the detailed study of diverse
tumor tissues and rapid testing of novel therapies. Malignant
human tumor tissues or cells can be directly implanted into immu-
nocompromised mice to grow PDXs, which accurately reflect the
histological and molecular features of the original patient tumor
[1]. The successful development of PDX models represents an
important advance in translational research from previous xeno-
graft models, which were largely generated using human immorta-
lized cancer cell lines. Cancer cell lines are widely used for in vitro
and in vivo study of human cancer, and can be injected subcutane-
ously to rapidly and effectively generate xenograft models
[2]. However, these cell lines are a poor representation of the
unique characteristics occurring in individual primary patient
tumors, which demonstrate significant histological, architectural
and molecular heterogeneity [3].

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_13, © Springer Science+Business Media, LLC, part of Springer Nature 2021

165
166 Joanne Lundy et al.

PDX tumors can be serially passaged or frozen and thawed

while maintaining genomic stability, and can also be used for the
generation of complementary preclinical models such as organoid
cultures [4–6]. Successful engraftment is dependent on a number
of factors, including the quality of tumor tissue obtained, time to
tissue implantation, method of implantation, host mouse strain and
the original tumor stage, mitotic index and histology [7–9].
Non-small cell lung cancer (NSCLC) is the major histological
type of lung cancer, accounting for up to 85% of all human lung
cancer cases. NSCLC can be subclassified into squamous cell carci-
noma, large cell carcinoma, and lung adenocarcinoma (LAC), with
the latter accounting for 40% of NSCLC cases. Reported PDX
engraftment rates vary substantially in NSCLC, ranging from 20%
to 90% [3, 10–12]. Among the NSCLC subtypes, squamous lung
histology has been associated with higher engraftment rates (60%)
than adenocarcinoma (13%) [3, 11]. Recent developments in pre-
cision medicine have drastically altered the treatment landscape in
NSCLC [13–15]. The expanding landscape of personalized thera-
pies in NSCLC highlights the need for preclinical tumor models
which accurately reflect the molecular pathology of individual
patient tumors, and can be used to study specific molecular altera-
tions of LAC, as well as responses and resistance mechanisms to
targeted therapies [3, 7, 16]. The evolution of immunotherapy
agents such as checkpoint inhibitors has led to encouraging
advances in the treatment of NSCLC, and heightened interest in
exploring research models which can mimic the interface between
the host tumor and immune system [17–20].
The immunodeficient mouse strains which are used for PDX
engraftment do not harbor immune cells and cannot reflect the
normal interaction between tumor cells and stromal immune cells,
limiting the clinical utility of this model in studying immune
responses and novel immunotherapies. The development of
“humanized” mouse models allows mice harboring PDX tumors
to be engrafted with human immune cells, which interact with the
PDX in vivo and allow for the functional assessment of human T
and B cell responses [21]. The earliest humanized models were
described over 30 years ago [22], and the efficacy and utility of
the models have increased in ensuing decades, as mouse strains with
more comprehensive impairments in innate immunity have been
more widely used [23]. Collectively, PDXs are important resources
to expand our understanding of NSCLC, and methods to human-
ize these models have further expanded the utility of this method.
We describe below our methods for the generation of PDXs and
humanized mice in LAC.
 Establishing Human Lung Adenocarcinoma PDX Models 167

2 Materials

2.1 Materials, 1. NOD scid gamma (NSG) mice, 6–8 weeks of age (see Note 1).
Laboratory Equipment, 2. Personal protective equipment (PPE): surgical gown, sterile
and Solutions gloves, face mask.
for Tumor Implantation
3. Autoclaved surgical equipment: forceps
2, scalpel blade, scis-
sors, wound clip stapler, staples.
4. Heat pad.
5. Anesthetic machine (isoflurane, oxygen).
6. Electric razor.
7. 80% Ethanol (ETOH), diluted with distilled water from abso-
lute or 95% ethanol.
8. Dulbecco’s Modified Eagle’s Medium (DMEM). Both
un-supplemented and supplemented with 5% Fetal Calf
Serum (FCS) are required, depending on the specific proce-
dure (see Subheading 3 below).
9. Phosphate-buffered saline (PBS) supplemented with 1% peni-
cillin/streptomycin (P/S). For the PBS, we use a commercially
available 1
PBS solution.
10. Ice and transport bucket.
11. Matrigel (see Note 2). This comes in ready-made solutions for
direct use. We recommend aliquoting the solution and storing
it at 80  C until use. Thaw the aliquots overnight at 4  C
before injection into mice.
12. 1 mL syringes with 27-gauge (G) needles.
13. Carprofen (to be used at a dose of 5 mg/kg in 100 μL injection
volume). Prepare the solution in sterile water.
14. Bupivacaine 0.25%. Prepare the solution in sterile water.
15. Petri dishes.
16. Pathogen-free laboratory hood.
17. Mouse surgical stapler.

2.2 Materials 1. 2 mL cryovials.

for Tumor 2. Freezing media: 90% fetal calf serum (FCS) with 10% dimethyl
Freeze Down sulfoxide (DMSO).
3. Freezing container containing isopropanol.

2.3 Materials 1. Human peripheral blood mononuclear cells (PBMCs), isolated

for Peripheral Blood from human whole blood using density gradient media.
Mononuclear Cell 2. Heat lamp.
(PBMC) Engraftment
3. 80% ETOH, diluted with distilled water from absolute or 95%
ethanol.
168 Joanne Lundy et al.

4. 1 mL syringe with 25G needles.

5. Perspex conical restraining chamber.

2.4 Materials 1. Dulbecco’s Modified Eagle’s Medium (DMEM). Both

for Generating un-supplemented and supplemented with 5% Fetal Calf
and Freezing Tumor Serum (FCS) are required, depending on the specific proce-
Cell Suspension dure (see Subheading 3 below).
2. Collagenase A and Dispase digestion medium. To prepare, add
10 mg of Collagenase A and 5 mg of Dispase to 10 mL
of DMEM.
3. Filter-sterile RBCs lysis buffer. To prepare, dissolve 8.3 g of
NH4Cl in 1 L of 0.01 M Tris–HCl buffer (pH 7.5). The
solution is stored at 2–8  C and filter-sterilized before use.
4. Dimethyl sulfoxide (DMSO).
5. Cell strainer (100 μM).
6. PBS, we use a commercially available 1
PBS solution.
7. Matrigel.
8. Autoclaved surgical equipment: forceps
2, scalpel blade,
scissors.
9. Falcon tubes, 50 mL.
10. Shaker capable of holding 50 mL Falcon tubes, with capacity to
heat at 37  C.
11. Micro-centrifuge tubes, sterile.
12. Injection matrix solution: mix 75 μL of Matrigel and 75 μL of
1
PBS.

3 Methods

3.1 Subcutaneous 1. To prepare tumor pieces from a fresh tumor biopsy or estab-
Implantation of Tumor lished PDX tumor (see Note 3), place tumor in Petri dish filled
Pieces halfway with sterile 1
PBS with 1% P/S. The Petri dish should
be on ice all the time. Use a scalpel blade to dissect the tumor
into pieces approximately 2 mm3, ensuring tumor pieces
remain completely submerged in the 1
PBS solution. At this
stage excess tumor tissue can be frozen down as described in
Subheading 3.2. Proceed to step 2. Alternatively, if a fresh
biopsy is not available, this step can be performed using frozen
tissue. When using frozen tissue, place cryovial containing
tumor pieces into 37  C water bath for 1–2 min to thaw, then
remove and place on ice. Transfer contents of cryovial into petri
dish containing sterile 1
PBS with 1% P/S (keep on ice), then
gently wash twice to remove DMSO. Cut tissue into 2 mm3
pieces.
 Establishing Human Lung Adenocarcinoma PDX Models 169

2. Put on Personal protective equipment (PPE) and prepare

pathogen-free hood.
3. Wipe down bench with 80% ETOH, place heat pad on bench
and cover with clean bench roll.
4. Prepare analgesia and anesthetic machine. Pre-fill induction
chamber with isoflurane.
5. Place mouse into induction chamber and observe until mouse
is sedated.
6. Remove mouse from chamber and place nose in nose cone,
continuing maintenance of isoflurane (generally 1–3%).
7. Confirm adequacy of analgesia by observing pattern of breath-
ing and response to toe pinch/tail pinch.
8. Shave rear flank of mouse and wipe skin clean with 80% ETOH.
9. Use forceps to lift skin on right rear flank (just above right hip)
and use scissors to make a small incision.
10. Use scissors to gently create a subcutaneous pocket for the
tumor piece, by blunt dissection between the skin and
peritoneum.
11. Gently dip a 2 mm tumor piece into Matrigel, then carefully
place it in the subcutaneous pocket you have created (see Note
4).
12. Use a syringe to drop approximately 50 μL Matrigel around
tumor.
13. Use forceps to hold skin, ensuring tumor is away from incision,
and use stapler to completely close wound.
14. Use a syringe to add a few drops of bupivacaine on the incision
site and inject Carprofen 5 mg/kg subcutaneously using 27G
needle.
15. Remove mouse from anesthesia and place in a new cage on the
heat mat to recover. Record date, mouse number, details of
tumor implanted and passage number on experimental cage
card. Monitor closely for tumor growth (see Note 5). Staples
can be removed after 7 days, or once wound has completely
closed.

3.2 Freezing 1. After dissecting tumor pieces into approximately 2 mm3 pieces,
of Tumor Pieces gently wash tumor pieces that will not be used for implantation
for PDXs in 1
PBS with 1% P/S (see Note 6).
2. Place tumor pieces directly into cryovial containing 1 mL freez-
ing media (up to 10 pieces per vial).
3. Place cryovial into a freezing container containing isopropanol,
and place into 80  C freezer (see Note 7).
4. Move cryovials to liquid nitrogen after 24 h for long-term
storage.
170 Joanne Lundy et al.

3.3 Engrafting Mice engrafted with PBMCs can be used in experiments immedi-
PBMCs into Immuno- ately, planning for an endpoint within 4 weeks. Monitor mice for
deficient Mice signs of graft versus host disease (GVHD), particularly weight loss
of 15% or more. Adequacy of engraftment of PMBCs can be
assessed using flow cytometry (see Note 8).
1. Count PBMCs and suspend at a concentration of
20
106 cells/200 μL sterile 1
PBS.
2. Prepare pathogen-free hood by wiping down with 80% ETOH
and set up heat lamp.
3. Load 0.2 mL cell suspension into 1 mL syringe.
4. Restrain mouse in Perspex conical holder, and gently wipe tail
clean with 80% ETOH. Allow ETOH to evaporate prior to
injection.
5. Inject 0.2 mL cell suspension into the lateral tail vein using a
25 G needle.

3.4 Subcutaneous 1. Collect tumor or PDX pieces in ice-cold

Implantation of Tumor un-supplemented DMEM.
Cells into Immuno- 2. Wash tumor or PDX pieces with ice-cold un-supplemented
deficient Mice DMEM twice.
3. Transfer tumor pieces in sterile Petri dish with 5 mL ice-cold
DMEM and slice the tumor into small pieces (1–3 mm3) using
sterile scissors and scalpel.
4. Transfer the tumor pieces into a 50 mL Falcon tube containing
pre-warmed and sterile digestion media.
5. Place the tube on a shaker for 1 h at 37  C.
6. Filter tumor cell suspension using 100 μM cell strainer, add
5 mL of DMEM supplemented with 5% FCS to the filtrate,
then centrifuge at 300
g for 5 min.
7. Remove supernatant and resuspend the cell pellet in 5–10 mL
pre-warmed sterile RBCs lysis buffer. Incubate for 3–6 min at
room temperature.
8. Add 10 mL DMEM supplemented with 5% FCS to the suspen-
sion, mix and centrifuge at 300
g for 5 min.
9. Wash the cell pellet twice with DMEM supplemented with
5% FCS.
10. Count tumor cells and resuspend in un-supplemented DMEM.
11. Transfer 1–2
106 cells into a sterile 1.7 mL Eppendorf tube,
centrifuge at 300
g for 3 min and resuspend in 150 μL
injection matrix (75 μL Matrigel and 75 μL 1
PBS), then
place it on ice until injection time.
12. Place mouse into induction chamber and observe until mouse
is sedated.
 Establishing Human Lung Adenocarcinoma PDX Models 171

Fig. 1 Establishment of human lung adenocarcinoma patient-derived xenografts (PDXs) in immunocompro-

mised mice. Resected tumors from lung adenocarcinoma patients are implanted (as small pieces or cell
suspension) in one flank of NSG mice. Mice are monitored closely for tumor growth (at least twice weekly),
and tumor volume is calculated and recorded. When tumors reach 1000 mm3, mice are humanely culled and
tumors are harvested for histological and molecular analyses, freezing down or reimplantation into mice

13. Remove mouse from chamber and place nose in nose cone,
continuing maintenance of isoflurane (generally 1–3%).
14. Shave rear flank of mouse and wipe skin clean with 80% ETOH.
15. Resuspend the injection mixture using freezer cold pipette tips
and transfer into freezer cold syringe.
16. Inject cells subcutaneously, remove mouse from anesthesia and
place in a new cage on the heat mat to recover. Record date,
mouse number, details of tumor implanted and passage num-
ber on experimental cage card. Monitor closely for tumor
growth (Fig. 1).

3.5 Freezing Tumor 1. Resuspend tumor cells at an appropriate concentration

Cells for PDXs (2–10
106) in 1 mL freezing media (FCS supplemented
with 10% DMSO) and transfer the suspension into cryovials.
2. Place cryovial into freezing container containing isopropanol,
and place into 80  C freezer.
3. Move cryovials to liquid nitrogen after 24 h for long-term
storage.

4 Notes

1. NSG mice should be housed in specific pathogen-free (SPF)

environment and handled in accordance with local biosafety
protocols.
172 Joanne Lundy et al.

2. Matrigel can be thawed at 4  C overnight, or on wet ice at least

half an hour prior to procedure. Freeze in small aliquots to
avoid wastage and repeated freeze–thaw cycles. Use a fresh
aliquot for each tumor used. Take care to keep on ice at all
times, as it will solidify if left at room temperature.
3. Tumors/biopsies should be collected and placed in a sterile
container of freshly prepared DMEM + 1% P/S on ice for
transport to the laboratory. Use tumor as soon as possible
after biopsy (within 24 h, but highest tumor viability is
achieved if processed within first 4–6 h). Human tissues should
be considered potential biological hazards. Appropriate PPE
should be worn for all steps in handling these tissues, in accor-
dance with local protocols.
4. Ensure that the pocket created is deep enough to securely
harbor the tumor piece in Matrigel, small fragments can easily
slip out of the pocket or adhere to the staple line if it is too
shallow.
5. Mice should be monitored at least twice weekly for tumor
growth and weighed weekly. Tumors can be measured with
calipers, and tumor volume (TV) calculated using the formula:
TV ¼ longest diameter
(short diameter)2/2. Mice should be
culled once tumor volume reaches 1000 mm3. When tumors
are harvested, a section should be preserved in formalin and
histological sections prepared to examine architecture of tumor
(note that NSG mice can rarely develop spontaneous lympho-
mas). Smaller tumor pieces can be snap frozen in liquid nitro-
gen and then stored long term at 80  C, and later used to
prepare protein lysates or extract DNA/RNA.
6. It is best to make all solutions fresh, but leftover 1
PBS with
1% P/S can be stored at 4  C for up to 2 weeks.
7. Freezing cryovials in isopropanol will ensure slow freezing of
tumor. Move cryovials (on dry ice) to liquid nitrogen tanks for
long-term storage once frozen.
8. Perform cardiac blood draw and collect spleen at end of experi-
ment. Assess adequacy of engraftment with flow cytometry
(we typically assess human CD45 for total immune cells,
human CD3 for T cells, human CD20 for B cells, and
mouse CD45).

References

1. Wang D, Pham NA, Tong J et al (2017) Molec- 2. Jiang Y, Zhao J, Zhang Y et al (2018) Estab-
ular heterogeneity of non-small cell lung carci- lishment of lung cancer patient-derived xeno-
noma patient-derived xenografts closely reflect graft models and primary cell lines for lung
their primary tumors. Int J Cancer 140 cancer study. J Transl Med 16(1):138
(3):662–673 3. Fichtner I, Rolff J, Soong R et al (2018) Estab-
lishment of patient-derived non-small cell lung
 Establishing Human Lung Adenocarcinoma PDX Models 173

cancer xenografts as models for the identifica- 13. Maemondo M, Inoue A, Kobayashi K et al
tion of predictive biomarkers. Clin Cancer Res (2010) Gefitinib or chemotherapy for non-
14(20):6456–6468 small-cell lung cancer with mutated EGFR. N
4. Kim M, Mun H, Sung CO et al (2019) Patient- Engl J Med 362(25):2380–2388
derived lung cancer organoids as in vitro cancer 14. Shaw AT, Kim DW, Nakagawa K et al (2013)
models for therapeutic screening. Nat Com- Crizotinib versus chemotherapy in advanced
mun 10(1):1–15 ALK-positive lung cancer. N Engl J Med 368
5. Sachs N, Papaspyropoulos A, Zomer-van (25):2385–2394
Ommen DD et al (2019) Long-term expand- 15. Sundar R, Chénard-Poirier M, Collins DC et al
ing human airway organoids for disease mod- (2017) Imprecision in the era of precision med-
eling. EMBO J 38(4):e100300 icine in non-small cell lung cancer. Front Med
6. Reyal F, Guyader C, Decraene C et al (2012) 4:39
Molecular profiling of patient-derived breast 16. Zhang Y, Yao K, Shi C et al (2015) 244-MPT
cancer xenografts. Breast Cancer Res 14(1): overcomes gefitinib resistance in non-small cell
R11 lung cancer cells. Oncotarget 6
7. Hidalgo M, Amant F, Biankin AV et al (2014) (42):44274–44288
Patient-derived xenograft models: an emerging 17. Reck M, Rodrı́guez-Abreu D, Robinson AG
platform for translational cancer research. Can- et al (2016) Pembrolizumab versus chemother-
cer Discov 4(9):998–1013 apy for PD-L1-positive non-small-cell lung
8. Johnson JR, Hammond WG, Benfield JR et al cancer. N Engl J Med 375(19):1823–1833
(1995) Successful xenotransplantation of 18. Socinski MA, Jotte RM, Cappuzzo F et al
human lung cancer correlates with the meta- (2018) Atezolizumab for first-line treatment
static phenotype. Ann Thorac Surg 60 of metastatic nonsquamous NSCLC. N Engl J
(1):32–37 Med 378(24):2288–2301
9. Perez-Soler R, Kemp B, Wu QP et al (2000) 19. Hellmann MD, Paz-Ares L, Bernabe-caro R
Response and determinants of sensitivity to et al (2019) Nivolumab plus ipilimumab in
paclitaxel in human non-small cell lung cancer advanced non-small-cell lung cancer. N Engl J
tumors heterotransplanted in nude mice. Clin Med 381(21):2020–2031
Cancer Res 6(12):4932–4938 20. Ma Y, Zhang P, An G et al (2016) Induction of
10. Dong X, Guan J, English JC et al (2010) patient-derived xenograft formation and clini-
Patient-derived first generation xenografts of cal significance of programmed cell death
non-small cell lung cancers: promising tools ligand 1 (PD-L1) in lung cancer patients.
for predicting drug responses for personalized Med Sci Monit 22:4017–4025
chemotherapy. Clin Cancer Res 16 21. Pearson T, Greiner DL, Shultz LD (2008)
(5):1442–1451 Creation of “humanized” mice to study
11. Ilie M, Nunes M, Blot L et al (2015) Setting up human immunity. Curr Protoc Immunol 81
a wide panel of patient-derived tumor xeno- (1):15–21
grafts of non-small cell lung cancer by improv- 22. Bosma GC, Custer RP, Bosma MJ (1983) A
ing the preanalytical steps. Cancer Med 4 severe combined immunodeficiency mutation
(2):201–211 in the mouse. Nature 301(5900):527–530
12. Merk J, Rolff J, Becker M et al (2009) Patient- 23. Ito M, Hiramatsu H, Kobayashi K et al (2002)
derived xenografts of non-small-cell lung can- NOD/SCID/gamma(c)(null) mouse: an
cer: a pre-clinical model to evaluate adjuvant excellent recipient mouse model for engraft-
chemotherapy? Eur J Cardiothorac Surg 36 ment of human cells. Blood 100
(3):454–459 (9):3175–3182
 Chapter 14

A Method for the Establishment and Characterization

of Mouse Lung Adenocarcinoma Cell Lines that Mimic
Traits of Human Adenocarcinomas
Magda Spella, Ioannis Lilis, and Georgios T. Stathopoulos

Abstract
Lung adenocarcinoma (LADC) is the leading cause of cancer death worldwide and is largely inflicted by
carcinogens contained in tobacco smoke. The generation of cell lines mimicking traits of human LADC will
profoundly advance our understanding of the pathobiology of the disease, as they offer an easy and valuable
tool to study the cellular and molecular aspects of carcinogenesis. Here we describe a detailed protocol for
the generation of such cell lines, following the exposure of experimental mouse strains to different tobacco
carcinogens and isolation of the resulting lung tumors.

Key words Lung adenocarcinoma, Smoke-induced carcinogenesis, Tobacco smoke, Mouse cell lines,
Chemical carcinogenesis

1 Introduction

Lung cancer is the leading cause of cancer death worldwide, and

lung adenocarcinoma (LADC), its main subtype, claims the major-
ity of the cases [1]. Lung cancer and LADC in particular are mainly
caused by chemical carcinogens contained in tobacco smoke [2],
which inflict thousands of mutations in the forming tumors. It is
evident that the generation of faithful mouse models relevant to the
human disease will greatly advance our understanding of the initi-
ating and signaling events leading to smoke-induced LADC forma-
tion. However, although elaborate genetic mouse models of lung
cancer are available, they do not fully recapitulate smoke-induced
carcinogenesis, whereas mouse models of tobacco carcinogen-
induced LADC are more closely related to the human disease [3].
Here we demonstrate a detailed protocol for the generation of
truly malignant and transplantable mouse tobacco-carcinogen-
derived lung cancer cell lines [4, 5]. In this protocol, different
mouse strains are exposed to tobacco carcinogens, and the

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_14, © Springer Science+Business Media, LLC, part of Springer Nature 2021

175
176 Magda Spella et al.

developed lung tumors are enucleated from the surrounding lung

parenchyma and, following their positive diagnosis as true LADC,
cultured indefinitely under standard conditions. The established
cell lines can then be validated in vitro for their proliferative and
stemness capacity, and in vivo for their malignancy and the ability to
form metastases. Importantly, the genetic characterization of these
cell lines shows high similarity to human LADC [4], indicative of
their value in recapitulating the disease.

2 Materials

2.1 Solutions 1. 1
phosphate-buffered saline (PBS). Prepare by adding 8 g

and Reagents NaCl, 0.2 g KCl, 1.44 g Na2HPO4 and 0.24 g KH2PO4 to
800 mL of distilled water. Adjust the pH to 7.4 with HCl and
adjust the final volume to 1 L with distilled water. Autoclave
(20 min, 121  C, liquid cycle).
2. Dulbecco’s Modified Eagle Medium (DMEM). Standard
DMEM supplemented with 10% FBS, 2 mM L-glutamine,
1 mM pyruvate, 100 U/mL penicillin, and 100 U/mL
streptomycin.
3. Formalin 10%. Dilute concentrated formaldehyde in distilled
water to a final concentration of 10%.
4. Isoflurane.
5. Ethanol 70%, 80%, 95%, 96% and 100%. For the dilutions,
dilute histological grade ethanol (95.6% or absolute) in distilled
water to the appropriate final concentration.
6. Xylene, histological grade.
7. Paraffin wax.
8. Harris’ Hematoxylin solution and Eosin Y 0.5% alcoholic solu-
tion (for H&E staining).
9. Acid ethanol. Dilute 2 mL of concentrated 12.1 M HCl in
200 mL 70% ethanol.
10. Lithium carbonate (saturated). Add 3.08 g of lithium carbon-
ate to 200 mL of distilled water. Mix to dissolve and store at
room temperature.
11. Alpha Amylase from Bacillus subtilis (Diastase): Add 100 mL of
1
PBS to a glass beaker. Weigh 1.0 g of Alpha Amylase and
0.1 g of Sodium Azide and add both to the beaker. Mix well
and store at 4  C.
12. 0.5% Periodic acid (for Periodic Acid-Schiff Staining). Add
200 mL of distilled water to a glass beaker. Weigh 1.0 g of
potassium periodate powder and transfer it to the beaker. Mix
well. Alternatively, periodic acid can be commercially pur-
chased as a ready-to-use 0.5% periodic acid solution.
 Derivation of Mouse Lung Adenocarcinoma Cell Lines 177

13. 1
Tris-Buffered Saline (TBS). Dissolve 6.05 g of Tris base and

8.76 g of NaCl in 800 mL of distilled H2O. Adjust pH to 7.6
with 1 M HCl. Make volume up to 1 L with distilled water.
Once prepared TBS is stable at 4  C for 3 months.
14. Sodium Citrate Buffer. Dissolve 2.94 g of Tri-sodium citrate
(dihydrate) in 800 mL of distilled H2O. Adjust pH to 6.0 with
1 M HCl. Make volume up to 1 L with distilled water. Store at
room temperature for 3 months or at 4  C for longer storage.
15. Ethylenediaminetetraacetic acid disodium salt dihydrate
(EDTA) solution. Dissolve 0.37 g of EDTA in 800 mL of
distilled H2O. Adjust pH to 8.0. Make volume up to 1 L
with distilled water. Store at room temperature for 3 months.
16. Hydrogen peroxide (H2O2). Dilute a 30% H2O2 stock in
distilled water to a final concentration of 0.3%.
17. Blocking buffer. Dissolve bovine serum albumin powder in
TBS at a final concentration of 3%.
18. MTT Solution. Dissolve 500 mg of MTT powder in 10 mL
PBS. Stir with a magnetic stirrer for approximately 1 h in the
dark. Filter sterilize the solution with a 0.22 mm filter and store
at 20  C.
19. Acidified isopropanol. Prepare by mixing 5 mL of 2 M HCl per
250 mL of isopropanol.
20. B-27 50
Supplement.
21. Sterile 1
Dulbecco’s Phosphate-Buffered Saline.
22. Trypan blue dye.
23. Tumorsphere medium (500 mL). Prepare by adding 20 ng/
mL epidermal growth factor, 10 ng/mL basic fibroblast
growth factor, 5 μg/mL insulin and 0.4% Bovine Serum Albu-
min to 500 mL Dulbecco’s Modified Eagle Medium/F12.
24. Tobacco carcinogens. Indicative carcinogens include urethane
(ethyl carbamate, EC, CH3CH2OCNH2, CAS #51-79-6) and
diethylnitrosamine (N,N-Diethylnitrous amide, DEN,
C4H10N2O, CAS # 55-18-5). Dilute the tobacco carcinogen
in the sterile 1
phosphate-buffered saline (PBS) (see Note 1).
25. Cell culture grade trypsin-EDTA solution.
26. Distilled and deionized water.
27. Xylene-based mounting medium.
28. Schiff’s reagent, commercially available in ready-to-use form.
29. Freezing medium (we use 10%FBS in DMSO).
30. Primary antibodies for immunohistochemistry: anti-TTF-1
and anti-Napsin-A. Use dilution recommended by the
manufacturer.
178 Magda Spella et al.

31. Secondary antibodies, HRP-conjugated.

32. Immunohistochemistry development kit (should include the
enzyme substrate, and all development reagents, use according
to manufacturer’s instructions).

2.2 Mice Use both males and females, at least n ¼ 10 per experiment. We
and Surgical have optimized this procedure for the three strains indicated below.
Procedure Equipment
1. FVB mice.
2. Balb/c mice.
3. C57/BL6 mice.
4. Basic mice surgery tools such as scissors, forceps, and scalpel.
These must be sterilized before use.
5. Perfusion catheter, 32 mm length, 20 G intravenous catheter.

2.3 Laboratory 1. Standard biosafety level 2 cell station.

Equipment 2. Phase-contrast microscope.
3. Hemocytometer.
4. Spectrophotometer.
5. Humidified slide incubation chamber.
6. Microwaveable slide racks.
7. Microwave oven.
8. Microtome.
9. Stereomicroscope.
10. Incubator, set for 5% CO2, 37  C.
11. Slide holders.

2.4 Plasticware 1. Falcon Tubes, 50 mL.

and Other 2. Eppendorf tubes, 1.5 mL.
Consumables
3. Syringes, 1 mL, and needles.
4. 10 cm culture dishes.
5. Microscope coated slides.
6. 96-well plates.

3 Methods

3.1 Injection 1. Use both male and female, sex-, weight (20–25 g)-, and age
of Carcinogen to Mice (6–12 week)-matched experimental mice (at least n ¼ 10/car-
cinogen/group), randomized across different cages. Perform
the following manipulations per carcinogen/per strain. For
diethylnitrosamine (working concentration at 20 mg/kg):
one intraperitoneal injection for FVB mice, 10 weekly
 Derivation of Mouse Lung Adenocarcinoma Cell Lines 179

intraperitoneal injections for C57/BL6 mice and eight weekly

intraperitoneal injections for Balb/c mice. Control mice
receive injections of saline. For urethane (working concentra-
tion at 1 g/kg): one or four weekly intraperitoneal injections
for FVB mice, and 10 weekly intraperitoneal injections for
Balb/c and C57/BL6 mice. Control mice receive injections
of saline.
2. Monitor mice body weight monthly and harvest the mice
10 months after the first carcinogen injection.

3.2 Isolation of Lung 1. Keep sterile scissors, forceps and scalpel on ice inside a 50 mL
Tumors Falcon tube containing DMEM 10% FBS, 2 mM L-glutamine,
1 mM pyruvate, 100 U/mL penicillin, and 100 U/mL strep-
tomycin. At this point you can prepare the 10% formalin solu-
tion as indicated in Subheading 2.
2. Sacrifice mice according to an approved euthanization
protocol.
3. Rinse mice with 70% ethanol. Perform all the following proce-
dures in this section under sterile conditions.
4. Cut open the mouse peritoneal cavity and expose the lungs by
cutting open the chest wall along the sternum. Carefully exam-
ine the lungs to locate the tumors.
5. Dissect the lung tumors from the surrounding lung paren-
chyma. Cut the tumors in half.
6. Place one half of the tumors in 10% formalin and process it for
histology (Subheading 3.3).
7. Place the other half in a 50 mL Falcon tube containing DMEM
10% FBS, 2 mM L-glutamine, 1 mM pyruvate, 100 U/mL
penicillin, and 100 U/mL streptomycin. Perform the follow-
ing step under a standard biosafety level 2 cell station in the cell
culture room.
8. Transfer the halved tumor to a 10 cm cell culture dish, chop it
with the scalpel into 1 mm pieces and dissociate it further by
pipetting it up and down with a 1000 μL pipette so that single
cells can adhere to the plate surface. Culture the dissociated
cells in DMEM 10% FBS, 2 mM L-glutamine, 1 mM pyruvate,
100 U/mL penicillin, and 100 U/mL streptomycin under
standard conditions (37  C in 5% CO2–95% air). Only trans-
formed tumor cells are expected to survive in culture after
prolonged culture and passaging. Continue to Subheading
3.5 for the procedure to generate tumor-derived cell lines.

3.3 Histology Murine lung tumors bear similar morphology, histopathology, and
and Lung molecular anomalies as those observed in human tumors [6]. Lung
Adenocarcinoma adenocarcinoma is an epithelial malignancy that usually presents
Diagnosis glandular differentiation and/or mucin production. When such
180 Magda Spella et al.

morphologic features are recognized, tumor can be designated as

adenocarcinoma. Within this context, perform Hematoxylin &
Eosin staining (H&E) stain to reveal tumor histological architec-
ture and Periodic Acid-Schiff Staining with Diastase to locate the
neutral mucins. These staining steps are described in this section.
Lung adenocarcinoma cells usually express pneumocytic markers.
Thyroid transcription factor (TTF-1) and Napsin A can serve as
markers of adenocarcinoma or adenocarcinoma differentiation even
in poorly differentiated tumors [7], and these can be detected by
immunohistochemistry of tissue sections (described in Subheading
3.4).

3.3.1 Tissue Preparation In our laboratory the procedures of tissue fixation, dehydration,
for Histology and embedding are performed in a Leica TP1020 automatic tissue
processor with reagent containers’ capacity of 1.8 L. In the absence
of an automatic tissue processor, the steps described below can be
performed by placing the tissues in any container that allows a
volume ratio tissue:formalin 1:2.
1. Fix, dehydrate, clear, and embed tumors by immersing them in
the following washes: 10% Formalin, one wash for 1 h; 70%
Ethanol, one wash for 1 h and 30 min; 80% Ethanol, one wash
for 1 h and 30 min; 96% Ethanol, two washes for 1 h and
30 min each; 100% Ethanol, three washes for 1 h each; Xylene,
two washes for 1 h and 30 min each; Paraffin (60  C), two
washes for 2 h each.
2. Prepare 4–5 μm paraffin sections cutting the paraffin-
embedded tissue sections in a microtome and mount sections
on coated glass slides. Preferably place two serial sections on
each slide. Proceed with staining as described in the following
steps.

3.3.2 H&E Staining 1. Place slides with paraffin sections in a slide holder.
2. Deparaffinize sections by immersing the slides through hot
xylene (~58  C) three washes/wells 5 min each.
3. Rehydrate sections by immersing the slides through the follow-
ing washes/wells: Xylene 1:1 with 100% ethanol one wash for
2 min; 100% Ethanol, two washes 2 min each; 95% Ethanol,
two washes 2 min each; 80% Ethanol, two washes 2 min each;
70% Ethanol, two washes 2 min each; Deionized Water, two
washes for 3 min.
4. Stain in Harris Hematoxylin solution for 1–5 min (you can
select the color intensity under the microscope) and wash in
running tap water for 3 min.
5. Differentiate in 1% acid alcohol for 2 s and wash in running tap
water for 1 min.
 Derivation of Mouse Lung Adenocarcinoma Cell Lines 181

6. Perform a bluing step in saturated lithium carbonate solution

for 30 s to 1 min and wash in running tap water for 3 min.
7. Counterstain in Eosin Y alcoholic solution for 30 s to 1 min and
wash in running tap water for 3 min.
8. Dehydrate sections by immersing the slides through the fol-
lowing washes/wells (see Note 2): 80% Ethanol wash for 2 min;
95% Ethanol, wash for 2 min; 100% Ethanol, two washes
2 min each.
9. Clear sections by immersing the slides through xylene three
washes/wells 5 min each.
10. Mount with xylene-based mounting medium.

3.3.3 Periodic 1. Place, deparaffinize and rehydrate sections as mentioned in the

Acid-Schiff Staining procedure for H&E staining (Subheading 3.3.2).
with (α-Amylase) Diastase 2. Place the slides in the Alpha Amylase solution for 20 min (see
(PAS-D) Note 3).
3. Wash the slides well in distilled H2O (dH2O).
4. Place the slides in 0.5% periodic acid for 10 min (see Note 4).
5. Wash three times with dH2O, changing the water each time.
6. Place the slides in Schiff’s reagent for 15 min (see Note 5).
7. Wash in running tepid tap water for 5–10 min in order for the
tissue to develop a pink color.
8. Counterstain with hematoxylin for 1 min.
9. Wash three times with dH2O, changing the water each time.
10. Place the slides in bluing reagent (saturated lithium carbonate
solution) for 30 s in order to differentiate the blue color.
11. Rinse the slides in dH2O for 1 min.
12. Dehydrate and mount the slides as described in H&E proce-
dure (Subheading 3.3.2).

3.4 Immuno- 1. Place, deparaffinize, and rehydrate sections as described in

histochemical H&E procedure (Subheading 3.3.2) and immerse them in
Localization of Lung TBS for 10 min at least (see Note 6).
Adenocarcinoma 2. Perform heat-induced epitope retrieval with EDTA
Markers pH 8.0–9.0 buffer or with sodium citrate buffer pH 6.0
according to antigen manufacturer recommendations. Place
the sections in a microwaveable rack and vessel and immerse
them in the appropriate antigen retrieval buffer. Place the vessel
inside the microwave and heat the slides until the buffer starts
to boil (850 W for 2–3 min). Adjust the power setting of the
microwave to 20–30%, for example (300 W). Heat for
8–10 min and observe the vessel. A vigorous boil should be
avoided. Cool slides on bench top for 20 min. Add some dH2O
182 Magda Spella et al.

and leave the slides for 10 more min. Wash sections in dH2O
two times for 2 min each and place them in TBS for 5 min (see
Note 7).
3. To quench endogenous peroxidase activity in samples, place
sections in 0.3% hydrogen peroxide (H2O2) in water for
15 min. Wash sections in dH2O two times for 2 min each and
place them in TBS for 5–10 min.
4. Block nonspecific binding by adding 100 μL blocking buffer
(3% bovine serum albumin in TBS) on the sections and incu-
bate in a humidified chamber at room temperature for 15 min.
Wash sections in TBS two times for 5 min each.
5. Apply the primary antibody diluted in TBS with 1% BSA onto
the sections and incubate in a humidified chamber at 4  C
overnight. Rinse two times for 5 min each with TBS.
6. Apply the enzyme-conjugated secondary antibody to the slide,
the antibody diluted in TBS with 1% BSA to the concentration
recommended by the manufacturer and incubate for 1 h at
room temperature. Rinse two times for 5 min each with TBS.
7. Develop with chromogen for 5–10 min at room temperature.
Rinse in running tap water for 5 min.
8. Counterstain with hematoxylin 30 s to 1 min.
9. Dehydrate, clear, and mount sections as described in H&E
protocol (Subheading 3.3.2).

3.5 Derivation The sections above are aimed at establishing a diagnosis of lung
of Mouse Lung adenocarcinoma in the formed tumors. Consult with a pathologist
Adenocarcinoma if needed. For the following steps, proceed only with those cell
Cell Lines cultures whose corresponding tumors were diagnosed as lung
adenocarcinoma.
1. Culture the cell lines in vitro in DMEM 10% FBS, 2 mM L-
glutamine, 1 mM pyruvate, 100 U/mL penicillin, and 100 U/
mL streptomycin (see Note 8) under standard conditions
(37  C in 5% CO2–95% air) for at least 60 passages or
18 months (whichever comes first), to ensure immortality of
the cell line. Over the first few passages all primary cell types
(fibroblasts, immune cells, etc.) will have died whereas the
malignant cancer cells will be the only ones able to survive.
2. Freeze cells in FBS containing 10% DMSO or another appro-
priate freezing medium.

3.6 In Vitro 1. Plate 2
104 cells per well in DMEM in 96-well plates at a final
Validation volume of 100 μL/well.
of Proliferative 2. Incubate for desired period of time (usually 24 h).
Capacity by MTT Assay
3. Add 15 μL of 5 mM MTT working solution in 1
PBS
per well.
 Derivation of Mouse Lung Adenocarcinoma Cell Lines 183

4. Incubate 4 h at 37  C in a 5% CO2 humidified incubator.

5. Add 100 μL acidified isopropanol to each well to dissolve
formazan crystals. Mix to ensure complete solubilization.
6. Record absorbance at 492 nm on photometer.

3.7 In Vitro Validation of stemness can be done according to previously

Validation of Stemness described procedures [8] and is described in detail in this section.
by Tumorsphere
1. Add B27 supplement (50
) to tumorsphere medium, making
Formation Assay 1
concentration as needed for experiments. Add fresh B27
before each experiment.
2. Harvest cells by centrifugation and suspend the resulting pellet
in 5 mL 1
PBS. Retain cells on ice for the duration of the
experiment.
3. Mix the suspension gently and pipette 20 μL of the suspension
into a 1.5 mL Eppendorf tube.
4. Add 20 μL (1:1 ratio) of Trypan Blue to cell volume in the
Eppendorf tube and mix well.
5. Pipette approximately 10 μL of the mixture onto the hemocy-
tometer and count only the bright cells for viable cell count.
6. Take the needed number of cells and add the appropriate
volume of tumorsphere medium to make the cell concentration
at 1 cell/μL. Keep this suspension on ice and mix well for
plating.
7. Add 1
PBS to the first and last columns of the 96-well plate to
help minimize medium evaporation. This will leave 10 wells
available for each row.
8. Seed 200 μL of the cells suspended in tumorsphere medium
into each well (200 cells per well) (see Note 9).
9. For each cell line or treatment, seed cells into the wells of
2 rows for a total of 20 wells. This will equal a total of 4000
cells.
10. Seal the upper and lower edges of the 96-well plate with
laboratory tape to avoid evaporation of medium and place the
cells in an incubator set at 37  C and 5% CO2 for 1 week (see
Note 10).
11. After a 1-week incubation, tumorsphere numbers are counted
under a phase-contrast microscope using the 40

magnification lens.
12. Results can be presented as a percentage of the number of
tumorspheres divided by the initial number of cells seeded
(4000 cells).
184 Magda Spella et al.

3.8 In Vivo Validation 1. Use syngeneic, both male and female, sex-, weight (20–25 g)-,
of Malignancy and age (6–12 week)-matched experimental mice (at least
and Spontaneous n ¼ 10/experiment). On the previous day of the experiment
Metastatic Potential by anesthetize the mice by isoflurane inhalation and shave their
Flank Assay flank.
2. On the day of the experiment, prepare the cells as follows:
Trypsinize cells, count, and prepare a mix of 106 cells in
100 μL 1
PBS. Keep the mix on ice.
3. Anesthetize the mice by isoflurane inhalation and load the cell
mix in a 1 mL syringe (see Note 11).
4. Inject each mouse subcutaneously in the flank with 100 μL of
the cell mix.
5. Once per week measure three vertical tumor dimensions (δ1,
δ2, and δ3), and calculate primary tumor volume using the
formula: π
δ1
δ2
δ3/6 (see Note 12) [4, 5].
6. Sacrifice the mice when tumor volume reaches 20 mm3.
7. Isolate the primary tumor, fix it in 10% formalin and process it
for histology.
8. Cut open the peritoneal cavity, cut away the diaphragm and
expose the lungs by carefully opening the thorax along the
sternum and removing the chest walls. Continue cutting
along the thorax midline to expose the trachea. Place a suture
thread underneath the trachea and make a knot without tight-
ening it. Make a small nip along the upper surface of the
trachea.
9. Connect a 20 G intravenous catheter with a three-way stopcock
through a tubing to a reservoir containing 10% formalin placed
on a ring stand set approximately to 20 cm above the level of
the mouse. Empty all air from the tubing by running some
formalin out of the stopcock. Insert the tip of the catheter into
the small incision in the mouse trachea and open the stopcock
to inflate the lungs with 10% formalin at 20 cmH2O pressure
(see Note 13).
10. Tighten the knot on the trachea while pulling back slowly the
tip of the catheter. When the knot is tied securely, close the
stopcock and remove the catheter. Carefully remove the lungs
and transfer them to a 50 mL Falcon tube containing 10%
formalin.
11. Observe the inflated lungs under a stereomicroscope to locate
and quantify spontaneous metastases.
12. For further in-depth analysis of metastatic potential, incubate
lungs overnight in 10% formalin, embed in paraffin, section in
5 μm-thick sections, stain with hematoxylin and eosin and
examine all sections for metastatic sites [5].
 Derivation of Mouse Lung Adenocarcinoma Cell Lines 185

4 Notes

1. Wear mask, gloves, and protective clothing when handling the

carcinogens.
2. Before moving to the clearing step, make sure to completely
remove water from the sections. If sections still have traces of
water, a replacement of the ethanol wells may be needed. Blot
excess ethanol before going into xylene.
3. Prepare diastase solution 1 h at 37  C. Do not heat the solution
above 40  C, as enzyme activity can be destroyed at higher
temperatures. Insufficient heating may cause incomplete diges-
tion of glycogen. The Amylase solution can be stored up to
1 month at 4  C.
4. Make fresh 0.5% periodic acid solution each time this proce-
dure is performed.
5. In order to test the Schiff reagent, place 10 mL of 37% formalin
into a glass surface and add a few drops of the Schiff reagent on
it. Good Schiff reagent will rapidly turn a red-purple color.
Deteriorating Schiff’s reagent will display a delayed reaction
and the color produced will be a deep blue-purple. Preheat the
Schiff’s reagent at room temperature for at least 30 min.
6. Do not allow sections to dry at any time during this procedure
as this can lead to inconsistent staining.
7. When using this method, a large amount of the retrieval buffer
will evaporate. Be sure to watch the buffer level of the slide
vessel and add more buffer if necessary. Do not allow the slides
to dry out. Slides should be placed in a plastic rack and vessel
for this procedure. Standard glass histology staining racks and
vessels will crack when heated.
8. During the first passages of the newly isolated cell lines you can
use a higher concentration (e.g., double) of antibiotics in the
culture media to prevent contamination of the cell culture.
9. The number of cells used for tumorsphere formation assays
may vary with the cell type.
10. The medium is not changed during the experiment so as to not
disturb the formation of the tumorspheres.
11. In the in vivo validation experiments, make sure to remove the
air from the syringe and to invert the syringe regularly so that
no cell clumps form.
12. In the in vivo validation experiments, use a cell line of known
malignant and metastatic potential as a positive control to
compare the newly derived cell line.
13. 20 cm H2O pressure provides for a lung volume equivalent to
the resting volume of the lungs and enables precise histologic
observations.
186 Magda Spella et al.

Acknowledgments

The work was supported by European Research Council 2010

Starting Independent Investigator and 2015 Proof of Concept
Grants (grant numbers 260524 and 679345 respectively; to
G.T.S.).

References
1. Torre LA, Bray F, Siegel RL et al (2015) Global cooperate with TRP53 and CCL2 to promote
cancer statistics, 2012. CA Cancer J Clin lung metastasis. Onco Targets Ther 6:e1256528
65:87–108 6. Vikis HG, Rymaszewski AL, Tichelaar JW
2. Hecht SS (1999) Tobacco smoke carcinogens (2013) Mouse models of chemically-induced
and lung cancer. J Natl Cancer Inst lung carcinogenesis. Front Biosci (Elite Ed)
91:1194–1210 5:939–946
3. Westcott PM, Halliwill KD, To MD et al (2015) 7. Turner BM, Cagle PT, Sainz IM et al (2012)
The mutational landscapes of genetic and chem- Napsin A, a new marker for lung adenocarci-
ical models of Kras-driven lung cancer. Nature noma, is complementary and more sensitive
517:489–492 and specific than thyroid transcription factor
4. Kanellakis NI, Giannou AD, Pepe MA et al 1 in the differential diagnosis of primary pulmo-
(2019) Tobacco chemical-induced mouse lung nary carcinoma: evaluation of 1674 cases by tis-
adenocarcinoma cell lines pin the prolactin sue microarray. Arch Pathol Lab Med
orthologue proliferin as a lung tumour pro- 2:163–171
moter. Carcinogenesis 40(11):1352–1362 8. Johnson S, Chen H, Lo P-K (2013) In vitro
5. Giopanou I, Lilis I, Papaleonidopoulos V et al Tumorsphere formation assays. Bio Protoc 3
(2016) Tumor-derived osteopontin isoforms (3):e325
 Chapter 15

Whole Transcriptome Sequencing Analysis of Cancer Stem/

Progenitor Cells Obtained from Mouse Lung
Adenocarcinomas
Ansam Sinjab, Reem Daouk, Wassim Abou-Kheir, and Humam Kadara

Abstract
Interrogation and characterization of lung cancer stem cells (CSCs) that are implicated in lung oncogenesis
is crucial for our understanding of inter- and intra-tumor heterogeneity and the aggressive nature of the
disease, including tumor resistance and relapse in response to conventional therapy. Here, we describe an
in vitro surrogate model, namely the “sphere-forming assay,” for the derivation, enrichment, and propaga-
tion of lung stem/progenitor cells with CSC properties, including self-renewal, tumor initiation capacity
and propagation, and differentiation into cells of the tumor bulk, from a murine Kras-mutant lung
adenocarcinoma cell line. Self-renewing cancer stem/progenitor cells, in the form of 3D in vitro spheres,
can be phenotypically interrogated using downstream techniques such as gene expression analysis (e.g.,
whole transcriptome sequencing and quantitative real time PCR), which is the focus of this chapter.

Key words RNA-sequencing, Quantitative real time PCR, 3D spheres, Self-renewal, Cancer stem/
progenitor cells

1 Introduction

This procedure describes the in vitro enrichment of lung cancer

stem/progenitor cells by culturing and propagating sphere-
forming cells with self-renewal capacity from a mouse lung cancer
cell line. This model can be implemented using other cell lines of
interest with cell-type specific adjustments such as the choice of cell
culture medium and additives. The cell line used herein, termed
MDA-F471, was derived from somatically-induced Kras-mutant
mouse lung tumors which develop upon prolonged exposure to
tobacco-related carcinogens. The clonal derivation of single lung
tumor cell lines from dissociated mouse lung tumors,

Ansam Sinjab and Reem Daouk Co-contributing first authors.

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_15, © Springer Science+Business Media, LLC, part of Springer Nature 2021

187
188 Ansam Sinjab et al.

immortalization and characterization has been previously described

and will not be the focus of this chapter.
The chapter is divided into multiple sections, starting with
establishing first generation 3D spheres. It describes in detail how
the spheres can be maintained and monitored in culture and
assessed for self-renewal capacity. The chapter also covers the tech-
nique used for serial propagation for prolonged periods of time in
order to further enrich for self-renewing stem/progenitor cells in
culture. Spheres can be maintained for multiple generations for
subsequent analysis. Since our focus here is gene expression, we
will describe RNA isolation from spheres which can be used for
subsequent RNA sequencing (RNA-seq) and quantitative real time
PCR (qRT-PCR) for the amplification of a select set of markers
(such as stem-cell related genes) for the purpose of validating
differentially expressed genes identified in sequencing data.

2 Materials

2.1 Cell Culture 1. Cell lines. We use this protocol for MDA-F471 cells, described
above.
2. Growth media for 2D culture (complete growth medium):
DMEM-F12 supplemented with 10% Fetal Bovine Serum
(FBS), 1% Penicillin–Streptomycin and 0.2% Plasmocin
Prophylactic.
3. Growth media for 3D culture (sphere media): DMEM-F12
supplemented with 5% Fetal Bovine Serum (FBS), 1% Penicil-
lin–Streptomycin and 0.2% Plasmocin Prophylactic.
4. Sphere dissociation media: dissolve 0.5 mg/mL of dispase
enzyme in sphere media, and filter using 0.2 μm syringe filter.
5. Growth factor-reduced (GFR) Matrigel™.
6. 0.4% Trypan Blue solution.
7. Cell culture dishes, 10 cm.
8. Cell culture plates, 24-wells.
9. 0.05% Trypsin-EDTA solution. We purchase as a ready-to-use
solution.

2.2 RNA Extraction 1. RNeasy Plus mini kit (Qiagen). We have optimized this proce-
dure with this kit. Using other kits for RNA extraction may
require optimization.
2. RLT lysis buffer: Included in the RNeasy Plus mini kit. Before
using, add 10 μL of 14.3 M β-mercaptoethanol for every 1 mL
of RLT. This buffer can be stored for up to 1 month in the dark
at room temperature.
 Gene Expression Analysis of Lung Cancer Stem Cells 189

2.3 RNA-Seq 1. We perform the whole transcriptome sequencing (RNA-Seq)

Workflow using the NovaSeq 6000 platform (Illumina).
and Analysis, Kits 2. Ribo-zero rRNA removal kit (Illumina).
and Software
3. TruSeq stranded total RNA LT sample kit (Illumina).
4. FastQC software, downloadable from http://www.bioinfor
matics.babraham.ac.uk/projects/fastqc/.
5. Trimmomatic software, downloadable from http://www.
usadellab.org/cms/?page¼trimmomatic.
6. HISAT2 software, downloadable from https://ccb.jhu.edu/
software/hisat2/index.shtml.
7. StringTie software, downloadable from https://ccb.jhu.edu/
software/stringtie/.
8. DESeq2 software, downloadable from https://bioconductor.
org/packages/release/bioc/html/DESeq2.html.
9. R programming language and environment, downloadable.
10. Ingenuity® Pathway Analysis (IPA), web-based bioinformatics
application.

2.4 Reverse 1. Quantitect Reverse Transcription Kit (Qiagen). The use of

Transcription of RNA other kits may require additional optimization.
to cDNA 2. Reverse transcription master mix: per one reaction add 1 μL
Reverse Transcriptase, 4 μL RT buffer and 1 μL RT primer mix
(see Note 1). These components are included in the Quantitect
Reverse Transcription Kit.

2.5 General 1. Heating blocks for microcentrifuge tubes, set at 42  C and

Laboratory Equipment, 95  C.
Supplies, 2. Ice, or cooling block.
and Solutions
3. Humidified cell culture incubator (5% CO2, 37  C).
4. 1 Phosphate Buffered Saline (PBS), Ca2+- and Mg2+-free. We
purchase as a ready -to-use solution.
5. Serological pipettes, different volumes.
6. Light microscope.
7. Micro-pipettes, different volumes, tips.
8. Conical tubes, 15 mL.
9. Eppendorf microcentrifuge tubes.
10. Centrifuges: benchtop microcentrifuge and also a centrifuge
with a swinging bucket rotor capable of holding conical tubes.
11. Hemocytometer cell counting chamber, pre-cleaned with 70%
ethanol.
12. 20-gauge needle (0.9 mm diameter) fitted to an RNase-free
syringe.
190 Ansam Sinjab et al.

13. Vortex mixer.

14. Ethanol, 75%.
15. Microvolume spectrophotometer.

3 Methods

3.1 Culturing Cells 1. Thaw growth factor-reduced (GFR) Matrigel™ on ice before
for Sphere-Formation starting.
Assay 2. Culture MDA-F471 cells in 10 cm dishes in complete growth
medium in a humidified incubator until approximately 90%
confluency.
3. Discard media and wash attached cells with 5 mL of room
temperature 1 Ca2+- and Mg2+-free PBS, to remove any
remainder of Fetal Bovine Serum that will interfere with trypsin
activity.
4. PBS is discarded, and 2 mL of pre-warmed (37  C) 0.05%
Trypsin-EDTA solution is added to the cells with swirling of
the plate to allow equal coverage of all cells on the plate.
5. Return the plate to the humidified incubator to allow for
trypsin action. Depending on the cell-type, trypsinization
time may vary.
6. Observe the plate under a light microscope. When at least 90%
of cells are detached, add 2 mL of complete growth medium to
neutralize the trypsin action (see Note 2).
7. Mix the cell suspension in the plate by gently pipetting while
washing the plate. Transfer the single-cell suspension to a
15 mL conical tube.
8. To determine the concentration of the cell suspension, take a
50 μL sample for cell counting (next section) in an Eppendorf
tube. Centrifuge the cells for 5 min to remove the trypsin. This
centrifugation con be done in a centrifuge with a swinging
bucket rotor, a speed of up to 300  g can be used.
9. After centrifugation, carefully discard the supernatant and
re-suspend the cell pellet in 1 mL of cold serum-free medium.

3.2 Preparation 1. Add 50 μL 0.4% Trypan Blue solution to the tube containing
of Cell Suspension the previously obtained 50 μL cell suspension sample, mix by
in Matrigel™ Mixture pipetting, then transfer 10 μL to the hemocytometer cell
at a Defined Plating counting chamber.
Density 2. Count the viable cells in 4 quadrants under a light microscope
and estimate the total number of cells in the original suspension
as follows: take the average cell count from each of the four sets
of 16 corner squares; multiply by 10,000 (104); multiply by
 Gene Expression Analysis of Lung Cancer Stem Cells 191

2 to adjust for the 1:2 dilution resulting from the Trypan Blue
addition; the final value is the number of viable cells per mL in
the original cell suspension (in this case 4 mL).
3. Determine the final concentration of cells needed for the
sphere-formation assay. Depending on cell growth rate and
doubling time, cells can be plated at a final density of 2000 to
10,000 cells per well in a 24-well plate. The cells will be
suspended in 50 μL of a 1:1 “serum-free medium: Matrigel™”
mixture per well. For quantitative assays, spheres are plated in
duplicates or triplicates. For example, if plating at a density of
5000 cells per well for 8 different conditions in triplicates,
24 wells will be needed. Identify the number of wells needed
with an additional well to take pipetting errors into account, in
this case we would calculate for 25 wells.

Total number of cells ¼ 25 wells  5000 cells=well

¼ 125, 000 cells

Final Volume of 1 : 1 mixture ¼ 25 wells  50 μL=well

¼ 1:25 mL
4. Perform the required calculations for the proportion of cells
needed from the original suspension (count obtained above)
and calculate the final volume (in μL) needed of each of serum-
free medium and Matrigel™.

V needed f rom cell suspension μL

¼ ð1:25  105 Þ  1000 μL=cell density in suspension
5. Add the appropriate volume of serum-free medium to the
volume of cells taken from suspension to make a final volume
of 625 μL.
6. Check that the Matrigel™ is now in liquid form. Pipet 625 μL
of Matrigel™ to the 625 μL of cell suspension, gently mix by
pipetting and keep the mixture on ice.

3.3 Plating the Cell 1. Before plating, make sure the mixture (cells and Matrigel™) is
Suspension uniformly suspended by gently mixing the solution on ice using
in Matrigel™ a 1000 μL micropipette. Carefully transfer 50 μL of the mixture
for Sphere-Formation to each well, and slowly dispense around the rim of each well in
Assay a circular manner (Fig. 1) (see Notes 3 and 4).
2. Transfer the plate to the humidified incubator to allow the
Matrigel™ to solidify. This should take around 45 min.
3. After solidification, slowly add pre-warmed sphere medium to
the middle of each well. Any sphere treatment of interest can be
added to this medium. Medium (with or without treatment) is
to be replenished every 2–3 days (see Note 5).
192 Ansam Sinjab et al.

Fig. 1 Representative bright-field images of MDA-F471 G1-G5 spheres at the rim of the well visualized by
Axiovert inverted microscope at 10 magnification after 1 week of plating and before propagation to the next
generation. Scale bar ¼ 100 μm

3.4 Calculation The efficiency with which single cells are able to form spheres,
of Sphere-Formation termed sphere-forming efficiency (SFE) is an indication of the
Efficiency self-renewal ability of cells, or their “stemness,” which can also
reflect tumor aggressiveness and resistance to therapy. SFE is the
percentage of the ratio of the number of spheres to the number of
cells plated. For instance, at day seven, 200 first generation
(G1) spheres were counted in one well whereby 5000 cells had
been plated.
SFE ðG1Þ ¼ 200=5000  100 ¼ 4%
For replicate wells, average SFE can also be calculated.

3.5 Sphere Cells that are able to self-renew over an extended period of time
Propagation (beyond secondary or tertiary spheres) are confidently deemed as
stem cells. To further enrich for stem cells in our in vitro assay,
spheres can be propagated over multiple generations under the
same conditions, allowing them to self-renew at every
dissociation/re-plating step. With each passage/propagation, the
generation of new spheres will represent the self-renewal of the
previous population (Fig. 1). Theoretically, only cells with self-
renewal capacity will be successfully propagated to further genera-
tions and at an “indefinite” rate. Furthermore, since progenitor
cells do retain self-renewal capabilities and can generate primary
spheres (G1), serial propagation to generate later sphere genera-
tions (e.g., G5) are best characterized as bona fide stem cells
[1]. Thus, the below propagation protocol is carried out on pri-
mary spheres (G1) 7 days post-first-time plating and repeated at
least four times to generate fifth generation spheres (G5) to select
for true self-renewing stem cells [2].
1. Aspirate the medium from the center of the well and gently add
500 μL of sphere dissociation media.
2. Incubate for 30 min in a humidified incubator at 37  C to allow
for enzymatic dissociation to take place.
3. After incubation, the dispase should digest the Matrigel™
allowing the embedded spheres to be released into the media.
 Gene Expression Analysis of Lung Cancer Stem Cells 193

Collect the spheres and media into microcentrifuge tubes and

centrifuge at 1200 rpm (150  g) in a benchtop microcentri-
fuge for 5 min at room temperature (see Note 6).
4. Carefully aspirate and discard the supernatant and re-suspend
the sphere pellet in 1 mL of pre-warmed 0.05% Trypsin-EDTA
solution to further dissociate the spheres into single cells.
5. Incubate for 15 min in a humidified incubator at 37  C to allow
for enzymatic dissociation to take place. Incubation time with
trypsin may vary depending on the cell line.
6. Add 1 mL of sphere media to each tube to stop the action of
trypsin. Centrifuge at 900 rpm (80  g) in a benchtop micro-
centrifuge for 5 min at room temperature.
7. Carefully aspirate and discard the supernatant and re-suspend
the pellet in 1 mL of cold serum-free growth medium. Take a
sample for Trypan Blue counting using a hemocytometer.
8. Based on cell counts, cells are re-plated at the desired density as
outlined in the section above.

3.6 RNA Isolation The derived spheres can be used to characterize phenotypic and
from Lung Cancer genome-wide gene expression features. In the case of the utilized
Spheres Kras-mutant lung adenocarcinoma cell line, such downstream
methods can help elucidate the underlying mechanisms in the
pathogenesis of this aggressive molecular subtype of lung cancer.
Several assays have been described for the characterization of
sphere-derived stem cells, and those include but are not limited to
investigation of differentiation potential of the propagated cancer
stem cells, analysis of protein expression by immunofluorescence, as
well as gene expression analysis using real time PCR (RT-PCR). In
this protocol, we describe a method for RNA isolation and
subsequent whole exome sequencing using the Illumina platform,
as well as target validation by RT-PCR.
Spheres can be collected at any generation for RNA isolation.
Depending on the scientific question at hand, gene expression can
be compared between spheres of different generations or between
spheres and their parental cells (grown in 2D, non-stem cells, as
further described), or under different treatment conditions.
1. At the timepoint of interest, spheres are collected from the
wells by dispase-mediated Matrigel™ digestion as previously
described in Subheading 3.5. Total RNA can be purified from
parental cells or spheres using commercial kits, such as the
RNeasy Plus Mini Kit (Qiagen) described in the steps to follow.
All steps described below use materials and solutions supplied
in this kit.
2. Carefully aspirate and discard the supernatant and resuspend
the sphere pellet in 350 μL of RLT lysis buffer.
194 Ansam Sinjab et al.

3. Homogenize cells by passing the lysate at least five times

through a 20-gauge needle (0.9 mm diameter) fitted to an
RNase-free syringe. Vortex the tubes for 1 min.
4. Transfer the homogenized lysate to a gDNA Eliminator spin
column placed in a 2 mL collection tube. Centrifuge for 30 s at
8000  g (10,000 rpm). Discard the column and save the
flow-through.
5. Add 350 μL of 75% ethanol to the flow-through and mix well
by pipetting (see Note 7).
6. Transfer the sample (now 700 μL) to a RNeasy spin column
placed in a 2 mL collection tube and centrifuge for 20 s at full
speed.
7. Discard the flow-through and add 700 μL of Buffer RW1 to
the RNeasy spin column. Centrifuge for 20 s at full speed to
wash the spin column membrane.
8. Discard the flow-through and add 500 μL Buffer RPE to the
RNeasy spin column. Centrifuge for 20 s at full speed to wash
the spin column membrane. Discard the flow-through and
repeat this step for a total of two washes with buffer RPE.
After the second wash, discard the old collection tube with
the flow-through and place the column in a new collection
tube. Centrifuge at full speed for 1 min to dry the membrane.
9. Place the RNeasy spin column in a new 1.5 mL collection tube
and add 40 μL RNase-free water directly to the spin column
membrane. Incubate at room temperature for 5 min to allow
the membrane to soak, then centrifuge for 1 min at full speed
to elute the RNA (see Note 8).
Spectrophotometric assessment of RNA quality and quan-
tity is done using a microvolume spectrophotometer. Yield
would depend on the RNA content of the cells being used.
Acceptable A260/A280 and A260/A230 are 1.9–2.1 and
2.0–2.2, respectively. Purified RNA is maintained on ice or
kept at 80  C for long-term storage (see Note 9).

3.7 Whole This section describes whole transcriptome sequencing (RNA-Seq)

Transcriptome of MDA-F471 G1-derived spheres and parental isoforms using the
Sequencing NovaSeq 6000 platform (Illumina).
3.7.1 Experimental 1. Use at least 3 biological replicates of each experimental sample.
Workflow 2. For removal of ribosomal RNA from total RNA samples, the
Ribo-zero RNA Removal Kit can be used according to the
manufacturer’s instructions.
3. Around 500 ng of total RNA can be used to generate paired-
end libraries (101 bp reads) using the TruSeq stranded total
RNA LT sample kit from Illumina according to the manufac-
turer’s instructions briefly described in the below steps.
 Gene Expression Analysis of Lung Cancer Stem Cells 195

4. After fragmentation of total RNAs for short read sequencing,

RNA samples are reverse transcribed into cDNA.
5. Adaptors are ligated onto both ends of the cDNA fragments
followed by amplification of the fragments.
6. Fragments with insert sizes between 200 and 400 bp (size
selection using the Agilent Bioanalyzer platform) are subjected
to paired-end sequencing using the NovaSeq 6000 platform
(Illumina).

3.7.2 Analysis Workflow RNA-seq analysis workflow is summarized in the below steps.
1. Sequenced raw reads are first subjected to quality control
(QC) using FastQC.
2. Trimmomatic [3] is used to remove adapter sequences, low
quality bases as well as reads with lengths shorter than 36 base
pairs.
3. Percentage of raw and trimmed reads with Phred quality scores
(Q) of greater than or equal to 30 are computed for each
sample.
4. Reads are mapped to the reference mouse genome (e.g., UCSC
mm10) using the fast splice-aware aligner HISAT2 splice-
aware aligner [4].
5. Transcripts are assembled from aligned reads using StringTie
[5] borrowing from the annotation database
RefSeq_2017_06_12.
6. Normalization is performed using DESEQ2 [6] considering
both transcript length and depth of coverage.
7. Read counts are computed for each transcript/gene. For dif-
ferential expression analysis, first a pseudo-count of one is
applied to all genes/transcripts and samples; this ensures anal-
ysis of non-zero counts.
8. Identification of gene features significantly differentially
expressed between the MDA-F471 G1 spheres and parental
isoforms is performed using DESEQ2 [6] in the R language
and environment and using a false discovery rate (FDR) thresh-
old of 1% and a random variance model. A fold-change thresh-
old of 2, for instance, can be further applied.
9. Differentially expressed gene features are functionally analyzed
and topologically organized into gene–gene interaction net-
works using the commercially available software Ingenuity
Pathways Analysis (IPA). IPA enables the examination of func-
tional associations among the genes and generates functional
(with predicted activated or inhibited states) gene-gene inter-
action networks based on the presence of interconnected genes
and estimated by a scoring system provided by IPA. Scores are
196 Ansam Sinjab et al.

determined by the number of differentially expressed genes

within the networks, and the strength of the associations
among network members. IPA also allows the identification
of upstream regulators, i.e., genes that are predicted to be
functionally associated or upstream of the identified differen-
tially expressed genes, using a modified version of gene set
enrichment analysis. The pathways, gene network, and gene
set analyses permit selection of genes predicted to have key
roles in the phenotype (sphere versus parental) based on their
expression and number of functional associations within signif-
icant interaction networks.

3.8 Interrogation Differentially expressed genes can be selected for confirmation by

of Select Differentially qRT-PCR based on their upregulation or down-regulation in the
Expressed Genes by spheres, extent of differential expression as well as biological func-
Quantitative Real Time tional associations based on the functional pathways and gene set
PCR (qRT-PCR) analyses.

3.8.1 Reverse Reverse transcription is carried out using commercial kits such as
Transcription of RNA the QuantiTect Reverse Transcription Kit (Qiagen) according to
to cDNA the manufacturer’s protocol and as summarized below. All materials
and reagents in this section are supplied in the kit.
1. Thaw RNA samples on ice and the reverse transcription ingre-
dients (gDNA Wipeout Buffer, Reverse Transcriptase, RT
Buffer, RT Primer Mix, and RNase-free water) at room tem-
perature for 10 min.
2. Gently flick the tubes to allow homogenization and centrifuge
briefly to collect residual liquid from the sides of the tubes, then
keep everything on ice.
3. Eliminate genomic DNA (gDNA) by mixing 2 μL of the
gDNA Wipeout Buffer with 1 μg of each RNA sample and
RNase-free water in a total reaction volume of 14 μL.
4. Incubate for 2 min at 42  C.
5. Prepare the reverse transcription master mix as described in
Subheading 2.
6. Transfer 6 μL of the master mix into each tube of template
RNA and mix gently.
7. Incubate the tubes for 15 min at 42  C to allow the reverse
transcription reaction to take place.
8. Incubate for 3 min at 95  C to inactivate the reverse transcrip-
tase enzyme.
9. Add 80 μL RNase-free water to each tube to dilute cDNA to a
final volume of 100 μL.
 Gene Expression Analysis of Lung Cancer Stem Cells 197

The cDNA can then be used to interrogate gene expression

by qRT PCR using primers specific for the genes of interest as
well reference gene(s) chosen according to the experimental
conditions being investigated. Fold change between samples
(e.g., treated and control, spheres and parental cells, or differ-
ent sphere generations) can then be calculated using the
2ΔΔCq method.

4 Notes

1. If reverse transcribing an N number of reactions, prepare a

master mix for a total of N + 2 reactions to account for pipet-
ting errors.
2. Do not leave cells exposed to trypsin for an extended period of
time since this could result in cell death. Check the detachment
of cells every 1 min and immediately stop the action of trypsin
by adding an equal amount of cell culture media
containing FBS.
3. Avoid bubble formation which may disrupt the Matrigel™
matrix by creating gaps. You can get rid of a bubble by pricking
it with the needle of a 27-gauge syringe. Always check if you
have uniform and bubble-free plating under the microscope.
4. Plating the Matrigel™ matrix at the rims of the wells confers
several technical and biological advantages. Rim-plating
enables medium/treatment replenishment by gently changing
the medium in the center of the well without disruption of the
matrix. Since Matrigel™ matrix is a gel-like substance,
rim-plating confers edge support and tension to stabilize the
matrix and prevent its breakage over long incubation times
(up to 2 weeks). Furthermore, physical confinement of the
spheres to the well edges facilitates spheroid identification,
size analysis, and counting [7].
5. To aspirate the old media, use gentle vacuum pressure to avoid
disturbing the cell-containing Matrigel™ mixture at the rims.
6. To increase the sphere yield, pipette up and down the rims
vigorously to aid in Matrigel™ disruption.
7. Prepare fresh 75% ethanol using molecular grade absolute eth-
anol and nuclease-free water.
8. The eluate can be reused to repeat step 9 of the RNA extrac-
tion to increase the RNA yield.
9. Follow common best practices for working with RNA to avoid
degradation or contamination. Spray and wipe the equipment
and working place with an RNase decontamination solution
before starting and keep RNA samples on ice at all times.
198 Ansam Sinjab et al.

References
1. Reynolds BA, Rietze RL (2005) Neural stem 5. Pertea M, Pertea GM, Antonescu CM et al
cells and neurospheres--re-evaluating the rela- (2015) StringTie enables improved reconstruc-
tionship. Nat Methods 2(5):333–336 tion of a transcriptome from RNA-seq reads.
2. Daouk R, Hassane M, Bahmad HF et al (2019) Nat Biotechnol 33(3):290–295
Genome-wide and phenotypic evaluation of 6. Love MI, Huber W, Anders S (2014) Moderated
stem cell progenitors derived from Gprc5a- estimation of fold change and dispersion for
deficient murine lung adenocarcinoma with RNA-seq data with DESeq2. Genome Biol 15
somatic Kras mutations. Front Oncol 9:207 (12):550
3. Bolger AM, Lohse M, Usadel B (2014) Trim- 7. Bahmad HF, Cheaito K, Chalhoub RM et al
momatic: a flexible trimmer for Illumina (2018) Sphere-formation assay: three-
sequence data. Bioinformatics 30 dimensional in vitro culturing of prostate cancer
(15):2114–2120 stem/progenitor sphere-forming cells. Front
4. Kim D, Langmead B, Salzberg SL (2015) Oncol 8:347–347
HISAT: a fast spliced aligner with low memory
requirements. Nat Methods 12(4):357–360
 Chapter 16

In Vivo Imaging of Orthotopic Lung Cancer Models in Mice

Peng Liu, Liwei Zhao, Laura Senovilla, Oliver Kepp, and Guido Kroemer

Abstract
The success of anticancer interventions relies on their ability to ignite an anticancer immune response and to
reinstate cancer immunosurveillance. Thus, high dose crizotinib can induce immunogenic cell death (ICD)
in cancer cells. If combined with cisplatin, crizotinib sensitizes non-small cell lung cancers (NSCLC) to
subsequent (but not simultaneous) immunotherapy with PD-1 immune checkpoint blockade, facilitating
the cure of more than 90% of established orthotopic cancers in mice. Here, we detail protocols for the
establishment and monitoring of transplantable orthotopic NSCLCs in syngeneic immunocompetent
animals. Indeed, TC1 cells establish lung cancer upon their intravenous injection into the tail vein, while
Lewis lung carcinoma (LLC) cells can be implanted intrathoracically to generate lung cancers. If transduced
with luciferase, both TC1 and LLC cells form tumors that can be conveniently monitored by chemilumi-
nescence. This type of NSCLC model is highly useful for the development of novel curative anticancer
therapies.

Key words Non-small cell lung cancer, Immunogenic cell death, Immune checkpoint blockade, PD-
1, Lung cancer models

1 Introduction

The occurrence of non-small cell lung cancer (NSCLC) has

increased during the past decades. Despite the implementation of
PD-1/PD-L1 immune checkpoint blockade immunotherapy,
NSCLC has become the most frequent lethal human cancer.
Immunotherapy is either used as first- or second-line therapy fol-
lowing failed chemotherapy. Nevertheless, the objective response
rate is below 30% and permanent cure is anecdotic. Certain success-
ful antineoplastic cytotoxicants (such as anthracyclines, cyclophos-
phamide, and oxaliplatin) have the ability to ignite an antitumor
immune response that is the result of immunogenic cell death
(ICD) [1–3]. ICD involves the coordinated emission of danger-
associated molecular patterns (DAMPs) that act as endogenous

Peng Liu and Liwei Zhao contributed equally to this work.

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_16, © Springer Science+Business Media, LLC, part of Springer Nature 2021

199
200 Peng Liu et al.

adjuvants, finally facilitating tumor antigen presentation by den-

dritic cells and the establishment of T-cell mediated immunity. The
accompanying conversion of immunologically cold into hot tumors
sensitizes the cancer to subsequent immune checkpoint blockade
[4, 5]. Recently we identified crizotinib as an ICD inducer that, at
high doses (in the 10 μM range), acts “off-target,” likely through a
multi-kinase inhibitory action. Crizotinib was able to increase the
efficacy of the standard-of-care chemotherapy cisplatin, which is
widely used for NSLCL but has a low ICD-inducing capacity, and
the combination of both agents, crizotinib and cisplatin, caused a
synergistic tumor growth reduction [5, 6]. This effect was abro-
gated in tumors that were deficient in ANXA1 or HMGB1 [7–9],
two key DAMPs that, among others, dictate the immunogenicity of
cell death, supporting the idea that ICD must be induced in malig-
nant cells to stimulate a therapeutically relevant anticancer immune
response.
The cure rate in mice increased to more than 90% when
crizotinib-based chemotherapy was sequentially combined with
PD-1 blockade. Of note, permanently cured animals generated
immunological memory and resisted re-challenge with antigeni-
cally identical cancer cells [5]. These results were obtained in two
different models of NSCLC, including transplantable TC1 and
LLC cancers developing orthotopically in the lungs of syngeneic
immunocompetent animals. Here, we detail the methods for gen-
erating NSCLC arising from TC1 and LLC cells in the lung, i.e., in
an orthotopic location.

2 Materials

2.1 Cell Lines 1. Murine non-small-cell lung carcinoma (NSCLC) TC1 cells and
and Culture Reagents Lewis lung carcinoma (LLC) cells that stably express firefly
luciferase (TC1-Luc). We obtained these cells from John Hop-
kins University, Baltimore, Maryland, US, and they have been
previously described [10].
2. Cell culture medium: Dulbecco’s Modified Eagle Medium
(DMEM), 10% Fetal Bovine Serum (FBS), 100 U/mL penicil-
lin, 100 μg/mL streptomycin.
3. Phosphate-Buffered Saline (PBS). Can be purchased as a ready-
to-use pre-mixed solution.
4. Calcium- and Magnesium-free Dulbecco’s Phosphate-
Buffered Saline (DPBS). Can be purchased as a ready-to-use
premixed solution.
5. TrypLE™ Express Enzyme (1
).
6. Hygromycin B (50 mg/mL).
 In Vivo Imaging of Murine Lung Cancer Models 201

7. Trypan Blue Stain (0.4%) for use with the Countess™ Auto-
mated Cell Counter (Thermo Fisher Scientific #T10282).
8. 75% Ethanol; Surfa’Safe Premium Foaming Spray and Myco-
plasma Off™ for cleaning and disinfection of all laboratory
surfaces.

2.2 Plasticware 1. Tissue culture-treated cell culture flasks with vent cap;
for Cell Cultures T-175 cm2 format.
2. Corning® Costar® Stripette® serological pipettes (5 mL/
10 mL/25 mL).
3. Corning® aspiration pipettes 2 mL format.
4. 15 mL and 50 mL centrifuge tubes.
5. 0.5 mL, 1.5 mL, and 2 mL Eppendorf tubes.
6. 10 μL, 200 μL, and 1000 μL micro-pipette tips.
7. Corning® cell strainer, size 70 μm.
8. Cell counting slides.

2.3 Mice and Related 1. C57BL/6 mice, 6-week-old females.

Materials 2. 1 mL insulin syringes.
and Solutions
3. 25 G syringe needles.
4. 30 G syringe needles.
5. BD Micro-Fine™ + 0.3 mL insulin syringes.
6. Skin antiseptic (Formulated 70% ethanol, and iodide from local
Pharmacia), medical gauze pads, anesthetic agent (e.g.,
isoflurane).
7. Physiological saline solution: 0.9% sodium chloride solution in
water.
8. Matrigel matrix.
9. Crizotinib and cisplatin solutions. Start by preparing the sol-
vent solution as follows: mix (v/v) 10% Poly-(ethylene glycol)
(PEG400), 10% TWEEN®-80, 4% Dimethyl sulfoxide
(DMSO), and 76% of the physiological saline. This is
10:10:4:76 v/v PEG400: TWEEN®-80: DMSO: physiological
saline. Sterilize by passing through a 0.22 μm filter. Prepare a
1 mg/mL cisplatin stock solution as follows: dissolve 100 mg
of powder in 100 mL physiological saline. Aliquot the solution
and store at 20  C until use. Prepare the combination che-
motherapeutics (combo) consisting of crizotinib plus cisplatin
as follows: dissolve 5 mg of crizotinib in 1 mL solvent solution
containing 25 μL of cisplatin stock solution to obtain a final
concentration of 5 mg/mL crizotinib and 0.025 mg/mL cis-
platin. Place all prepared reagents on a horizontal shaker at 4  C
overnight to obtain a homogeneous solution.
202 Peng Liu et al.

10. InVivoMAb anti-mouse PD-1 (CD279) (BioXCell, Catalogue

# BE0273), (1 mg/mL in PBS).
11. InVivoMAb rat IgG2a isotype control, anti-trinitrophenol
(BioXCell, Catalogue # BE0089), (1 mg/mL in PBS).
12. Beetle luciferin solution: Dissolve 1 g of luciferin powder
(potassium salt) into 66.7 mL of DPBS to obtain a final con-
centration of 15 mg/mL. Sterilize by filtering through a
0.22 μm filter, then aliquot into 2 mL Eppendorf tubes and
store at 20  C until use.

2.4 Equipment 1. Cell culture incubator (37  C, 5% CO2).

2. Micropipettes, electronic pipette controller, and vacuum
aspirator.
3. Centrifuge suitable for 15 mL and 50 mL tubes.
4. Veterinary anesthesia machine for small animals.
5. Heating pad for mice/rats.
6. Rechargeable cordless hair trimmer.
7. Surgical instruments (e.g., scissors, forceps, skin clip).
8. Xenogen IVIS™ 50 bioluminescence imaging system.

2.5 Software 1. Microsoft Office.

2. GraphPad Prism V7.
3. Living Image V4.2.

3 Methods

3.1 Cell Culture 1. TC-1-Luc cells and LLC-Luc cells are routinely cultured in
DMEM medium in a humidified atmosphere containing 5%
CO2 at 37  C (see Notes 1 and 2). LLC-Luc cells have to be
continuously maintained in 250 μg/mL hygromycin B to
select for cells with luciferase expression (see Note 3).
2. Monitor the confluence of the cell culture and prepare subcul-
tures when around 80% confluence is reached (see Notes
2 and 4).
3. Remove the culture medium by vacuum aspiration, and gently
add 10 mL of PBS to wash the adherent cells (see Note 5).
4. Remove the PBS by vacuum aspiration and add 5 mL of Try-
pLE™ Express to detach adherent cells from the culture sur-
face (see Note 6).
5. Add 10 mL of complete culture medium and mix by pipetting
up-and-down several times to stop the trypsinization (see
Note 7).
 In Vivo Imaging of Murine Lung Cancer Models 203

6. Transfer cell suspensions to 15 mL or 50 mL falcon tubes and

centrifuge at 500
g for 5 min to collect cells. Discard super-
natant and resuspend the cellular pellet in complete medium
for further dilution and reseeding in flasks (see Notes 2,
8 and 9).

3.2 Preparation 1. Collect cells as described in Subheading 3.1.

of Cellular Suspension 2. After centrifugation, remove the supernatant, and resuspend
for Injection the cell pellet in 30 mL of cold PBS (see Note 10). Centrifuge
cells at 300–500
g for 5 min.
3. After centrifugation, remove the supernatant, and resuspend
the cells in 5–10 mL of cold PBS by pipetting up-and-down
several times. The cells are then passed through a 70 μm nylon
cell strainer to obtain a single cell suspension (see Notes 11
and 12).
4. Measure and calculate the total number of viable cells (see Note
13) and add cold PBS to the cell suspension before centrifuga-
tion at 300–500
g for 5 min (see Note 10).
5. Remove the supernatant and resuspend the cells with an appro-
priate volume of cold PBS to obtain a concentration of
5
106 cells/mL for both TC1-Luc and LLC-Luc cells.
Now the TC1-Luc cells are ready for intravenous (i.v.) injection
(see Note 14).
6. To prepare the working suspension of LLC-Luc cells for inter-
costal injection, 20% Matrigel Matrix is added to the suspen-
sion obtained in step 5 above to get a final concentration of
4
106 cells/mL (see Notes 15 and 16). The cells should be
kept on ice at all times.

3.3 Intravenous 1. Place the mice on a heating pad (located in a cage), or under an
Injection infrared lamp for 5–10 min to induce vasodilation in the tail
of TC1-Luc Cells veins (see Note 17). The mice have to be carefully observed at
all times to avoid overheating (especially when using the heat-
ing lamps).
2. Place the animal in a restraining device and put in an appropri-
ate position where the mouse is well controlled (not able to
turn around) but not extruded.
3. Two hundred μL of cell suspension are aspirated with a 1 mL
syringe. A 25G needle is mounted and air is evacuated from the
syringe by pressing the plunger. Finally, the volume is adjusted
to 100 μL (see Note 18). Air bubbles within the cell suspension
need to be avoided at all times.
4. Disinfect the tail with a small amount of 70% alcohol, this also
helps to visualize the veins.
204 Peng Liu et al.

Fig. 1 Mouse tail anatomy and the suggested position of intravenous injection. Drawings showing the
localization of lateral veins in (a) transverse and (b) sagittal views

5. Locate one of the lateral veins, facing the experimenter (see

Notes 19 and 20, and Fig. 1a) and insert the needle with the
bevel facing upwards. The needle and syringe should be main-
tained parallel to the tail. The veins should be localized under
the skin (see Note 21, and Fig. 1b).
6. The plunger is gently pulled to confirm a correct positioning of
the needle in the vein. If fresh blood enters the needle, it is
correctly inserted into the vein (see Note 22). Gently push the
plunger until all 100 μL cell suspension is injected into the vein
(see Notes 23 and 24).
7. After the injection, the needle is removed, and slight pressure is
rapidly applied to the puncture site with your finger pad and
sustained for 5–10 s to stop the bleeding. The mouse can now
be released from the restraining device and placed into a
new cage.

3.4 Intercostal 1. Shave the surgical area from the left armpit to the end of the
Injection chest of the mice in order to avoid contamination of the wound
of LLC-Luc Cells (see Note 25).
2. Prior to the injection, the mouse cage should be preheated on a
heating pad for 5 min so that the litter temperature is approxi-
mately 38–39  C. After preheating, the mouse is subjected to
isoflurane anesthesia (2.5% with a flow rate of 1.5 L/min) in an
anesthesia box, and is then maintained in an anesthesia mask
with the same flow rate of isoflurane, on a heating pad warmed
at 37  C. The animal is placed in a right lateral decubitus
position on a surgical drape.
3. Disinfect the left costal area with 70% ethanol followed by
iodine to maintain sterility.
 In Vivo Imaging of Murine Lung Cancer Models 205

Fig. 2 Illustration of the position for intercostal tumor inoculation. The needle is
inserted between the third and fourth costa through the chest wall

4. Exactly 50 μL of the prepared LLC-Luc cell suspension is

aspirated into a 300-μL insulin syringe with a 29G needle (see
Notes 15 and 26).
5. Expose the costal layer by applying a 5 mm cutaneous incision
below the left scapula.
6. Insert the needle between the third and fourth costa through
the chest wall and carefully pierce into the left lung. Inject the
cells slowly while keeping the syringe upright. Upon injection,
the needle should be removed rapidly (Fig. 2).
7. Following the injection, carefully close the incision with forceps
and a skin clip. The animal is then removed from the anesthesia
mask and allowed to rest on a heating mat until recovery (see
Note 27).

3.5 Bioluminescent 1. Prepare the beetle luciferin working solution as indicated in

Imaging and Data Subheading 2.3 above (see Note 28).
Analysis 2. Bioluminescence imaging and data processing are performed
using the Xenogen IVIS™ 50 imager equipped with the Living
Image® 4.2 software starting on day 7 of tumor implantation
for the TC1-Luc model, and on day 5 for the LLC-Luc model.
When tumor size reaches a level detectable by bioluminescence
(see Notes 29 and 30), mice with similar photon counts are
randomized to either the control or treatment group.
Subsequent bioluminescence measurements should be per-
formed twice a week (see Notes 29–31).
3. For image acquisition, mice are injected intraperitoneally with
200 μL of luciferin solution before imaging and are then
206 Peng Liu et al.

anesthetized using 2% isoflurane. Acquisition starts eight (for

TC1-Luc model), or 12 min (for the LLC-Luc model) after
luciferin injection (see Notes 32 and 33).
4. The bioluminescent signal is quantified as total photon flux by
measuring at the site of lung tumors using a region of interest
(ROI) tool for statistical analysis, which directly correlates the
signal with the size of the tumor.

3.6 Preparation 1. Prepare the solvent solution as indicated in Subheading 2.3 (see
of Reagents Note 34).
and Treatments 2. Prepare the cisplatin stock solution as described in Subheading
of Tumor Bearing Mice 2.3 (see Note 35).
3. Prepare the combination chemotherapeutics (Combo) as
described in Subheading 2.3.
4. When tumor incidence in the lung can be detected (day 0),
randomize mice and assign to control or treatment group.
Mice in the control group should receive an intraperitoneal (i.
p.) injection of 200 μL solvent solution; and mice in the treat-
ment group receive an i.p. injection of 200 μL Combo. Repeat
the treatment 2 days later (day 2) (see Notes 36 and 37, and
Figs. 3a and 4a).
5. Eight days after the first treatment (day 8), mice in the control
group are injected intraperitoneally with 200 μL of isotype
antibody, and mice in the treatment group receive 200 μL of
anti-PD-1. Repeat the treatments at day 12 and day 16 (see
Notes 36 and 37, and Figs. 3a and 4a).
6. Conduct in vivo imaging every 3–4 days with a gradual adjust-
ment of exposure time. Tumor bearing mice showing a photon
saturation at 1 min of exposure should be euthanized. In this
protocol, tumors in all control mice develop rapidly and reach
the ethical endpoint within 4–5 weeks; while tumors in more
than 80% of treated animal are cured after treatment with anti-
PD-1 antibody (see Note 38). Bioluminescence images and
quantified photons obtained from one mouse at different
points are shown in Figs. 3 and 4.

4 Notes

1. This basic culture medium is different from the official recom-

mendations of the American Type Culture Collection (ATCC,
Manassas, VA, US) and has been optimized according to the
lab’s expertise. RMPI 1640 medium is also suitable for the
general culture of these two cell lines, and no morphological
difference has been observed when the cells were cultured in
RPMI 1640 medium.
 In Vivo Imaging of Murine Lung Cancer Models 207

Fig. 3 Treatment schedule and development of TC1-Luc lung tumors. (a) Timeline describing tumor
establishment and sequential chemotherapy-immunotherapy regimen. i.v. intravenous, i.p. intraperitoneal.
(b) Representative bioluminescent images from an individual mouse at different time points is shown. (c, d)
Bioluminescence signal is quantified as an indication of tumor size for individual mice (c) or as the mean of
3 animals (mean  SEM) (d)

2. Both TC1-Luc and LLC-Luc cells are conveniently maintained

in 175 cm2 tissue culture flasks (with around 3–5
107 cells at
full confluence, a sub-cultivation ratio of 1:20 for TC1-Luc and
1:10 for LLC-Luc is recommended at least two times per
week). Cell confluence is a very crucial parameter for the suc-
cess of this experiment. Over-confluent cell cultures shall be
avoided as over-confluency majorly decreases cellular viability
and affects the rate of tumor formation in vivo.
3. The concentration of hygromycin B could vary between 250 to
500 μg/mL in LLC-Luc cells. The TC1-Luc cell line is gener-
ated by lentiviral transduction that can maintain luciferase
expression without further antibiotic selection.
4. Pre-warm all cell culture reagents to 37  C before starting.
5. TC1-Luc and LLC-Luc cells are loosely adherent cells, so a
direct flush of PBS on the cell culture layer should be avoided.
6. Typical time for complete detachment of TC1-Luc cells in
37  C pre-warmed TrypLE™ Express is about 30 s, and for
LLC-Luc cells it is less than 10 s. Although LLC-Luc cells are
208 Peng Liu et al.

Fig. 4 Treatment schedule and development of LLC-Luc lung tumors. (a) Timeline describing tumor estab-
lishment and sequential chemotherapy-immunotherapy regimen. i.c. intercostal, i.p. intraperitoneal. (b)
Representative bioluminescent images from an individual mouse at different time points is shown. (c, d)
Bioluminescence signal is quantified as an indication of tumor size. Tumor growth is depicted as individual
curves (c) or as the means of 3 animals (mean  SEM) (d)

very loosely adherent and can be detached from the flask by

flushing with a pipette, trypsinization is recommended to
obtain a single cell suspension.
7. During the trypsinization step, it is recommended to keep the
cap tightly closed and to visually inspect the procedure under a
light microscope. When most of the cells round up, gently tap
the flasks to support complete cellular detachment before add-
ing complete growth medium to stop trypsinization. Over-
trypsinization will lead to reduced cell viability as well, so add
the complete medium in time.
8. Cell suspension can be centrifuged at 300–500
g for 5 min at
room temperature. Centrifugation is not obligatory but
recommended for the purpose of removing dead cells and
debris.
9. Never reuse plastic flasks for cell cultures, especially for loosely
adherent cells which will not properly attach to the culture
surface of reused plastic flasks.
 In Vivo Imaging of Murine Lung Cancer Models 209

10. This is to wash out the resident serum, which is immunogenic

when injected into mice. In the following steps, try to keep the
cells in a cold environment (on ice) to maintain viability.
11. TC1 and LLC cells are pretty aggregated even after trypsiniza-
tion, especially when collected from high confluency cultures,
therefore passing cellular suspension through a cell strainer
facilitates obtaining a homogeneous single cell suspension,
which again facilitates accurate cell counting and reduces the
heterogeneity of in tumor growth.
12. Cells are generally stained with trypan blue to exclude dam-
aged/dead cells in the cell counting step. In untreated controls
the percentage of viable cells should be more than 90%. Spon-
taneous cell death/damage will increase the heterogeneity of
established tumors.
13. Total number of viable cells ¼ concentration of viable cells per
mL
volume of cell suspension (mL).
14. Exactly 100 μL of TC1-Luc cells should be injected into each
mouse, which means 5
105 cells/mouse. As i.v. injection
requires a certain level of experience, we would suggest prepar-
ing twice the volume of the cellular suspension that is theoreti-
cally needed, e.g., for 20 mice, prepare >4 mL of the cellular
suspension.
15. Strictly follow the handling protocol from the manufacturer
when using the Matrigel matrix (such as the use of chilled
plastics, as well as the maintenance on ice at all times) and
plan the experiment in advance as it takes time to prepare the
Matrigel.
16. Exactly 50 μL of LLC-Luc cells will be injected into each
mouse, which means 2
105 cells/mouse. As intercostal
injection requires a substantial expertise, we would suggest
preparing cellular suspension in excess, e.g., for 20 mice, pre-
pare >2 mL of the cell suspension.
17. After 5–10 min of preheating, the cage can be removed from
the heating device for injection, while another cage can be
placed under the heating device.
18. For well-trained operators, a larger volume of cell suspension
can be aspirated into the syringe for repeated injections of
individual mice. To ensure the homogeneity of cells, the
syringe should be gently flipped upside down regularly.
19. According to our experience, directly applying the ethanol
onto the tail increases the visibility as compared to swabbing
the tail with ethanol containing gauze.
20. Injection sites shall be the lateral tail veins as they are better
visible than the dorsal vein, and the acupuncture on lateral
veins causes less pain to the animal.
210 Peng Liu et al.

21. It is a good practice to start the injection close to the tip of the
tail, as the injection site can be gradually moved up toward the
tail root if needed.
22. For experienced operators, the proper needle placement can
also be verified by smooth movement of the needle under
the skin.
23. There should be no resistance while injecting and the fluid will
temporary bleach the vein by the displacement of the blood. If
resistance is felt, it is likely caused by incorrect placement of the
needle, do not increase pressure, but stop the procedure and
reinitiate the injection proximally.
24. If the operator can precisely insert the needle into the vein, it is
possible to inject only 100 μL of the cell suspension and keep
the rest for other mice.
25. It is recommended to shave the mice 1 day before performing
the injection to minimize continuous stress.
26. The syringe should be ideally kept on ice to maintain a low
temperature.
27. The animals can be returned to their cages when they have
regained mobility and demonstrate regular breathing patterns.
Strict observations should last as long as 48 h. If the skin
closure clips are rejected by the animal within 48 h after sur-
gery, they need to be replaced by new ones.
28. Luciferin solution should be transparent with light yellow
color. The aliquoted solution can be stored at 20  C for up
to 6 months. Repeated freeze–thaw cycles need to be avoided.
29. Bioluminescence image acquisition and quantification should
be conducted by an experienced experimenter. Latest genera-
tions of the IVIS™ imaging system, such as IVIS™ Spectrum
and IVIS™ SpectrumCT can be used following similar
procedures.
30. According to our experience, the tumor reaches a size detect-
able by bioluminescence at the indicated time after the inocu-
lation of cells when the <Acquisition Control Panel> is set at
the most sensitive conditions (Auto Exposure, Binning Large,
F/Stop ¼ 1), and the expected photon counts is about 5
104
31. During the tumor development, when photon saturation
occurs, the exposure time for monitoring is gradually
decreased from 5 to 1 min. In addition to the exposure time,
other parameters including F/stop and pixel binning can be
adjusted to obtain avoid saturation.
32. We use 6–7 weeks old female C57Bl/6 mice for this protocol,
whose average body weight is 20 g, so the final dosage of
luciferin is 150 mg/kg.
 In Vivo Imaging of Murine Lung Cancer Models 211

33. The time between luciferin injection and image acquisition is

provided here as a reference. At the beginning of each experi-
ment, we strongly suggest acquiring an image sequence imme-
diately after the injection of luciferin to get a kinetic of
bioluminescent signal, and then select the time point when
the signal reaches the peak for further acquisitions.
34. This solvent is designed for complete constitution of crizoti-
nib, which does not solve well in physiological solutions like
0.9% NaCl or PBS [5].
35. This is the maximum solubility of cisplatin in physiological
solution. Avoid dissolving cisplatin in DMSO [11].
36. It is recommended to perform the chemical treatments at least
4 h after the acquisition of bioluminescence images.
37. The combination chemotherapeutics provided here has been
proven to regress the tumor development of orthotopic TC1
and LLC lung cancers [5], at a final dose of 50 mg/kg crizo-
tinib and 0.25 mg/kg cisplatin.
38. This consolidation with anti-PD-1 has been proven to cure
>80% of tumor bearing mice that have received the treatment
of crizotinib plus cisplatin [5], at a final dose of 10 mg/kg.

Acknowledgments

GK is supported by the Ligue contre le Cancer (équipe labellisée);

Agence National de la Recherche (ANR)—Projets blancs; ANR
under the frame of E-Rare-2, the ERA-Net for Research on Rare
Diseases; Association pour la recherche sur le cancer (ARC); Can-
céropôle Ile-de-France; Chancellerie des universités de Paris (Legs
Poix), Fondation pour la Recherche Médicale (FRM); a donation
by Elior; European Research Area Network on Cardiovascular
Diseases (ERA-CVD, MINOTAUR); Gustave Roussy Odyssea,
the European Union Horizon 2020 Project Oncobiome; Fonda-
tion Carrefour; High-end Foreign Expert Program in China
(GDW20171100085 and GDW20181100051), Institut National
du Cancer (INCa); Inserm (HTE); Institut Universitaire de France;
LeDucq Foundation; the LabEx Immuno-Oncology; the RHU
Torino Lumière; the Seerave Foundation; the SIRIC Stratified
Oncology Cell DNA Repair and Tumor Immune Elimination
(SOCRATE); and the SIRIC Cancer Research and Personalized
Medicine (CARPEM). Peng Liu and Liwei Zhao contributed
equally to this work.
212 Peng Liu et al.

References
1. Garg AD, Dudek-Peric AM, Romano E et al immunogenic cell death. Onco Targets Ther
(2015) Immunogenic cell death. Int J Dev Biol 3:e955691
59:131–140 8. Apetoh L, Ghiringhelli F, Tesniere A et al
2. Galluzzi L, Chan TA, Kroemer G et al (2018) (2007) Toll-like receptor 4-dependent contri-
The hallmarks of successful anticancer immu- bution of the immune system to anticancer
notherapy. Sci Transl Med 10(459):eaat7807 chemotherapy and radiotherapy. Nat Med
3. Galluzzi L, Buque A, Kepp O et al (2017) 13:1050–1059
Immunogenic cell death in cancer and infec- 9. Vacchelli E, Ma Y, Baracco EE et al (2015)
tious disease. Nat Rev Immunol 17:97–111 Chemotherapy-induced antitumor immunity
4. Pfirschke C, Engblom C, Rickelt S et al (2016) requires formyl peptide receptor 1. Science
Immunogenic chemotherapy sensitizes tumors 350:972–978
to checkpoint blockade therapy. Immunity 10. Kim D, Hung CF, Wu TC (2007) Monitoring
44:343–354 the trafficking of adoptively transferred
5. Liu P, Zhao L, Pol J et al (2019) Crizotinib- antigen-specific CD8-positive T cells in vivo,
induced immunogenic cell death in non-small using noninvasive luminescence imaging.
cell lung cancer. Nat Commun 10(1):1486 Hum Gene Ther 18(7):575–588
6. Liu P, Zhao L, Kepp O et al (2019) Crizotinib - 11. Hall MD, Telma KA, Chang KE et al (2014)
a tyrosine kinase inhibitor that stimulates Say no to DMSO: dimethylsulfoxide inactivates
immunogenic cell death. Onco Targets Ther cisplatin, carboplatin, and other platinum com-
8:1596652 plexes. Cancer Res 74:3913–3922
7. Kepp O, Senovilla L, Vitale I et al (2014) Con-
sensus guidelines for the detection of
 Chapter 17

An Annexin V-FITC—Propidium Iodide-Based Method

for Detecting Apoptosis in a Non-Small Cell Lung
Cancer Cell Line
Robin Kumar, Ankit Saneja, and Amulya K. Panda

Abstract
Annexin V and propidium iodide staining is widely used for determining the cellular death through
apoptosis. In the presence of Ca2+ ions, annexin V has a strong binding affinity for phosphatidylserine, a
membrane phospholipid that during apoptosis is translocated from the inner side of the cell membrane to
its outer side. On the other hand, propidium iodide has ability for DNA binding and it can only enter into
necrotic or late apoptotic cells. This chapter describes a commonly used method for detection of apoptosis
in a non-small cell lung cancer cell line using annexin V and propidium iodide dye. We describe the
detection of different stages of apoptosis in the A549 lung cancer cell line treated with dihydroartemisinin
(DHA). This apoptosis detection method can be used to determine the efficacy of different kinds of drugs
on cultured cancer cell lines.

Key words Apoptosis, Lung cancer, Annexin V, Propidium iodide, Mammalian cells, Phosphatidyl-
serine, DNA, Dihydroartemisinin

1 Introduction

Apoptosis is a biological programmed cell death phenomenon that

plays an essential role in the regulation of homeostasis and in overall
animal development. Due to this reason, abnormalities in the apo-
ptotic process are associated to variety of diseases in humans includ-
ing developmental disorders, immunological diseases, and
cancer [1].
Apoptosis is recognized as a cellular suicide or self-destruction
of a cell that is mainly characterized by chromatic condensation,
membrane blebbing, cellular deformation, and shrinkage [2, 3]. At
later stages of apoptosis, detachment of apoptotic cells from sur-
rounding cells and nuclear fragmentation can be observed. Unlike
necrosis, apoptotic cells are separated into multiple apoptotic

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_17, © Springer Science+Business Media, LLC, part of Springer Nature 2021

213
214 Robin Kumar et al.

bodies that are cleared by macrophage cells in a non-inflammatory

manner [4, 5]. The apoptotic process is dependent on a proteolytic
cascade of caspase proteins, and around 14 caspases have been
reported in mammals so far [6, 7]. These apoptotic caspases are
mainly divided into three categories: initiator, effector, and inflam-
matory caspases.
Apoptotic cell death is mainly induced by two signaling path-
ways: the extrinsic and intrinsic pathways. Binding of death ligands
to the death receptors is the first step in extrinsic pathway, which
leads to the activation of initiator caspase-8/10 [8, 9]. The main
role of activated caspase-8/10 is to activate the effector caspases like
caspase -3, -6 and -7. In turn, activated effector caspases are respon-
sible for targeting many cellular substrates that lead to cellular
apoptosis triggered by the extrinsic signaling pathway [10].
On the other hand, the intrinsic apoptotic pathway is triggered
mainly by cell stress engendered by a range of stimuli such as the
effect of chemotherapeutic agents, irradiation, hypoxia, oxidative
stress, and deprivation of essential elements or growth factors
[11, 12]. These factors cause the disruption of the mitochondrial
membrane which leads to the release of pro-apoptotic factors
through the inner mitochondrial membrane into the cytoplasm.
This pathway depends on a protein complex called the apoptosome
that includes cytochrome c, apoptotic protease activating factor
1 (Apaf-1) and procaspase-9 [13–15]. The apoptosome initiates
the activation of caspase-9 that leads to the downstream activation
of the effector caspases such as caspase-3, -6 and -7 that are respon-
sible for cell death by the intrinsic apoptotic pathway
[16]. Although both extrinsic and intrinsic apoptotic pathways are
capable of inducing apoptotic cell death independently, cross-talk
between both apoptotic pathways also exist and each plays an
important role in amplifying the apoptotic cascade [9].
Non-small-cell lung cancer (NSCLC) is one of the most com-
mon cancers worldwide and is responsible for high mortality due to
its chemo- and radiation therapy resistant nature [17]. Therefore, it
is important to understand the mechanism of apoptosis in lung
cancer cell lines such as A549 in order to develop therapies against
lung cancer [18]. There are several methods available for detecting
apoptosis in cancer cells, including Annexin V staining which shows
high affinity to phosphatidylserine on the outer membrane surface
of apoptotic cells (Fig. 1). Among the different methods, flow
cytometric analysis of Annexin V-FITC-propidium iodide-stained
apoptotic cancer cells is the preferred platform for its ability to
conduct single cell analysis, its rapidity, and its highly sensitive
nature [19–22].
 Annexin Staining Detection of Apoptosis in NSCLC Cell Lines 215

Fig. 1 Schematic representation of the Annexin V assay for apoptosis detection. In normal healthy cells
phosphatidylserine is transported to the inside of the lipid bilayer by the aminophospholipid translocase (a Mg2
+
ATP dependent enzyme). During apoptosis phosphatidylserine is translocated to the external membrane
where it serves as a recognition molecule for macrophages. FITC labeled annexin V (green fluorescence) binds
to phosphatidylserine residues exposed to the external membrane of apoptotic cells in a Ca2+ dependent
manner. Annexin V does not bind to normal cells as it has no ability to penetrate the phospholipid layer. By
incorporating DNA binding dyes such as propidium iodide (PI, red fluorescence), Annexin V staining via flow
cytometry is a fast and reproducible way for analyzing different stages of cellular apoptosis. This allows the
discrimination of viable (FITC PI ), dead cells (FITC PI+), early apoptotic (FITC+PI ), and late apoptotic cells
(FITC+PI+), which can be detected by flow cytometry. (This figure was generated from material provided by
Servier Medical Art (https://smart.servier.com/) under the CC 3.0 license)

2 Materials

Always use ultrapure deionized water for preparing reagents and

solutions. Use only analytical grade reagents. Prepare reagents at
room temperature and keep at the appropriate temperature accord-
ing to the reagent’s guidelines. Make sure to avoid direct light
exposure of light sensitive reagents. Follow the required regulations
and guidelines to dispose of all chemicals.

2.1 Reagents 1. Phosphate buffered saline (PBS), pH 7.4: 137 mM NaCl,

and Solutions 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4. PBS
can be purchased in 10 or 1 ready–to-use solutions. Alter-
natively, it can be prepared in the laboratory from its compo-
nents. To prepare 1 L of 1 PBS, add 8 g of NaCl, 0.2 g of KCl,
1.44 g of Na2HPO4, and 0.24 g of KH2PO4 in 800 mL of
Milli-Q water and stir properly with a magnetic stirrer. Adjust
the pH of solution to 7.4 using concentrated HCl (use lower
concentration HCL as you approach the desired pH) and
complete the volume to 1 L with Milli-Q water. Sterilize by
autoclaving or by filtering, and store at room temperature.
2. HEPES binding buffer. The composition of this solution is
10 mM HEPES pH 7.4, 150 mM NaCl and 2.5 mM CaCl2,
and we purchase it as a 5 or 10 solution as part of commer-
cially available annexin V and propidium iodide apoptosis
216 Robin Kumar et al.

detection kits (all kits include the 5 or 10 concentrated

stock). Before using, dilute the concentrated stock to a 1
working solution with distilled water followed by filter sterili-
zation. It is better to use a freshly diluted 1 working solution
for each experiment.
3. Annexin V-FITC conjugate. This can be obtained as a ready-
to-use solution or can be purchased from several manufacturers
along with propidium iodide. We have optimized this protocol
using the Annexin V-FITC conjugate included in the Dead
Cell Apoptosis Kit V13242 from ThermoFisher Scientific,
strictly following manufacturer’s instruction. However, other
manufacturers produce similar reagents that can be used for
this protocol, and you must always ensure to strictly follow the
manufacturer’s instructions. Before each use, you should
gently mix the solution using a pipette to ensure a homoge-
neous solution. Always store the solution at 4  C and keep it in
ice during experiments. Protect this reagent from direct light
exposure. Please follow any other manufacturer’s instructions
regarding storing and use.
4. Propidium iodide (PI). This can be purchased in powder or
solution form. It can also be obtained along with annexin V as
components of apoptosis detection kits. Make a stock solution
or working solution using Milli-Q water and store it at 4  C in
the dark. To use, prepare the propidium iodide at a final work-
ing concentration of 100 μg/mL in 1 HEPES binding buffer.

2.2 Cell Culture 1. Incubator, set at standard culture conditions of 37  C and 5%

Reagents CO2.
and Equipment 2. A549 cells, these are adeno-carcinomic human alveolar basal
epithelial cells. Culture cells in Dulbecco’s Modified Eagle
Medium (DMEM) media supplemented with 10% fetal bovine
serum in presence of 5% CO2 at 37  C.
3. Cell culture flasks and plates.
4. Drug test compound of interest to be tested for its capacity to
induce apoptosis. We have optimized this protocol for the
induction of apoptosis with dihydroartemisinin. However, as
this protocol focuses on the Annexin V-FITC/propidium
iodide staining of cells for analysis by flow cytometry, it can
be used to test the apoptosis-inducing capacity of any other
experimental compound of interest. It is recommended that
you prepare solutions of the drug or compound of interest of
varying concentrations.
5. 0.25% trypsin solution. This is a 0.25% (w/v) Trypsin-
0.53 mM EDTA solution, and we use a commercially available
ready-to-use solution. Before use, we make sure that solution is
at room temperature.
 Annexin Staining Detection of Apoptosis in NSCLC Cell Lines 217

2.3 Other Labware 1. 1.2 mL fluorescent-activated cell sorter (FACS) cluster tubes.
and Equipment 2. Flow cytometer. Annexin V-FITC conjugate- and propidium
iodide- stained cell samples can be analyzed using a flow cyt-
ometer instrument that must have a laser for excitation at
488 nm. It should have channels capable of reading fluores-
cence emission at 530 nm for FITC and at 617 nm for PI and
phycoerythrin (PE).
3. Conical 15 mL centrifuge tubes.
4. Refrigerated benchtop centrifuge capable of holding conical
tubes.
5. Hemocytometer or cell counting method of choice. It is
important to stain cells at a specific cellular density since effi-
ciency of staining is cell density dependent.
6. Ice buckets with ice.

3 Methods

3.1 Cell Preparation 1. Harvest cells from a semi-confluent cell culture flask and seed
and Drug Treatment the desired number of cells in tissue culture plates or culture
wells for attachment. Culture overnight (see Notes 1 and 2).
2. On the next day, prepare varying concentrations of drugs or
test compounds in fresh culture media.
3. Remove the culture media from the culture plates or wells and
add the media containing the drug or test compound. This will
be the treatment to be measured for its capacity to induce
apoptosis. If the drug or test compound needs to be solubilized
in a vehicle before being added to the culture medium, be sure
to include control cell cultures that have been treated with
vehicle alone.
4. Incubate the cells in the CO2 incubator at 37  C for desired
time period, as needed based on the specification of the treat-
ment (see Note 3).

3.2 Cell Staining 1. Collect the culture media from each well or plate into
pre-labeled FACS tubes (see Note 4). To collect the adherent
cells remaining in the wells or plates, add 0.25% trypsin solu-
tion to the plates or wells to detach them, placing the plates
with the trypsin solution inside the 37  C incubator. Before
adding the trypsin, be sure that the culture media is removed
completely and that cells are rinsed with 1 PBS to remove any
trace of trypsin inhibitor. Add sufficient volume of the trypsin
solution to cover the surface of the plate with a thin layer of
liquid. You can monitor cell detachment under a microscope,
and ideally cells should become detached within 5 min of
218 Robin Kumar et al.

treatment (with a fresh trypsin solution, a 1–2 min incubation

should be sufficient). Use a freshly prepared trypsin solution if
cell detachment requires more than 5 min of trypsin treatment
(see Note 5).
2. Add ten times the volume of the trypsin solution of cell culture
medium supplemented with serum to neutralize the effect of
trypsin. Transfer to conical centrifuge tubes.
3. Centrifuge the cell suspensions at 805  g for 5 min at 4  C.
After this first centrifugation, collect both the pellet (see next
step) as well as the supernatant which contains floating dead
cells that can also be analyzed (see Note 6).
4. Resuspend the cell pellet in cold PBS and wash twice. To wash,
centrifuge at 805  g, discard the supernatant, resuspend the
cell pellet with fresh PBS, and repeat a second time (see Note
7).
5. Depending on number of samples including the controls, pre-
pare enough 1 HEPES binding buffer by diluting the 5 or
10 stock with Milli-Q water. For example, add 200 μL of 5
HEPES binding buffer to 800 μL of water to prepare 1 mL of
1 solution. Or, add 100 μL of 10 HEPES binding buffer to
900 μL of water to prepare 1 mL of 1 solution. See Table 1 for
the groups that should be stained and analyzed in each
experiment.
6. Collect cells from each tube and determine the number of cells,
using a hemocytometer or your cell counting method of
choice.
7. Resuspend 2  105 cells in 200 μL of 1 HEPES binding
buffer. For lower cell numbers, you can also resuspend 1  105
cells in 100 μL of 1 HEPES binding buffer (see Notes
8 and 9).

Table 1
Typical experimental setup indicating the samples that are required for flow cytometry analysis of
Annexin V and propidium iodide staining apoptosis detection

Sample No. Group Stain

1 Untreated cells No stain
2 Untreated cells Annexin V, Propidium iodide
3 Treated cells Annexin V
4 Treated cells Propidium iodide
5 Treated cells Annexin V, Propidium iodide
 Annexin Staining Detection of Apoptosis in NSCLC Cell Lines 219

8. Add 10 μL Annexin V-FITC conjugate solution per 200 μL of

sample (each sample meaning cells suspended in 1 HEPES
binding buffer).
9. Add 2 μL of the 100 μg/mL solution of propidium iodide in
1 HEPES binding buffer to each sample, except to the con-
trol groups (see Notes 10–13).
10. Incubate for 15–20 min at room temperature in the dark (see
Note 14).
11. Add 300–400 μL of 1 HEPES binding buffer to each stained
cell sample and mix gently. Keep samples in ice and protect
from light.

3.3 Flow Cytometer 1. Turn on the instrument and clean the machine properly before
Instrument Setup using it (see Notes 15 and 16). Both FITC and propidium
iodide can be excited at 488 nm for their emission at 520 nm
and 617 nm, respectively.
2. Open a new experiment and select a dot plot for forward
scattering (FSC) versus side scattering (SSC). Forward scatter
provides information about the cellular size whereas side scatter
is mainly for cellular granularity.
3. Set a new dot plot for propidium iodide versus annexin V-FITC
for detecting the different stages of apoptosis in treated cells
(Table 2).

3.4 Cell Analysis 1. Run the untreated control cells on instrument to adjust the
voltage for detection of cells on an FSC versus SSC plot.
2. Set a gate to remove cellular debris from the cells to be analyzed
(see Note 17).
3. Also use the untreated cells to adjust the voltage for setting the
quadrant gate in propidium iodide versus Annexin V-FITC.
Untreated cells are supposed to be in left bottom quadrant,
meaning that they have the basal level of propidium iodide and
annexin V coordinates.
4. Run the treated cells stained with propidium iodide only and
adjust the voltage in such a way that dead cells appear on the
top of quadrant.
5. Also run the treated cells stained with Annexin V only and
adjust the voltage so that most of the apoptotic cells fall in
the bottom of quadrant.
6. Run a sample stained with both Annexin V and propidium
iodide to check that live cells, apoptotic cells and necrotic
cells are falling in their respective quadrants (Fig. 2).
7. Run all the samples at the same setting and acquire at least
10,000 events for each sample. Always perform experiment in
three replicates for each sample for statistical analysis.
220 Robin Kumar et al.

Table 2
Binding ability of Annexin V and propidium iodide dye to cells in different apoptosis stages

Sample No. Stained population Cellular status

1 Annexin V negative-Propidium iodide negative Healthy
2 Annexin V positive-Propidium iodide negative Early apoptotic
3 Annexin V positive-Propidium iodide positive Late apoptotic
4 Annexin V negative-Propidium iodide positive Dead cells

Fig. 2 Flow cytometry analysis of apoptosis induced in A549 cells stained with Annexin V -FITC and propidium
iodide. Apoptosis was induced after treatment with dihydroartemisinin (DHA) for 72 h. (Reproduced from ref.
[21] with permission from Elsevier)

4 Notes

1. Maintain the optimum cell density for apoptotic studies using

Annexin V and propidium iodide as their staining properties are
cell density dependent.
2. Experiments must always be performed on live cells. Fixed cells
will always be positive for propidium iodide, which will give
false results.
3. Always check the cellular morphology of treated cells after
completion of treatment, check for any morphological change
that could be indicative of apoptosis or cellular death. This may
preliminarily help you to visually assess whether the test com-
pound is having an effect on the cultured cells. Apoptotic cells
can be seen with membrane blebbing and shrinkage in their
shape whereas dead cells appear as floating bodies under light
microscope.
 Annexin Staining Detection of Apoptosis in NSCLC Cell Lines 221

4. For epithelial cancerous cells or adherent cells, it is important

to recover late apoptotic or dead cells that may be present as
floating bodies in the culture media. These floating bodies
must be analyzed as well.
5. Be careful when using trypsin solutions for detachment of
adherent cells because this treatment may affect the percentage
of apoptotic cells in the samples as trypsinization may tempo-
rarily disrupt the cell membrane. Expose adherent cells to
trypsin for a short time period or give some time for cells to
recover after trypsinization.
6. Collect treated cells at higher centrifugal speed to settle down
both apoptotic cells and dead cells along with live cells.
7. Always discard the supernatant carefully and try not to disturb
cell pellet after centrifugation.
8. Resuspend cells in HEPES binding buffer very gently by flick-
ing the sample tube. Do not vortex the sample tube containing
cells as this may affect the actual percentage of apoptotic cells in
the sample.
9. Achieving single cell suspensions of experimental samples is
important for staining with Annexin V and propidium iodide.
When resuspending cells in the HEPES binding buffer, be sure
to avoid cell clumps in the cellular suspension, as these may
affect the flow cytometry analysis.
10. Always wear personal protective equipment and take the neces-
sary precautions while handling propidium iodide as it may
be carcinogenic.
11. It is important that cells should be properly stained with
Annexin V and propidium iodide for detection in flow cyto-
metry. Please follow the manufacturer instruction for right
dilution of both reagents.
12. The actual concentration of both Annexin V and propidium
iodide can be optimized for different cancer cell lines, if the
initially chosen working concentration does not yield the
expected results.
13. If cells are poorly stained with Annexin V even at higher con-
centration than recommended, ensure that CaCl2 was added to
the binding buffer in the correct concentration as CaCl2 is
necessary for Annexin V binding to phosphatidylserine.
14. Avoid direct light exposure to the stock and working solutions
of Annexin V and propidium iodide as this may compromise
the efficacy of both fluorescent reagents. Make sure that all
staining procedures are performed in the dark.
15. Analyze cells within 1 h or as soon as possible after staining.
Because apoptosis is a continuous process and propidium
222 Robin Kumar et al.

iodide may enter into cells passively through diffusion, allow-

ing too much time between staining and analysis may affect the
experimental results.
16. Make sure before using the FACS instrument that it is clean
and calibrated. Otherwise it can affect the outcome of the
analysis.
17. It is important to set a broader gate during the flow cytometry
analysis in order to acquire both live and dead cells. This is
because live cells and dead cells may have different sizes and
granularity.

Acknowledgments

The authors acknowledge the financial support from National

Institute of Immunology for carrying out this research.

References
1. Pérez-Garijo A, Fuchs Y, Steller H (2013) 8. Fulda S, Meyer E, Friesen C et al (2001) Cell
Apoptotic cells can induce non-autonomous type specific involvement of death receptor and
apoptosis through the TNF pathway. Elife 2: mitochondrial pathways in drug-induced apo-
e01004 ptosis. Oncogene 20(9):1063
2. Deschesnes RG, Huot J, Valerie K et al (2001) 9. Li J, Yang Z, Li Y et al (2016) Cell apoptosis,
Involvement of p38 in apoptosis-associated autophagy and necroptosis in osteosarcoma
membrane blebbing and nuclear condensation. treatment. Oncotarget 7(28):44763
Mol Biol Cell 12(6):1569–1582 10. Chang DW, Xing Z, Pan Y et al (2002)
3. Willenberg H, Bornstein S, Dumser T et al c-FLIPL is a dual function regulator for
(1998) Morphological changes in adrenals caspase-8 activation and CD95-mediated apo-
from victims of suicide in relation to altered ptosis. EMBO J 21(14):3704–3714
apoptosis. Endocr Res 24(3-4):963–967 11. Argun M, Tök L, Uğuz A et al (2014) Melato-
4. D’Avila H, Freire-de-Lima CG, Roque NR nin and amfenac modulate calcium entry, apo-
et al (2011) Host cell lipid bodies triggered ptosis, and oxidative stress in ARPE-19 cell
by Trypanosoma cruzi infection and enhanced culture exposed to blue light irradiation
by the uptake of apoptotic cells are associated (405 nm). Eye 28(6):752
with prostaglandin E2 generation and 12. Katoh I, Sato S, Fukunishi N et al (2008) Apaf-
increased parasite growth. J Infect Dis 204 1-deficient fog mouse cell apoptosis involves
(6):951–961 hypo-polarization of the mitochondrial inner
5. Nunez R, Sancho-Martı́nez S, Novoa J et al membrane, ATP depletion and citrate accumu-
(2010) Apoptotic volume decrease as a geo- lation. Cell Res 18(12):1210
metric determinant for cell dismantling into 13. Caroppi P, Sinibaldi F, Fiorucci L et al (2009)
apoptotic bodies. Cell Death Differ 17 Apoptosis and human diseases: mitochondrion
(11):1665 damage and lethal role of released cytochrome
6. Eckhart L, Ballaun C, Uthman A et al (2005) C as proapoptotic protein. Curr Med Chem 16
Identification and characterization of a novel (31):4058–4065
mammalian caspase with proapoptotic activity. 14. Sanchis D, Mayorga M, Ballester M et al
J Biol Chem 280(42):35077–35080 (2003) Lack of Apaf-1 expression confers resis-
7. Wei W, Norton DD, Wang X et al (2002) Aβ tance to cytochrome c-driven apoptosis in car-
17–42 in Alzheimer’s disease activates JNK and diomyocytes. Cell Death Differ 10(9):977
caspase-8 leading to neuronal apoptosis. Brain 15. Schamberger CJ, Gerner C, Cerni C (2005)
125(9):2036–2043 Caspase-9 plays a marginal role in serum
 Annexin Staining Detection of Apoptosis in NSCLC Cell Lines 223

starvation-induced apoptosis. Exp Cell Res 302 annexin V binding, propidium iodide uptake,
(1):115–128 and flow cytometry. Cold Spring Harb Protoc
16. Arbab IA, Abdul AB, Sukari MA et al (2013) 2016(11):pdb prot087288
Dentatin isolated from Clausena excavata 20. Hingorani R, Deng J, Elia J et al (2011) Detec-
induces apoptosis in MCF-7 cells through the tion of apoptosis using the BD Annexin V
intrinsic pathway with involvement of NF-κB FITC assay on the BD FACSVerse™ system.
signalling and G0/G1 cell cycle arrest: a BD Biosciences 1:1–12
bioassay-guided approach. J Ethnopharmacol 21. Kumar R, Singh M, Meena J et al (2019) Hya-
145(1):343–354 luronic acid-dihydroartemisinin conjugate:
17. Liu G, Pei F, Yang F et al (2017) Role of synthesis, characterization and in vitro evalua-
autophagy and apoptosis in non-small-cell tion in lung cancer cells. Int J Biol Macromol
lung cancer. Int J Mol Sci 18(2):367 133:495–502
18. Pore MM, Hiltermann TJN, Kruyt FA (2013) 22. Wlodkowic D, Skommer J, Darzynkiewicz Z
Targeting apoptosis pathways in lung cancer. (2009) Flow cytometry-based apoptosis detec-
Cancer Lett 332(2):359–368 tion. Apoptosis. Humana Press, New Jersey
19. Crowley LC, Marfell BJ, Scott AP et al (2016)
Quantitation of apoptosis and necrosis by
 Chapter 18

Detection of DNA Adduct Formation in Rat Lungs

by a Micro-HPLC/MS/MS Approach
Angélica B. Sanchez, Camila C. M. Garcia, Paolo Di Mascio,
and Marisa H. G. Medeiros

Abstract
Aldehydes are abundantly present in tobacco smoke and in urban air pollution and are endogenously
generated as products of the lipid peroxidation process. These molecules can react with DNA bases forming
mutagenic exocyclic adducts, which have been used as biomarkers of aldehyde exposure and as potential
tools for the study of inflammation, metal storage diseases, neurodegenerative disorders, and cancer. High-
performance liquid chromatography-tandem mass spectrometry (HPLC/MS/MS) provides a highly pre-
cise, specific and ultrasensitive method for the detection of exocyclic DNA adducts. Here we present and
describe a validated micro-HPLC-Electro Spray Ionization (ESI)-MS/MS method for the quantification of
1,N2-propanodGuo, an adduct produced following the reaction between 20 -deoxyguanosine and acetalde-
hyde or crotonaldehyde.

Key words 1,N2-propanodGuo, Acetaldehyde, Crotonaldehyde, DNA adducts, Micro-liquid

chromatography-tandem mass spectrometry

1 Introduction

Inhaled acetaldehyde, at concentrations found in the atmospheres

of megacities, was shown to result in the formation of 1,N2-pro-
pano-20 -deoxyguanosine (1,N2-propanodGuo) adducts in the
DNA from the lungs and brains of rats [1]. In human cells, this
modification promotes DNA miscoding, mainly through G!T
transversions, and DNA synthesis inhibition [2]. In fact, the for-
mation of DNA-aldehyde adducts has been suggested to be an
important factor in mutagenesis and carcinogenesis
mechanisms [3].
Previously, our group developed a highly sensitive method
employing micro-HPLC/MS/MS on a triple-quadrupole mass
spectrometer to unequivocally detect the formation of 13C-labeled
1,N2-propanodGuo in DNA from the lungs and brains of animals
exposed to [13C2]-acetaldehyde. This method requires the addition

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_18, © Springer Science+Business Media, LLC, part of Springer Nature 2021

225
226 Angélica B. Sanchez et al.

of [13C4,15N5]-1,N2-propanodGuo, an isotopically labeled internal

standard prior to DNA hydrolysis, which improves the confidence
level by correcting for any potential analyte losses encountered
during the procedure [1].
Acetaldehyde has been detected in food, drinks, cigarette
smoke, and fuel emissions [4]. In fact, chronic inhalation of high
concentrations of acetaldehyde increases the incidence of nasal
tumors in rats [5]. Endogenously, acetaldehyde is generated during
ethanol metabolism [6] and in small amounts during threonine
catabolism [7]. Interestingly, aldehyde dehydrogenase deficient
individuals that consume alcohol have an increased risk of develop-
ing esophageal cancer [8]. Additionally, 1,N2-propanodGuo
adducts have also been detected following the reaction between
crotonaldehyde, a mutagenic and carcinogenic aldehyde, and 2-
0
-deoxyguanosine [3, 9] (Fig. 1). Crotonaldehyde is an important
industrial aldehyde and known environmental pollutant. Moreover,
this aldehyde is formed endogenously by unsaturated lipid oxida-
tion and N-nitrosopyrrolidine metabolism [10].
A variety of lesions are generated when DNA reacts with alde-
hydes produced during the lipid oxidation process, including: mal-
onaldehyde, 4-hydroxy-2-nonenal, 4-hydroperoxy-(2E)-nonenal,
4-oxo-(2E)-nonenal, 2,4-decadienal, hexenal, and acrolein. The
reaction between DNA bases and α,β-unsaturated aldehydes yields
cyclic substituted propano adducts, such as 1,N2-propanodGuo. In
addition, epoxidized α,β-unsaturated aldehydes generate ethano or
etheno derivatives upon reaction with DNA [11–13]. Relevantly,
some of these DNA lesions have been shown to be highly muta-
genic [14–18] and could represent possible pathways for oxidative
stress-related carcinogenesis.
Adducts formed by the reaction between DNA and aldehydes
are emerging as potential markers of inflammation, metal storage
diseases, and neurodegenerative disorders, and could be employed
for determining cancer etiology and risk [19, 20]. The in vivo levels
of these adducts, under normal and pathological conditions, has
been reported to be approximately 0–20 lesions per 108 nucleo-
tides [11, 12, 20]. Consequently, the low levels of these adducts
mean that ultrasensitive methods must be developed for quantify-
ing this modification in tissues, cells, and/or urine. Several techni-
32
ques, including immunoassays, P-postlabeling, gas
chromatography-mass spectrometry, and high-performance liquid
chromatography-tandem mass spectrometry (HPLC/MS/MS),
have been developed to quantify these adducts in vivo. Among
these examples, HPLC/MS/MS provides a precise, highly specific
and ultrasensitive method for the quantification of exocyclic DNA
adducts, with advantages including on-line sample processing and
the possibility of simultaneous multiple DNA adduct
detection [13].
 Detection of DNA Adducts by HPLC/MS 227

Fig. 1 Formation of (a) 1,N2-ethylidenedGuo from the addition of one molecule of

acetaldehyde, (b) 1,N2-propanodGuo from the subsequent addition of the second
molecule of acetaldehyde and (c) 1,N2-propanodGuo, from crotonaldehyde;
(dR ¼ 2-deoxyribose)

2 Materials

All of the required chemicals should be of the highest purity grade

commercially available. Prepare all of the solutions with deionized
ultrapure water with resistivity of 18 MΩ-cm at 25  C. Store all
solutions at 4  C, unless otherwise indicated.

2.1 Synthesis, 1. 20 -deoxyguanosine (dGuo), [15N5]-20 -deoxyguanosine, acetal-

Purification, dehyde, [13C2]-acetaldehyde and lysine for the synthesis of the
and Characterization standards. Keep them stored at 20  C.
of 1,N2-propanodGuo, 2. Acetonitrile, required for purification. Maintain at room
[15N5]-1, temperature.
N2-propanodGuo 3. Luna C18(2) analytical column, 250 mm  4.6 mm ID, 5μm
and [13C2,15N5]-1, (see Note 1).
N2-propanodGuo
4. 100 mM Phosphate buffer, pH 8.0: Prepare by mixing
16.284 g of K2HPO4 and 0.888 g of KH2PO4 with 800 mL
of H2O in a glass flask. Adjust the pH to 8.0 (see Note 2).
Adjust the volume to 1 L with water.

2.2 DNA Extraction 1. 1 M Tris––HCl, pH 7.5: Add 12.11 g of Tris-base to 80 mL of

and Enzymatic water in a 100 mL glass flask. Adjust pH to 7.5 with concen-
Hydrolysis trated HCl (see Note 3). Adjust the volume to 100 mL with
water.
228 Angélica B. Sanchez et al.

2. Lysis Buffer: Add 10 mL of stock Triton X-100, 103.75 g of

sucrose, 0.48 g of MgCl2, 0.15 mM desferroxamine mesy-
late and 10 mL of 1 M Tris–HCl, pH 7.5 to 980 mL of
water, and mix in a glass flask. The resulting solution should
have the following composition, 1% Triton X-100, 320 mM
sucrose, 5 mM MgCl2, 10 mM Tris–HCl, pH 7.5.
3. 10 mM Tris–HCl, 5 mM EDTA and 0.15 mM desferroxamine
mesylate, pH 8.0: Add 1.211 g of Tris-base to 800 mL of water
in a 1 L glass flask. Adjust the pH to 8.0 with HCl (see Note 3).
Next add 1.46 g of EDTA and 0.098 g of desferroxamine
mesylate. Adjust the volume to 1 L with water.
4. 10 mM sodium acetate/acetic acid, pH 5.2: Add 0.625 g of
sodium acetate (anhydrous) and 0.143 g of acetic acid to
800 mL of water in a glass flask. Adjust the pH to 5.2 (see
Note 2). Adjust the volume to 1 L with water.
5. RNAse A solution: Add 10 mg of RNAse A to 1 mL of 10 mM
sodium acetate/acetic acid buffer, pH 5.2 in a 1.5 mL micro-
tube. Heat for 15 min at 100  C (see Notes 4 and 5).
6. 10 mM Tris–HCl, 1 mM EDTA and 2.5 mM desferroxamine
mesylate, pH 7.4: Add 1.211 g of Tris-base to 800 mL of water
in a 1 L glass flask. Adjust the pH to 7.4 with concentrated HCl
(see Note 3). Next add 0.29 g of EDTA and 1.63 g of desfer-
roxamine mesylate. Adjust the volume to 1 L with water.
7. RNAse T1 solution: Dilute the commercial RNAse T1 solution
to a concentration of 20 U/μL with 10 mM Tris–HCl, 1 mM
EDTA and 2.5 mM desferroxamine mesylate, pH 7.4.
8. 10% Sodium Dodecyl Sulfate (SDS): Add 10 g of SDS to
100 mL of water (see Note 6).
9. 20 g/L Proteinase K: Add 20 mg of proteinase K to 1 mL of
water in a 1.5 mL microtube.
10. 5 M NaCl: Add 14.61 g of NaCl to 50 mL of water in a 100 mL
flask. Stir vigorously.
11. Diluted alcohol solutions: isopropanol 60% (v/v), and ethanol
70% (v/v). Prepare with water and store in ice during the
procedures (see Note 7).
12. 0.1 mM Desferroxamine mesylate: Add 0.0656 g of desferrox-
amine mesylate to 1 L of water.
13. 1 M Sodium acetate/acetic acid, pH 5.0: Add 82.03 g of
sodium acetate (anhydrous) to 800 mL of water. Once in
solution, add 35.37 g of acetic acid. Adjust the pH of the
solution to 5.0 (see Note 2). Adjust the volume to 1 L with
water.
 Detection of DNA Adducts by HPLC/MS 229

14. 10 U/μL Nuclease P1: Dilute the commercial Nuclease P1

solution to a 10 U/μL with 1 M sodium acetate/acetic acid,
pH 5.0 (see Note 8).
15. 1 M Tris–HCl, pH 7.4: Add 12.11 g of Tris-base to 80 mL of
water in a 100 mL glass flask. Adjust the pH to 7.4 with
concentrated HCl (see Note 3). Adjust the volume to
100 mL with water.
16. Phosphatase Buffer: Add 0.30 g of Tris-base, 0.0095 g of
MgCl2, 0.0013 g of ZnCl2 to 50 mL of water. Adjust the pH
to 7.6 (see Note 2). Next add 50 mL of glycerol. The solution
should have the following composition: 25 mM Tris–HCl,
1 mM MgCl2, 0.1 mM ZnCl2, 50% glycerol (v/v), pH 7.6.
17. 1 U/μL Alkaline phosphatase: Dilute the commercial solution
or powder to 1 U/μL with Phosphatase Buffer (see Note 9).
18. Internal Standards: Prepare [15N5]-1,N2-propanodGuo or
[13C2,15N5]-1,N2-propanodGuo (5.5 fmol/μL) (6S, 8S) and
(6R, 8R) diastereomers in water at final concentrations of
5.5 fmol/μL (see Note 10).
19. Millipore Ultrafree Filter Centrifugal Unit with a 0.1μm
pore size.

2.3 Quantification 1. Mobile phase: Add 80 mL of isopropanol to 960 mL of water

of 20 -Deoxyguanosine in a flask. Filter the solution through polyvinylidene fluoride
(PVDF) filters, with the aid of a vacuum pump, and remove air
bubbles by placing the solution in an ultrasonic bath for 5 min
(see Note 11).

2.4 Enrichment 1. Phenomenex Strata X C18-coated columns.

and Purification 2. Methanol Solutions: Prepare 7%, 10%, and 25% v/v methanol
of the 1, solutions with water and maintain on ice during the procedures
N2-propanodGuo (see Note 12).
Adducts 3. Mobile phase: acetonitrile used for purification, maintained at
room temperature.

2.5 Analysis by 1. Mobile phase: 10 mM ammonium formate: Add 0.63 g of

Micro-LC-ESI/MS/MS ammonium formate to 1 L of water. Filter the solution with
of 1,N2-propanodGuo PVDF filters, with the aid of a vacuum pump, and remove air
in Rats bubbles by placing the solution in an ultrasonic bath for 5 min
(see Note 11).
2. Acetonitrile: Filter 0.5 L of acetonitrile through PVDF filters,
with the aid of a vacuum pump, and remove air bubbles by
placing the solution in an ultrasonic bath for 5 min (see
Note 11).
230 Angélica B. Sanchez et al.

3 Methods

3.1 Synthesis of 1, 1. Dissolve 25μmol of 20 -deoxyguanosine (or [15N5]-2-

0
N2-propanodGuo, -deoxyguanosine), 1 mmol of acetaldehyde (or [13C2]-acetal-
[15N5]-1, dehyde) and 0.05 mmol of lysine in 2 mL of 100 mM
N2-propanodGuo phosphate buffer, pH 8.0. Stir this solution in a shaker at
and [13C4,15N5]-1, 500 rpm for 24 h at 37  C (see Note 13).
N2-propanodGuo 2. Purify adducts and standards by HPLC with the Luna C18
Standards (2) analytical column, 250 mm  4.6 mm ID, 5μm, using the
following water/acetonitrile gradient method: from 0 to
30 min, 0% to 8% acetonitrile at 0.8 to 0.5 mL/min; 30 to
50 min, 8% to 15% acetonitrile at 0.5 to 0.6 mL/min; 50 to
60 min, 15% to 50% acetonitrile at 0.6 to 0.8 mL/min; 60 to
65 min, 50% to 0% acetonitrile at 0.8 mL/min; and from 65 to
70 min, 0% acetonitrile at 0.8 mL/min (see Note 14).
3. In the chromatogram, two peaks at 19.3 and 20.6 min moni-
tored at 254 nm correspond to the adducts diastereomers
(Fig. 2). From several chromatographic runs, collect the
peaks separately in 15 mL tubes and lyophilize. Next, dissolve
the adducts in 1 mL of water and measure the absorption of the
stock solutions at 254 nm. An ε ¼ 15,600 M1 cm1 was used
for quantifying (6S,8S) 1,N2-propanodGuo and (6S,8S)
[15N5]-1,N2-propanodGuo adducts and ε ¼ 15,700 M1 cm1

40

30
Intensity x 103 (mAU)

20

10
(6R,8R) 1,N2-propanodGuo,
20.6 min
(6S,8S) 1,N2-propanodGuo,
19.1 min

0
0 5 10 15 20 25 30 35 40 45 50
Time (min)

-10

Fig. 2 HPLC-UV chromatogram of synthesis of the two diastereomers of 1,N2-propanodGuo

 Detection of DNA Adducts by HPLC/MS 231

2.5 2
A B
222.0 227.0
2
Intensity x 107 (cps)

Intensity x 107 (cps)

1.5

1.5
1
1 182.9
178.0
0.5
0.5 209.1
204.2 157.2
152.0
0 0
100 150 200 250 300 350 100 150 200 250 300 350
m/z 0.4 m/z
C 231.1
Intensity x 107 (cps)

0.3

0.2
185.0

0.1
213.2
157.0

0
100 150 200 250 300 350
m/z

Fig. 3 MS2 spectra of (a) m/z ¼ 338, 1,N2-propano-dGuo; (b) m/z ¼ 343, [15N5]-1,N2-propano-dGuo (internal
standard) and (c) m/z ¼ 347, [13C4,15N5]-1,N2-propano-dGuo (internal standard) (dR ¼ 2-deoxyribose)

was used for (6R,8R) 1,N2-propanodGuo and (6R,8R)

[15N5]-1,N2-propanodGuo adducts (we use the SPD-E10A/
VP Shimadzu UV-Vis HPLC Detector) (see Notes 14 and 15).
4. The identities of the two diastereomeric products is confirmed
by the following spectroscopic features: ESI/MS: 1,N2-propa-
nodGuo m/z 338!222 ([M + H-2-D-erythro-pentose]+),
222!178 ([M + H]+); [15N5]-1,N2-propanodGuo m/z
343!227 ([M + H- 2-D-erythro-pentose]+), 227!183
([M + H]+) and [13C4, 15N5]-1,N2-propanodGuo m/z
347!231 ([M + H -2-D-erythro-pentose]+), 231!185
([M + H]+) (Fig. 3).

3.2 DNA Extraction 1. Centrifuge the tissue homogenate (0.5 g) (see Note 16) at
and Enzymatic 1500  g for 10 min and resuspend each pellet in 3 mL of
Hydrolysis Lysis Buffer (see Note 17).
2. Repeat step 1, twice.
3. Centrifuge samples at 1500  g for 10 min and resuspend the
nuclei pellets in 3 mL of 10 mM Tris–HCl, 5 mM EDTA and
0.15 mM desferroxamine mesylate, pH 8.0.
4. Add 30μL of the RNAse A solution and 4μL of the RNAse T1
solution, along with 150μL of 10% SDS. Incubate the reaction
mixture at 37  C for 1 h.
232 Angélica B. Sanchez et al.

5. Add 60μL of the proteinase K (20 g/L) solution and incubate

the reaction mixture at 37  C for 1 h.
6. Centrifuge the samples at 5000  g for 15 min and collect the
supernatant. Add 0.6 mL of 5 M NaCl and rest the samples in
an ice bath for 20 min. Centrifuge the samples at 5000  g for
15 min and collect the supernatant.
7. Add 4 mL of 100% isopropanol. Mix the tube gently by inver-
sion until a whitish precipitate appears (see Note 7).
8. Collect the precipitate by centrifugation at 5000  g for
15 min. Then wash it with 1 mL of 60% isopropanol (v/v)
followed by 1 mL of 70% ethanol (v/v) (see Note 7).
9. Centrifuge the pellet at 5000  g for 15 min, remove the
supernatant and solubilize the pellet with 100μL 0.1 mM des-
ferroxamine mesylate (see Note 18).
10. Measure the DNA concentration spectrophotometrically at
260 nm and assess purity at 280 nm. Highly pure samples
present A260/A280 values of 1.7 (see Note 19).
11. For the hydrolysis assay, add 1 mg of the DNA sample to 20μL
of 1 M sodium acetate buffer pH 5.0, 10μL of nuclease P1
(1 U/μL) and 1μL of the internal standard [15N5]-1,N2-pro-
panodGuo (5.5 fmol/μL). Incubate the samples at 37  C for
30 min.
12. Mix 40μL of 1 M Tris–HCl buffer, pH 7.4, 40μL of phospha-
tase buffer and 40μL of alkaline phosphatase. Incubate the
reaction mixtures at 37  C for an additional 1 h.
13. Adjust the final volume of the sample to 550μL with water.
14. To remove the enzymes from the hydrolysis solution, filter the
samples through Millipore Ultrafree Filter Centrifugal Units
with a pore size of 0.1μm.

3.3 Quantification 1. Remove a 50μL aliquot of the hydrolyzed sample and transfer it
of 20 -Deoxyguanosine to an HPLC vial with a sealed top.
2. Analyze the concentration of dGuo in each sample (we use the
Shimadzu UFLC-Prominence system, Kyoto, Japan) with a
DAD detector operating at 260 nm (see Note 14). The dGuo
can be separated away from the other deoxyribonucleosides by
using the Luna C18 column (250 mm  4.6 mm ID, 5μm),
with an isocratic flow of 8% methanol at a rate of 0.7 mL/min
and an injection volume of 10μL (see Note 11). The peak at
16.1 min corresponds to dGuo. We use a standard curve rang-
ing from 1 to 5 nmol of injected dGuo to determine the dGuo
concentrations (Fig. 4).
 Detection of DNA Adducts by HPLC/MS 233

6
40 A B

dGuo area x 106

4
dGuo (16.1 min)

2
30
Intensity x 104 (mAU)

y = 1.0983x
R² = 0.999
0
0 1 2 3 4 5
dGuo (nmol)
20

10

0
0 5 10 15 20 25 30 35 40 45 50
Time (min)

Fig. 4 (a) HPLC-UV chromatogram of separation of the deoxyribonucleosides from a hydrolyzed sample from
lung tissue. (b) Standard curve for dGuo

3.4 Enrichment 1. Precondition the Phenomenex StrataX C18-coated column by

and Purification adding 1 mL of methanol to the column, repeat five times;
of the 1, followed by adding 1 mL of water, repeat five times.
N2-propanodGuo 2. Load one sample per column and wash with 1 mL of water,
Adducts 1 mL of 7% methanol and 1 mL of 10% methanol. Repeat five
times.
3. Elute the adducts with 1 mL of 25% methanol. Repeat one
additional time.
4. Dry the fraction containing 1,N2-propanodGuo adducts in a
speed vacuum system and resuspend it in 100μL of water.
These samples will be subsequently purified using HPLC.
5. Apply samples (we use Shimadzu UFLC-Prominence system,
Kyoto, Japan) with a DAD detector operating at 260 nm (see
Note 14). Separate the adducts with the Luna C18 column
250 mm  4.6 mm ID, 5μm, using the following water/
acetonitrile gradient method: from 0 to 30 min, 0% to 8%
acetonitrile at 0.8 to 0.5 mL/min; 30 to 50 min, 8% to 15%
acetonitrile at 0.5 to 0.6 mL/min; 50 to 60 min, 15% to 50%
acetonitrile at 0.6 to 0.8 mL/min; 60 to 65 min, 50% to 0%
acetonitrile at 0.8 mL/min; and from 65 to 70 min, 0% aceto-
nitrile at 0.8 mL/min using several injections of 20μL for each
sample (see Note 14). Collect the effluent from 17 to 22 min in
15 mL tubes (see Note 20). Lyophilize the collected effluent
and resuspend in 10μL of water.
234 Angélica B. Sanchez et al.

3.5 Analysis by 1. The 1,N2-propanodGuo adduct detection method was devel-

Micro-LC-ESI/MS/MS oped using a micro-LC Eksigent system, consisting of a TAG/-
of 1,N2-propanodGuo PAL autoinjector cooled to 10  C, a column oven set at 30  C,
in Rat Lungs and operated using Analyst 1.4.2 software (see Note 14). Sep-
arate the adducts by injecting 1μL of sample onto a
150 mm  0.5 mm, 2.7μm ID HALO Phenyl Hexyl analytical
column (we use Eksigent, Dublin, CA), using the following
10 mM ammonium formate/acetonitrile gradient method (see
Note 11): from 0 to 1.5 min, 2% acetonitrile; 1.5 to 3 min, 2%
to 15% acetonitrile; 3 to 3.5 min, 15% acetonitrile; 3.5 to
3.6 min, 95% acetonitrile; and from 3.6 to 5 min, 95% acetoni-
trile (see Note 14). In the chromatogram, two peaks at 3.0 and
3.3 min correspond to the adducts and standards diastereomers
(Fig. 5).
2. Analyze the purified adducts by electrospray ionization (ESI) in
the positive mode, with the detection made using selected
reaction monitoring (SRM) on an API 6500 triple-quadrupole

10 338-222 10 347-231
A 338-178 B 347-185
8 8
Intensity x 104 (cps)

Intensity x 104 (cps)

6 6

4 4

2 2

0 0
2 2.5 3 3.5 4 2 2.5 3 3.5 4
Time (min) Time (min)

4
1,N2-propanodGuo/[13C4,15N5]1,N 2-

C
3
propanodGuo

1
y = 0.7354x
R² = 0.9989
0
0 1 2 3 4 5
1,N 2-propanodGuo (fmol)

Fig. 5 Representative chromatograms of selected reaction monitoring (SRM) of the quantification transition
(blue line) and confirmation transition (red line) of the micro-HPLC-ESI+-MS/MS analysis of (a) 1,N2-propano-
dGuo (endogenous), and (b) [13C4,15N5]-1,N2-propano-dGuo (internal standard) in the lungs of rats exposed to
ambient air. (c) Micro-HPLC-ESI+-MS/MS calibration curve for 1,N2-propanodGuo calculated by the ratio
between the areas of the synthesized standards and its isotopically labeled standard, [13C4,15N5]-1,N2-
propanodGuo
 Detection of DNA Adducts by HPLC/MS 235

mass spectrometer (Sciex) (see Note 14). Monitor the m/z

338!222 (1,N2-propanodGuo), and 347!231
([ C4, N5] 1,N2-propanodGuo) transitions as quantification
13 15

transitions with a dwell time of 100 ms. The m/z 222!178 (1,
N2-propanodGuo), 231!185 ([13C4,15N5]1,N2-propanod-
Guo) transitions should be monitored as qualification transi-
tions. If necessary, the transitions 343!227 and 227!183
([15N5] 1,N2-propanodGuo) can be added. The Turbo ion
spray voltage should be maintained at 5500 V, the curtain gas
should be set at 20 psi, and the nebulizer and auxiliary gases at
50 psi. The temperature should be set at 400  C, and the
pressure of nitrogen in the collision cell adjusted to High. For
adduct quantification, a signal to noise (S/N) ratio of 10 is
used and adduct detection relied on an S/N ratio of 3. Results
are based on standard curves constructed with standards rang-
ing from 10 amol to 5 fmol. For validation of the method, see
Note 21.
3. The results are presented as the ratio between the amount of
the adduct by the amount of 20 -deoxyguanosine. The area of
the peaks corresponding to the two diastereomer peaks of the
adducts and the internal standard can be integrated together
and presented as the sum of the diastereomers.

4 Notes

1. We use the Luna C18(2) analytical column from Phenomenex

(Torrance, CA, USA) to develop the method of purification of
standards and samples in our laboratory. Its use is not obliga-
tory and if you have a C18 analytical column from another
company with the same dimensions (250 mm  4.6 mm ID,
5μm), it can be employed. However, be aware that you should
expect to observe changes in analyte retention times, as well as
other chromatographic parameters such as retention, selectivity
and efficiency. Thus, some optimization of the method will be
required, in order to obtain the best set of chromatographic
parameters.
2. To adjust the pH of the solutions we start by using a concen-
trated acid or base, appropriated to each solution. This step
must be made with caution, so that the pH does not abruptly
fall or rise. Once we approach our desired pH, we switch to a
more dilute acid or base solution. Care must be taken so that
the final desired volume is not exceeded. Changes in tempera-
ture may result in a shift in dissociation, so it is highly recom-
mended that you prepare your buffers at room temperature,
and that your pH meters and the pH standards solutions are
kept at approximately 20  C, since the pH electrode is
236 Angélica B. Sanchez et al.

temperature dependent. Avoid contaminating your solutions

by using clean, sterile materials. Buffers with diluted concen-
tration ranges (typically 0.01–0.50 M) should be refrigerated
and stored for no longer than 1 week.
3. Tris-base solutions, with concentrations 1 M are typically
difficult to dilute, so we find it best to add the stock Tris
solutions to a beaker with water that is already in magnetic
stirring. To adjust the pH, start with concentrated HCl (12 M)
and when the pH approaches the desired value, change to a
diluted acid solution (i.e., 6 M or less).
4. It is not obligatory to use the DNA extraction method we
describe in Subheading 3.2. DNA extraction kits and enzyme
solutions are commercially available and can be utilized,
according the protocols provided by the manufacturer. This
method can be used when DNA extraction kits and/or enzyme
solutions are unavailable.
5. This solution must be prepared fresh on the day of the experi-
ment. We use the boiling-water bath method to eliminate
DNase activity. There are commercially available solutions for
this purpose. If you happen to be using one of these products
this step is not necessary. Remember to cool the solution to
room temperature before adding it to the sample.

6. SDS precipitates at 4 C and must be stored at room
temperature.
7. In order to increase the DNA precipitation performance, the
isopropanol (100%, 60%) and ethanol (70%) solutions must be
prepared fresh and kept in an ice bath.
8. Nuclease P1 is often sold as a lyophilized powder with 200 U/
mg of protein or in solutions of 10,000 U/μL. We dilute these
stock solutions to a final concentration of 10 U/μL using 1 M
sodium acetate/acetic acid buffer, pH 5.0. This solution is
prepared fresh on the day of the experiment.
9. Alkaline Phosphatase is often sold as solutions ranging from
50 to 10,000 U/μL. We keep small aliquots of this solution
and store them at 20  C. On the day of experiments, we
dilute the solution to a final concentration of 1 U/μL using
the Phosphatase Buffer.
10. The standard solutions are prepared from the stock solution
prepared after purification, fresh on the day of the experiment.
The concentration of the stock solutions must be measured
each time a dilution is performed. To prevent contamination,
we typically keep stock solution aliquots at 80  C.
11. When preparing the mobile phases, it is very important to use
clean flasks, and to filter the solutions with the appropriate
filters, to avoid biological and/or trace contamination. It is
 Detection of DNA Adducts by HPLC/MS 237

best to prepare the mobile phase fresh and not use it for more
than 5 days. The ultrasonic bath step is also important for
preventing bubbles that can damage the HPLC and micro-
LC systems, as well as the analytical columns.
12. It is best to prepare these solutions at the moment of use.
13. Our previous study showed the detection and quantification of
[13C4]-1,N2-propanodGuo adducts (m/z ¼ 342) formed in
lungs and brains of rats exposed to exogenous [13C2]-acetalde-
hyde (1). For that reason, we used a doubly isotope internal
standard, [13C2,15N5]-1,N2-propanodGuo (m/z ¼ 347), to
ensure a mass difference of 5 units and avoid interference in the
mass spectrometer channels. If you are only assessing endoge-
nous levels 1,N2-propanodGuo (m/z ¼ 338), there is no need
to use the doubled internal standard. In this situation, it is
recommended that you instead use the [15N5]-1,N2-propa-
nodGuo (m/z ¼ 343). The resulting mass difference will be
the same and you avoid having to purchase the isotopically
labeled acetaldehyde.
14. We describe the LC and MS systems used to develop the
purification method, as well as the quantification methods for
standards and samples in our laboratory, but any system that
provides the same specified parameters can be used. Be aware
that some optimization of the method will be required to
obtain the same retention times, selectivity, and resolution.
15. Always inject a solution of 20 -deoxyguanosine before starting
the purification. This step confirms the retention time, thus
preventing the loss of the adducts. Be sure to collect the
diastereomers separately to prevent potential cross
contamination.
16. We describe this protocol for 0.5 g of lung tissue, but any other
tissue can be used (i.e., liver, brain, heart, etc.). This protocol
can also be used with any cell culture, using a cell pellet con-
taining 3  108 cells.
17. Lung tissue is often difficult to homogenize, even when a mixer
is used. Try to incubate the tissue in lysis buffer on ice for
15 min before homogenization.
18. To remove residual ethanol and ease the DNA solubilization in
the desferroxamine mesylate solution, dry the DNA under a
stream of N2.
19. The DNA concentration must be calculated in order to nor-
malize the amount of sample needed for the hydrolysis step.
Using a high quantity (i.e., >1 mg) or low purity (i.e., A260/
A280 < 1.7) DNA can compromise hydrolysis efficiency.
238 Angélica B. Sanchez et al.

20. The detection limit of the DAD system of the HPLC is below
the concentration of adducts in the sample, so you will not see
any peaks in the 17–23 min region. For that reason, before
starting any purification, inject a standard to verify that the
retention times of the adducts are between the collection times.
21. We validated the Micro-LC-ESI/MS/MS method by injecting
samples spiked with 5 fmol of internal standard ([13C2],
[15N5]-1,N2-propanodGuo) and different amounts of analytes
([13C4]-1,N2-propanodGuo and 1,N2-propanodGuo) ranging
from 10 amol to 5 fmol. The injections were performed on
three consecutive days with three injections per day and the
coefficients of variance within the same day and subsequent
days were calculated. We also injected hydrolyzed DNA from
the brain and lungs contaminated with 40 amol of each of the
[13C4]-1,N2-propanodGuo diastereomer standards, and
5 fmol of the internal standard ([13C2,15N5]-1,N2-propanod-
Guo. When employing this method for different tissues or
cultured cells, these validation steps must be performed.

Acknowledgments

FAPESP (Fundação de Amparo à Pesquisa do Estado de São Paulo,

No. 2012/12663-1, CEPID Redoxoma No. 2013/07937-8),
CNPq (Conselho Nacional para o Desenvolvimento Cientı́fico
e Tecnológico, No. 302120/2018-1 and No. 159068/2014-2),
PRPUSP (Pro-Reitoria de Pesquisa da Universidade de São Paulo,
NAP Redoxoma No. 2011.1.9352.1.8).

References

1. Sanchez AB, Garcia CCM, Freitas FP et al 5. Woutersen RA, Appelman LM, Van Der Heijde
(2018) DNA adduct formation in the lungs CA (1984) Inhalation toxicity of acetaldehyde
and brain of rats exposed to low concentrations in rats II. Carcinogenicity study: interim results
of [13C2]-acetaldehyde. Chem Res Toxicol after 15 months. Toxicology 31:123–133
18:332–339 6. Visapaa JP, Gotte K, Benesova M et al (2004)
2. Stein S, Lao Y, Yang IY et al (2006) Genotoxi- Increased cancer risk in heavy drinkers with the
city of acetaldehyde- and crotonaldehyde- alcohol dehydrogenase 1C*1 allele, possibly
induced 1,N2-propanodeoxyguanosine DNA due to salivary acetaldehyde. Gut 53:871–876
adducts in human cells. Mutat Res Genet Tox- 7. International Agency for Research on Cancer,
icol Environ Mutagen 608:1–7 Lyon, France (1999) Monographs on the Eval-
3. Hecht SS, McIntee EJ, Wang MY (2001) New uation of the Carcinogenic Risk of Chemicals
DNA adducts of crotonaldehyde and acetalde- to Humans 71: 319–335
hyde. Toxicology 166:31–36 8. Matsuda T, Yabushita H, Kanaly RA et al
4. Lachenmeier DW, Sohnius EM (2008) The (2006) Increased DNA damage in ALDH2-
role of acetaldehyde outside ethanol metabo- deficient alcoholics. Chem Res Toxicol
lism in the carcinogenicity of alcoholic bev- 19:1374–1378
erages: evidence from a large chemical survey.
Food Chem Toxicol 46:2903–2911
 Detection of DNA Adducts by HPLC/MS 239

9. Garcia CCM, Angeli JPF, Freitas FP et al 15. Pandya G, Moriya M (1996) 1,N6-
(2011) J Am Chem Soc 133(24):9140–9143. ethenodeoxyadenosine, a DNA adduct highly
https://doi.org/10.1021/ja2004686 mutagenic in mammalian cells. Biochemistry
10. Wang M, Nishikawa A, Chung FL (1992) Dif- 35:11487–11492
ferential effects of thiols on DNA modifications 16. Palejwala VA, Rzepka RW, Simha D et al
via alkylation and Michael addition by alpha- (1993) Quantitative multiplex sequence analy-
acetoxy-N-nitrosopyrrolidine. Chem Res Tox- sis of mutational hot spots. Frequency and
icol 5:528–531 specificity of mutations induced by a site-
11. Nair U, Bartsch H, Nair J (2007) Lipid specific ethenocytosine in M13 viral DNA. Bio-
peroxidation-induced DNA damage in cancer- chemistry 32:4105–4111
prone inflammatory diseases. A review of pub- 17. Moriya M, Zhang W, Johnson F et al (1994)
lished adduct types and levels in humans. Free Mutagenic potency of exocyclic DNA adducts
Radic Biol Med 43:1109–1120 marked differences between Escherichia coli
12. Blair I (2008) DNA adducts with lipid peroxi- and simian kidney cells. Proc Natl Acad Sci U
dation products. J Biol Chem S A 91:11899–11903
283:15545–15549 18. Cheng KC, Preston BD, Cahill DS et al (1991)
13. Medeiros MHG (2009) Exocyclic DNA The vinyl chloride DNA derivative N-2,3-ethe-
adducts as biomarkers of lipid oxidation and noguanine produces G-A transitions in Escher-
predictors of disease. Challenges in developing ichia coli. Proc Natl Acad Sci U S A
sensitive and specific methods for clinical stud- 88:9974–9978
ies. Chem Res Toxicol 22:419–425 19. Marnett LJ (2000) Oxyradicals and DNA dam-
14. Basu AK, Wood ML, Niedernhofer LJ et al age. Carcinogenesis 21:361–370
(1993) Mutagenic and genotoxic effects of 20. Dedon PC, DeMott MS, Elmquist CE et al
three vinyl chloride-induced DNA lesions: 1, (2007) Challenges in developing DNA and
N6-ethenoadenine, 3,N4-ethenocytosine,and RNA biomarkers of inflammation. Biomark
4-amino-5-(imidazol-2-yl)imidazole. Bio- Med 1:293–312
chemistry 32:12793–12801
 Chapter 19

A Method for Liposome Co-encapsulation of Phenethyl

Isothiocyanate and Cisplatin and Determining Its Toxicity
Against Lung and Lung Cancer Cells
Mengwei Sun and Anthony J. Di Pasqua

Abstract
Non-small cell lung cancer (NSCLC) is one of the leading causes of cancer-related deaths in the United
States. It is extremely difficult to treat, and its survival rate is low. Today, the most effective treatments are
still those that implement the platinum anticancer drug cisplatin (CDDP) in combination with other drugs.
We previously demonstrated that the naturally occurring compound phenethyl isothiocyanate (PEITC)
could be used to sensitize NSCLC cells to CDDP. Furthermore, co-encapsulation of PEITC and CDDP in
liposomes enhances their toxicity toward NSCLC cells. We have optimized a liposomal-PEITC-CDDP
formulation and investigated its cytotoxicity. We determined that liposomal-PEITC-CDDP is much more
toxic toward human NSCLC cell lines than it is toward human normal lung cell lines. In this chapter, we
describe detailed methods for preparing liposomal-PEITC-CDDP and determining its cytotoxicity.

Key words NSCLC, Liposomes, Cisplatin, Isothiocyanate, Chemotherapy, Cytotoxicity

1 Introduction

Cisplatin (CDDP) is commonly used in the clinic against non-small

cell lung cancer (NSCLC); however, the negative side-effects asso-
ciated with this metal-based drug urgently need to be addressed.
When CDDP is encapsulated in liposomes, it causes less toxicity to
patients than free CDDP, but has a similar efficacy against NSCLC
[1]. Naturally occurring phenethyl isothiocyanate (PEITC) can be
used to sensitize NSCLC cells to CDDP [2]. We have previously
shown that co-encapsulation of PEITC and CDDP in liposomes
(Lipo-PEITC-CDDP) enhances toxicity toward NSCLC cells,
compared to free PEITC or CDDP [3]. More recently, we reported
on the preparation of an optimized liposomal nanoparticle contain-
ing both PEITC and CDDP and its therapeutic index [4]. Studies
have shown that drugs reformulated in liposomes have an increased
circulation time in the bloodstream and, furthermore, increased
accumulation in tumors, which is due to the enhanced permeability

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1_19, © Springer Science+Business Media, LLC, part of Springer Nature 2021

241
242 Mengwei Sun and Anthony J. Di Pasqua

and retention (EPR) effect [5]. Liposomes encapsulated with the

relatively hydrophilic CDDP and hydrophobic PEITC were
prepared and characterized. For this preparation, 1,2-distearoyl-
sn-glycero-3-phosphocholine (DSPC) was chosen. Liposomes con-
taining DSPC were reported to show greater drug retention over
48 h at 4
C and 37
C than those composed of phospholipids with
lower phase transition temperature values [6].
Here we expand on our previous work [4]. The optimized
liposomal nanoparticles have a 1:3 ratio of CDDP:PEITC, so less
platinum drug can be administered to achieve desired toxicities.
Careful characterization studies including dynamic light scattering
(DLS) and scanning electron microscopy (SEM) were performed,
PEITC and CDDP loading percentages were determined via a
1,2-benzenedithiol-based cyclocondensation assay and inductively
coupled plasma-mass spectrometry (ICP-MS), respectively, and
in vitro release profiles obtained for liposomal-CDDP, liposomal-
PEITC and liposomes containing both CDDP and PEITC (lipo-
somal-PEITC-CDDP). Toxicities were then determined using two
human NSCLC cell lines, A549 and H596, and human normal
lung cells, BEAS-2B and WI-38.

2 Materials

Prepare all solutions using deionized water (18 MΩ) and analytical
grade reagents. Prepare and store all reagents at room temperature
(unless indicated otherwise). Carefully follow all waste disposal
regulations when disposing waste materials.

2.1 Liposome 1. 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). Store at

Preparation 20
C.
2. L-α-phosphatidylglycerol (egg, chicken) (EPG). Store at
20
C.
3. Phenethyl isothiocyanate (PEITC). Store at 4
C.
4. Chloroform (see Note 1).
5. Hydration medium: This consists of 0, 4, 6, or 8.33 mM
Cisplatin (CDDP) in 0.9% Sodium Chloride (NaCl). To pre-
pare, add 0.45 g of NaCl to 50 mL deionized water to make a
0.9% NaCl stock. For the 4, 6, and 8.33 mM CDDP solutions,
dissolve 0.012, 0.018 or 0.025 g CDDP, respectively, in 10 mL
0.9% NaCl (see Note 2). Cover the container (centrifuge tube)
with aluminum foil because of the light-sensitivity of CDDP
and allow to equilibrate in the dark for 24 h.
 Phenethyl Isothiocyanate and Cisplatin Liposome Formulation 243

2.2 1,2-Benzened- 1. BDT/methanol reagent. This is 8 mM BDT in 2 mL methanol

ithiol (BDT) Assay [7]. To prepare, add 1.84 μL of BDT to 1998.19 μL of metha-
nol to make 2 mL of the BDT/methanol reagent (see Note 3).
2. 100 mM potassium phosphate buffer (PPB), pH adjusted to
8.5. To prepare, add 8.709 g of potassium phosphate dibasic
anhydrous powder to 500 mL of deionized water to make a
500 mL stock of 100 mM potassium phosphate buffer.

2.3 Release 1. Release medium. To prepare, mix 15 mL of 1 phosphate-

buffered saline (PBS, we use commercially available readymade
1 PBS) with 5 mL methanol. Methanol is required to dissolve
the PEITC due to its lipophilicity.

2.4 Cell Lines, Cell 1. Minimum essential medium (MEM) supplemented with 10%
Culture Media, fetal bovine serum (FBS), 100 μg/mL streptomycin, 2.0 mM
and Cytotoxicity Assay L-glutamine and 100 IU/mL penicillin.
Reagents 2. Supplemented Bronchial Epithelial Cell Basal Medium
(BEBM). This is usually purchased in the form of a Bronchial
Epithelial Cell Growth Kit that includes the supplements that
need to be added to the medium. The supplements that must
be included in the kit are bovine pituitary extract (BPE), insu-
lin, hydrocortisone, gentamicin sulfate-amphotericin
(GA-1000), retinoic acid, transferrin, triiodothyronine, epi-
nephrine, and human epidermal growth factor (hEGF). Pre-
pare the supplemented medium following the kit’s
instructions.
3. Roswell Park Memorial Institute (RPMI) medium supplemen-
ted with 10% fetal bovine serum (FBS), 100 μg/mL strepto-
mycin, 2.0 mM L-glutamine and 100 IU/mL penicillin.
4. Wi-38 cells, these are fibroblast-like human lung fetal cells.
5. BEAS-2B cells, these are normal human bronchial epithelial
cells.
6. NCI-H596 cells, these are adeno-squamous lung carcinoma
cells.
7. A549 cells, these are adeno-carcinomic human alveolar basal
epithelial cells.
8. MTS solution. This is available as a commercially ready-to-use
solution.

2.5 Additional 1. Round-bottom flasks.

Laboratory Equipment 2. Rotary evaporator for solvent removal by evaporation.
and Reagents
3. Water bath, set at 30
C (temperature monitoring with ther-
mometer is recommended).
4. Sonicators, both probe and water bath models. For the probe
sonicator, use with amplitude set to 20%.
244 Mengwei Sun and Anthony J. Di Pasqua

5. Vortex mixer and spin bars.

6. Handheld extruder with polycarbonate filter membranes,
100 and 200 nm. We use the Avanti Polar Lipid Inc. handheld
extruder (Alabaster, AL, USA), but other models can be used.
7. Hot plate.
8. Ultracentrifugation filter columns, 50 kDa.
9. Benchtop microcentrifuge.
10. Glass vials, 1 mL and 2 mL, with caps.
11. Light scattering measurement instrument, this is used to mea-
sure nanoparticle size and zeta potential. We use the Zetasizer
Nano (Malvern Instruments, Worcestershire, UK).
12. Heating block with capacity to hold 1.5–2.0 mL microcentri-
fuge tubes.
13. 96-well culture plates.
14. UV-spectrophotometer capable of holding 96-well plates.
15. UV-clear polystyrene spectrophotometer cuvettes.
16. Field Emission Scanning Electron Microscope (FESEM). The
use of a FESEM is needed to assess liposome morphology. We
place samples on carbon-coated grids for FESEM analysis.
17. Inductively coupled plasma-mass spectrometry (ICP-MS)
instrument. We use the PerkinElmer 350D (Waltham,
MA, USA).
18. 70% nitric acid solution, commercially available. In addition to
the 70% nitric acid solution, you will also need to prepare a 2%
nitric acid solution, which you can prepare by diluting the
concentrated 70% with deionized water. We prepare this solu-
tion by mixing 10 mL of 70% nitric acid with 340 mL of
deionized water.
19. Dialysis bags, 12 kDa molecular weight cut-off. You will need
cotton strings to tie and seal the ends. You also need a capped
glass vial capable of holding inside the dialysis bag and with
20 mL of release medium.
20. Water-jacketed incubator, to be set for standard culture condi-
tions of 37
C and 5% CO2.
21. Deionized water.

3 Methods

3.1 Preparation 1. Prepare liposomes by mixing 12.6 mg of DSPC, 4.1 mg of

and Characterization EPG, PEITC (0, 10, 16 or 20 μL) and 0.4 mL of chloroform
of Liposomes (see Note 4) in a round-bottom flask. Gently shake the flask to
dissolve all the chemicals.
 Phenethyl Isothiocyanate and Cisplatin Liposome Formulation 245

2. Remove the chloroform by rotary evaporation accompanied by

a thermally controlled water bath at 30
C for 30 min until a
dry mixture is obtained. The mixture is considered dry when a
thin lipid film is formed at the bottom of the flask.
3. Hydrate the thin film with 1 mL 0.9% NaCl hydration medium
containing 0, 4, 6 or 8.33 mM CDDP.
4. Sonicate the mixture for 2 min with a water-type sonicator at
65
C and then vortex it for 30 s until the film is completely
hydrated and the suspension is homogeneous.
5. Extrude the lipid suspension ten times through 200 nm and
100 nm polycarbonate membranes at 65
C using a handheld
extruder on a hot plate (see Note 5).
6. Remove the unencapsulated CDDP and PEITC using 50 kDa
ultracentrifugation filter columns spinning at 3000  g for
20 min (see Note 6). Properly discard the free PEITC or
CDDP after centrifugation, weigh the lipids encapsulated
with PEITC/CDDP.
7. Prepare the samples for Zetasizer Nano (or equivalent instru-
ment) to investigate the particle size and zeta potential of the
liposomes by adding 100 μL of liposomes suspension to 1 mL
0.9% NaCl (see Note 7). Sonicate the diluted liposomes using a
probe sonicator discontinuously for 5 s to evenly distribute the
liposome nanoparticles without disturbing the encapsulated
drug. Add 1 mL of the diluted solution to a UV-clear polysty-
rene cuvette and read with the Zetasizer Nano or equivalent
instrument. The average diameters of blank liposomes, lipo-
somes encapsulated with PEITC and/or CDDP should range
from 116.3 (blank liposomes) to 173.4 nm (liposomes
encapsulated with PEITC and CDDP) (Table 1). The average
polydispersity indexes (PDI) of these nanoparticles indicate
uniform particle size and good dispersion (Table 1). The sta-
bility of the blank liposomes and drug-encapsulated liposomes
should be verified by measuring their zeta potentials, and these
should range from 40 to 60 mV (Table 1). The images
acquired from Zetasizer should be representative of the size
distribution and zeta potential of liposomes encapsulated with
PEITC and CDDP (Fig. 1a and b).
8. Prepare the sample for Field Emission Scanning Electron
Microscope (FESEM) to characterize the morphology of lipo-
somes encapsulated with PEITC and CDDP (Lipo-PEITC-
CDDP). Drop 5 μL of Lipo-PEITC-CDDP onto a carbon-
coated grid three times (during each time, absorb excess fluid
using a filter paper 15 min after dropping), then place the grid
in a vacuum desiccator overnight. SEM observation should
confirm that the Lipo-PEITC-CDDP exhibits spherical mor-
phology, with an average particle size of approximately 150 nm
(Fig. 1c).
246 Mengwei Sun and Anthony J. Di Pasqua

Table 1
Size and zeta potentials of blank liposomes and liposomes loaded with cisplatin (CDDP) and/or
phenethyl isothiocyanate (PEITC)

DSPC EPG CDDP PEITC Polydispersity

Formulations (μmol) (μmol) (μmol) (μmol) Size (nm) Index (PDI) Zeta (mV)
Blank liposomes 16 4 0 0 116.3  15.2 0.06 41.0  5.2
Liposomes 16 4 4 0 142.4  26.4 0.08 45.3  7.4
encapsulated with 16 4 6 0 149.2  36.7 0.08 46.3  7.2
CDDP 16 4 8.33 0 155.6  29.5 0.09 51.2  6.5
Liposomes 16 4 0 68 139.2  35.1 0.12 50.6  4.1
encapsulated with 16 4 0 108.8 157.5  28.3 0.13 52.4  7.8
PEITC 16 4 0 134 165.6  20.2 0.16 54.5  6.3
Liposomes 16 4 8.33 134 173.4  26.8 0.22 61.8  6.9
encapsulated with
PEITC and CDDP

Fig. 1 Size distribution (a) and zeta potential images (b) (acquired from Zetasizer) of liposomes containing both
phenethyl isothiocyanate (PEITC) and cisplatin (CDDP) (Lipo-PEITC-CDDP). Scanning electron microscopy
image of Lipo-PEITC-CDDP (c). (Modified from [4]. Copyright retained by the authors. The original article is
licensed under Creative Commons CC BY 4.0 license)

3.2 Determination The 1,2-benzenedithiol-based cyclocondensation assay is a useful

of PEITC Loading tool to determine the amount of PEITC. All aliphatic and aromatic
in Liposomal-PEITC isothiocyanates (ITC), except tertiary ITCs, react quantitatively
and Liposomal- with BDT when BDT is present in 100-fold excess over the
PEITC-CDDP Using ITC to be assayed, typically at 4 mM [7].
1,2-Benzenedithiol 1. Prepare the BDT assay reaction mixture as follows: dilute the
(BDT) Assay sample to be analyzed in 1 mL of 100 mM PPB, keeping the
sample concentration at 80 μM in 1 mL PPB. Then prepare
2 mL of reaction mixture by mixing 1 mL of the BDT/metha-
nol reagent with 0.5–1 mL of the 100 mM PPB containing the
 Phenethyl Isothiocyanate and Cisplatin Liposome Formulation 247

sample to be measured. It is important that when preparing the

reaction mixture, the concentration of the sample should be
kept 80 μM in 1 mL of PPB while the concentration of BDT
in 1 mL BDT/methanol mixture should be 8 mM.
2. Take 1.2 μL of liposomal-PEITC or liposomal-PEITC-CDDP
and add to 998.8 μL PPB (see Note 8). Vortex to mix well.
3. Pipette the reaction mixture into a tightly capped glass vial.
4. Place the vial on a hot plate at 65
C for 2 h, monitoring the
temperature on the hot plate with a thermometer. Take three
200 μL aliquots in a 96-well plate and read the UV-vis absor-
bance at 365 nm. Establish a standard curve of PEITC using
BDT assay prior to calculating the amount of PEITC in the
liposomes. The drug loading of PEITC can be calculated using
the equation:
Weight of PEITC in liposomes
PEITC loading ð%Þ ¼  100%
Total weight of lipids and PEITC

3.3 Determination Cisplatin loading is determined by analyzing a sample by induc-

of CDDP Loading tively coupled plasma-mass spectrometry (ICP-MS), which mea-
in Liposomal-CDDP sures the amount of platinum from cisplatin in the sample.
and Liposomal- 1. Digest the sample by adding 20 μL of the Lipo-CDDP or Lipo-
PEITC-CDDP by PEITC-CDDP sample to 1 mL 70% nitric acid in a 2 mL tube.
Inductively Coupled
2. Heat the tube at 70
C with the cap open overnight in a heating
Plasma-Mass
block (see Note 9). Control the temperature on the heating
Spectrometry (ICP-MS)
block with a thermometer.
3. Remove from heat. Make sure the sample is dry (see Note 10),
then re-dissolve the sample in 1 mL of 70% nitric acid. Take
three 0.1 mL aliquots from the sample and add each of them to
3.4 mL 2% nitric acid containing at least one internal standard
(see Note 11).
4. Prepare a set of standard solutions (0, 25, 50, 100, 200, 400,
600, 800, and 1000 ppb). The correlation coefficient (R2) of
the linear standard curve should be 0.9999 or better.
5. Read the sample. If the concentration is higher than 1000 ppb,
then dilute the sample until its concentration falls within the
range of the standard curve. The drug loading of cisplatin can
be calculated using the equation:
Weight of CDDP in liposomes
CDDP loading ð%Þ ¼  100%
Total weight of lipids and CDDP
Percent loading and encapsulation efficiency (EE) of the
two drugs should increase with their concentrations, respec-
tively (Table 2). In our hands, the highest loading
(1.35  0.27%) and EE (83.9  4.1%) for CDDP in liposomes
248 Mengwei Sun and Anthony J. Di Pasqua

Table 2
Percent drug loading and encapsulation efficiency (EE) of cisplatin (CDDP) and/or phenethyl
isothiocyanate (PEITC) in liposomes

CDDP PEITC CDDP CDDP-EE PEITC PEITC-EE

Formulations (μmol) (μmol) loading (%) (%) loading (%) (%)
Blank liposomes 0 0 – – – –
Liposomes encapsulated with 4 0 0.56  0.29 60.5  6.7 – –
CDDP 6 0 0.67  0.33 79.8  5.2 – –
8.33 0 1.35  0.27 83.9  4.1 – –
Liposomes encapsulated with 0 68 – – 2.05  0.21 26.7  3.1
PEITC 0 108.8 – – 2.89  0.32 31.5  4.7
0 134 – – 3.66  0.35 37.0  2.4
Liposomes encapsulated with 8.33 134 1.37  0.18 84.3  2.6 3.24  0.47 34.7  3.2
PEITC and CDDP

(Lipo-CDDP) has been achieved using 8.33 μmol of CDDP;

and the highest loading (3.66  0.35%) and EE (37.0  2.4%)
for PEITC in liposomes (Lipo-PEITC) was achieved using
134 μmol of PEITC (Table 2). In the PEITC and CDDP-
loaded liposomal formulation (Lipo-PEITC-CDDP),
8.33 μmol of CDDP and 134 μmol of PEITC were used to
obtain 1.37  0.18% and 3.24  0.47% loading of CDDP and
PEITC, respectively (Table 2).

3.4 In Vitro Drug 1. Cut the dialysis bags into about 8 cm long pieces. Immerse the
Release Studies bags and cotton strings in deionized water for 30 min. Tie
three knots using cotton strings on one end of the bag to seal
the bag at that end.
2. Pipette 1 mL of Lipo-PEITC, Lipo-CDDP, or Lipo-PEITC-
CDDP in the dialysis bag. Tie three knots on the other end of
the bag to seal it.
3. Put the bag in a capped glass vial that contains 20 mL of release
medium and a spin bar. Make sure the bag is completely
immersed in the release medium. Place the glass vial on a hot
plate and use a thermometer to control the temperature on the
hot plate. Set the rotation speed for the spin bar and the
temperature on the hot plate at 100 rpm and 37
C,
respectively.
4. Take three sample aliquots (100 μL  3) of the release medium
and add to a 96-well plate (see Note 12) for analysis at different
time points (0.5, 1, 1.5, 2, 4, 8, 16 and 24 h), replacing the
volume with fresh release medium. Measure the absorbance of
PEITC released from Lipo-PEITC and Lipo-PEITC-CDDP
 Phenethyl Isothiocyanate and Cisplatin Liposome Formulation 249

using the same BDT assay as described in Subheading 3.2. Use

ICP-MS to calculate the amount of CDDP released from Lipo-
CDDP and Lipo-PEITC-CDDP.
5. Calculate the percentage of the release of CDDP or PEITC at
different time points using the equation:
Cumulative amount released
Release ð%Þ ¼  100%
Total amount in liposomes
In our hands, over 2 h, Lipo-CDDP and Lipo-PEITC-
CDDP release 76.5  3.9% and 75.2  3.3% of their CDDP,
respectively. Over 24 h, the amount of CDDP released reached
86.1  4.3% and 91.1  2.9%, respectively. In our hands Lipo-
PEITC has shown a relatively sustained PEITC release, with
40.2  2.5% released gradually in the first 8 h. The percent
release remains almost the same up to 24 h. A similar PEITC
release profile was observed for Lipo-PEITC-CDDP, with
44.8  2.6% of the PEITC released gradually within 8 h [4].

3.5 Cytotoxicity Cytotoxicity studies should include 9 groups: group 1, control

Studies group with only medium; group 2, control group with untreated
cells. Groups 3–9 should be treated cells: group 3, free CDDP;
group 4, free PEITC; group 5, CDDP and PEITC (CDDP +
PEITC); group 6, blank liposomes; group 7, Lipo-CDDP; group
8, Lipo-PEITC; group 9, Lipo-PEITC-CDDP.
Carry out all cell studies in a humidified 37
C, 5% CO2
(standard conditions) atmosphere incubator. Use the supplemen-
ted MEM for WI-38 cells; the supplemented BEBM for the BEAS-
2B cells; and the supplemented RPMI medium for the two cancer
cell lines, H596 and A549. Grow the cells for at least 2 weeks before
the experiments.
1. In four 96-well plates, seed the cells from the four cell lines at
5  103 cells/mL (100 μL/well) in 9  6 wells one cell line per
96-well plate. Allow the cells to grow for 24 h (see Note 13).
2. Remove the culture medium from each well and replace it with
100 μL of medium containing the treatment suspensions (see
Note 14). Expose the cells with the treatment suspensions for
24 h.
3. Replace the treatment with 100 μL of fresh culture medium
and 20 μL of MTS solution (see Note 15). Incubate for 2 h.
Read the UV-Vis absorbance at 490 nm. Calculate the percent
survival of cells treated using the following equation:
At  Am
%Survival ¼  100%,
Ac  Am
where At is the absorbance of cells in treatment groups, Am is
the absorbance of culture medium alone, and Ac is the absor-
bance of cells without treatment (see Note 16).
250 Mengwei Sun and Anthony J. Di Pasqua

4 Notes

1. Store chloroform in a ventilated cabinet and seal its container

when not in use. When handling chloroform, a laboratory coat,
nitrile gloves, and safety goggles are required during the whole
time due to its toxicity.
2. After putting CDDP in 0.9% NaCl, sonicate the container of
CDDP in a water-type sonicator at 60
C until it is fully
dissolved.
3. We find that it is best to prepare fresh BDT/methanol
each time.
4. Chloroform tends to drip down the pipette when taking it out
from the container, making it difficult to get the exact volume.
To prevent dripping, saturate the tip of the pipette by multiple
times of up and down pipetting.
5. The lipid suspension should be kept above its phase transition
temperature (65
C for DSPC) during hydration and extru-
sion. When inserting the membrane in the extruder, make sure
that the shiny side of the membrane faces the direction of the
mix, so it is exposed to the first pass through the extruder. To
reduce the dead volume, pre-wet the extruder parts by passing
a syringe full of deionized water through the extruder and
discard the water. Load the lipid suspension into a gas-tight
syringe and insert the syringe into one end of the extruder.
Insert the other syringe into the other end of the extruder and
set the plunger of the empty gas-tight syringe to zero. This
syringe will begin to fill automatically as the lipid is extruded
through the membrane. Insert the extruder apparatus onto the
heating block by making the line connected by the two oppos-
ing apexes vertical to the heating block. To extrude, gently
push the plunger of the filled syringe until the lipid suspension
is fully transferred to the alternate syringe, then push back the
suspension to the original syringe. The last extrusion should
end in the alternate syringe to reduce contamination and large
particles.
6. When the rotation speed is too fast, the suspension will aggre-
gate, and this will result in a large loss of drug and lipid. We
found 3000  g for 20 min was feasible to avoid aggregation
and achieve complete separation at the same time.
7. When preparing the diluted nanoparticles sample for DLS, the
dilution factor depends on the concentration of the sample.
One convenient way to determine the dilution factor is to
dilute the sample until it is close to becoming transparent.
8. Calculation method: assume there is no decrease in volume of
Lipo-PEITC or Lipo-PEITC-CDDP and all the PEITC added
 Phenethyl Isothiocyanate and Cisplatin Liposome Formulation 251

is encapsulated in the liposomes after centrifugation; the high-

est possible concentration of PEITC (calculate using the largest
amount of PEITC 20 μL) in the liposomes can be calculated
using the equation:
mðPEITCÞ
nðPEITCÞ M ðPEITCÞ
c ðPEITCÞ ¼ ¼
V ðliposomesþPEITCÞ V ðliposomesþPEITCÞ
ρðPEITCÞ  V ðPEITCÞ g
1:09 mL  20 μL
¼ ¼
M ðPEITCÞ  V ðliposomesþPEITCÞ 163:29 mol
g
 1000 μL
¼ 133:5 mM,
where c, n, V, m, M, and ρ stand for concentration, mole,
volume, mass, molar mass, and density, respectively.
In order to have 40 μM PEITC in the final 2 mL assay
solution, the concentration of PEITC in 1 mL PPB should be
80 μM. Dilute the 133.5 mM Lipo-PEITC or Lipo-PEITC-
CDDP to 80 μM in 1 mL PPB. According to the equation:
c1  V1 ¼ c2  V2, we need to take 1.2 μL from Lipo-PEITC or
Lipo-PEITC-CDDP and add to 998.8 μL PPB. After adding
PPB/sample to 1 mL BDT/methanol, the highest concentra-
tion of the PEITC encapsulated in the liposomes will always be
less than 40 μM since there will be some loss in the volume of
Lipo-PEITC or Lipo-PEITC-CDDP after centrifugation to
remove the free PEITC.
9. To prevent contamination from other elements during diges-
tion, place the tube with the sample in a clean heating block in a
fume hood.
10. If the sample is not dry, repeat the digestion step by adding
another 500 μL 70% nitric acid to the tube and heat it
overnight.
11. To obtain optimal precision and accuracy, the internal standard
should be selected as close in mass number as possible to that of
the analyte element(s). Lutetium (atomic number 71) and gold
(atomic number 79) were chosen to be the internal standards
for platinum (atomic number 78) in this experiment.
12. When taking the aliquots, pipette the release medium up and
down prior to taking the sample out to decrease discrepancy.
13. For cells to grow homogeneously or treatment to spread evenly
in each well, gently move the well plates left and right, up and
down on a horizontal plane.
14. The volume of the treatment solution cannot exceed 5% of the
total volume (100 μL).
15. Mix the medium with the MTS solution at a 5:1 ratio prior to
adding to the cells. A dark environment is preferred due to the
light-sensitivity of the MTS.
252 Mengwei Sun and Anthony J. Di Pasqua

16. The blank liposomes should have no significant effect on cell

growth, and we have obtained percent survivals of
92.6  3.7%, 90.7  9.1%, 85.5  19.9%, and 96.0  14.2%
for A549, H596, WI-38 and BEAS-2B cell lines, respectively.
In the cytotoxicity study of A549, we have obtained a percent
cell survival for 5 μM CDDP alone of 55.9  3.4%, while with
only 15 μM PEITC the percent cell survival was 79.2  3.8%.
When treated with a combination of 5 μM free CDDP and
15 μM free PEITC (CDDP + PEITC), the A549 cells had a
percent survival of 46.2  2.7%. The cytotoxicity associated
with the combination of CDDP and PEITC should be signifi-
cantly greater than that associated with CDDP ( p ¼ 1.2  105)
or PEITC ( p ¼ 1.3  108) alone. It is expected that lipo-
somes containing 5 μM CDDP or 15 μM PEITC show greater
toxicities toward A549 cell than the free drugs. In our hands,
the percent cell survival after treatment with liposomes loaded
with CDDP (Lipo-CDDP) has been 43.4  4.0%, and for
liposomes with PEITC (Lipo-PEITC), the percent cell survival
has been 64.6  4.2%. The cytotoxicity of Lipo-CDDP and
Lipo-PEITC is expected to be significantly greater than that of
free CDDP ( p ¼ 2.1  105) or PEITC ( p ¼ 5.9  106).
When treated with liposomes containing 5 μM of CDDP and
15 μM of PEITC (Lipo-PEITC-CDDP), we have observed a
percent survival of 33.3  2.9%, which is significantly greater
than that of free CDDP + free PEITC ( p ¼ 3.3  107), Lipo-
CDDP ( p ¼ 1.3  104) and Lipo-PEITC ( p ¼ 3.3  108).
We use Microsoft Excel t-test function to calculate all p values.
In our hands, the viability of H596 cells after treatment
was similar to that of A549 cells. The percent survival of free
15 μM PEITC was 84.9  8.9%; the percent survival of free
5 μM CDDP was 74.6  9.2%. Cells treated with 5 μM of
CDDP and 15 μM of PEITC together had a percent survival of
55.0  9.5%, which is significantly lower than that of free
CDDP ( p ¼ 2.8  104) or free PEITC ( p ¼ 3.4  105).
The percent survival of Lipo-CDDP treatment group (5 μM,
37.5  8.9%) was significantly lower than that of the free
CDDP group (5 μM, 74.6  9.2%) with p ¼ 1.7  106,
while cell percent survival of the Lipo-PEITC treatment
group (15 μM, 69.8  9.8%) was also significantly lower than
free PEITC (15 μM, 84.9  8.9%) with p ¼ 1.2  103. Like
A549 cells, the lowest percent survival of H596 cells
(28.3  6.3%) occurred when treated by 5 μM CDDP and
15 μM of PEITC loaded in liposomes (Lipo-PEITC-CDDP),
which was significantly lower than that of free CDDP + free
PEITC ( p ¼ 4.9  105), Lipo-CDDP ( p ¼ 1.9  102) and
Lipo-PEITC ( p ¼ 1.2  106).
 Phenethyl Isothiocyanate and Cisplatin Liposome Formulation 253

The significant difference between the percent survival of

CDDP + PEITC treatment groups and free CDDP treatment
groups in both A549 and H596 cells confirms the reported
sensitization role of PEITC [2]. Lipo-PEITC, Lipo-CDDP,
and Lipo-PEITC-CDDP groups in the two lung cancer lines
showed significantly higher cytotoxicity effects than free
PEITC, CDDP, and CDDP + PEITC groups, respectively,
which indicates that liposomes can be used as an effective
drug delivery vehicle. Loaded with CDDP and PEITC, Lipo-
PEITC-CDDP has the advantages of enhanced CDDP efficacy
and an effective liposomal drug delivery and is expected to
show the highest cytotoxicity against the two NSCLC cell
lines. All cytotoxicity results have been previously
summarized [4].
Because of our 3:1 PEITC:CDDP ratio, we are able to use
less cisplatin in the Lipo-PEITC-CDDP against NSCLC cells
than in our previous formulation, which was 2:1 PEITC:
CDDP [3]. We were able to achieve similar toxicity profiles
using less CDDP and a higher concentration of PEITC. Cis-
platin is a known nephrotoxic agent, so reducing its concentra-
tion to get a similar toxicity profile in NSCLC cells is
advantageous. For the two normal lung cell lines, while the
Lipo-PEITC-CDDP caused the lowest survival percentages,
59.0  15.7% and 71.5  11.0% for WI-38 and BEAS-2B,
respectively, the cytotoxic effect of Lipo-PEITC-CDDP was
much greater in NSCLC cells. Therefore, the PEITC and
CDDP combined liposomal therapy has a high therapeutic
index.

References
1. Stathopoulos GP, Antoniou D, Dimitroulis J liposomal nanoparticle for treatment of
et al (2011) Comparison of liposomal cisplatin non-small cell lung cancer. Molecules
versus cisplatin in non-squamous cell non-small- 24:801–813
cell lung cancer. Cancer Chemother Pharmacol 5. Al-Jamal WT, Kostarelos K (2011) Liposomes:
68(4):945–950 from a clinically established drug delivery system
2. Di Pasqua AJ, Hong C, Wu MY et al (2010) to a nanoparticle platform for theranostic nano-
Sensitization of non-small cell lung cancer cells medicine. Acc Chem Res 44(10):1094–1104
to cisplatin by naturally occurring isothiocya- 6. Anderson M, Omri A (2004) The effect of dif-
nates. Chem Res Toxicol 23(8):1307–1309 ferent lipid components on the in vitro stability
3. Yang YT, Shi Y, Jay M et al (2014) Enhanced and release kinetics of liposome formulations.
toxicity of cisplatin with chemosensitizer phe- Drug Deliv 11(1):33–39
nethyl isothiocyanate toward non-small cell 7. Zhang Y (2012) The 1,2-benzenedithiole-based
lung cancer cells when delivered in liposomal cyclocondensation assay: a valuable tool for the
nanoparticles. Chem Res Toxicol 27 measurement of chemopreventive isothiocya-
(6):946–948 nates. Crit Rev Food Sci Nutr 52(6):525–532
4. Sun M, Shi Y, Dang UJ et al (2019) Phenethyl
isothiocyanate and cisplatin co-encapsulated in a
 INDEX

A H520 lung cancer cell line..................................61, 64

H596 cells .....................................150, 242, 249, 252
ALK human normal lung cells ........................................ 242
overexpression ......................................................... 157 Kras-mutant lung adenocarcinoma cell MDA-F471
rearrangements ........................................... 2, 157–163
line................................................................ 193
tyrosine kinase receptors ......................................... 157 Lewis lung carcinoma cells ..................................... 200
Antibodies TC1 cells.................................................................. 200
antibody concentration............................................. 19
tobacco carcinogen-derived.................................... 175
antibody incubation time ........ 11, 32, 60, 73, 80, 89 WI-38 ............................................242, 249, 252, 253
anti PD-L1 E1L3N clone............................ 38, 51, 56 Chemotherapy............................................. 128, 199, 200
anti PD-L1 E1J2J clone .............................. 38, 51, 56
Cisplatin............................. 200, 201, 206, 211, 241–253
anti PD-L1 EPR1161-2 clone ...........................38, 51 Clinical Diagnostics ...................................................... 146
anti PD-L1, rabbit polyclonal .............. 19, 72, 80, 81 Clinically Informative Tumor Biomarkers ........................v
anti PD-L1 7G11 clone......................................38, 51
Clinical pathology .....................................................24, 36
anti PD-L1 SP142 clone ............................. 38, 51, 56 Cultured cells ........................................60, 159, 220, 238
anti PD-L1 28-8 clone ......................... 36, 38, 51, 56 Cyclocondensation assay...................................... 242, 245
anti PD-L1 22C3 clone ......................................44, 56 Cytological samples
anti-p40 5-17 clone ............................................15, 19
bronchial brush of the nodule................................ 157
anti-Rb-phospho-serine 249 ....................... 76, 80, 86 bronchoalveolar lavage............................................ 157
phospho-specific antibodies................................ 75–89 endobronchial ultrasound-guided transbronchial
Antigen Immunoreactivity ....................... 76, 86, 87, 159
needle aspirates or EBUS-TBNA ............... 157
Antigens............................ 2, 6, 9–11, 13–21, 23, 27, 30, pericardial effusion .................................................. 157
32, 35, 36, 42, 50, 60, 61, 63, 70–72, 162, pleural effusion ........................................................ 162
181, 200
TBNA ...................................................................... 157
Apoptosis Cytology ................................................14, 20, 21, 36, 92
annexin V-FITC propidium iodide Cytotoxicity .........................................243, 249, 252, 253
detection ............................................. 213–222
phosphatidylserine.......................................... 214, 215 D
B Diagnostic assays ............................................................. 37
Dihydroartemisinin .............................................. 216, 220
Biomarkers.................................... 24, 30, 59–61, 76, 146 DNA
Bovine intestinal phosphatase (BIP) ................ 76–79, 82, adduct formation ........................................... 225–238
83, 86, 87
aldehyde adducts ..................................................... 225
BRAF isolation from tumor tissue sections ...................... 111
codon 600 mutations.............................................. 110 sequencing .............................. 92, 110, 111, 123–125
wild type ................................................ 130, 140, 141
C
Dynamic light scattering (DLS) .......................... 242, 250
Cancer Diagnostics ................................................ 36, 157
Cancer Prognosis ................................................... v, vi, 76 E
Cancer Stem Cells EGFR
gene expression analysis .......................................... 193 exon 19 deletion ................................... 134, 140, 144
self-renewal .............................................................. 187
exon 20 mutations ......................................... 109, 128
Cell Lines exon 20 p.T790M mutation .................................. 128
A549 cells ............................. 150, 214, 242, 249, 252 exon 21 mutations ......................................... 109, 127
BEAS-2B cells ....................................... 242, 252, 253
p.C797S mutation ................................ 128, 131, 134

Pedro G. Santiago-Cardona (ed.), Lung Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2279,
https://doi.org/10.1007/978-1-0716-1278-1, © Springer Science+Business Media, LLC, part of Springer Nature 2021

255
 LUNG CANCER: METHODS AND PROTOCOLS
256 Index
EGFR? (cont.) In vivo imaging .................................................... 199–211
p.G719A mutation.................................................. 129
p.G719C mutation ................................................. 129 K
p.G719S mutation .................................................. 129 Kinase activity .................................................................. 75
p.L858R mutation ................................ 128, 129, 131
KRAS
p.L861Q mutation......................................... 129, 131 codons 12 and 13 mutations.................................. 109
Electrophoretic mobility shift ........................................ 76
L
F
Liposome
FGFR families.................................................................. 92 co-encapsulation............................................. 241–253
Flow cytometric analysis ............................................... 214
liposomal nanoparticles ................................. 241, 242
Formalin-fixed, paraffin-embedded tissues (FFPE) Liquid biopsies ..................................................... 128, 129
FFPE-derived RNA................................................... 93 Lung cancer
Fusion gene
adenocarcinomas ..................... 9, 30, 31, 60, 91, 110,
detection ...............................................92, 94–96, 100 166, 175
status ...........................................................92, 96, 105 large cell carcinoma.......................................... 91, 166
large cell neuroendocrine carcinoma ....................... 91
H
squamous cell carcinoma ................................. 91, 166
HER2.........................................................................36, 92 sub-classification........................................................ 60
H-Score............................................................................ 36 tissue sections ........................................... 14, 109–125
Human Biopsy Samples .....................................................v Lung Markers
Napsin-A............................................. v, 2, 23–32, 180
I PD-L1 ........................... v, 35–45, 50, 52, 55, 56, 199
Immune Cell Expression ................................................ 35 p39 .......................................................................60, 61
Immune Checkpoint Proteins p40 ................................................................... v, 13–21
retinoblastoma protein
immune checkpoint blockade........................ 199, 200
Immunoblots................................................49, 50, 75–89 hyper-phosphorylation..................................75, 76
Immunocytochemistry (ICC) ................ 20, 21, 157–162 phosphorylated.................v, vi, 75–78, 80, 82, 83,
Immunohistochemistry 86, 87, 89
unphosphorylated .........................................76, 86
antigen retrieval.............................................. 6, 28, 63
automation .............................................. 1–11, 23–32, TTF-1 ........................................................v, 1–11, 180
35–45
M
cytoplasmic staining .................................................. 36
membrane staining.................................................... 44 MET
nuclear staining ......................................................... 18 alternate splicing variants.......................................... 92
protocol optimization ..................................................v cell proliferation ...................................................... 145
Immunohistochemistry reagents cell survival .............................................................. 145
eosin ............................................................18, 67, 180 epithelial-to-mesenchymal transition ..................... 145
hematoxylin ......................................... 18, 25, 67, 180 exon 14 skipping ...................................... 93, 145–154
horseradish peroxidase .............................................. 63 gene amplification ................................................... 145
mounting medium .................................................. 177 invasion .................................................................... 145
primary antibody ..............3, 6, 13, 23–25, 36, 63, 72 morphogenesis ........................................................ 145
secondary antibody ........................... 3, 23–25, 63, 72 mutations.......................................................... 92, 146
serum ......................................................................... 80 oncogenesis ............................................................. 145
10% neutral-buffered formalin ........... 5, 9, 14, 26, 65 receptor tyrosine kinase .......................................... 145
3-3´diaminobenzidine tetrahydrochloride (DAB) ... 3, tissue remodeling .................................................... 145
7, 14, 15, 17, 25, 29, 38, 64, 71–73, Metastasis........................................... v, 61, 176, 184, 185
159, 160 Molecular Cancer Research .............................................vii
Immunosuppressive tumor microenvironment............. 36 Molecular weight .......................... 51, 55, 56, 76, 78, 86,
Immunotherapy .............................................50, 166, 199 88, 143, 244
Inductively coupled plasma-mass spectrometry Mutation
(ICP-MS) ...........................242, 244, 247, 249 activating mutations................................................ 127
 LUNG CANCER: METHODS AND PROTOCOLS
Index 257
detection ...................... 127, 128, 130, 133, 140, 143 tyrosine kinase receptors......................................... 157
driver mutation analysis ................................. 109–125
gene rearrangement .................................................... 2 S
Scanning electron microscopy (SEM) ............... 207, 208,
N
242, 245
N .................................................................................... 128 Screening .............................................................. 146, 158
NanoString Gene Expression Platform Smoke-induced Carcinogenesis
multiplexed platform ................................................ 93 chemical carcinogenesis .......................................... 175
target sequence.......................................................... 93 diethylnitrosamine.......................................... 177, 178
nCounter Elements chemistry.................. 93, 96, 99, 105 tobacco carcinogens ....................................... 175, 177
Non-small Cell Lung Carcinoma (NSCLC) tobacco smoke.................................................... vi, 175
genetic alterations .................................... 91–106, 127 urethane .......................................................... 177, 179
Sphere-forming Assay
O Spheroid blocks .........................................................64, 66
Oncogene addiction........................................................ 92
T
Oncogenic signaling ....................................................... 36
Orthotopic Lung Cancer Model Targeted therapy
detection by chemiluminescence................. 52, 54, 86 crizotinib.................................................................... 92
in syngeneic immunocompetent mice ................... 200 resistance.................................................................. 109
tyrosine kinase inhibitors ................................. 92, 109
P afatinib ............................................................... 128
PCR erlotinib ............................................................. 128
gefitinib.............................................................. 128
allele-specific
COBAS® assay................................................... 110 osimertinib ........................................................ 128
annealing...................... 110, 113–115, 120, 125, 149 Three-dimensional Lung Cancer Cellular
Spheroid ...................................................59–73
denaturation ................................................... 120, 149
extension......................................................... 120, 149 Tissue-like architecture ................................................... 60
multiplexing............................................................. 129 Transcriptome
reaction mix sequencing analysis......................................... 187–198
Tumor ...................... 2, 4, 5, 7, 8, 18, 19, 21, 23–32, 36,
buffers ...............................................110, 111, 151
deoxyribonucleotides ............................... 110, 111 37, 39–41, 44, 45, 59–62, 66, 69, 76, 91, 92,
DNA polymerase .....................110, 111, 120, 151 94, 104, 111, 117–119, 124, 128–130,
167–171, 175, 176, 179, 180, 182, 184, 187,
forward and reverse primers .....................113–115
templates........................ 110, 120, 131, 133, 134, 192, 200, 205–211, 241
136, 140, 142, 151 Tumor microarrays (TMAs) .....................................60, 61
Tumor microenvironment
six-color digital PCR...................................... 127–144
Personalized therapies................................................... 166 heterogeneity............................................................. 61
Phenethyl isothiocyanate ..................................... 241–253 multi-clonal ............................................................... 61
Phosphate groups......................................................76, 86 Tumor proportion score (TPS)...................................... 37
Precision medicine ....................................................1, 166 Tumor suppressors .......................................................... 76
Proto-oncogenes ............................................................. 92
W
R Western blot
Resections ........................................................... 14, 18, 60 fluorescent label......................................................... 49
gel electrophoresis..........................50, 53, 79, 81, 83,
RET
rearrangements ................................................. 92, 110 84, 149–150
RNA nitrocellulose membrane ............................. 53, 84–85
nylon membrane .............................................. 49, 203
isolation from formalin-fixed, paraffin-embedded
section ...........................................92, 131, 147 primary antibody .................................................49, 89
isolation from tissues ..................................... 147–149 PVDF membrane ............................................. 49, 229
ROS1 secondary antibody .............................................49, 54
target protein.................................3, 9, 24, 42, 49, 76
overexpression ......................................................... 157
rearrangements ........................................................ 110 transfer ....................................................................... 51
 LUNG CANCER: METHODS AND PROTOCOLS
258 Index
X peripheral blood mononuclear cell
engraftment ........................................ 167–168
Xenografts subcutaneous implantation............................ 168–171
humanized models .................................................. 166
patient-derived ............................................... 165–172