RTGOperations Manual
RTGOperations Manual
Release 3.9
1 Overview 1
1.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
1.2 RTG software description . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
1.3 Installation and deployment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
1.3.1 Quick start instructions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
1.3.2 License Management . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
1.4 Technical assistance and support . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
i
2.5.17 bndeval . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
2.5.18 pedfilter . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54
2.5.19 pedstats . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55
2.5.20 rocplot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57
2.5.21 version . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61
2.5.22 license . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62
2.5.23 help . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62
4 Appendix 69
4.1 RTG reference file format . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69
4.2 Pedigree PED input file format . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72
4.3 RTG commands using indexed input files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73
4.4 RTG JavaScript filtering API . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73
4.4.1 VCF record field access . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73
4.4.2 VCF header modification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74
4.4.3 Additional information and functions . . . . . . . . . . . . . . . . . . . . . . . . . . . 74
4.5 Distribution Contents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
4.6 README.txt . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
4.7 Notice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
ii
CHAPTER
ONE
OVERVIEW
This chapter introduces the features, operational options, and installation requirements of the data analysis soft-
ware from Real Time Genomics.
1.1 Introduction
RTG software enables the development of fast, efficient software pipelines for deep genomic analysis. RTG is built
on innovative search technologies and new algorithms designed for processing high volumes of high-throughput
sequencing data from different sequencing technology platforms. The RTG sequence search and alignment func-
tions enable read mapping and protein searches with a unique combination of sensitivity and speed.
The RTG Tools platform provides a subset of the functionality available from the full suite of functions for ana-
lyzing and manipulating variant call results. These utilities can be used to perform a variety of tasks such as:
• Accuracy Evaluation – Compare called variants to a set of known variants to find specificity and sensitivity,
check mendelian consistency for the variants from a family, finding basic variant statistics for a set of calls.
• Result Filtering – Find a subset of variants that match a given set of filtering criteria, extracting only the
variant information required for a specific task.
• Variant Set Manipulation – Merging multiple sets of variant results together, adding additional annotation
information to existing variants.
RTG software is delivered as a single executable with multiple commands executed through a command line
interface (CLI). Commands are delivered in product packages, and for commercial users each command can be
independently enabled through a license key.
Usage:
See also:
For detailed information about RTG command syntax and usage of individual commands, refer to RTG Command
Reference.
RTG is a self-contained tool that sets minimal expectations on the environment in which it is placed. It comes with
the application components it needs to execute completely, yet performance can be enhanced with some simple
modifications to the deployment configuration. This section provides guidelines for installing and creating an
optimal configuration, starting from a typical recommended system.
1
RTG Tools Operations Manual, Release 3.9
RTG software pipeline runs in a wide range of computing environments from dual-core processor laptops to
compute clusters with racks of dual processor quad core server nodes. However, internal human genome analysis
benchmarks suggest the use of six server nodes of the configuration shown in below.
Table : Recommended system requirements
Processor Intel Core i7-2600
Memory 48 GB RAM DDR3
Disk 5 TB, 7200 RPM (prefer SAS disk)
RTG Software can be run as a Java JAR file, but platform specific wrapper scripts are supplied to provide improved
pipeline ergonomics. Instructions for a quick start installation are provided here.
For further information about setting up per-machine configuration files, please see the README.txt contained
in the distribution zip file (a copy is also included in this manual’s appendix).
These instructions are intended for an individual to install and operate the RTG software without the need to
establish root / administrator privileges.
RTG software is delivered in a compressed zip file, such as: rtg-core-3.3.zip. Unzip this file to begin
installation.
Linux and Windows distributions include a Java Virtual Machine (JVM) version 1.8 that has undergone quality
assurance testing. RTG may be used on other operating systems for which a JVM version 1.8 or higher is available,
such as MacOS X or Solaris, by using the ‘no-jre’ distribution.
RTG for Java is delivered as a Java application accessed via executable wrapper script (rtg on UNIX systems,
rtg.bat on Windows) that allows a user to customize initial memory allocation and other configuration options.
It is recommended that these wrapper scripts be used rather than directly executing the Java JAR.
Here are platform-specific instructions for RTG deployment.
Linux/MacOS X:
• Unzip the RTG distribution to the desired location.
• If your installation requires a license file (rtg-license.txt), copy the license file provided by Real
Time Genomics into the RTG distribution directory.
• In a terminal, cd to the installation directory and test for success by entering ./rtg version
• On MacOS X, depending on your operating system version and configuration regarding unsigned applica-
tions, you may encounter the error message:
If this occurs, you must clear the OS X quarantine attribute with the command:
• The first time rtg is executed you will be prompted with some questions to customize your installation.
Follow the prompts.
• Enter ./rtg help for a list of rtg commands. Help for any individual command is available using the
--help flag, e.g.: ./rtg format --help
• By default, RTG software scripts establish a memory space of 90% of the available RAM - this is automati-
cally calculated. One may override this limit in the rtg.cfg settings file or on a per-run basis by supplying
RTG_MEM as an environment variable or as the first program argument, e.g.: ./rtg RTG_MEM=48g map
• [OPTIONAL] If you will be running RTG on multiple machines and would like to customize settings on
a per-machine basis, copy rtg.cfg to /etc/rtg.cfg, editing per-machine settings appropriately (re-
quires root privileges). An alternative that does not require root privileges is to copy rtg.cfg to rtg.
2 Chapter 1. Overview
RTG Tools Operations Manual, Release 3.9
HOSTNAME.cfg, editing per-machine settings appropriately, where HOSTNAME is the short host name
output by the command hostname -s
Windows:
• Unzip the RTG distribution to the desired location.
• If your installation requires a license, copy the license file provided by Real Time Genomics
(rtg-license.txt) into the RTG distribution directory.
• Test for success by entering rtg version at the command line. The first time RTG is executed you will
be prompted with some questions to customize your installation. Follow the prompts.
• Enter rtg help for a list of rtg commands. Help for any individual command is available using the
--help flag, e.g.: ./rtg format --help
• By default, RTG software scripts establish a memory space of 90% of the available RAM - this is automati-
cally calculated. One may override this limit by setting the RTG_MEM variable in the rtg.bat script or as
an environment variable.
Commercial distributions of RTG products require the presence of a valid license key file for operation.
The license key file must be located in the same directory as the RTG executable. The license enables the execution
of a particular command set for the purchased product(s) and features.
A license key allows flexible use of the RTG package on any node or CPU core.
To view the current license features at the command prompt, enter:
$ rtg license
See also:
For more data center deployment and instructions for editing scripts, see Administration & Capacity Planning.
For assistance with any technical or conceptual issue that may arise during use of the RTG product, contact Real
Time Genomics Technical Support via email at [email protected]
In addition, a discussion group is available at: https://groups.google.com/a/realtimegenomics.com/forum/#!forum/
rtg-users
A low-traffic announcements-only group is available at: https://groups.google.com/a/realtimegenomics.com/
forum/#!forum/rtg-announce
4 Chapter 1. Overview
CHAPTER
TWO
This chapter describes RTG commands with a generic description of parameter options and usage. This section
also includes expected operation and output results.
RTG is installed as a single executable in any system subdirectory where permissions authorize a particu-
lar community of users to run the application. RTG commands are executed through the RTG command-
line interface (CLI). Each command has its own set of parameters and options described in this section.
The availability of each command may be determined by the RTG license that has been installed. Contact
[email protected] to discuss changing the set of commands that are enabled by your li-
cense.
Results are organized in results directories defined by command parameters and settings. The command line shell
environment should include a set of familiar text post-processing tools, such as grep, awk, or perl. Otherwise,
no additional applications such as databases or directory services are required.
Usage:
To run an RTG command at the command prompt (either DOS window or Unix terminal), type the product name
followed by the command and all required and optional parameters. For example:
Typically results are written to output files specified with the -o option. There is no default filename or filename
extension added to commands requiring specification of an output directory or format.
Many times, unfiltered output files are very large; the built-in compression option generates block compressed
output files with the .gz extension automatically unless the parameter -Z or --no-gzip is issued with the
command.
Many command parameters require user-supplied information of various types, as shown in the following:
Type Description
DIR, FILE File or directory name(s)
SDF Sequence data that has been formatted to SDF
INT Integer value
FLOAT Floating point decimal value
STRING A sequence of characters for comments, filenames, or labels
REGION A genomic region specification (see below)
Genomic region parameters take one of the following forms:
5
RTG Tools Operations Manual, Release 3.9
Converts the contents of sequence data files (FASTA/FASTQ/SAM/BAM) into the RTG
Sequence Data File (SDF) format.
File Input/Output
-f, --format=FORMAT format of input. Allowed values are [fasta,
fastq, sam-se, sam-pe, cg-fastq, cg-sam]
(Default is fasta)
-I, --input-list-file=FILE file containing a list of input read files (1
per line)
-l, --left=FILE left input file for FASTA/FASTQ paired end
data
-o, --output=SDF name of output SDF
-p, --protein input is protein. If this option is not
specified, then the input is assumed to
consist of nucleotides
-q, --quality-format=FORMAT format of quality data for fastq files (use
sanger for Illumina 1.8+). Allowed values are
[sanger, solexa, illumina]
-r, --right=FILE right input file for FASTA/FASTQ paired end
data
FILE+ input sequence files. May be specified 0 or
more times
Filtering
--duster treat lower case residues as unknowns
--exclude=STRING exclude input sequences based on their name.
If the input sequence contains the specified
string then that sequence is excluded from the
SDF. May be specified 0 or more times
--select-read-group=STRING when formatting from SAM/BAM input, only
include reads with this read group ID
--trim-threshold=INT trim read ends to maximise base quality above
the given threshold
Utility
--allow-duplicate-names disable checking for duplicate sequence names
-h, --help print help on command-line flag usage
--no-names do not include name data in the SDF output
--no-quality do not include quality data in the SDF output
--sam-rg=STRING|FILE file containing a single valid read group SAM
header line or a string in the form
"@RG\tID:READGROUP1\tSM:BACT_SAMPLE\tPL:ILLUMINA"
Required parameters are indicated in the usage display; optional parameters are listed immediately below the
Commonly used command options provide an abbreviated single-character version of a full command parameter,
indicated with only a single dash, (Thus --output is the same as specifying the command option with the
abbreviated character -o):
A set of utility commands are provided through the CLI: version, license, and help. Start with these
commands to familiarize yourself with the software.
The rtg version command invokes the RTG software and triggers the launch of RTG product commands,
options, and utilities:
$ rtg version
It will display the version of the RTG software installed, RAM requirements, and license expiration, for example:
$rtg version
Product: RTG Core 3.5
Core Version: 6236f4e (2014-10-31)
RAM: 40.0GB of 47.0GB RAM can be used by rtg (84%)
License: Expires on 2015-09-30
License location: /home/rtgcustomer/rtg/rtg-license.txt
Contact: [email protected]
Citation:
John G. Cleary, Ross Braithwaite, Kurt Gaastra, Brian S. Hilbush, Stuart
Inglis, Sean A. Irvine, Alan Jackson, Richard Littin, Sahar
Nohzadeh-Malakshah, Mehul Rathod, David Ware, Len Trigg, and Francisco
M. De La Vega. "Joint Variant and De Novo Mutation Identification on
Pedigrees from High-Throughput Sequencing Data." Journal of
Computational Biology. June 2014, 21(6): 405-419.
doi:10.1089/cmb.2014.0029.
(c) Real Time Genomics Inc, 2014
To see what commands you are licensed to use, type rtg license:
$rtg license
License: Expires on 2015-03-30
Licensed to: John Doe
License location: /home/rtgcustomer/rtg/rtg-license.txt
Data formatting:
format Licensed GA
sdf2fasta Licensed GA
sdf2fastq Licensed GA
Utility:
bgzip Licensed GA
index Licensed GA
extract Licensed GA
sdfstats Licensed GA
sdfsubset Licensed GA
sdfsubseq Licensed GA
mendelian Licensed GA
vcfstats Licensed GA
vcfmerge Licensed GA
vcffilter Licensed GA
vcfannotate Licensed GA
vcfsubset Licensed GA
vcfeval Licensed GA
pedfilter Licensed GA
pedstats Licensed GA
rocplot Licensed GA
version Licensed GA
license Licensed GA
help Licensed GA
To display all commands and usage parameters available to use with your license, type rtg help:
$ rtg help
Usage: rtg COMMAND [OPTION]...
rtg RTG_MEM=16G COMMAND [OPTION]... (e.g. to set maximum memory use to 16
˓→GB)
Data formatting:
format convert a FASTA file to SDF
cg2sdf convert Complete Genomics reads to SDF
sdf2fasta convert SDF to FASTA
sdf2fastq convert SDF to FASTQ
sdf2sam convert SDF to SAM/BAM
Read mapping:
map read mapping
mapf read mapping for filtering purposes
cgmap read mapping for Complete Genomics data
Protein search:
mapx translated protein search
Assembly:
assemble assemble reads into long sequences
addpacbio add Pacific Biosciences reads to an assembly
Variant detection:
calibrate create calibration data from SAM/BAM files
svprep prepare SAM/BAM files for sv analysis
sv find structural variants
discord detect structural variant breakends using discordant
˓→reads
The help command will only list the commands for which you have a license to use.
To display help and syntax information for a specific command from the command line, type the command and
then the –help option, as in:
Note: The following commands are synonymous: rtg help format and rtg format --help
See also:
Refer to Installation and deployment for information about installing the RTG product executable.
2.3.1 format
Synopsis:
The format command converts the contents of sequence data files (FASTA/FASTQ/SAM/BAM) into the RTG
Sequence Data File (SDF) format. This step ensures efficient processing of very large data sets, by organizing the
data into multiple binary files within a named directory. The same SDF format is used for storing sequence data,
whether it be genomic reference, sequencing reads, protein sequences, etc.
Syntax:
Format one or more files specified from command line into a single SDF:
Format one or more files specified in a text file into a single SDF:
Examples:
For FASTA (.fa) genome reference data:
Parameters:
File Input/Output
-f --format=FORMAT The format of the input file(s). Allowed values are [fasta, fastq,
fastq-interleaved, sam-se, sam-pe] (Default is fasta).
-I --input-list-file=FILE Specifies a file containing a list of sequence data files (one per
line) to be converted into an SDF.
-l --left=FILE The left input file for FASTA/FASTQ paired end data.
-o --output=SDF The name of the output SDF.
-p --protein Set if the input consists of protein. If this option is not specified,
then the input is assumed to consist of nucleotides.
-q --quality-format=FORMAT The format of the quality data for fastq format files. (Use sanger
for Illumina1.8+). Allowed values are [sanger, solexa, illumina].
-r --right=FILE The right input file for FASTA/FASTQ paired end data.
FILE+ Specifies a sequence data file to be converted into an SDF. May
be specified 0 or more times.
Filtering
--duster Treat lower case residues as unknowns.
--exclude=STRING Exclude individual input sequences based on their name. If the
input sequence name contains the specified string then that
sequence is excluded from the SDF. May be specified 0 or more
times.
--select-read-group=STRING Set to only include only reads with this read group ID when
formatting from SAM/BAM files.
--trim-threshold=INT Set to trim the read ends to maximise the base quality above the
given threshold.
Utility
--allow-duplicate-names Set to disable duplicate name detection.
-h --help Prints help on command-line flag usage.
--no-names Do not include sequence names in the resulting SDF.
--no-quality Do not include sequence quality data in the resulting SDF.
--sam-rg=STRING|FILE Specifies a file containing a single valid read group SAM header
line or a string in the form
@RG\tID:RG1\tSM:G1_SAMP\tPL:ILLUMINA.
Usage:
Formatting takes one or more input data files and creates a single SDF. Specify the type of file to be converted,
or allow default to FASTA format. To aggregate multiple input data files, such as when formatting a reference
genome consisting of multiple chromosomes, list all files on the command line or use the --input-list-file
flag to specify a file containing the list of files to process.
For input FASTA and FASTQ files which are compressed, they must have a filename extension of .gz (for gzip
compressed data) or .bz2 (for bzip2 compressed data).
When formatting human reference genome data, it is recommended that the resulting SDF be augmented with
chromosome reference metadata, in order to enable automatic sex-aware features during mapping and variant
calling. The format command will automatically recognize several common human reference genomes and
install a reference configuration file. If your reference genome is not recognized, a configuration can be manually
adapted from one of the examples provided in the RTG distribution and installed in the SDF directory. The
reference configuration is described in RTG reference file format.
When using FASTQ input files you must specify the quality format being used as one of sanger, solexa or
illumina. As of Illumina pipeline version 1.8 and higher, quality values are encoded in Sanger format and
so should be formatted using --quality-format=sanger. Output from earlier Illumina pipeline versions
should be formatted using --quality-format=illumina for Illumina pipeline versions starting with 1.3
and before 1.8, or --quality-format=solexa for Illumina pipeline versions less than 1.3.
For FASTQ files that represent paired-end read data, indicate each side respectively using the --left=FILE and
--right=FILE flags. Sometimes paired-end reads are represented in a single FASTQ file by interleaving each
side of the read. This type of input can be formatted by specifying fastq-interleaved as the format type.
The mapx command maps translated DNA sequence data against a protein reference. You must use the -p,
--protein flag to format the protein reference used by mapx.
Use the sam-se format for single end SAM/BAM input files and the sam-pe format for paired end SAM/BAM
input files. Note that if the input SAM/BAM files are sorted in coordinate order (for example if they have already
been aligned to a reference), it is recommended that they be shuffled before formatting, so that subsequent mapping
is not biased by processing reads in chromosome order. For example, a BAM file can be shuffled using samtools
collate as follows:
And this can be carried out on the fly during formatting using bash process redirection in order to reduce interme-
diate I/O, for example:
$ rtg format --format sam-pe <(samtools collate -uOn 256 reads.bam temp-prefix) ...
The SDF for a read set can contain a SAM read group which will be automatically picked up from the input
SAM/BAM files if they contain only one read group. If the input SAM/BAM files contain multiple read groups
you must select a single read group from the SAM/BAM file to format using the --select-read-group flag
or specify a custom read group with the --sam-rg flag. The --sam-rg flag can also be used to add read group
information to reads given in other input formats. The SAM read group stored in an SDF will be automatically
used during mapping the reads it contains to provide tracking information in the output BAM files.
The --trim-threshold flag can be used to trim poor quality read ends from the input reads by inspecting
base qualities from FASTQ input. If and only if the quality of the final base of the read is less than the threshold
given, a new read length is found which maximizes the overall quality of the retained bases using the following
formula.
(︃ 𝑙 )︃
∑︁
arg max 𝑥 (𝑇 − 𝑞(𝑖)) if 𝑞(𝑙) < 𝑇
𝑖=𝑥+1
Where l is the original read length, x is the new read length, T is the given threshold quality and q(n) is the quality
of the base at the position n of the read.
Note: Sequencing system read files and reference genome files often have the same extension and it may not
always be obvious which file is a read set and which is a genome. Before formatting a sequencing system file,
open it to see which type of file it is. For example:
$ less pf3.fa
In general, a read file typically begins with an @ or + character; a genome reference file typically begins with the
characters chr.
Normally when the input data contains multiple sequences with the same name the format command will fail with
an error. The --allow-duplicate-names flag will disable this check conserving memory, but if the input
data has multiple sequences with the same name you will not be warned. Having duplicate sequence names can
cause problems with other commands, especially for reference data since the output many commands identifies
sequences by their names.
See also:
sdf2fasta, sdf2fastq, sdfstats
2.3.2 sdf2fasta
Synopsis:
Convert SDF data into a FASTA file.
Syntax:
Example:
Parameters:
File Input/Output
-i --input=SDF SDF containing sequences.
-o --output=FILE Output filename (extension added if not present). Use ‘-‘ to write to standard
output.
Filtering
--end-id=INT Only output sequences with sequence id less than the given number.
(Sequence ids start at 0).
--start-id=INT Only output sequences with sequence id greater than or equal to the given
number. (Sequence ids start at 0).
-I --id-file=FILE Name of a file containing a list of sequences to extract, one per line.
--names Interpret any specified sequence as names instead of numeric sequence ids.
--taxons Interpret any specified sequence as taxon ids instead of numeric sequence ids.
This option only applies to a metagenomic reference species SDF.
STRING+ Specify one or more explicit sequences to extract, as sequence id, or sequence
name if –names flag is set.
Utility
-h --help Prints help on command-line flag usage.
--interleave Interleave paired data into a single output file. Default is to split to
separate output files.
-l --line-length=INT Set the maximum number of nucleotides or amino acids to print on a line
of FASTA output. Should be nonnegative, with a value of 0 indicating that
the line length is not capped. (Default is 0).
-Z --no-gzip Set this flag to create the FASTA output file without compression. By
default the output file is compressed with blocked gzip.
Usage:
Use the sdf2fasta command to convert SDF data into FASTA format. By default, sdf2fasta creates a
separate line of FASTA output for each sequence. These lines will be as long as the sequences themselves. To
make them more readable, use the -l, --line-length flag and define a reasonable record length like 75.
By default all sequences will be extracted, but flags may be specified to extract reads within a range, or explicitly
specified reads (either by numeric sequence id or by sequence name if --names is set). Additionally, when the
input SDF is a metagenomic species reference SDF, the --taxons option, any supplied id is interpreted as a
taxon id and all sequences assigned directly to that taxon id will be output. This provides a convenient way to
extract all sequence data corresponding to a single (or multiple) species from a metagenomic species reference
SDF.
Sequence ids are numbered starting at 0, the --start-id flag is an inclusive lower bound on id and the
--end-id flag is an exclusive upper bound. For example if you have an SDF with five sequences (ids: 0, 1,
2, 3, 4) the following command:
2.3.3 sdf2fastq
Synopsis:
Convert SDF data into a FASTQ file.
Syntax:
Example:
Parameters:
File Input/Output
-i --input=SDF Specifies the SDF data to be converted.
-o --output=FILE Specifies the file name used to write the resulting FASTQ output.
Filtering
--end-id=INT Only output sequences with sequence id less than the given number. (Sequence
ids start at 0).
--start-id=INT Only output sequences with sequence id greater than or equal to the given
number. (Sequence ids start at 0).
-I --id-file=FILE Name of a file containing a list of sequences to extract, one per line.
--names Interpret any specified sequence as names instead of numeric sequence ids.
STRING+ Specify one or more explicit sequences to extract, as sequence id, or sequence
name if –names flag is set.
Utility
-h --help Prints help on command-line flag usage.
-q --default-qualty=INT Set the default quality to use if the SDF does not contain sequence
quality data (0-63).
--interleave Interleave paired data into a single output file. Default is to split to
separate output files.
-l --line-length=INT Set the maximum number of nucleotides or amino acids to print on a
line of FASTQ output. Should be nonnegative, with a value of 0
indicating that the line length is not capped. (Default is 0).
-Z --no-gzip Set this flag to create the FASTQ output file without compression. By
default the output file is compressed with blocked gzip.
Usage:
Use the sdf2fastq command to convert SDF data into FASTQ format. If no quality data is available in the
SDF, use the -q, --default-quality flag to set a quality score for the FASTQ output. The quality encoding
used during output is sanger quality encoding. By default, sdf2fastq creates a separate line of FASTQ output
for each sequence. As with sdf2fasta, there is an option to use the -l, --line-length flag to restrict the
line lengths to improve readability of long sequences.
By default all sequences will be extracted, but flags may be specified to extract reads within a range, or explicitly
specified reads (either by numeric sequence id or by sequence name if --names is set).
It may be preferable to extract data to unaligned SAM/BAM format using sdf2sam, as this preserves read-group
information stored in the SDF and may also be more convenient when dealing with paired-end data.
The --start-id and --end-id flags behave as in sdf2fasta.
See also:
format, sdf2fasta, sdf2sam, sdfstats
2.3.4 sdf2sam
Synopsis:
Convert SDF read data into unaligned SAM or BAM format file.
Syntax:
Example:
Parameters:
File Input/Output
-i --input=SDF Specifies the SDF data to be converted.
-o --output=FILE Specifies the file name used to write the resulting SAM/BAM to. The output
format is automatically determined based on the filename specified. If ‘-‘ is
given, the data is written as uncompressed SAM to standard output.
Filtering
--end-id=INT Only output sequences with sequence id less than the given number. (Sequence
ids start at 0).
--start-id=INT Only output sequences with sequence id greater than or equal to the given
number. (Sequence ids start at 0).
-I --id-file=FILE Name of a file containing a list of sequences to extract, one per line.
--names Interpret any specified sequence as names instead of numeric sequence ids.
STRING+ Specify one or more explicit sequences to extract, as sequence id, or sequence
name if –names flag is set.
Utility
-h --help Prints help on command-line flag usage.
-Z --no-gzip Set this flag when creating SAM format output to disable compression. By default
SAM is compressed with blocked gzip, and BAM is always compressed.
Usage:
Use the sdf2sam command to convert SDF data into unaligned SAM/BAM format. By default all sequences
will be extracted, but flags may be specified to extract reads within a range, or explicitly specified reads (either by
numeric sequence id or by sequence name if --names is set). This command is a useful way to export paired-end
data to a single output file while retaining any read group information that may be stored in the SDF.
The output format is either SAM/BAM depending on the specified output file name. e.g. output.sam or
output.sam.gz will output as SAM, whereas output.bam will output as BAM. If neither SAM or BAM
format is indicated by the file name then BAM will be used and the output file name adjusted accordingly. e.g
output will become output.bam. However if standard output is selected (-) then the output will always be
in uncompressed SAM format.
The --start-id and --end-if behave as in sdf2fasta.
See also:
format, sdf2fasta, sdf2fastq, sdfstats, cg2sdf , sdfsplit
2.3.5 fastqtrim
Synopsis:
Trim reads in FASTQ files.
Syntax:
Example:
Apply hard base removal from the start of the read and quality-based trimming of terminal bases:
Parameters:
File Input/Output
-i --input=FILE Input FASTQ file, Use ‘-‘ to read from standard input.
-o --output=FILE Output filename. Use ‘-‘ to write to standard output.
-q --quality-format=FORMAT Quality data encoding method used in FASTQ input files
(Illumina 1.8+ uses sanger). Allowed values are [sanger, solexa,
illumina] (Default is sanger)
Filtering
--discard-empty-reads Discard reads that have zero length after trimming.
Should not be used with paired-end data.
-E --end-quality-threshold=INT Trim read ends to maximise base quality above the
given threshold (Default is 0)
--min-read-length=INT If a read ends up shorter than this threshold it will be
trimmed to zero length (Default is 0)
-S --start-quality-threshold=INT Trim read starts to maximise base quality above the
given threshold (Default is 0)
-e --trim-end-bases=INT Always trim the specified number of bases from read
end (Default is 0)
-s --trim-start-bases=INT Always trim the specified number of bases from read
start (Default is 0)
Utility
-h --help Print help on command-line flag usage.
-Z --no-gzip Do not gzip the output.
-r --reverse-complement If set, output in reverse complement.
--seed=INT Seed used during subsampling.
--subsample=FLOAT If set, subsample the input to retain this fraction of reads.
-T --threads=INT Number of threads (Default is the number of available cores)
Usage:
Use fastqtrim to apply custom trimming and preprocessing to raw FASTQ files prior to mapping and align-
ment. The format command contains some limited trimming options, which are applied to all input files,
however in some cases different or specific trimming operations need to be applied to the various input files. For
example, for paired-end data, different trimming may need to be applied for the left read files compared to the
right read files. In these cases, fastqtrim should be used to process the FASTQ files first.
The --end-trim-threshold flag can be used to trim poor quality bases from the ends of the input reads by
inspecting base qualities from FASTQ input. If and only if the quality of the final base of the read is less than the
threshold given, a new read length is found which maximizes the overall quality of the retained bases using the
following formula:
(︃ 𝑙 )︃
∑︁
arg max 𝑥 (𝑇 − 𝑞(𝑖)) if 𝑞(𝑙) < 𝑇
𝑖=𝑥+1
where l is the original read length, x is the new read length, T is the given threshold quality and q(n) is the quality
of the base at the position n of the read. Similarly, --start-quality-threshold can be used to apply this
quality-based thresholding to the start of reads.
Some of the trimming options may result in reads that have no bases remaining. By default, these are output
as zero-length FASTQ reads, which RTG commands are able to handle normally. It is also possible to remove
zero-length reads altogether from the output with the --discard-empty-reads option, however this should
not be used when processing FASTQ files corresponding to paired-end data, otherwise the pairs in the two files
will no longer be matched.
Similarly, when using the --subsample option to down-sample a FASTQ file for paired-end data, you should
specify an explicit randomization seed via --seed and use the same seed value for the left and right files.
Running custom filtering with fastqtrim need not mean that additional disk space is required or that formatting
be slowed down due to additional disk I/O. It is possible when using standard unix shells to perform the filtering
on the fly. The following example demonstrates how to apply different trimming options to left and right files
while formatting to SDF:
See also:
format
2.3.6 petrim
Synopsis:
Trim paired-end read FASTQ files based on read arm alignment overlap.
Syntax:
Parameters:
File Input/Output
-l --left=FILE Left input FASTQ file (AKA R1)
-o --output=FILE Output filename prefix. Use ‘-‘ to write to standard output.
-q --quality-format=FORMAT Quality data encoding method used in FASTQ input files
(Illumina 1.8+ uses sanger). Allowed values are [sanger, solexa,
illumina] (Default is sanger)
-r --right=FILE Right input FASTQ file (AKA R2)
Sensitivity Tuning
--aligner-band-width=FLOAT Aligner indel band width scaling factor, fraction of read
length allowed as an indel (Default is 0.5)
--gap-extend-penalty=INT Penalty for a gap extension during alignment (Default is 1)
--gap-open-penalty=INT Penalty for a gap open during alignment (Default is 19)
-P --min-identity=INT Minimum percent identity in overlap to trigger overlap
trimming (Default is 90)
-L --min-overlap-length=INT Minimum number of bases in overlap to trigger overlap
trimming (Default is 25)
--mismatch-penalty=INT Penalty for a mismatch during alignment (Default is 9)
--soft-clip-distance=INT Soft clip alignments if indels occur INT bp from either end
(Default is 5)
--unknowns-penalty=INT Penalty for unknown nucleotides during alignment (Default
is 5)
Filtering
--discard-empty-pairs If set, discard pairs where both reads have zero length
(after any trimming)
--discard-empty-reads If set, discard pairs where either read has zero length
(after any trimming)
--left-probe-length=INT Assume R1 starts with probes this long, and trim R2
bases that overlap into this (Default is 0)
-M --midpoint-merge If set, merge overlapping reads at midpoint of overlap
region. Result is in R1 (R2 will be empty)
-m --midpoint-trim If set, trim overlapping reads to midpoint of overlap
region.
--min-read-length=INT If a read ends up shorter than this threshold it will be
trimmed to zero length (Default is 0)
--mismatch-adjustment=STRING Method used to alter bases/qualities at mismatches
within overlap region. Allowed values are [none,
zero-phred, pick-best] (Default is none)
--right-probe-length=INT Assume R2 starts with probes this long, and trim R1
bases that overlap into this (Default is 0)
Utility
-h --help Print help on command-line flag usage.
--interleave Interleave paired data into a single output file. Default is to split to separate
output files.
-Z --no-gzip Do not gzip the output.
--seed=INT Seed used during subsampling.
--subsample=FLOAT If set, subsample the input to retain this fraction of reads.
-T --threads=INT Number of threads (Default is the number of available cores)
Usage:
Paired-end read sequencing with read lengths that are long relative to the typical library fragment size can often
result in the same bases being sequenced by both arms. This repeated sequencing of bases within the same
fragment can skew variant calling, and so it can be advantageous to remove such read overlap.
In some cases, complete read-through can occur, resulting in additional adaptor or non-genomic bases being
present at the ends of reads.
In addition, some library preparation methods rely on the ligation of synthetic probe sequence to attract target
DNA, which is subsequently sequenced. Since these probe bases do not represent genomic material, they must be
removed at some point during the analytic pipeline prior to variant calling, otherwise they could act as a reference
bias when calling variants. Removal from the primary arm where the probe is attached is typically easy enough
(e.g. via fastqtrim), however in cases of high read overlap, probe sequence can also be present in the other
read arm.
petrim aligns each read arm against it’s mate with high stringency in order to identify cases of read over-
lap. The sensitivity of read overlap detection is primarily controlled through the use of --min-identity and
--min-overlap-length, although it is also possible to adjust the penalties used during alignment.
The following types of trimming or merging may be applied.
• Removal of non-genomic bases due to complete read-through. This removal is always applied.
• Removal of overlap bases impinging into regions occupied by probe bases. For example, if the left arms
contain 11-mer probes, using --left-probe-length=11 will result in the removal of any right arm
bases that overlap into the first 11 bases of the left arm. Similar trimming is available for situations where
probes are ligated to the right arm by using --right-probe-length.
• Adjustment of mismatching read bases inside areas of overlap. Such mismatches indicate that one or
other of the bases has been incorrectly sequenced. Alteration of these bases is selected by supplying the
--mismatch-adjustment flag with a value of zero-phred to alter the phred quality score of both
bases to zero, or pick-best to choose whichever base had the higher reported quality score.
• Removal of overlap regions by trimming both arms back to a point where no overlap is present. An equal
number of bases are removed from each arm. This trimming is enabled by specifying --midpoint-trim
and takes place after any read-through or probe related trimming.
• Merging non-redundant sequence from both reads to create a single read, enabled via
--midpoint-merge. This is like --midpoint-trim with a subsequent moving of the R2
read onto the end of the the R1 read (thus the R2 read becomes empty).
After trimming or merging it is possible that one or both of the arms of the pair have no bases remain-
ing, and a strategy is needed to handle these pairs. The default is to retain such pairs in the output, even
if one or both are zero-length. When both arms are zero-length, the pair can be dropped from output
with the use of --discard-empty-pairs. If downstream processing cannot handle zero-length reads,
--discard-empty-reads will drop a read pair if either of the arms is zero-length.
petrim also provides the ability to down-sample a read set by using the --subsample option. This will
produce a different sampling each time, unless an explicit randomization seed is specified via --seed.
Running custom filtering with petrim can be done in standard Unix sheels without incurring the use of additional
disk space or unduly slowing down the formatting of reads. The following example demonstrates how to apply
paired-end trimming while formatting to SDF:
This can even be combined with fastqtrim to provide extremely flexible trimming:
Note: petrim currently assumes Illumina paired-end sequencing, and aligns the reads in FR orientation. Se-
quencing methods which produce arms in a different orientation can be processed by first converting the in-
put files using fastqtrim --reverse-complement, running petrim, followed by another fastqtrim
--reverse-complement to restore the reads to their original orientation.
See also:
fastqtrim, format
RTG includes some simulation commands that may be useful for experimenting with effects of various RTG
command parameters or when getting familiar with RTG work flows. A simple simulation series might involve
the following commands:
--sam-rg "@RG\tID:sim-rg\tSM:sample1\tPL:ILLUMINA"
$ rtg snp --template sim-ref-sdf --output sim-name-snp sim-mapping/alignments.bam
2.4.1 genomesim
Synopsis:
Use the genomesim command to simulate a reference genome, or to create a baseline reference genome for a
research project when an actual genome reference sequence is unavailable.
Syntax:
Specify number of sequences, plus minimum and maximum lengths:
Example:
Parameters:
File Input/Output
-o --output=SDF The name of the output SDF.
Utility
--comment=STRING Specify a comment to include in the generated SDF.
--freq=STRING Set the relative frequencies of A,C,G,T in the generated sequence.
(Default is 1,1,1,1).
-h --help Prints help on command-line flag usage.
-l --length=INT Specify the length of generated sequence. May be specified 0 or more
times, or as a comma separated list.
--max-length=INT Specify the maximum sequence length.
--min-length=INT Specify the minimum sequence length.
-n --num-contigs=INT Specify the number of sequences to generate.
--prefix=STRING Specify a sequence name prefix to be used for the generated sequences.
The default is to name the output sequences ‘simulatedSequenceN’,
where N is increasing for each sequence.
-s --seed=INT Specify seed for the random number generator.
Usage:
The genomesim command allows one to create a simulated genome with one or more contiguous sequences -
exact lengths of each contig or number of contigs with minimum and maximum lengths provided. The contents
of an SDF directory created by genomesim can be exported to a FASTA file using the sdf2fasta command.
This command is primarily useful for providing a simple randomly generated base genome for use with subsequent
simulation commands.
Each generated contig is named by appending an increasing numeric index to the specified prefix. For example
--prefix=chr --num-contigs=10 would yield contigs named chr1 through chr10.
See also:
cgsim, readsim, popsim, samplesim
2.4.2 cgsim
Synopsis:
Simulate Complete Genomics Inc sequencing reads. Supports the original 35 bp read structure (5-10-10-10), and
the newer 29 bp read structure (10-9-10).
Syntax:
Generation by genomic coverage multiplier:
Example:
Parameters:
File Input/Output
-t --input=SDF SDF containing input genome.
-o --output=SDF Name for reads output SDF.
Fragment Generation
--abundance If set, the user-supplied distribution represents desired
abundance.
-N --allow-unknowns Allow reads to be drawn from template fragments
containing unknown nucleotides.
-c --coverage=FLOAT Coverage, must be positive.
-D --distribution=FILE File containing probability distribution for sequence
selection.
--dna-fraction If set, the user-supplied distribution represents desired
DNA fraction.
-M --max-fragment-size=INT Maximum fragment size (Default is 500)
-m --min-fragment-size=INT Minimum fragment size (Default is 350)
--n-rate=FLOAT Rate that the machine will generate new unknowns in the
read (Default is 0.0)
-n --num-reads=INT Number of reads to be generated.
--taxonomy-distribution=FILE File containing probability distribution for sequence
selection expressed by taxonomy id.
Complete Genomics
-V --cg-read-version=INT Select Complete Genomics read structure version, 1 (35 bp) or 2 (29
bp)
Utility
--comment=STRING Comment to include in the generated SDF.
-h --help Print help on command-line flag usage.
--no-names Do not create read names in the output SDF.
--no-qualities Do not create read qualities in the output SDF.
-q --qual-range=STRING Set the range of base quality values permitted e.g.: 3-40 (Default is
fixed qualities corresponding to overall machine base error rate)
--sam-rg=STRING|FILE File containing a single valid read group SAM header line or a string
in the form
@RG\tID:READGROUP1\tSM:BACT_SAMPLE\tPL:ILLUMINA
-s --seed=INT Seed for random number generator.
Usage:
Use the cgsim command to set either --coverage or --num-reads in simulated Complete Genomics reads.
For more information about Complete Genomics reads, refer to http://www.completegenomics.com
RTG simulation tools allows for deterministic experiment repetition. The --seed parameter, for example, allows
for regeneration of exact same reads by setting the random number generator to be repeatable (without supplying
this flag a different set of reads will be generated each time).
The --distribution parameter allows you to specify the probability that a read will come from a particular
named sequence for use with metagenomic databases. Probabilities are numbers between zero and one and must
sum to one in the file.
See also:
genomesim, readsim, popsim, samplesim
2.4.3 denovosim
Synopsis:
Use the denovosim command to generate a VCF containing a derived genotype containing de novo variants.
Syntax:
Example:
Parameters:
File Input/Output
-i --input=FILE The input VCF containing parent variants.
--original=STRING The name of the existing sample to use as the original genotype.
-o --output=FILE The output VCF file name.
--output-sdf=FILE Set to output an SDF of the genome generated.
-t --reference=SDF The SDF containing the reference genome.
-s --sample=STRING The name for the new derived sample.
Utility
-h --help Prints help on command-line flag usage.
-Z --no-gzip Set this flag to create the VCF output file without compression.
--num-mutations=INT Set the expected number of mutations per genome. (Default is 70).
--ploidy=STRING The ploidy to use when the reference genome does not contain a
reference text file. Allowed values are [auto, diploid, haploid] (Default
is auto)
--seed=INT Set the seed for the random number generator.
--show-mutations Set this flag to display information regarding de novo mutation points.
Usage:
The denovosim command is used to simulate a derived genotype containing de novo variants from a VCF
containing an existing genotype. The new output VCF will contain all the existing variants and samples with a
new column for the new sample.
The --output-sdf flag can be used to optionally generate an SDF of the derived genome which can then be
used by the readsim command to simulate a read set for the new genome.
See also:
readsim, genomesim, popsim, samplesim, samplereplay
2.4.4 readsim
Synopsis:
Use the readsim command to generate single or paired end reads of fixed or variable length from a reference
genome, introducing machine errors.
Syntax:
Generation by genomic coverage multiplier:
Example:
Parameters:
File Input/Output
-t --input=SDF SDF containing input genome.
--machine=STRING Select the sequencing technology to model. Allowed values are
[illumina_se, illumina_pe, complete_genomics, complete_genomics_2,
454_pe, 454_se, iontorrent]
-o --output=SDF Name for reads output SDF.
Fragment Generation
--abundance If set, the user-supplied distribution represents desired
abundance.
-N --allow-unknowns Allow reads to be drawn from template fragments
containing unknown nucleotides.
-c --coverage=FLOAT Coverage, must be positive.
-D --distribution=FILE File containing probability distribution for sequence
selection.
--dna-fraction If set, the user-supplied distribution represents desired
DNA fraction.
-M --max-fragment-size=INT Maximum fragment size (Default is 250)
-m --min-fragment-size=INT Minimum fragment size (Default is 200)
--n-rate=FLOAT Rate that the machine will generate new unknowns in the
read (Default is 0.0)
-n --num-reads=INT Number of reads to be generated.
--taxonomy-distribution=FILE File containing probability distribution for sequence
selection expressed by taxonomy id.
Illumina PE
-L --left-read-length=INT Target read length on the left side.
-R --right-read-length=INT Target read length on the right side.
Illumina SE
-r --read-length=INT Target read length, must be positive.
454 SE/PE
--454-max-total-size=INT Maximum 454 read length (in paired end case the sum of the left
and the right read lengths)
--454-min-total-size=INT Minimum 454 read length (in paired end case the sum of the left
and the right read lengths)
IonTorrent SE
--ion-max-total-size=INT Maximum IonTorrent read length.
--ion-min-total-size=INT Minimum IonTorrent read length.
Utility
--comment=STRING Comment to include in the generated SDF.
-h --help Print help on command-line flag usage.
--no-names Do not create read names in the output SDF.
--no-qualities Do not create read qualities in the output SDF.
-q --qual-range=STRING Set the range of base quality values permitted e.g.: 3-40 (Default is
fixed qualities corresponding to overall machine base error rate)
--sam-rg=STRING|FILE File containing a single valid read group SAM header line or a string
in the form
@RG\tID:READGROUP1\tSM:BACT_SAMPLE\tPL:ILLUMINA
-s --seed=INT Seed for random number generator.
Usage:
Create simulated reads from a reference genome by either specifying coverage depth or a total number of reads.
A typical use case involves creating a mutated genome by introducing SNPs or CNVs with popsim and
samplesim generating reads from the mutated genome with readsim, and mapping them back to the orig-
inal reference to verify the parameters used for mapping or variant detection.
RTG simulation tools allows for deterministic experiment repetition. The --seed parameter, for example, allows
for regeneration of exact same reads by setting the random number generator to be repeatable (without supplying
this flag a different set of reads will be generated each time).
The --distribution parameter allows you to specify the sequence composition of the resulting read set,
primarily for use with metagenomic databases. The distribution file is a text file containing lines of the form:
<probability><space><sequence name>
Probabilities must be between zero and one and must sum to one in the file. For reference databases containing
taxonomy information, where each species may be comprised of more than one sequence, it is instead possible to
use the --taxonomy-distribution option to specify the probabilities at a per-species level. The format of
each line in this case is:
<probability><space><taxon id>
2.4.5 popsim
Synopsis:
Use the popsim command to generate a VCF containing simulated population variants. Each variant allele
generated has an associated frequency INFO field describing how frequent in the population that allele is.
Syntax:
Example:
Parameters:
File Input/Output
-o --output=FILE Output VCF file name.
-t --reference=SDF SDF containing the reference genome.
Utility
-h --help Print help on command-line flag usage.
-Z --no-gzip Do not gzip the output.
--seed=INT Seed for the random number generator.
Usage:
The popsim command is used to create a VCF containing variants with frequency in population information
that can be subsequently used to simulate individual samples using the samplesim command. The frequency in
population is contained in a VCF INFO field called AF. The types of variants and the allele-frequency distribution
has been drawn from observed variants and allele frequency distribution in human studies.
See also:
readsim, genomesim, samplesim, childsim, samplereplay
2.4.6 samplesim
Synopsis:
Use the samplesim command to generate a VCF containing a genotype simulated from population variants
according to allele frequency.
Syntax:
Example:
From a population frequency VCF:
Parameters:
File Input/Output
-i --input=FILE Input VCF containing population variants.
-o --output=FILE Output VCF file name.
--output-sdf=SDF If set, output an SDF containing the sample genome.
-t --reference=SDF SDF containing the reference genome.
-s --sample=STRING Name for sample.
Utility
-h --help Prints help on command-line flag usage.
-Z --no-gzip Set this flag to create the VCF output file without compression.
--ploidy=STRING The ploidy to use when the reference genome does not contain a reference
text file. Allowed values are [auto, diploid, haploid] (Default is auto)
--seed=INT Set the seed for the random number generator.
--sex=SEX Specifies the sex of the individual. Allowed values are [male, female, either]
(Default is either).
Usage:
The samplesim command is used to simulate an individuals genotype information from a population variant
frequency VCF generated by the popsim command or by previous samplesim or childsim commands. The
new output VCF will contain all the existing variants and samples with a new column for the new sample. The
genotype at each record of the VCF will be chosen randomly according to the allele frequency specified in the AF
field.
The ploidy for each genotype is generated according to the ploidy of that chromosome for the specified sex of the
individual, as defined in the reference genome reference.txt file. For more information see RTG reference
file format.
The --output-sdf flag can be used to optionally generate an SDF of the individuals genotype which can then
be used by the readsim command to simulate a read set for the individual.
See also:
readsim, genomesim, popsim, childsim, samplereplay
2.4.7 childsim
Synopsis:
Use the childsim command to generate a VCF containing a genotype simulated as a child of two parents.
Syntax:
$ rtg childsim [OPTION]... --father STRING -i FILE --mother STRING -o FILE -t SDF \
-s STRING
Example:
Parameters:
File Input/Output
--father=STRING Name of the existing sample to use as the father.
-i --input=FILE Input VCF containing parent variants.
--mother=STRING Name of the existing sample to use as the mother.
-o --output=FILE Output VCF file name.
--output-sdf=SDF If set, output an SDF containing the sample genome.
-t --reference=SDF SDF containing the reference genome.
-s --sample=STRING Name for new child sample.
Utility
-h --help Print help on command-line flag usage.
-Z --no-gzip Do not gzip the output.
--num-crossovers=FLOAT Likelihood of extra crossovers per chromosome (Default is 0.01)
--ploidy=STRING Ploidy to use. Allowed values are [auto, diploid, haploid] (Default
is auto)
--seed=INT Seed for the random number generator.
--sex=SEX Sex of individual. Allowed values are [male, female, either]
(Default is either)
--show-crossovers If set, display information regarding haplotype selection and
crossover points.
Usage:
The childsim command is used to simulate an individuals genotype information from a VCF containing the
two parent genotypes generated by previous samplesim or childsim commands. The new output VCF will
contain all the existing variants and samples with a new column for the new sample.
The ploidy for each genotype is generated according to the ploidy of that chromosome for the specified sex of the
individual, as defined in the reference genome reference.txt file. For more information see RTG reference
file format. The generated genotypes are all consistent with Mendelian inheritance (de novo variants can be
simulated with the denovosim command).
The --output-sdf flag can be used to optionally generate an SDF of the child’s genotype which can then be
used by the readsim command to simulate a read set for the child.
See also:
readsim, genomesim, popsim, samplesim, samplereplay
2.4.8 samplereplay
Synopsis:
Use the samplereplay command to generate the genome SDF corresponding to a sample genotype in a VCF
file.
Syntax:
$ rtg samplereplay [OPTION]... -i FILE -o SDF -t SDF -s STRING
Example:
$ rtg samplereplay -i 3samples.vcf -o child.sdf -t HUMAN_reference -s person3
Parameters:
File Input/Output
-i --input=FILE Input VCF containing the sample genotype.
-o --output=SDF Name for output SDF.
-t --reference=SDF SDF containing the reference genome.
-s --sample=STRING Name of the sample to select from the VCF.
Utility
-h --help Print help on command-line flag usage.
Usage:
The samplereplay command can be used to generate an SDF of a genotype for a given sample from an existing
VCF file. This can be used to generate a genome from the outputs of the samplesim and childsim commands.
The output genome can then be used in simulating a read set for the sample using the readsim command.
Every chromosome for which the individual is diploid will have two sequences in the resulting SDF.
See also:
2.5.1 bgzip
Synopsis:
Block compress a file or decompress a block compressed file. Block compressed outputs from the mapping and
variant detection commands can be indexed with the index command. They can also be processed with standard
gzip tools such as gunzip and zcat.
Syntax:
Example:
Parameters:
File Input/Output
-l --compression-level=INT The compression level to use, between 1 (least but fast) and 9
(highest but slow) (Default is 5)
-d --decompress Decompress.
-f --force Force overwrite of output file.
--no-terminate If set, do not add the block gzip termination block.
-c --stdout Write on standard output, keep original files unchanged. Implied
when using standard input.
FILE+ File to (de)compress, use ‘-‘ for standard input. Must be specified
1 or more times.
Utility
-h --help Print help on command-line flag usage.
Usage:
Use the bgzip command to block compress files. Files such as VCF, BED, SAM, TSV must be block-compressed
before they can be indexed for fast retrieval of records corresponding to specific genomic regions.
See also:
index
2.5.2 index
Synopsis:
Create tabix index files for block compressed TAB-delimited genome position data files or BAM index files for
BAM files.
Syntax:
Multi-file input specified from command line:
Example:
Parameters:
File Input/Output
-f --format=FORMAT Format of input to index. Allowed values are [sam, bam, cram, sv,
coveragetsv, bed, vcf, auto] (Default is auto)
-I --input-list-file=FILE File containing a list of block compressed files (1 per line)
containing genome position data.
FILE+ Block compressed files containing data to be indexed. May be
specified 0 or more times.
Utility
-h --help Print help on command-line flag usage.
Usage:
Use the index command to produce tabix indexes for block compressed genome position data files like SAM
files, VCF files, BED files, and the TSV output from RTG commands such as coverage. The index command
can also be used to produce BAM indexes for BAM files with no index.
See also:
map, coverage, snp, extract, bgzip
2.5.3 extract
Synopsis:
Extract specified parts of an indexed block compressed genome position data file.
Syntax:
Extract whole file:
Example:
Parameters:
File Input/Output
FILE The indexed block compressed genome position data file to extract.
Filtering
REGION+ The range to display. The format is one of <sequence_name>,
<sequence_name>:<start>-<end>, <sequence_name>:<pos>+<length> or
<sequence_name>:<pos>~<padding>. May be specified 0 or more times.
Reporting
--header Set to also display the file header.
--header-only Set to only display the file header.
Utility
-h --help Prints help on command-line flag usage.
Usage:
Use the extract command to view specific parts of indexed block compressed genome position data files such
as those in SAM/BAM/BED/VCF format.
See also:
map, coverage, snp, index, bgzip
2.5.4 aview
Synopsis:
View read mapping and variants corresponding to a region of the genome, with output as ASCII to the terminal,
or HTML.
Syntax:
Example:
Parameters:
File Input/Output
-b --baseline=FILE VCF file containing baseline variants.
-B --bed=FILE BED file containing regions to overlay. May be specified 0 or more
times.
-c --calls=FILE VCF file containing called variants. May be specified 0 or more
times.
-I --input-list-file=FILE File containing a list of SAM/BAM format files (1 per line)
-r --reads=SDF Read SDF (only needed to indicate correctness of simulated read
mappings). May be specified 0 or more times.
-t --template=SDF SDF containing the reference genome.
FILE+ Alignment SAM/BAM files. May be specified 0 or more times.
Filtering
-p --padding=INT Padding around region of interest (Default is to automatically determine
padding to avoid read truncation)
--region=REGION The region of interest to display. The format is one of <sequence_name>,
<sequence_name>:<start>-<end>, <sequence_name>:<pos>+<length> or
<sequence_name>:<pos>~<padding>
--sample=STRING Specify name of sample to select. May be specified 0 or more times, or as a
comma separated list.
Reporting
--html Output as HTML.
--no-base-colors Do not use base-colors.
--no-color Do not use colors.
--no-dots Display nucleotide instead of dots.
--print-cigars Print alignment cigars.
--print-mapq Print alignment MAPQ values.
--print-mate-position Print mate position.
--print-names Print read names.
--print-readgroup Print read group id for each alignment.
--print-reference-line=INT Print reference line every N lines (Default is 0)
--print-sample Print sample id for each alignment.
--print-soft-clipped-bases Print soft clipped bases.
--project-track=INT If set, project highlighting for the specified track down through
reads (Default projects the union of tracks)
--sort-readgroup Sort reads first on read group and then on start position.
--sort-reads Sort reads on start position.
--sort-sample Sort reads first on sample id and then on start position.
--unflatten Display unflattened CGI reads when present.
Utility
-h --help Print help on command-line flag usage.
Usage:
Use the aview command to display a textual view of mappings and variants corresponding to a small region of
the reference genome. This is useful when examining evidence for variant calls in a server environment where
a graphical display application such as IGV is not available. The aview command is easy to script in order to
output displays for multiple regions for later viewing (either as text or HTML).
See also:
map, snp
2.5.5 sdfstats
Synopsis:
Print statistics that describe a directory of SDF formatted data.
Syntax:
$ rtg sdfstats [OPTION]... SDF+
Example:
$ rtg sdfstats human_READS_SDF
Location : C:\human_READS_SDF
Parameters : format -f solexa -o human_READS_SDF
c:\users\Elle\human\SRR005490.fastq.gz
SDF Version : 6
Type : DNA
Source : SOLEXA
Paired arm : UNKNOWN
Number of sequences: 4193903
Maximum length : 48
Minimum length : 48
N : 931268
A : 61100096
C : 41452181
G : 45262380
T : 52561419
Total residues : 201307344
Quality scores available on this SDF
Parameters:
File Input/Output
SDF+ Specifies an SDF on which statistics are to be reported. May be specified 1 or more times.
Reporting
--lengths Set to print out the name and length of each sequence. (Not recommended for read
sets).
-p --position Set to include information about unknown bases (Ns) by read position.
-q --quality Set to display mean of quality.
--sex=SEX Set to display the reference sequence list for the given sex. Allowed values are [male,
female, either]. May be specified 0 or more times, or as a comma separated list.
--taxonomy Set to display information about the taxonomy.
-n --unknowns Set to include information about unknown bases (Ns).
Utility
-h --help Prints help on command-line flag usage.
Usage:
Use the sdfstats command to get information about the contents of SDFs.
See also:
format, sdf2fasta, sdf2fastq, sdfstats
2.5.6 sdfsubset
Synopsis:
Extracts a specified subset of sequences from one SDF and outputs them to another SDF.
Syntax:
Individual specification of sequence ids:
Example:
Parameters:
File Input/Output
-i --input=SDF Specifies the input SDF.
-o --output=SDF The name of the output SDF.
Filtering
--end-id=INT Only output sequences with sequence id less than the given number. (Sequence
ids start at 0).
--start-id=INT Only output sequences with sequence id greater than or equal to the given
number. (Sequence ids start at 0).
-I --id-file=FILE Name of a file containing a list of sequences to extract, one per line.
--names Interpret any specified sequence as names instead of numeric sequence ids.
STRING+ Specifies the sequence id, or sequence name if the names flag is set to extract
from the input SDF. May be specified 0 or more times.
Utility
-h --help Prints help on command-line flag usage.
Usage:
Use this command to obtain a subset of sequences from an SDF. Either specify the subset on the command line
as a list of space-separated sequence ids or using the --id-file parameter to specify a file containing a list of
sequence ids, one per line. Sequence ids start from zero and are the same as the ids that map uses by default in the
QNAME field of its BAM files.
For example:
This will produce an SDF called subset_reads with sequences 10, 20, 30, 40 and 50 from the original SDF con-
tained in it.
See also:
sdfsubseq, sdfstats
2.5.7 sdfsubseq
Synopsis:
Prints a subsequence of a given sequence in an SDF.
Syntax:
Print sequences from sequence names:
Example:
Parameters:
File Input/Output
-i --input=FILE Specifies the input SDF.
Filtering
-I --sequence-id If set, use sequence id instead of sequence name in region (0-based)
REGION+ The range to display. The format is one of <sequence_name>,
<sequence_name>:<start>-<end>, <sequence_name>:<pos>+<length> or
<sequence_name>:<pos>~<padding>. Must be specified 1 or more times.
Utility
-f --fasta Set to output in FASTA format.
-q --fastq Set to output in FASTQ format.
-h --help Prints help on command-line flag usage.
-r --reverse-complement Set to output in reverse complement.
Usage:
Prints out the nucleotides or amino acids of specified regions in a set of sequences.
For example:
See also:
sdfsubset, sdfstats
2.5.8 mendelian
Synopsis:
The mendelian command checks a multi-sample VCF file for variant calls which do not follow Mendelian
inheritance, and compute aggregate sample concordance.
Syntax:
Example:
Parameters:
File Input/Output
-i --input=FILE VCF file containing multi-sample variant calls. Use ‘-‘ to
read from standard input.
-o --output=FILE If set, output annotated calls to this VCF file. Use ‘-‘ to write
to standard output.
--output-consistent=FILE If set, output only consistent calls to this VCF file.
--output-inconsistent=FILE If set, output only non-Mendelian calls to this VCF file.
-t --template=SDF SDF containing the reference genome.
Sensitivity Tuning
--all-records Use all records, regardless of filters (Default is to only process
records where FILTER is . or PASS)
-l --lenient Allow homozygous diploid calls in place of haploid calls and
assume missing values are equal to the reference.
--min-concordance=FLOAT Percentage concordance required for consistent parentage
(Default is 99.0)
--pedigree=FILE Genome relationships PED file (Default is to extract pedigree
information from VCF header fields)
Utility
-h --help Print help on command-line flag usage.
-Z --no-gzip Do not gzip the output.
Usage:
Given a multi-sample VCF file for a nuclear family with a defined pedigree, the mendelian com-
mand examines the variant calls and outputs the number of violations of Mendelian inheritance. If the
--output-inconsistent parameter is set, all detected violations are written into an output VCF file. As
such, this command may be regarded as a VCF filter, outputting those variant calls needing a non-Mendelian
explanation. Such calls may be the consequence of sequencing error, calling on low-coverage, or genuine novel
variants in one or more individuals.
Pedigree information regarding the relationships between samples and the sex of each sample is extracted from
the VCF headers automatically created by the RTG pedigree-aware variant calling commands. If this pedigree
information is absent from the VCF header or is incorrect, a pedigree file can be explicitly supplied with the
--pedigree flag.
To ensure correct behavior when dealing with sex chromosomes it is necessary to specify a sex-aware reference
and ensure the sex of each sample is supplied as part of the pedigree information. While it is best to give the
reference SDF used in the creation of the VCF, for checking third-party outputs any reference SDF containing the
same chromosome names and an appropriate reference.txt file will work. For more information, see RTG
reference file format. Variants calls where the call ploidy does not match what is expected are annotated in the
output VCF with an MCP FORMAT annotation.
Particularly when evaluating VCF files that have been produced by third party tools or when the VCF is the
result of combining independent per-sample calling, it is common to end up with situations where calls are not
available for every member of the family. Under normal circumstances mendelian will attempt to determine
Mendelian consistency on the basis of the values that have been provided. Records where the presence of missing
values makes the Mendelian consistency undecidable contain MCU INFO annotations in the annotated output VCF.
The following examples illustrate some consistent, undecidable, and inconsistent calls in the presence of missing
values:
Since the number of calls where one sample is missing can be quite high, an alternative option is to treat missing
values as equal to the reference by using the --lenient parameter. Note that while this approach will be correct
in most cases, it will give inaccurate results where the calling between different samples has reported the variant
in an equivalent but slightly different position or representation (e.g. positioning of indels within homopolymer
regions, differences of representation such as splitting MNPs into multiple SNPs etc).
The mendelian command computes overall concordance between related samples to assist detecting cases
where pedigree has been incorrectly recorded or samples have been mislabelled. For each child in the pedigree,
pairwise concordance is computed with respect to each parent by identifying diploid calls where the parent does
not contain either allele called in the child. Low pairwise concordance with a single parent may indicate that the
parent is the source of the problem, whereas low pairwise concordance with both parents may indicate that the
child is the source of the problem. A stricter three-way concordance is also recorded.
By default, only VCF records with the FILTER field set to PASS or missing are processed. All variant records
can be examined by specifying the --all-records parameter.
See also:
family, population, vcfstats
2.5.9 vcfstats
Synopsis:
Display simple statistics about the contents of a set of VCF files.
Syntax:
Example:
Location : /data/human/wgs/NA19240/snp_chr5.vcf.gz
Passed Filters : 283144
Failed Filters : 83568
SNPs : 241595
MNPs : 5654
Insertions : 15424
Deletions : 14667
Indels : 1477
Unchanged : 4327
SNP Transitions/Transversions : 1.93 (210572/108835)
Total Het/Hom ratio : 2.13 (189645/89172)
SNP Het/Hom ratio : 2.12 (164111/77484)
MNP Het/Hom ratio : 3.72 (4457/1197)
Insertion Het/Hom ratio : 1.69 (9695/5729)
Deletion Het/Hom ratio : 2.33 (10263/4404)
Indel Het/Hom ratio : 3.13 (1119/358)
Insertion/Deletion ratio : 1.05 (15424/14667)
Indel/SNP+MNP ratio : 0.13 (31568/247249)
Parameters:
File Input/Output
--known Set to only calculate statistics for known variants.
--novel Set to only calculate statistics for novel variants.
--sample=FILE Set to only calculate statistics for the specified sample. (Default is to include all
samples). May be specified 0 or more times.
FILE+ VCF file from which to derive statistics. Use ‘-‘ to read from standard input. Must
be specified 1 or more times.
Reporting
--allele-lengths Set to output variant length histogram.
Utility
-h --help Prints help on command-line flag usage.
Usage:
Use the vcfstats command to display summary statistics for a set of VCF files. If a VCF file contains multiple
sample columns, the statistics for each sample are shown individually.
When determining the categorization of a REF to ALT transformation, some normalization is carried out to ignore
same as reference bases at the start and end of the alleles. Thus the following REF to ALT transformations are
categorized as SNPs:
Cases where multiple bases change, but the lengths of the two alleles do not are considered to be MNPs:
Cases where there is pure addition or removal of bases are classified as Insertions or Deletions respec-
tively:
The remaining case is there there is a length change between the REF and ALT, but it is not pure. These are called
Indels:
In the per-sample summary output of vcfstats, each genotype is classified as a whole into one of the above
categories, preferring the more complex of the transformations when ploidy is greater than one.
When computing the per-sample variant length histograms, note that the histograms are incremented for each
called allele (thus a diploid homozygous call will increment the appropriate cell by two), and the length of an
indel is taken as the change in length rather than the overall length.
See also:
snp, family, somatic, vcffilter, vcfmerge, vcfsubset
2.5.10 vcfmerge
Synopsis:
Combines the contents of two or more VCF files. The vcfmerge command can concatenate the outputs of
per-chromosome variant detection runs to create a complete genome VCF file, and also merge VCF outputs from
multiple samples to form a multi-sample VCF file.
Syntax:
Example:
Parameters:
File Input/Output
-I --input-list-file=FILE File containing a list of VCF format files (1 per line) to be merged.
-o --output=FILE Output VCF file. Use ‘-‘ to write to standard output.
FILE+ Input VCF files to merge. May be specified 0 or more times.
Utility
-a --add-header=STRING|FILE File containing VCF header lines to add, or a literal header
line. May be specified 0 or more times.
-f --force-merge=STRING Allow merging of specified header ID even when descriptions
do not match. May be specified 0 or more times.
-F --force-merge-all Attempt merging of all non-matching header declarations.
-h --help Print help on command-line flag usage.
-Z --no-gzip Do not gzip the output.
--preserve-formats If set, variants with different ALTs and unmergeable FORMAT
fields will be kept unmerged (Default is to remove those
FORMAT fields so the variants can be combined)
--stats Output statistics for the merged VCF file.
Usage:
The vcfmerge command takes a list of VCF files and outputs to a single VCF file. The input files must have
consistent header lines, although similar header lines can be forced to merge using the --force-merge param-
eter. Each VCF file must be block compressed and have a corresponding tabix index file, which is the default
for outputs from RTG variant detection tools, but may also be created from an existing VCF file using the RTG
bgzip and index commands.
There are two primary usage scenarios for the vcfmerge command. The first is to combine input VCFs cor-
responding to different genomic regions (for example, if variant calling was carried out for each chromosome
independently on different nodes of a compute cluster). The second scenario is when combining VCFs containing
variant calls for different samples (e.g. combining calls made for separate cohorts into a single VCF). If the input
VCFs contain multiple calls at the same position for the same sample, a warning is issued and only the first is kept.
When multiple records occur at the same position and the length on the reference is the same, the records will be
merged into a single record. If the merge results in a change in the set of ALT alleles, any VCF FORMAT fields
declared to be of type A, G, or R will be set to the missing value (.), as they cannot be meaningfully updated.
Similarly, if multiple input records with the same position and length on the reference contain information for
the same sample, only that information from the first record will be retained. The --preserve-formats flag
prevents this loss of information by refusing to merge the records when these conditions occur (separate records
will be output).
The --add-header option allows inserting arbitrary VCF header lines into the output VCF. For more informa-
tion, see vcfannotate.
See also:
snp, family, population, somatic, vcffilter, vcfannotate, vcfsubset, bgzip, index
2.5.11 vcffilter
Synopsis:
Filters VCF records based on various criteria. When filtering on multiple samples, if any of the specified samples
fail the criteria, the record will be filtered. By default filtered records are removed, but see the –fail, –clear-failed-
samples, and –fail-samples options for alternatives.
Syntax:
Examples:
Keep only records where the sample has depth of coverage at least 5:
Parameters:
File Input/Output
--all-samples Apply sample-specific criteria to all samples contained in the input VCF.
--bed-regions=FILE If set, only read VCF records that overlap the ranges contained in the
specified BED file.
-i --input=FILE VCF file containing variants to be filtered. Use ‘-‘ to read from standard
input.
-o --output=FILE Output VCF file. Use ‘-‘ to write to standard output. This option is
required, unless --javascript is being used.
--region=REGION If set, only read VCF records within the specified range. The format is
one of <sequence_name>, <sequence_name>:<start>-<end>,
<sequence_name>:<pos>+<length> or
<sequence_name>:<pos>~<padding>
--sample=STRING Apply sample-specific criteria to the named sample contained in the
input VCF. May be specified 0 or more times.
Use vcffilter to get a subset of the results from variant calling based on the filtering criteria supplied by the
filter flags. Multiple criteria can be specified at once, and advanced processing can be specified via JavaScript
scripting.
When filtering on multiple samples, if any of the specified samples fail the criteria, the record will be filtered. The
default behavior is for filtered records to be excluded from output altogether, but alternatively the records can be
retained but with an additional user-specified VCF FILTER status set via --fail option, or if sample-specific
filtering criteria is being applied, only those samples can be filtered either by setting their GT field to missing by
using the --clear-failed-samples option, or by setting the FORMAT FT field with a user-specified status
via the --fail-samples option.
The --bed-regions option makes use of tabix indexes to avoid loading VCF records outside the supplied
regions, which can give faster filtering performance. If the input VCF is not indexed or being read from standard
input, or if records failing filters are to be annotated via the --fail option, use the --include-bed option
instead.
The flags --min-denovo-score and --max-denovo-score can only be used on a single sample. Records
will only be kept if the specified sample is flagged as a de novo variant and the score is within the range specified
by the flags. It will also only be kept if none of the other samples for the record are also flagged as a de novo
variant within the specified score range.
The --add-header option allows inserting arbitrary VCF header lines into the output VCF. For more informa-
tion, see vcfannotate.
A powerful general-purpose filtering capability has been included that permits the specification of filter crite-
ria as simple JavaScript expressions (--keep-expr) or more comprehensive JavaScript processing functions
(--javascript). Both --keep-expr and --javascript can take JavaScript on the command line or
if a filename is supplied then the script/expression will be read from that file. --keep-expr will be applied
before --javascript, so the --javascript record function will not be called for records filtered out by
--keep-expr.
See also:
For full details of functions available in --keep-expr and --javascript see RTG JavaScript filtering API
The --keep-expr flag aims to provide a convenient way to apply some simple (typically one line) filtering
expressions which are evaluated in the context of each record. The final expression of the fragment must evaluate
to a boolean value. Records which evaluate to true will be retained, while false will be removed. The value
must be of type boolean, simply being truthy/falsy (in the JavaScript sense) will raise an error.
--keep-expr examples:
The following expression keeps records where the NA12878 sample has GQ > 30 and the total depth is > 20.
JavaScript will auto convert numerical strings when comparing a string with a number, so calls to parseInt can
be omitted.
If the field of interest may contain the missing value (‘.’) or may be entirely missing on a per-record basis, the
has() function can be used to control whether such records are kept vs filtered. For example, to keep records
with depth greater than 20, and remove any without a DP annotation:
Alternatively, to keep records with depth greater than 20, as well as those without a DP annotation:
The next example keeps records where all samples have a depth > 10. The standard JavaScript array methods
every and some can be used to apply a condition on every sample column.
Similarly, the following example retains records where the FILTER field is unset, or if set must be either PASS
or MED_QUAL:
Note that multi-valued INFO and FORMAT fields are not split into sub-values, so in some cases correct filtering
may require splitting the values first. For example, to select bi-allelic records with AF greater than 0.1, the
following simple selection will work:
However, in the presence of multi-allelic records, something like the following is required:
The --javascript option aims to support more complicated processing than --keep-expr. permitting
modification of the output VCF, or supporting use cases where the script is tasked to compute and output alternative
information in addition to (or instead of) the output VCF. The scripts specified by the user are evaluated once at
the start of processing. Two special functions may be defined in a --javascript script, which will then be
executed in different contexts:
• A function with the name record will be executed once for each VCF record. If the record function has
a return value it must have type boolean. Records which evaluate to true will be retained, while false
will be removed. If the record function has no return value then the record will be retained. The record
function is applied after any --keep-expr expression.
• A function with the name end will be called once at the end of processing. This allows reporting of
summary statistics collected during the filter process.
This --javascript flag may be specified multiple times, they will be evaluated in order, in a shared JavaScript
namespace, before VCF processing commences. This permits a use case where an initial JavaScript expression
supplies parameter values which will be required by a subsequent JavaScript file.
To find indels with length greater than 5, save the following to a file named find-indels.js:
The following example derives a new FORMAT column containing variant allelic fraction to two decimal places
based on the values in the AD and DP FORMAT annotations, for every sample contained in the VCF. Save the
following to a file named add-vaf.js:
// Derive new VAF FORMAT field for each sample
ensureFormatHeader('##FORMAT=<ID=VAF,Number=1,Type=Float,' +
'Description="Variant Allelic Fraction">');
function record() {
SAMPLES.forEach(function(sample) {
// Take all but the first AD value as numerics
var altDepths = sample.AD.split(",").slice(1);
// Find the max
var maxAltDepth = Math.max.apply(null, altDepths);
if (maxAltDepth > 0) {
sample.VAF = (maxAltDepth / sample.DP).toFixed(2);
}
});
}
The next example produces a table of binned indel lengths, save the following to a file named indel-lengths.
js:
// bin breakpoints can be customised by defining your own bins[] in a
// previous -j flag
if (typeof bins == "undefined") {
var bins = [-10, -5, -3, 0, 4, 6, 11];
}
if (delta == 0) {
return false;
}
for (var i = 0; i < bins.length; i++) {
if (delta < bins[i]) {
counts[i]++;
break;
}
}
if (delta > bins[bins.length - 1]) {
counts[counts.length - 1]++;
}
return false;
}
function end() {
print("Delta\\tCount");
for (var i = 0; i < bins.length; i++) {
print("<" + bins[i] + "\\t" + counts[i]);
}
print(">" + bins[bins.length - 1] + "\\t" + counts[counts.length - 1]);
}
We could use this same script with adjusted bins and omitting the output of the VCF via:
See also:
snp, family, somatic, population, vcfannotate, vcfmerge, vcfsubset
2.5.12 vcfannotate
Synopsis:
Used to add annotations to a VCF file, either to the VCF ID field, as a VCF INFO sub-field, or as a VCF FORMAT
sub-field.
Syntax:
Example:
Parameters:
File Input/Output
-i --input=FILE VCF file containing variants to annotate. Use ‘-‘ to read from standard input.
-o --output=FILE Output VCF file name. Use ‘-‘ to write to standard output.
Reporting
-A --annotation=STRING Add computed annotation to VCF records. Allowed values
are [AC, AN, EP, GQD, IC, LAL, MEANQAD, NAA, PD,
QA, QD, RA, SCONT, VAF, ZY]. May be specified 0 or
more times, or as a comma separated list.
--bed-ids=FILE Add variant IDs from BED file. May be specified 0 or more
times.
--bed-info=FILE Add INFO annotations from BED file. May be specified 0 or
more times.
--fill-an-ac Add or update the AN and AC INFO fields.
--info-description=STRING If the BED INFO field is not already declared, use this
description in the header (Default is Annotation)
--info-id=STRING The INFO ID for BED INFO annotations (Default is ANN)
--relabel=FILE Relabel samples according to old-name new-name pairs
in specified file.
--vcf-ids=FILE Add variant IDs from VCF file. May be specified 0 or more
times.
Utility
-a --add-header=STRING|FILE File containing VCF header lines to add, or a literal header line.
May be specified 0 or more times.
-h --help Print help on command-line flag usage.
-Z --no-gzip Do not gzip the output.
--no-header Prevent VCF header from being written.
Usage:
Use vcfannotate to add text annotations to variants.
A common use case is to add annotations to only those variants that fall within ranges specified in a BED or VCF
file, supplied via --bed-ids or --vcf-ids respectively. The annotations from the BED file are added as an
INFO field in the output VCF file. It can also be used to compute or fill in certain additional annotations from the
existing content.
If the --bed-ids flag is used, instead of adding the annotation to the INFO fields, it is added to the ID column
of the VCF file instead. If the --vcf-ids flag is used, the ID column of the input VCF file is used to update the
ID column of the output VCF file instead.
If the --fill-an-ac flag is set, the output VCF will have the AN and AC info fields (as defined in the VCF 4.1
specification) created or updated.
It is also possible to use vcfannotate to insert additional VCF header lines into the VCF header. These are
supplied using the --add-header flag which may either be a literal VCF header line (useful for adding one or
two header lines), or from a file.
or alternatively:
Care should be taken that the lines being inserted are valid VCF header lines.
If the --annotation flag is set, vcfannotate attempts to compute the specified annotation(s) and add them
as FORMAT fields in the corresponding records. Records for which particular annotations cannot be computed,
due to a lack of pre-requisite fields, will not be modified.
For a description of the meaning of fields available for annotation, see Small-variant VCF output file description.
The SCONT annotation is a convenience to annotate with all of the contrary evidence annotations: DCOC, DCOF,
OCOC, OCOF.
See also:
snp, family, somatic, population, vcffilter, vcfsubset
2.5.13 vcfsubset
Synopsis:
Create a VCF file containing a subset of the original columns.
Syntax:
Example:
Parameters:
File Input/Output
-i --input=FILE VCF file containing variants to manipulate. Use ‘-‘ to read from standard input.
-o --output=FILE Output VCF file. Use ‘-‘ to write to standard output.
Filtering
--keep-filter=STRING Keep the specified FILTER tag. May be specified 0 or more times, or
as a comma separated list.
--keep-format=STRING Keep the specified FORMAT field. May be specified 0 or more times,
or as a comma separated list.
--keep-info=STRING Keep the specified INFO tag. May be specified 0 or more times, or as
a comma separated list.
--keep-sample=STRING Keep the specified sample. May be specified 0 or more times, or as a
comma separated list.
--remove-filter=STRING Remove the specified FILTER tag. May be specified 0 or more times,
or as a comma separated list.
--remove-filters Remove all FILTER tags.
--remove-format=STRING Remove the specified FORMAT field. May be specified 0 or more
times, or as a comma separated list.
--remove-ids Remove the contents of the ID field.
--remove-info=STRING Remove the specified INFO tag. May be specified 0 or more times, or
as a comma separated list.
--remove-infos Remove all INFO tags.
--remove-qual Remove the QUAL field.
--remove-sample=STRING Remove the specified sample. May be specified 0 or more times, or as
a comma separated list.
--remove-samples Remove all samples.
Utility
-h --help Print help on command-line flag usage.
-Z --no-gzip Do not gzip the output.
--no-header Prevent VCF header from being written.
Usage:
Use the vcfsubset command to produce a smaller copy of an original VCF file containing only the columns
and information desired. For example, to produce a VCF containing only the information for one sample from
a multiple sample VCF file use the --keep-sample flag to specify the sample to keep. The various --keep
and --remove options can either be specified multiple times or with comma separated lists, for example,
--keep-format GT --keep-format DP is equivalent to -keep-format GT,DP.
See also:
snp, family, somatic, population, vcffilter, vcfannotate
2.5.14 vcfdecompose
Synopsis:
Decomposes complex variants within a VCF file into smaller components.
Syntax:
Parameters:
File Input/Output
-i --input=FILE VCF file containing variants to decompose. Use ‘-‘ to read from standard input.
-o --output=FILE Output VCF file name. Use ‘-‘ to write to standard output.
-t --template=SDF SDF of the reference genome the variants are called against.
Sensitivity Tuning
--break-indels If set, peel as many SNPs off an indel as possible.
--break-mnps If set, break MNPs into individual SNPs.
Utility
-h --help Print help on command-line flag usage.
-Z --no-gzip Do not gzip the output.
--no-header Prevent VCF header from being written.
Usage:
The vcfdecompose command decomposes and trims variants based on a multiple sequence alignment between
the alleles in each VCF record. Only records where every ALT allele is an ordinary allele (i.e. consisting of
nucleotides) will undergo decomposition. In addition, if there are redundant same-as-reference bases in the alleles,
these will be trimmed off.
The default behaviour is to break the variant at positions where there is at least one base aligned to the reference
across all ALT alleles, so the output may contain MNPs or impure indels. If desired, MNPs can be split into
individual SNPs via --break-mnps. Similarly, impure indels can be split into a combination of SNPs and pure
indels via --break-indels.
Although decomposed variants carry through the original INFO and FORMAT annotations, the decomposition may
mean that some annotations are no longer semantically correct. In particular, any VCF FORMAT fields declared to
be of type A, G, or R will no longer be valid if the set of alleles has changed.
Note that the reference genome is an optional parameter. When variants are decomposed and trimmed, the result-
ing variant may require a padding base to be added, as required by the VCF specification. The VCF specification
suggests that the padding base should be the base before the variant (i.e. padding on the left), but sometimes this
requires knowledge of reference bases not present in the original record. When the reference genome is supplied,
vcfdecompose will ensure that any padding bases are added on the left of the variant. If the reference genome
is not supplied, padding bases may sometimes be on the right hand side of the variant. For example:
and with a reference genome (where the reference base at position 19 can be determined to be a T) as:
The variants that are left vs right-padded are equivalent and identified as such by haplotype-aware comparison
tools such as vcfeval.
See also:
vcffilter, vcfeval
2.5.15 vcfeval
Synopsis:
Evaluates called variants for agreement with a baseline variant set irrespective of representational differences.
Outputs a weighted ROC file which can be viewed with rtg rocplot and VCF files containing false positives
(called variants not matched in the baseline), false negatives (baseline variants not matched in the call set), and
true positives (variants that match between the baseline and calls).
The baseline variants might be the variants that were used to generate a synthetic simulated sample (such as via
popsim, samplesim, etc), a gold-standard VCF corresponding to a reference sample such as NA12878, or
simply an alternative call-set being used as a basis for comparison.
Syntax:
Example:
Parameters:
File Input/Output
-b --baseline=FILE VCF file containing baseline variants.
--bed-regions=FILE If set, only read VCF records that overlap the ranges
contained in the specified BED file.
-c --calls=FILE VCF file containing called variants.
-e --evaluation-regions=FILE If set, evaluate within regions contained in the supplied BED
file, allowing transborder matches. To be used for truth-set
high-confidence regions or other regions of interest where
region boundary effects should be minimized.
-o --output=DIR Directory for output.
--region=REGION If set, only read VCF records within the specified range. The
format is one of <sequence_name>,
<sequence_name>:<start>-<end>,
<sequence_name>:<pos>+<length> or
<sequence_name>:<pos>~<padding>
-t --template=SDF SDF of the reference genome the variants are called against.
Filtering
--all-records Use all records regardless of FILTER status (Default is to only process records
where FILTER is . or PASS)
--decompose Decompose complex variants into smaller constituents to allow partial credit.
--ref-overlap Allow alleles to overlap where bases of either allele are same-as-ref (Default is to
only allow VCF anchor base overlap)
--sample=STRING The name of the sample to select. Use <baseline_sample>,<calls_sample> to
select different sample names for baseline and calls. (Required when using
multi-sample VCF files)
--squash-ploidy Treat heterozygous genotypes as homozygous ALT in both baseline and calls, to
allow matches that ignore zygosity differences.
Reporting
-m --output-mode=STRING Output reporting mode. Allowed values are [split, annotate,
combine, ga4gh, roc-only] (Default is split)
-O --sort-order=STRING The order in which to sort the ROC scores so that good scores
come before bad scores. Allowed values are [ascending,
descending] (Default is descending)
-f --vcf-score-field=STRING The name of the VCF FORMAT field to use as the ROC score.
Also valid are QUAL or INFO.<name> to select the named
VCF INFO field (Default is GQ)
Utility
-h --help Prints help on command-line flag usage.
-Z --no-gzip Set this flag to create the output files without compression.
-T --threads=INT Specify the number of threads to use in a multi-core processor. (Default is all
available cores).
Usage:
The vcfeval command can be used to generate VCF files containing called variants that were in the baseline
VCF, called variants that were not in the baseline VCF and baseline variants that were not in the called variants.
It also produces ROC curve data files based on a score contained in a VCF field which show the predictive power
of that field for the quality of the variant calls.
When developing and validating sequencing pipelines and variant calling algorithms, the comparison of variant
call sets is a common problem. The naïve way of computing these numbers is to look at the same reference
locations in the baseline (ground truth) and called variant set, and see if genotype calls match at the same posi-
tion. However, a complication arises due to possible differences in representation for indels between the baseline
and the call sets within repeats or homopolymers, and in multiple-nucleotide polymorphisms (MNPs), which en-
compass several nearby nucleotides and are locally phased. The vcfeval command includes a novel dynamic-
programming algorithm for comparing variant call sets that deals with complex call representation discrepancies,
and minimizes false positives and negatives across the entire call sets for accurate performance evaluation. A
primary advantage of vcfeval (compared to other tools) is that the evaluation does not depend on normalization
or decomposition, and so the results of analysis can easily be used to relate to the original variant calls and their
annotations.
Note that vcfeval operates at the level of local haplotypes for a sample, so for a diploid genotype, both alleles
must match in order to be considered correct. Some of the vcfeval output modes (described below) automatically
perform an additional haploid analysis phase to identify variants which may not have a diploid match but which
share a common allele (for example, zygosity errors made during calling). If desired, this more lenient haploid
comparison can be used at the outset by setting the --squash-ploidy flag (see below).
Note that variants selected for inclusion in a haplotype cannot be permitted to overlap each other (otherwise
the question arises of which variant should have priority when determining the resulting haplotype), and any
well-formed call-set should not contain these situations in order to avoid such ambiguity. When such cases are
encountered by vcfeval, the best non-overlapping result is determined. A special case of overlapping variants
is where calls are denoted as partially the same as the reference (for example, a typical heterozygous call). Strictly
speaking such variants are an assertion that the relevant haplotype bases must not be altered from the reference
and overlap should not be permitted (this is the interpretation that vcfeval employs by default). However,
sometimes as a result of using non-haplotype-aware variant calling tools or when using naïve merging of multiple
call sets, a more lenient comparison is desired. The --ref-overlap flag will permit such overlapping variants
to both match, as long as any overlap only occurs where one variant or other has asserted haplotype bases as being
the same as reference.
When --squash-ploidy is specified, a haploid match is attempted using each of the non-reference alleles
used in the sample genotype. For example if the baseline and call VCFs each had a record with the same REF and
ALT alleles declared, the following GT fields would be considered a match:
0/1, 1/1, 1/2 (genotypes match due to the 1 allele)
0/2, 1/2, 2/2 (genotypes match due to the 2 allele)
Thus --squash-ploidy matches any case where the baseline and calls share a common allele. This is most
often used to run matching that does not penalize for genotyping errors. For example, it is recommended to use
this option when matching somatic variant calls, as since somatic variation is usually associated with variable
allelic fractions and heterogeneity that mean strict diploid genotype comparisons are not appropriate.
A common scenario is to match a call set against a baseline which contains no sample column, where the objective
is to identify which baseline alleles which have been called. One example of this is to identify whether calls match
a database of known high-priority somatic variants such as COSMIC, or to find calls which have been previously
seen in a population allele database such as ExAC. Ordinarily vcfeval requires the input VCFs to contain a
sample column containing a genotype in the GT field, however, it is possible to specify a special sample name of
‘ALT’ in order to indicate that the the genotypes for comparison should be derived from the ALT alleles of the
record. This can be specified independently for baseline and calls, for example:
$ rtg vcfeval -t build37.sdf -b cosmic.vcf.gz -c tumor-calls.vcf.gz \
--squash-ploidy --sample ALT,tumor -o tumor-vs-cosmic
Which would perform a haploid matching of the GT of the called sample ‘tumor’ against all possible haploid
genotypes in the COSMIC VCF. The resulting true positives file contains all the calls containing an allele present
in the COSMIC VCF.
Note: It is also possible to run a diploid comparison by omitting --squash-ploidy, but this is not usually
required, and is computationally more intensive since there may be many more possible diploid genotypes to
explore, particularly if the ALT VCF contains many multiallelic records.)
When evaluating exome variant calls, it may be useful to restrict analysis only to exome target regions. In this
case, supply a BED file containing the list of regions to restrict analysis to via the --bed-regions flag. For
a quick way to restrict analysis only to a single region, the --region flag is also accepted. Note that when
restricting analysis to regions, there may be variants which can not be correctly evaluated near the borders of each
analysis region, if determination of equivalence would require inclusion of variants outside of the region. For this
reason, it is recommended that such regions be relatively inclusive.
When matching against gold standard truth sets which have an accompanying high-confidence regions BED file,
the flag --evaluation-regions should be used instead of --bed-regions, as it has special matching
semantics that aims to reduce comparison region boundary effects. When this comparison method is used, call
variants which match a baseline variant are only considered a true positive if the baseline variant is inside the
high confidence regions, and call variants are only considered false positive if they fall inside the high confidence
regions.
vcfeval outputs
The primary outputs of vcfeval are VCF files indicating which variants matched between the baseline and the
calls VCF, and data files containing information used to generate ROC curves with the rocplot command (or via
spreadsheet). vcfeval supports different VCF output modes which can be selected with the --output-mode
flag according to the type of analysis workflow desired. The following modes are available:
Split (--output-mode=split)
This output mode is the default, and produces separate VCF files for each of the match categories. The individual
VCF records in these files are not altered in any way, preserving all annotations present in the input files.
• tp.vcf – contains those variants from the calls VCF which agree with variants in the baseline VCF
• tp-baseline.vcf – contains those variants from the baseline VCF which agree with variants in the
calls VCF. Thus, the variants in tp.vcf and tp-baseline.vcf are equivalent. This file can be used to
successively refine a highly sensitive baseline variant set to produce a consensus from several call sets.
• fp.vcf – contains variants from the calls VCF which do not agree with baseline variants.
• fn.vcf – contains variants from the baseline VCF which were not correctly called.
This mode performs a single pass comparison, either in diploid mode (the default), or haploid mode (if
--squash-ploidy has been set). The separate output files produced by this mode allow the use of vcfeval
as an advanced haplotype-aware VCF intersection tool.
Annotate (--output-mode=annotate)
This output mode does not split the input VCFs by match status, but instead adds INFO annotations containing
the match status of each record:
• calls.vcf – contains variants from the calls VCF, augmented with match status annotations.
• baseline.vcf – contains variants from the baseline VCF, augmented with match status annotations.
This output mode automatically performs two comparison passes, the first finds diploid matches (assigned a match
status of TP), and a second pass that applies a haploid mode to the false positives and false negatives in order to
find calls (such as zygosity errors) that contain a common allele. This second category of match are annotated with
status FN_CA or FP_CA in the output VCFs, and those calls which do not have any match are assigned status FN
or FP. A status value of IGN indicates a VCF record which was ignored (for example, due to having a non-PASS
filter status, representing a structural variant, or otherwise containing a non-variant genotype). A status of OUT
indicates a VCF record which does not contain a match status due to falling outside the evaluation regions when
--evaluation-regions is being used.
Combine (–output-mode=combine)
This output mode provides an easy way to view the baseline and call variants in a single two-sample VCF.
• output.vcf – contains variants from both the baseline and calls VCFs, augmented with match status
annotations. The sample under comparison from each of the input VCFs is extracted as a column in the
output. As the VCF records from the baseline and calls typically have very different input annotations
which can be difficult to merge, and to keep the output format simple, there is no attempt to preserve any of
the original variant annotations.
As with the annotation output mode, this output mode automatically performs two comparison passes to find both
diploid matches and haploid (lenient) matches.
ROC-only (–output-mode=roc-only)
This output mode provides a lightweight way to run performance benchmarking, as VCF file output is omitted,
and only ROC data files are produced.
All of the output modes produce the following ROC data files:
• weighted_roc.tsv – contains ROC data derived from all analyzed call variants, regardless of their
representation. Columns include the score field, and standard accuracy metrics such as true positives, false
positives, false negatives, precision, sensitivity, and f-measure corresponding to each score threshold.
• snp_roc.tsv – contains ROC data derived from only those variants which were represented as SNPs.
Since the representation conventions can differ between the baseline and calls, there are some subtleties to
be aware of when interpreting metrics such as precision, sensitivity, etc, described below.
• non_snp_roc.tsv – contains ROC data derived from those variants which were not represented as
SNPs. As above, not all metrics are computed for this file.
Note: In addition, vcfeval has an output mode (--output-mode=ga4gh) which produces the intermediate
evaluation format defined by the GA4GH Benchmarking Team, without additional statistics files. This mode is not
generally intended for end users, rather it is used when vcfeval is selected as the comparison engine inside the
hap.py benchmarking tool see: https://github.com/ga4gh/benchmarking-tools and https://github.com/Illumina/
hap.py
Multiple ROC data files (from a single or several vcfeval runs) can be plotted with the rocplot command,
which allows output to a PNG or SVG image or analysis in an interactive GUI that provides zooming and visual-
ization of the effects of threshold adjustment. As these files are simple tab-separated-value format, they can also
be loaded into a spreadsheet tool or processed with shell scripts.
While ROC curve analysis provides a much more thorough method for examining the performance of a call
set with respect to a baseline truth set, for convenience, vcfeval also produces a summary.txt file which
indicates match summary statistics that correspond to two key points on the ROC curve. The first point is where
all called variants are included (i.e. no thresholding on a score value); and second point corresponding to a score
threshold that maximises the F-measure of the curve. While this latter point is somewhat arbitrary, it represents a
balanced tradeoff between precision and sensitivity which is likely to provide a fairer comparison when comparing
call sets from different callers.
Note that vcfeval reports true positives both counted using the baseline variant representation as well as counted
using the call variant representation. When these numbers differ greatly, it indicates a general difference in repre-
sentational conventions used between the two call sets. Since false negatives can only be measured in terms of the
baseline representation, sensitivity is defined as:
Conversely since false positives can only be measured in terms of the call representation, precision is defined as:
Note: For definitions of the terminology used when evaluating caller accuracy, see: https://en.wikipedia.org/wiki/
Receiver_operating_characteristic and https://en.wikipedia.org/wiki/Sensitivity_and_specificity
A common desire is to perform analysis separately for SNPs versus indels. However, it is important to note that
due the representation ambiguity problem, it is not always trivial to decide in a global sense whether a variant
is a SNP or an indel or other complex variant. A group of variants that may be represented as single SNPs in
one call-set may be represented as a single complex variant in another call-set. Consider the following example
reference and alternate haplotypes:
12345678901234567
REF: ATCGTAAATAAAATGCA
ALT: ATCGTAAAATAAATGCA
One variant caller might represent the haplotypes as the following VCF records:
chr1 5 . T TA . . . GT 1/1
chr1 9 . TA T . . . GT 1/1
While another variant caller could represent the same haplotypes as:
chr1 9 . T A . . . GT 1/1
chr1 10 . A T . . . GT 1/1
The decision as to which representation to use is essentially arbitrary, yet one caller has used indels (and no SNPs),
and the other has used SNPs (and no indels). For this reason it is certainly a poor idea to attempt to divide baseline
and called variants into separate SNP and indel datasets up front and perform evaluation on each set separately, as
any variants that use different representation categories will not be matched across the independent comparisons.
Any variant-type specific metrics should be computed after matching is carried out on the full variant sets.
Note that when there are different representational conventions between the baseline and calls (or between calls
from one variant caller and another), then at some level there is really a semantic difference between a “baseline
indel” and a “call-set indel” (or “variant-caller-A indel” and “variant-caller-B indel”), so caution should be applied
when making conclusions related to SNP versus indel accuracy.
In the snp_roc.tsv and non_snp_roc.tsv output files, vcfeval notes the number of baseline and call
variants of each variant type. When considering benchmarking metrics in the absence of any thresholding with
respect to a score field, it is straight-forward to use the previous formulae (i.e. sensitivity is computed using the
counts from baseline variants, and precision is computed using the counts from called variants). When computing
threshold-specific metrics for ROC data points, the computation is more involved. Since only the call variants
contain the score field used to rank variants, the number of (say) TP baseline indels that exceed threshold 𝑥 is not
defined. vcfeval computes a scaled count as:
This scaling ensures that the end point of the variant type specific ROC or precision/sensitivity curve ends at the
same point that is obtained when computing metrics without any threshold.
In general, it is not necessary to run any variant decomposition and/or normalization on variant call sets prior to
evaluation with vcfeval, as the haplotype aware matching process can account for representation differences.
However, since matching is at the granularity of entire variants, a single long complex call will be categorized as
either correct or incorrect, even if part of the call may match. If partial credit in the case of long calls is of interest,
vcfeval includes an option to internally decompose variants prior to matching, using the --decompose flag.
This decomposition is applied to both baseline and call variants, and any output VCFs will contain the decomposed
representation. External VCF decomposition (with more control over decomposition options) is also available via
rtg vcfdecompose.
See also:
snp, popsim, samplesim, childsim, rocplot, vcfdecompose
2.5.16 svdecompose
Synopsis:
Split composite structural variants into a breakend representation.
Syntax:
$ rtg svdecompose [OPTION]... -i FILE -o FILE
Parameters:
File Input/Output
-i --input=FILE VCF file containing variants to filter. Use ‘-‘ to read from standard input.
-o --output=FILE Output VCF file name. Use ‘-‘ to write to standard output.
Utility
-h --help Print help on command-line flag usage.
-Z --no-gzip Do not gzip the output.
--no-header Prevent VCF header from being written.
Usage:
The svdecompose command is applied to a VCF containing structural variants and converts deletion, insertion,
inversion, and tandem duplications with SVTYPE of DEL, INS, INV, and DUP, respectively, into correspond-
ing breakend events with SVTYPE=BND. svdecompose will also decompose sequence-resolved insertions and
deletions greater than --min-indel-length into breakend representation. Records of others types are passed
through without modification.
This operation can be useful for the purposes of reducing output from various structural variant callers to a com-
mon representation to better facilitate comparison with the bndeval command.
For insertions, svdecompose will represent the insertion as breakends between the reference and a “virtual hap-
lotype”, where for example, contig “<INS_A>” represents the destination of all insertions made on chromosome
A. So if another caller produced a similar insertion event (in position and/or length), the break end versions will
also be nearby on the virtual contig. For the following insertions:
1 54712 . T TTTTTTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC . . .
1 934144 I_7 C CGGAGGGGAGGGCGCGGAGCGGAGG . . .
1 934144 I_22 C CGGAGGGGAGGGCGCGGAGCGGAGGGGAGGGCGCGGAGCGGAGG . . .
See also:
bndeval
2.5.17 bndeval
Synopsis:
Evaluate called breakends for agreement with a baseline breakend set. Outputs a weighted ROC file which can
be viewed with rtg rocplot and VCF files containing false positives (called breakends not matched in the
baseline), false negatives (baseline breakends not matched in the call set), and true positives (breakends that match
between the baseline and calls).
Syntax:
Parameters:
File Input/Output
-b --baseline=FILE VCF file containing baseline variants.
--bed-regions=FILE If set, only read VCF records that overlap the ranges contained in the
specified BED file.
-c --calls=FILE VCF file containing called variants.
-o --output=DIR Directory for output.
--region=REGION If set, only read VCF records within the specified range. The format is
one of <sequence_name>, <sequence_name>:<start>-<end>,
<sequence_name>:<pos>+<length> or
<sequence_name>:<pos>~<padding>
Filtering
--all-records Use all records regardless of FILTER status (Default is to only process records
where FILTER is ”.” or “PASS”)
--bidirectional If set, allow matches between flipped breakends.
--tolerance=INT Positional tolerance for breakend matching (Default is 100)
Reporting
-m --output-mode=STRING Output reporting mode. Allowed values are [split, annotate]
(Default is split)
-O --sort-order=STRING The order in which to sort the ROC scores so that “good”
scores come before “bad” scores. Allowed values are
[ascending, descending] (Default is descending)
-f --vcf-score-field=STRING The name of the VCF field to use as the ROC score. Also valid
are “QUAL” or “INFO.<name>” to select the named VCF
INFO field (Default is INFO.DP)
Utility
-h --help Print help on command-line flag usage.
-Z --no-gzip Do not gzip the output.
Usage:
The bndeval command operates on VCF files containing breakends such as those produced by the discord
command. In particular, it considers records having the breakend structural variant type (SVTYPE=BND) as de-
fined in the VCF specification. Other types of record are ignored, but the svdecompose command can be
applied beforehand to split certain other structural variants (e.g., INV and DEL) or sequence-resolved insertions
and deletions into constituent breakend events.
The input and output requirements of bndeval are broadly similar to the vcfeval command. The primary
inputs to bndeval are a truth/baseline VCF containing expected breakends, and a query/call VCF containing the
called breakends. Evaluation can be restricted to particular regions by specifying a BED file.
The regions contained in the evaluation regions BED file are intersected with the breakend records contained
in the truth VCF in order to obtain a list of truth breakend regions. An evaluation region is included if there
is any overlapping truth VCF record (no attempt is made to look at the degree of overlap). Thus by supplying
either evaluation regions corresponding to targeted regions or larger gene-level regions bndeval can be used to
evaluate at different levels of granularity.
Similarly, the evaluation regions are intersected with the breakend records records contained in the calls VCF to
obtain called breakend regions.
The truth breakend regions are then intersected with the called breakend regions to obtain TP/FP/FN metrics. The
intersection supports a user-selectable tolerance in position. Further, be default, a breakend must occur in the same
orientation to be considered a match, but this constraint can be relaxed by supplying the --bidirectional
command line option.
bndeval outputs
Once complete, bndeval command produces summary statistics and the following primary result files in the
output directory:
• weighted_roc.tsv.gz - contains ROC data that can be plotted with rocplot
• baseline.bed.gz contains the truth breakend regions, where each BED record contains the region
status as TP or FN, the SVTYPE, and the span of the original truth VCF record.
• calls.bed.gz contains the called breakend regions, where each BED record contains the region status
as TP or FP, the SVTYPE, the span of the original calls VCF record, and the score value used for ranking
in the ROC plot.
• summary.txt contains the same summary statistics printed to standard output.
See also:
discord, svdecompose, vcfeval, rocplot
2.5.18 pedfilter
Synopsis:
Filter and convert a pedigree file.
Syntax:
Example:
Parameters:
File Input/Output
FILE The pedigree file to process, may be PED or VCF, use ‘-‘ to read from stdin.
Filtering
--keep-family=STRING Keep only individuals with the specified family ID. May be specified 0 or
more times, or as a comma separated list.
--keep-ids=STRING Keep only individuals with the specified ID. May be specified 0 or more
times, or as a comma separated list.
--keep-primary Keep only primary individuals (those with a PED individual line / VCF
sample column)
--remove-parentage Remove all parent-child relationship information.
Reporting
--vcf Output pedigree in in the form of a VCF header rather than PED.
Utility
-h --help Print help on command-line flag usage.
Usage:
The pedfilter command can be used to perform manipulations on pedigree information and convert pedigree
information between PED and VCF header format. For more information about the PED file format see Pedigree
PED input file format.
The VCF files output by the family and population commands contain full pedigree information represented
as VCF header lines, and the pedfilter command allows this information to be extracted in PED format.
This command produces the pedigree output on standard output, which can be redirected to a file or another
pipeline command as required.
See also:
family, population, mendelian, pedstats
2.5.19 pedstats
Synopsis:
Output information from pedigree files of various formats.
Syntax:
Example:
For a summary of pedigree information:
Total samples: 17
Primary samples: 17
Male samples: 9
Female samples: 8
Afflicted samples: 0
Founder samples: 4
Parent-child relationships: 26
Other relationships: 0
Families: 3
For quick pedigree visualization using GraphViz and ImageMagick, use a command-line such as:
Parameters:
File Input/Output
FILE The pedigree file to process, may be PED or VCF, use ‘-‘ to read from stdin.
Reporting
--dot=STRING Output pedigree in GraphViz format, using the supplied text as a title.
--families Output information about family structures.
--female-ids Output ids of all females.
--founder-ids Output ids of all founders.
--male-ids Output ids of all males.
--maternal-ids Output ids of maternal individuals.
--paternal-ids Output ids of paternal individuals.
--primary-ids Output ids of all primary individuals.
--simple-dot When outputting GraphViz format, use a layout that looks less like a traditional
pedigree diagram but works better with large complex pedigrees.
Utility
-h --help Print help on command-line flag usage.
Usage:
This command is used to show pedigree summary statistics or select groups of individual Ids. In addition, it is
possible to generate a simple pedigree visualization, using GraphViz, which can be saved to PNG or PDF. For
example, with the following chinese-trio.ped:
This will create a PNG image that can be displayed in any image viewing tool and contains the pedigree structure
as shown below.
For more information about the PED file format see Pedigree PED input file format.
The VCF files output by the RTG pedigree-aware variant calling commands contain full pedigree information
represented as VCF header lines, and the pedstats command can also take these VCFs as input. For example,
given a VCF produced by the population command after calling the CEPH-1463 pedigree:
See also:
family, population, pedfilter
2.5.20 rocplot
Synopsis:
Plot ROC curves from readsimeval and vcfeval ROC data files, either to an image, or using an interactive
GUI.
Syntax:
Example:
Parameters:
File Input/Output
--curve=STRING ROC data file with title optionally specified (path[=title]). May be specified 0 or
more times.
--png=FILE If set, output a PNG image to the given file.
--svg=FILE If set, output a SVG image to the given file.
--zoom=STRING Show a zoomed view with the given coordinates, supplied in the form
<xmax>,<ymax> or <xmin>,<ymin>,<xmax>,<ymax>
FILE+ ROC data file. May be specified 0 or more times.
Reporting
--hide-sidepane If set, hide the side pane from the GUI on startup.
--interpolate If set, interpolate curves at regular intervals.
--line-width=INT Sets the plot line width (Default is 2)
-P --precision-sensitivity If set, plot precision vs sensitivity rather than ROC.
--scores If set, show scores on the plot.
-t --title=STRING Title for the plot.
Utility
-h --help Print help on command-line flag usage.
Usage:
Used to produce ROC plots from the ROC files produced by readsimeval, bndeval and vcfeval. By
default this opens the ROC plots in an interactive viewer. On a system with only console access the plot can be
saved directly to an image file using the either the --png or --svg parameter.
ROC data files may be specified either as direct file arguments to the command, or via the --curve flag. The
former method is useful when selecting files using shell wild card globbing, and the latter method allows specifying
a custom title for each curve, so use whichever method is most convenient.
Strictly speaking, a true ROC curve should use rates rather than absolute numbers on the X and Y axes (e.g.
True Positive / Total Positives rather than True Positives on the Y, and False Positive / Total Negatives on the X
axis). However, there are a couple of difficulties involved with computing these rates with variant calling datasets.
Firstly, the truth sets do not include any indication of the set of negatives (the closest we may get is in the cases
of truth sets which contain a set of confidence regions, where it can be assumed that no other variants may be
present inside the specified regions); secondly even with knowledge of negative regions, how do you count the set
of possible negative calls, when a call could occupy multiple reference bases, or even (in the case of insertions)
zero reference bases. It is conceptually even possible to have a call-set contain more false positives than there are
reference bases. For this reason the ROC curves are plotted using the absolute counts.
Precision/sensitivity (also known as precision/recall) curves are another popular means of visualizing call-set ac-
curacy, and these metrics also do not require a count of Total Negatives and so cause no particular difficulty to plot.
Precision/sensitivity graphs can be selected from the command line via the --precision-sensitivity flag,
or may be interactively selected in the GUI.
An interesting result of ROC analysis is that although there may be few data points on an ROC graph, it is
possible to construct a filtered dataset corresponding to any point that lies on a straight line between two points
on the graph. (For example, using threshold A for 25% of the variants and threshold B for 75% of the variants
would result in accuracy that is 75% of the way between the points corresponding to thresholds A and B on the
ROC plot). So in a sense it is meaningful to connect points on an ROC graph with straight lines. However,
for precision/sensitivity graphs, it’s incorrect to connect adjacent points with a straight line, as this does not
correspond to achievable accuracy on the ROC convex hull and can over-estimate the accuracy. Instead, we can
plot appropriately interpolated values with the --interpolate option.
Interactive GUI
The following image shows the rocplot GUI with an example ROC plot :
• Reorder curves via drag and drop using the colored handle on the left.
• Right click within the ROC widget area to bring up a context menu that allows permanently removing that
curve, or customizing the color used for the curve
• Each curve has a slider to simulate the effect of applying a threshold on the scoring attribute. If the “show
scores” option is set, this provides an easy way to select appropriate filter threshold values, which you might
apply to variant sets using rtg vcffilter or similar VCF filtering tools.
Note: For definitions of the terminology used when evaluating caller accuracy, see: https://en.wikipedia.org/wiki/
Receiver_operating_characteristic and https://en.wikipedia.org/wiki/Sensitivity_and_specificity
Note: For a description of the precision/sensitivity interpolation, see: “The relationship between Precision-Recall
and ROC curves”, Davis, J., (2006), https://dx.doi.org/10.1145/1143844.1143874
See also:
readsimeval, bndeval, vcfeval
2.5.21 version
Synopsis:
The RTG version display utility.
Syntax:
$ rtg version
Example:
$ rtg version
Citation:
John G. Cleary, Ross Braithwaite, Kurt Gaastra, Brian S. Hilbush, Stuart Inglis,
˓→Sean A. Irvine, Alan Jackson, Richard Littin, Sahar Nohzadeh-Malakshah, Mehul
˓→Rathod, David Ware, Len Trigg, and Francisco M. De La Vega. "Joint Variant and
Parameters:
2.5.22 license
Synopsis:
The RTG license display utility.
Syntax:
$ rtg license
Example:
$ rtg license
Parameters:
There are no options associated with the license command.
Usage:
Use the license command to display license information and expiration date. Output at the command line
(standard output) shows command name, licensed status, and command release level.
See also:
help, version
2.5.23 help
Synopsis:
The RTG help command provides online help for all RTG commands.
Syntax:
List all commands:
$ rtg help
Example:
Parameters:
There are no options associated with the help command.
Usage:
Use the help command to view syntax and usage information for the main rtg command as well as individual
RTG commands.
See also:
license, version
THREE
RTG software can be shared by a group of users by installing on a centrally available file directory or shared drive.
Assignment of execution privileges can be determined by the administrator, independent of the software license
file. For commercial users, the software license prepared by Real Time Genomics (rtg-license.txt) need
only be included in the same directory as the executable (RTG.jar) and the run-time scripts (rtg or rtg.bat).
During installation on Unix systems, a configuration file named rtg.cfg is created in the installation directory.
By editing this configuration file, one may alter further configuration variables appropriate to the specific deploy-
ment requirements of the organization. On Windows systems, these variables are set in the rtg.bat file in the
installation directory. These configuration variables include:
Variable Description
RTG_MEM Specify the maximum memory for Java run-time execution. Use a G suffix for
gigabytes, e.g.: RTG_MEM=48G. The default memory allocation is 90% of
system memory.
RTG_JAVA Specify the path to Java (default assumes current path).
RTG_JAR Indicate the path to the RTG.jar executable (default assumes current path).
RTG_JAVA_OPTS Provide any additional Java JVM options.
RTG_DEFAULT_THREADS By default any RTG module with a --threads parameter will automatically
use the number of cores as the number of threads. This setting makes the
specified number the default for the --threads parameter instead.
RTG_PROXY Specify the http proxy server for TalkBack exception management (default is
no http proxy).
RTG_TALKBACK Send log files for crash-severity exception conditions (default is true, set to
false to disable).
RTG_USAGE If set to true, enable simple usage logging.
RTG_USAGE_DIR Destination directory when performing single-user file-based usage logging.
RTG_USAGE_HOST Server URL when performing server-based logging.
RTG_USAGE_OPTIONAL May contain a comma-separated list of the names of optional fields to include
in usage logging (when enabled). Any of username, hostname and
commandline may be set here.
RTG_REFERENCES_DIR Specifies an alternate directory containing metagenomic pipeline reference
datasets.
RTG_MODELS_DIR Specifies an alternate directory containing AVR models.
CPU — Multi-core operation finishes jobs faster by processing multiple application threads in parallel. By default
RTG uses all available cores of a multi-processor server node. With a command line parameter setting, RTG
operation can be limited to a specified number of cores if desired.
Memory — Adding more memory can improve performance where very high read coverage is desired. RTG
creates and uses indexes to speed up genomic data processing. The more RAM you have, the more reads you can
65
RTG Tools Operations Manual, Release 3.9
process in memory in a run. We use 48 GB as a rule of thumb for processing human data. However, a smaller
number of reads can be processed in as little as 2 GB.
Disk Capacity — Disk requirements are highly dependent on the size of the underlying data sets, the amount of
information needed to hold quality scores, and the number of runs needed to investigate the impact of varying
levels of sensitivity. Though all data is handled and stored in compressed form by default, a realistic minimum
disk size for handling human data is 1 TB. As a rule of thumb, for every 2 GB of input read data expect to add 1
GB of index data and 1 GB of output files per run. Additionally, leave another 2 GB free for temporary storage
during processing.
Demonstration system — For training, testing, demonstrating, processing and otherwise working with smaller
genomes, RTG works just fine on a newer laptop system with an Intel processor. For example, product testing in
support of this documentation was executed on a MacBook PC (Intel Core 2 Duo processor, 2.1 GHz clock speed,
1 processor, 2 cores, 3 MB L2 Cache, 4 GB RAM, 290 GB 5400 RPM Serial-ATA disk)
Clustered system — The comparison of genomic variation on a large scale demands extensive processing capa-
bility. Assuming standard CPU hardware as described above, scale up to meet your institutional or major product
needs by adding more rack-mounted boards and blades into rack servers in your data center. To estimate the num-
ber of cores required, first estimate the number of jobs to be run, noting size and sensitivity requirements. Then
apply the appropriate benchmark figures for different size jobs run with varying sensitivity, dividing the number
of reads to be processed by the reads/second/core.
Many RTG commands generate a log file with each run that is saved to the results output directory. The contents
of the file contain lists of job parameters, system configuration, and run-time information.
In the case of internal exceptions, additional information is recorded in the log file specific to the problem encoun-
tered. Fatal exceptions are trapped and notification is sent to Real Time Genomics with a copy of the log file. This
mechanism is called TalkBack and uses an embedded URL to which RTG sends the report.
The following sample log displays the software version information, parameter list, and run-time progress.
TalkBack may be disabled by adding RTG_TALK_BACK=false to the rtg.cfg configuration file (Unix) or
the rtg.bat file (Window) as described in Advanced installation configuration.
RTG has the ability to record simple command usage information for submission to Real Time Genomics. The
first time RTG is run (typically during installation), the user will be asked whether to enable usage logging. This
information may be required for customers with a pay-per-use license. Other customers may choose to send this
information to give Real Time Genomics feedback on which commands and features are commonly used or to
locally log RTG command use for their own analysis.
A usage record contains the following fields:
• Time and date
• License serial number
• Unique ID for the run
• Version of RTG software
• RTG command name, without parameters (e.g. map)
• Status (Started / Failed / Succeeded)
• A command-specific field (e.g. number of reads)
For example:
No confidential information is included in these records. It is possible to add extra fields, such as the user name
running the command, host name of the machine running the command, and full command-line parameters, how-
ever as these fields may contain confidential information, they must be explicitly enabled as described in Advanced
installation configuration.
When RTG is first installed, you will be asked whether to enable user logging. Usage logging can also be manually
enabled by editing the rtg.cfg file (or rtg.bat file on Windows) and setting RTG_USAGE=true. If the
RTG_USAGE_DIR and RTG_USAGE_HOST settings are empty, the default behavior is to directly submit usage
records to an RTG hosted server via HTTPS. This feature requires the machine running RTG to have access to the
Internet.
For cases where the machines running RTG do not have access to the Internet, there are two alternatives for
collecting usage information.
Usage information can be recorded directly to a text file. To enable this option, edit the rtg.cfg file (or rtg.
bat file on Windows), and set the RTG_USAGE_DIR to the name of a directory where the user has write permis-
sions. For example:
RTG_USAGE=true
RTG_USAGE_DIR=/opt/rtg-usage
Within this directory, the RTG usage information will be written to a text file named after the date of the current
month, in the form YYYY-MM.txt. A new file will be created each month. This text file can be manually sent to
Real Time Genomics when requested.
In this case, a local server can be started to collect usage information from compute nodes and recorded to local
files for later manual submission. To configure this method of collecting usage information, edit the rtg.cfg
file (or rtg.bat file on Windows), and set the RTG_USAGE_DIR to the name of a directory where the local
server will store usage logs, and RTG_USAGE_HOST to a URL consisting of the name of the local machine that
will run the server and the network port on which the server will listen. For example if the server will be run on a
machine named gridhost.mylan.net, listening on port 9090, writing usage information into the directory
/opt/rtg-usage/, set:
RTG_USAGE=true
RTG_USAGE_DIR=/opt/rtg-usage
RTG_USAGE_HOST=http://gridhost.mylan.net:9090/
If you wish to augment usage information with any of the optional fields, edit the rtg.cfg file (or rtg.bat file
on Windows) and set the RTG_USAGE_OPTIONAL to a comma separated list containing any of the following:
• username - adds the username of the user running the RTG command.
• hostname - adds the machine name running the RTG command.
• commandline - adds the command line, including parameters, of the RTG command (this field will be
truncated if the length exceeds 1000 characters).
For example:
RTG_USAGE_OPTIONAL=username,hostname,commandline
Some RTG commands make use of ANSI colors to visually enhance terminal output, and the decision as to
whether to colorize the output is automatically determined, although some commands also contain additional
flags to control colorization.
The default behaviour of output colorization can be configured by defining a Java system property named rtg.
default-markup with an appropriate value and supplying it via RTG_JAVA_OPTS. For example, to disable
output colorization, use:
RTG_JAVA_OPTS="-Drtg.default-markup=none"
FOUR
APPENDIX
Many RTG commands can make use of additional information about the structure of a reference genome, such
as expected ploidy, sex chromosomes, location of PAR regions, etc. When appropriate, this information may be
stored inside a reference genome’s SDF directory in a file called reference.txt.
The format command will automatically identify several common reference genomes during formatting and
will create a reference.txt in the resulting SDF. However, for non-human reference genomes, or less com-
mon human reference genomes, a pre-built reference configuration file may not be available, and will need to be
manually provided in order to make use of RTG sex-aware pipeline features.
Several example reference.txt files for different human reference versions are included as part of the RTG
distribution in the scripts subdirectory, so for common reference versions it will suffice to copy the appropriate
example file into the formatted reference SDF with the name reference.txt, or use one of these example files
as the basis for your specific reference genome.
To see how a reference text file will be interpreted by the chromosomes in an SDF for a given sex you can use the
sdfstats command with the --sex flag. For example:
Location : /data/human/ref/hg19
Parameters : format -o /data/human/ref/hg19 -I chromosomes.txt
SDF Version : 11
Type : DNA
Source : UNKNOWN
Paired arm : UNKNOWN
SDF-ID : b6318de1-8107-4b11-bdd9-fb8b6b34c5d0
Number of sequences : 25
Maximum length : 249250621
Minimum length : 16571
Sequence names : yes
N : 234350281
A : 844868045
C : 585017944
G : 585360436
T : 846097277
Total residues : 3095693983
Residue qualities : no
69
RTG Tools Operations Manual, Release 3.9
The reference file is primarily intended for XY sex determination but should be able to handle ZW and X0 sex
determination also.
The following describes the reference file text format in more detail. The file contains lines with TAB separated
fields describing the properties of the chromosomes. Comments within the reference.txt file are preceded
by the character #. The first line of the file that is not a comment or blank must be the version line.
version1
The sex field is one of male, female or either. The line-type field is one of def for default sequence settings,
seq for specific chromosomal sequence settings and dup for defining pseudo-autosomal regions. The line-setting
fields are a variable number of fields based on the line type given.
The default sequence settings line can only be specified with either for the sex field, can only be specified once
and must be specified if there are not individual chromosome settings for all chromosomes and other contigs. It is
specified with the following structure:
The ploidy field is one of diploid, haploid, polyploid or none. The shape field is one of circular or
linear.
The specific chromosome settings lines are similar to the default chromosome settings lines. All the sex field
options can be used, however for any one chromosome you can only specify a single line for either or two lines
for male and female. They are specified with the following structure:
The ploidy and shape fields are the same as for the default chromosome settings line. The chromosome-name field
is the name of the chromosome to which the line applies. The allosome field is optional and is used to specify the
allosome pair of a haploid chromosome.
The pseudo-autosomal region settings line can be set with any of the sex field options and any number of the lines
can be defined as necessary. It has the following format:
70 Chapter 4. Appendix
RTG Tools Operations Manual, Release 3.9
The regions must be taken from two haploid chromosomes for a given sex, have the same length and not go past
the end of the chromosome. The regions are given in the format <chromosome-name>:<start>-<end>
where start and end are positions counting from one and the end is non-inclusive.
An example for the HG19 human reference:
As of the current version of the RTG software the following are the effects of various settings in the reference.
txt file when processing a sample with the matching sex.
A ploidy setting of none will prevent reads from mapping to that chromosome and any variant calling from being
done in that chromosome.
A ploidy setting of diploid, haploid or polyploid does not currently affect the output of mapping.
A ploidy setting of diploid will treat the chromosome as having two distinct copies during variant calling,
meaning that both homozygous and heterozygous diploid genotypes may be called for the chromosome.
A ploidy setting of haploid will treat the chromosome as having one copy during variant calling, meaning that
only haploid genotypes will be called for the chromosome.
A ploidy setting of polyploid will treat the chromosome as having one copy during variant calling, meaning
that only haploid genotypes will be called for the chromosome. For variant calling with a pedigree, maternal
inheritance is assumed for polyploid sequences.
The shape of the chromosome does not currently affect the output of mapping or variant calling.
The allosome pairs do not currently affect the output of mapping or variant calling (but are used by simulated data
generation commands).
The pseudo-autosomal regions will cause the second half of the region pair to be skipped during mapping. During
variant calling the first half of the region pair will be called as diploid and the second half will not have calls
made for it. For the example reference.txt provided earlier this means that when mapping a male the X
chromosome sections of the pseudo-autosomal regions will be mapped to exclusively and for variant calling the
X chromosome sections will be called as diploid while the Y chromosome sections will be skipped. There may be
some edge effects up to a read length either side of a pseudo-autosomal region boundary.
The PED file format is a white space (tab or space) delimited ASCII file. Lines starting with # are ignored. It has
exactly six required columns in the following order.
Column Definition
Family Alphanumeric ID of a family group. This field is ignored by RTG commands.
ID
Individ- Alphanumeric ID of an individual. This corresponds to the Sample ID specified in the read group
ual of the individual (SM field).
ID
Paternal Alphanumeric ID of the paternal parent for the individual. This corresponds to the Sample ID
ID specified in the read group of the paternal parent (SM field).
Mater- Alphanumeric ID of the maternal parent for the individual. This corresponds to the Sample ID
nal specified in the read group of the maternal parent (SM field).
ID
Sex The sex of the individual specified as using 1 for male, 2 for female and any other number as
unknown.
Pheno- The phenotype of the individual specified using -9 or 0 for unknown, 1 for unaffected and 2 for
type affected.
Note: The PED format is based on the PED format defined by the PLINK project: http://pngu.mgh.harvard.edu/
~purcell/plink/data.shtml#ped
The value ‘0’ can be used as a missing value for Family ID, Paternal ID and Maternal ID.
The following is an example of what a PED file may look like.
# PED format pedigree
# fam-id ind-id pat-id mat-id sex phen
FAM01 NA19238 0 0 2 0
FAM01 NA19239 0 0 1 0
FAM01 NA19240 NA19239 NA19238 2 0
0 NA12878 0 0 2 0
When specifying a pedigree for the lineage command, use either the pat-id or mat-id as appropriate to the
gender of the sample cell lineage. The following is an example of what a cell lineage PED file may look like.
# PED format pedigree
# fam-id ind-id pat-id mat-id sex phen
LIN BASE 0 0 2 0
LIN GENA 0 BASE 2 0
LIN GENB 0 BASE 2 0
LIN GENA-A 0 GENA 2 0
72 Chapter 4. Appendix
RTG Tools Operations Manual, Release 3.9
RTG includes commands such as pedfilter and pedstats for simple viewing, filtering and conversion of
pedigree files.
Several RTG commands require coordinate indexed input files to operate and several more require them when the
--region or --bed-regions parameter is used. The index files used are standard tabix or BAM index files.
The RTG commands which produce the inputs used by these commands will by default produce them with ap-
propriate index files. To produce indexes for files from third party sources or RTG command output where the
--no-index or --no-gzip parameters were set, use the RTG bgzip and index commands.
The vcffilter command permits filtering VCF records via user-supplied JavaScript expressions or scripts
containing JavaScript functions that operate on VCF records. The JavaScript environment has an API provided
that enables convenient access to components of a VCF record in order to satisfy common use cases.
This section describes the supported methods to access components of an individual VCF record. In the following
descriptions, assume the input VCF contains the following excerpt (the full header has been omitted):
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA12877 NA12878
1 11259340 . G C,T . PASS DP=795;DPR=0.581;ABC=4.5 GT:DP 1/2:65 1/0:15
Within the context of a --keep-expr or record function these variables will provide access to the String
representation of the VCF column of the same name.
CHROM; // "1"
POS; // "11259340"
REF; // "G"
ALT, FILTER
INFO.{INFO_FIELD}
The values in the INFO field are accessible through properties on the INFO object indexed by INFO ID. These
properties will be the string representation of info values with multiple values delimited with “,”. Missing fields
will be represented by “.”. Assigning to these properties will update the VCF record. This will be undefined for
fields not declared in the header.
INFO.DP; // "795"
INFO.ABC; // "4,5"
INFO.DPR = "0.01"; // Will change the value of the DPR info field
{SAMPLE_NAME}.{FORMAT_FIELD}
The JavaScript String prototype has been extended to allow access to the format fields for each sample. The string
representation of values in the sample column are accessible as properties on the string matching the sample name
named after the FORMAT field ID These properties can be assigned in order to make modifications. This will be
undefined for fields not declared in the header.
'NA12877'.GT; // "1/2"
'NA12878'.GT; // "1/0"
'NA12877'.DP = "10"; // Will change the DP field of the NA12877 sample
Functions are provided that allow the addition of new INFO or FORMAT fields to the header and records. It is
recommended that the following functions only be used within the run-once portion of --javascript. They
may be called on every record, but this will be slow.
ensureFormatHeader(FORMAT_HEADER_STRING)
Add a new FORMAT field to the VCF if it is not already present. This will add a FORMAT declaration line to the
header and define the corresponding accessor methods for use in record processing.
ensureFormatHeader('##FORMAT=<ID=GL,Number=G,Type=Float,' +
'Description="Log_10 scaled genotype likelihoods.">');
ensureInfoHeader(INFO_HEADER_STRING)
Add a new INFO field to the VCF if it is not already present. This will add an INFO declaration line to the header
and define the corresponding accessor methods for use in record processing.
ensureInfoHeader('##INFO=<ID=CT,Number=1,Type=Integer,' +
'Description="Coverage threshold that was applied">');
SAMPLES
This variable contains an array of the sample names in the VCF header.
print({STRING})
74 Chapter 4. Appendix
RTG Tools Operations Manual, Release 3.9
See also:
For javascript filtering usage and examples see vcffilter
4.6 README.txt
RTG software from Real Time Genomics includes tools for the processing
and analysis of plant, animal and human sequence data from high
throughput sequencing systems. Product usage and administration is
described in the accompanying RTG Operations Manual.
No-JRE:
Linux/MacOS X:
The first time rtg is executed you will be prompted with some
questions to customize your installation. Follow the prompts.
Enter "./rtg help" for a list of rtg commands. Help for any individual
command is available using the --help flag, e.g.: "./rtg format --help"
Windows:
Test for success by entering "rtg version" at the command line. The
first time rtg is executed you will be prompted with some
questions to customize your installation. Follow the prompts.
Enter "rtg help" for a list of rtg commands. Help for any individual
command is available using the --help flag, e.g.: "rtg format --help"
76 Chapter 4. Appendix
RTG Tools Operations Manual, Release 3.9
A discussion group is now available for general questions, tips, and other
discussions. It may be viewed or joined at:
https://groups.google.com/a/realtimegenomics.com/forum/#!forum/rtg-users
Citing RTG
==========
Terms of Use
============
Patents
=======
The above copyright notice and this permission notice shall be included in
all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
4.6. README.txt 77
RTG Tools Operations Manual, Release 3.9
-------------------------
RTG software uses the bzip2 library included in the open source Ant project
(http://ant.apache.org/) for decompressing bzip2 format files, under the
following license:
Licensed under the Apache License, Version 2.0 (the "License"); you may not
use this file except in compliance with the License. You may obtain a copy of
the License at
http://www.apache.org/licenses/LICENSE-2.0
-------------------------
This code is distributed in the hope that it will be useful, but WITHOUT
ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
version 2 for more details (a copy is included in the LICENSE file that
accompanied this code).
You should have received a copy of the GNU General Public License version
2 along with this work; if not, write to the Free Software Foundation,
Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
or visit http://www.oracle.com if you need additional information or have
any questions.
-------------------------
78 Chapter 4. Appendix
RTG Tools Operations Manual, Release 3.9
4.7 Notice
Real Time Genomics does not assume any liability arising out of the application or use of any software described
herein. Further, Real Time Genomics does not convey any license under its patent, trademark, copyright, or
common-law rights nor the similar rights of others.
Real Time Genomics reserves the right to make any changes in any processes, products, or parts thereof, described
herein, without notice. While every effort has been made to make this guide as complete and accurate as possible
as of the publication date, no warranty of fitness is implied.
© 2017 Real Time Genomics All rights reserved.
Illumina, Solexa, Complete Genomics, Ion Torrent, Roche, ABI, Life Technologies, and PacBio are registered
trademarks and all other brands referenced in this document are the property of their respective owners.
4.7. Notice 79