0% found this document useful (0 votes)

12 views

Chap2 Data PDF

Uploaded by

Usama Panjutha

Available Formats

Download as PDF, TXT or read online on Scribd

0% found this document useful (0 votes)

12 views

Chap2 Data PDF

Uploaded by

Usama Panjutha

Available Formats

Download as PDF, TXT or read online on Scribd

You are on page 1/ 34

Data Mining: Data

Lecture Notes for Chapter 2

Introduction to Data Mining

by
Tan, Steinbach, Kumar

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

What is Data?

Collection of data objects and Attributes

their attributes

An attribute is a property or Tid Refund Marital

Status
Taxable
Income Cheat
characteristic of an object
1 Yes Single 125K No
– Examples: eye color of a
2 No Married 100K No
person, temperature, etc.
3 No Single 70K No
– Attribute is also known as
4 Yes Married 120K No
variable, field, characteristic,
5 No Divorced 95K Yes
or feature Objects
6 No Married 60K No
A collection of attributes
7 Yes Divorced 220K No
describe an object
8 No Single 85K Yes
– Object is also known as
9 No Married 75K No
record, point, case, sample,
10 No Single 90K Yes
entity, or instance 10

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

2
Attribute Values

Attribute values are numbers or symbols assigned

to an attribute

Distinction between attributes and attribute values

– Same attribute can be mapped to different attribute
values
 Example: height can be measured in feet or meters

– Different attributes can be mapped to the same set of

values
 Example: Attribute values for ID and age are integers
 But properties of attribute values can be different

– ID has no limit but age has a maximum and minimum value

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Measurement of Length
The way you measure an attribute is somewhat may not match
the attributes properties.
5 A 1

B
7 2

8 3

10 4

15 5

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

4
Types of Attributes

There are different types of attributes

– Nominal
 Examples: ID numbers, eye color, zip codes
– Ordinal
 Examples: rankings (e.g., taste of potato chips on a scale
from 1-10), grades, height in {tall, medium, short}
– Interval
 Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio
 Examples: temperature in Kelvin, length, time, counts

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Properties of Attribute Values

The type of an attribute depends on which of the

following properties it possesses:
– Distinctness: = 
– Order: < >
– Addition: + -
– Multiplication: */

– Nominal attribute: distinctness

– Ordinal attribute: distinctness & order
– Interval attribute: distinctness, order & addition
– Ratio attribute: all 4 properties

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

6
Attribute Description Examples Operations
Type

Nominal The values of a nominal attribute are zip codes, employee mode, entropy,
just different names, i.e., nominal ID numbers, eye color, contingency
attributes provide only enough sex: {male, female} correlation, 2 test
information to distinguish one object
from another. (=, )

Ordinal The values of an ordinal attribute hardness of minerals, median, percentiles,

provide enough information to order {good, better, best}, rank correlation,
objects. (<, >) grades, street numbers run tests, sign tests

Interval For interval attributes, the calendar dates, mean, standard

differences between values are temperature in Celsius deviation, Pearson's
meaningful, i.e., a unit of or Fahrenheit correlation, t and F
measurement exists. tests
(+, - )

Ratio For ratio variables, both differences temperature in Kelvin, geometric mean,
and ratios are meaningful. (*, /) monetary quantities, harmonic mean,
counts, age, mass, percent variation
length, electrical
current

Attribute Transformation Comments

Level

Nominal Any permutation of values If all employee ID numbers

were reassigned, would it
make any difference?

Ordinal An order preserving change of An attribute encompassing

values, i.e., the notion of good, better
new_value = f(old_value) best can be represented
where f is a monotonic function. equally well by the values
{1, 2, 3} or by { 0.5, 1,
10}.
Interval new_value =a * old_value + b Thus, the Fahrenheit and
where a and b are constants Celsius temperature scales
differ in terms of where
their zero value is and the
size of a unit (degree).

Ratio new_value = a * old_value Length can be measured in

meters or feet.

8
Discrete and Continuous Attributes

Discrete Attribute
– Has only a finite or countably infinite set of values
– Examples: zip codes, counts, or the set of words in a collection of
documents
– Often represented as integer variables.
– Note: binary attributes are a special case of discrete attributes

Continuous Attribute
– Has real numbers as attribute values
– Examples: temperature, height, or weight.
– Practically, real values can only be measured and represented
using a finite number of digits.
– Continuous attributes are typically represented as floating-point
variables.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Types of data sets

Record
– Data Matrix
– Document Data
– Transaction Data

Graph
– World Wide Web
– Molecular Structures

Ordered
– Spatial Data
– Temporal Data
– Sequential Data
– Genetic Sequence Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

10
Important Characteristics of Structured Data

– Dimensionality
 Curse of Dimensionality

– Sparsity
 Only presence counts

– Resolution
 Patterns depend on the scale

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Record Data

Data that consists of a collection of records, each

of which consists of a fixed set of attributes

Tid Refund Marital Taxable

Status Income Cheat

1 Yes Single 125K No

2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

12
Data Matrix

If data objects have the same fixed set of numeric

attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute

Such data set can be represented by an m by n matrix,

where there are m rows, one for each object, and n
columns, one for each attribute

Projection Projection Distance Load Thickness

of x Load of y load

10.23 5.27 15.22 2.7 1.2

12.65 6.25 16.22 2.2 1.1

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Document Data

Each document becomes a `term' vector,

– each term is a component (attribute) of the vector,
– the value of each component is the number of times
the corresponding term occurs in the document.
timeout

season
coach

game
score
team

ball

lost
pla

wi
n
y

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

14
Transaction Data

A special type of record data, where

– each record (transaction) involves a set of items.
– For example, consider a grocery store. The set of
products purchased by a customer during one
shopping trip constitute a transaction, while the
individual products that were purchased are the items.

TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Graph Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

16
Chemical Data

Benzene Molecule: C6H6

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Ordered Data

Sequences of transactions
Items/Events

An element of
the sequence

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

18
Ordered Data

Genomic sequence data

GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Ordered Data

Spatio-Temporal Data

Average Monthly
Temperature of
land and ocean

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

20
Data Quality

What kinds of data quality problems?

How can we detect problems with the data?
What can we do about these problems?

Examples of data quality problems:

– Noise and outliers
– missing values
– duplicate data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Noise

Noise refers to modification of original values

– Examples: distortion of a person’s voice when talking
on a poor phone and “snow” on television screen

Two Sine Waves Two Sine Waves + Noise

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

22
Outliers

Outliers are data objects with characteristics that

are considerably different than most of the other
data objects in the data set

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Missing Values

Reasons for missing values

– Information is not collected
(e.g., people decline to give their age and weight)
– Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)

Handling missing values

– Eliminate Data Objects
– Estimate Missing Values
– Ignore the Missing Value During Analysis
– Replace with all possible values (weighted by their
probabilities)

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

24
Duplicate Data

Data set may include data objects that are

duplicates, or almost duplicates of one another
– Major issue when merging data from heterogeous
sources

Examples:
– Same person with multiple email addresses

Data cleaning
– Process of dealing with duplicate data issues

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Data Preprocessing

Aggregation
Sampling
Dimensionality Reduction
Feature subset selection
Feature creation
Discretization and Binarization
Attribute Transformation

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

26
Aggregation

Combining two or more attributes (or objects) into

a single attribute (or object)

Purpose
– Data reduction
 Reduce the number of attributes or objects
– Change of scale
 Cities aggregated into regions, states, countries, etc
– More “stable” data
 Aggregated data tends to have less variability

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Aggregation

Variation of Precipitation in Australia

Standard Deviation of Average Standard Deviation of Average

Monthly Precipitation Yearly Precipitation

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

28
Sampling
Sampling is the main technique employed for data selection.
– It is often used for both the preliminary investigation of the data
and the final data analysis.

Statisticians sample because obtaining the entire set of data

of interest is too expensive or time consuming.

Sampling is used in data mining because processing the

entire set of data of interest is too expensive or time
consuming.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Sampling …

The key principle for effective sampling is the

following:
– using a sample will work almost as well as using the
entire data sets, if the sample is representative

– A sample is representative if it has approximately the

same property (of interest) as the original set of data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

30
Types of Sampling

Simple Random Sampling

– There is an equal probability of selecting any particular item

Sampling without replacement

– As each item is selected, it is removed from the population

Sampling with replacement

– Objects are not removed from the population as they are
selected for the sample.
 In sampling with replacement, the same object can be picked up
more than once

Stratified sampling
– Split the data into several partitions; then draw random samples
from each partition
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Sample Size

8000 points 2000 Points 500 Points

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

32
Sample Size
What sample size is necessary to get at least one
object from each of 10 groups.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Curse of Dimensionality

When dimensionality
increases, data becomes
increasingly sparse in the
space that it occupies

Definitions of density and

distance between points,
which is critical for
clustering and outlier
detection, become less
meaningful • Randomly generate 500 points
• Compute difference between max and min
distance between any pair of points

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

34
Dimensionality Reduction

Purpose:
– Avoid curse of dimensionality
– Reduce amount of time and memory required by data
mining algorithms
– Allow data to be more easily visualized
– May help to eliminate irrelevant features or reduce
noise

Techniques
– Principle Component Analysis
– Singular Value Decomposition
– Others: supervised and non-linear techniques

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Dimensionality Reduction: PCA

Goal is to find a projection that captures the

largest amount of variation in data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

36
Dimensionality Reduction: PCA

Find the eigenvectors of the covariance matrix

The eigenvectors define the new space

x1
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Dimensionality Reduction: ISOMAP

By: Tenenbaum, de Silva,

Langford (2000)

Construct a neighbourhood graph

For each pair of points in the graph, compute the shortest
path distances – geodesic distances

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

38
Dimensionality Reduction: PCA

Dimensions
Dimensions==206
120
160
10
40
80

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Feature Subset Selection

Another way to reduce dimensionality of data

Redundant features
– duplicate much or all of the information contained in
one or more other attributes
– Example: purchase price of a product and the amount
of sales tax paid

Irrelevant features
– contain no information that is useful for the data
mining task at hand
– Example: students' ID is often irrelevant to the task of
predicting students' GPA
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

40
Feature Subset Selection

Techniques:
– Brute-force approch:
Try all possible feature subsets as input to data mining algorithm
– Embedded approaches:
 Feature selection occurs naturally as part of the data mining
algorithm
– Filter approaches:
 Features are selected before data mining algorithm is run
– Wrapper approaches:
 Use the data mining algorithm as a black box to find best subset
of attributes

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Feature Creation

Create new attributes that can capture the

important information in a data set much more
efficiently than the original attributes

Three general methodologies:

– Feature Extraction
 domain-specific
– Mapping Data to New Space
– Feature Construction
 combining features

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

42
Mapping Data to a New Space

Fourier transform
Wavelet transform

Two Sine Waves Two Sine Waves + Noise Frequency

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Discretization Using Class Labels

Entropy based approach

3 categories for both x and y 5 categories for both x and y

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

44
Discretization Without Using Class Labels

Data Equal interval width

Equal frequency K-means

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Attribute Transformation

A function that maps the entire set of values of a

given attribute to a new set of replacement values
such that each old value can be identified with
one of the new values
– Simple functions: xk, log(x), ex, |x|
– Standardization and Normalization

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

46
Similarity and Dissimilarity

Similarity
– Numerical measure of how alike two data objects are.
– Is higher when objects are more alike.
– Often falls in the range [0,1]
Dissimilarity
– Numerical measure of how different are two data
objects
– Lower when objects are more alike
– Minimum dissimilarity is often 0
– Upper limit varies
Proximity refers to a similarity or dissimilarity
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Similarity/Dissimilarity for Simple Attributes

p and q are the attribute values for two data objects.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

48
Euclidean Distance

Euclidean Distance

n 2
dist   ( pk  qk )
k 1

Where n is the number of dimensions (attributes) and pk and qk

are, respectively, the kth attributes (components) or data
objects p and q.

Standardization is necessary, if scales differ.

Euclidean Distance

p1
point x y
2
p1 0 2
p3 p4
1
p2 2 0
p2 p3 3 1
0 p4 5 1
0 1 2 3 4 5 6

p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0

Distance Matrix

50
Minkowski Distance

Minkowski Distance is a generalization of Euclidean

Distance
1
n
dist  (  | pk  qk |r ) r
k 1
Where r is a parameter, n is the number of dimensions
(attributes) and pk and qk are, respectively, the kth attributes
(components) or data objects p and q.

Minkowski Distance: Examples

r = 1. City block (Manhattan, taxicab, L1 norm) distance.

– A common example of this is the Hamming distance, which is just the
number of bits that are different between two binary vectors

r = 2. Euclidean distance

r  . “supremum” (Lmax norm, L norm) distance.

– This is the maximum difference between any component of the vectors

Do not confuse r with n, i.e., all these distances are

defined for all numbers of dimensions.

52
Minkowski Distance

L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0
point x y
p1 0 2 L2 p1 p2 p3 p4
p2 2 0 p1 0 2.828 3.162 5.099
p3 3 1 p2 2.828 0 1.414 3.162
p4 5 1 p3 3.162 1.414 0 2
p4 5.099 3.162 2 0

L p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0

Mahalanobis Distance

mahalanobi s ( p , q )  ( p  q )  1 ( p  q )T

 is the covariance matrix of

the input data X

1 n
 j ,k   ( X ij  X j )( X ik  X k )
n  1 i 1

For red points, the Euclidean distance is 14.7, Mahalanobis distance is 6.

54
Mahalanobis Distance

Covariance Matrix:

 0.3 0.2
 
0.2 0.3
C

B A: (0.5, 0.5)
B: (0, 1)
A C: (1.5, 1.5)

Mahal(A,B) = 5
Mahal(A,C) = 4

Common Properties of a Distance

Distances, such as the Euclidean distance,

have some well known properties.
1. d(p, q)  0 for all p and q and d(p, q) = 0 only if
p = q. (Positive definiteness)
2. d(p, q) = d(q, p) for all p and q. (Symmetry)
3. d(p, r)  d(p, q) + d(q, r) for all points p, q, and r.
(Triangle Inequality)
where d(p, q) is the distance (dissimilarity) between
points (data objects), p and q.

A distance that satisfies these properties is a

metric

56
Common Properties of a Similarity

Similarities, also have some well known

properties.
1. s(p, q) = 1 (or maximum similarity) only if p = q.

2. s(p, q) = s(q, p) for all p and q. (Symmetry)

where s(p, q) is the similarity between points (data

objects), p and q.

Similarity Between Binary Vectors

Common situation is that objects, p and q, have only

binary attributes
Compute similarities using the following quantities
M01 = the number of attributes where p was 0 and q was 1
M10 = the number of attributes where p was 1 and q was 0
M00 = the number of attributes where p was 0 and q was 0
M11 = the number of attributes where p was 1 and q was 1

Simple Matching and Jaccard Coefficients

SMC = number of matches / number of attributes
= (M11 + M00) / (M01 + M10 + M11 + M00)

J = number of 11 matches / number of not-both-zero attributes values

= (M11) / (M01 + M10 + M11)

58
SMC versus Jaccard: Example

p= 1000000000
q= 0000001001

M01 = 2 (the number of attributes where p was 0 and q was 1)

M10 = 1 (the number of attributes where p was 1 and q was 0)
M00 = 7 (the number of attributes where p was 0 and q was 0)
M11 = 0 (the number of attributes where p was 1 and q was 1)

SMC = (M11 + M00)/(M01 + M10 + M11 + M00) = (0+7) / (2+1+0+7) = 0.7

J = (M11) / (M01 + M10 + M11) = 0 / (2 + 1 + 0) = 0

Cosine Similarity

If d1 and d2 are two document vectors, then

cos( d1, d2 ) = (d1  d2) / ||d1|| ||d2|| ,
where  indicates vector dot product and || d || is the length of vector d.

Example:

d1 = 3 2 0 5 0 0 0 2 0 0
d2 = 1 0 0 0 0 0 0 1 0 2

d1  d2= 3*1 + 2*0 + 0*0 + 5*0 + 0*0 + 0*0 + 0*0 + 2*1 + 0*0 + 0*2 = 5
||d1|| = (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0)0.5 = (42) 0.5 = 6.481
||d2|| = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2) 0.5 = (6) 0.5 = 2.245