Molecular Phylogeny of the Plant Pathogenic Genus Botrytis and

the Evolution of Host Specificity

Martijn Staats, Peter van Baarlen, and Jan A. L. van Kan
Wageningen University, Laboratory of Phytopathology, Wageningen, The Netherlands

The cosmopolitan genus Botrytis contains 22 recognized species and one hybrid. The current classification is largely
based on morphological characters and, to a minor extent, on physiology and host range. In this study, a classification of
the genus was constructed based on DNA sequence data of three nuclear protein-coding genes (RPB2, G3PDH, and
HSP60) and compared with the traditional classification. Sexual reproduction and the host range, important fitness traits,
were traced in the tree and used for the identification of major evolutionary events during speciation. The phylogenetic
analysis corroborated the classical species delineation. In addition, the hybrid status of B. allii (B. byssoidea 3 B. aclada)
was confirmed. Both individual gene trees and combined trees show that the genus Botrytis can be divided into two
clades, radiating after the separation of Botrytis from other Sclerotiniaceae genera. Clade 1 contains four species that all
colonize exclusively eudicot hosts, whereas clade 2 contains 18 species that are pathogenic on either eudicot (3) or
monocot (15) hosts. A comparison of Botrytis and angiosperm phylogenies shows that cospeciation of pathogens and

Downloaded from http://mbe.oxfordjournals.org/ at University of California, Santa Cruz on February 10, 2015
their hosts have not occurred during their respective evolution. Rather, we propose that host shifts have occurred during
Botrytis speciation, possibly by the acquisition of novel pathogenicity factors. Loss of sexual reproduction has occurred
at least three times and is supposed to be a consequence of negative selection.

Introduction
Fungi of the genus Botrytis Persoon are important infect species of the genera Vicia, Lens, Pisum, and
pathogens of many agronomically important crops, such as Phaseolus, all belonging to Fabaceae (Jarvis 1977).
grapevine, tomato, bulb flowers, and ornamental crops Specialized species occur on corolliferous monocotyledons
(Jarvis 1977). Botrytis diseases appear primarily as blossom and on members from the four eudicot families Fabaceae,
blights and fruit rots but also as leaf spots and bulb rots Ranunculaceae, Geraniaceae, and Paeoniaceae (Jarvis
in the field and in stored products. Botrytis species are 1977) (table 1). Narrow host range Botrytis species
necrotrophs, inducing host-cell death resulting in pro- parasitize living leaves or bulbs of their hosts but may also
gressive decay of infected plant tissue. The pathogen occur as saprophytes. In many cases, host-specific Botrytis
produces abundantly sporulating gray mycelium on in- species are able to cause primary lesions on a nonhost, but
fected tissue. Macroconidia (mitotically produced spores) these primary lesions fail to expand (Prins et al. 2000).
can be transported by wind over long distances. Botrytis Several specialists are able to infect members of the
overwinters in the soil as mycelium in decaying plant debris same plant family or the same plant species. Three species
and as sclerotia, melanized mycelial survival structures. of Botryotinia have been described occurring on the
Some species frequently produce a sexual teleomorphic buttercup family Ranunculaceae; B. calthae occurs on
stage in which ascospores are produced in an apothecium. Caltha palustris L., B. ranunculi on Ranunculus spp., and
When collected in nature, apothecia are found under cool B. ficariarum on Ficaria verna. Occasionally B. calthae
weather conditions, arising from sclerotia, which have has been observed infecting Ficaria verna, but otherwise
developed on decayed plant parts in moist soil. Botrytis and they are specific to their host (Hennebert and Groves
its sexual form Botryotinia Whetzel comprise 22 species 1963). As many as seven Botrytis species occur on Allium
and one hybrid (Hennebert 1973; Yohalem, Nielsen, and spp., which is one of the largest genera of the petaloid
Nicolaisen 2003) and are classified within the family
monocotyledons (Friesen, Fritsch, and Blattner 2004).
Sclerotiniaceae Whetzel (Inoperculate Discomycetes).
Allium includes several economically important species,
Delineation of species has traditionally been based on
such common onion, garlic, chives, and leek, all of which
morphological characteristics, especially macroconidium
ontogeny, and species have been named based on host are infected by B. byssoidea, B. aclada, and B. allii. The
association. Most species have a worldwide distribution or last species is an allodiploid hybrid based on mitotic
occur wherever their host crops are grown (Jarvis 1977). chromosome counts, conidia size, restriction fragment
The genus Botrytis comprises one generalist, B. length polymorphism (RFLPs), and sequence data (Niel-
cinerea, infecting over 200 eudicot hosts, especially sen and Yohalem 2001; Yohalem, Nielsen, and Nicolaisen
senescing or otherwise weakened or wounded plants 2003; Shirane, Masuko, and Hayashi 1989). B. byssoidea
(MacFarlane 1968). All other species are considered and B. aclada are considered to be its parental species
specialists with a narrow host range. They infect only one (Nielsen and Yohalem 2001; Yohalem, Nielsen, and
or a few closely related species within the same plant genus Nicolaisen 2003). Other Botrytis species infecting Allium
(Mansfield 1980), with the exception of B. fabae, which can spp. have a more restricted host range; they have become
specialized on wild Allium spp. or infect only one or two
economically important Allium crops.
Key words: Botrytis, necrotrophic fungus, coevolution, host shift, To investigate whether closely related Botrytis
Bayesian inference, molecular phylogeny.
species are pathogenic on closely related plant species,
E-mail [email protected].
we compared phylogenies of fungi and their angiosperm
Mol. Biol. Evol. 22(2):333–346. 2005
doi:10.1093/molbev/msi020 hosts (APG 2003) for possible cospeciation. Parallel
Advance Access publication October 20, 2004 cladogenesis between host and pathogens would be
Molecular Biology and Evolution vol. 22 no. 2 Ó Society for Molecular Biology and Evolution 2005; all rights reserved.
334 Staats et al.

Table 1
Species Recognized by Hennebert (1973), Sexual Stage, Disease Symptoms, and Typical Host Plant Species
Sexual Common Typical Host/Tissue
Species Stage Disease Name Specificity Host-Plant Species Host-Plant Family
B. cinerea Pers. / Yes Gray mould Fallen leaves, fruits, .235 plant species Polyphagous on
B. fuckeliana and flowers eudicotyledons
(de Bary) Whetzel
B. fabae Sardi~
na No Chocolate spot Leaves of bean Vicia spp. L., Fabaceae
Pisum spp. L,
Lens spp. L.,
Phaseolus spp. L.
B. calthae Hennebert Yes Stem of marsh-marigold Caltha palustris Ranunculaceae
B. ranunculi Hennebert Yes Buttercup Ranunculus spp. L. Ranunculaceae
B. ficariarum Hennebert Yes Buttercup Ficaria verna Ranunculaceae
B. pelargonii Roed Yes Leaves of geranium Pelargonium spp. L. Geraniaceae
B. paeoniae Oud. No Peony blight Stems of cultivated peonies Paeonia spp. L. Paeoniaceae

Downloaded from http://mbe.oxfordjournals.org/ at University of California, Santa Cruz on February 10, 2015
B. hyacinthi Westerd. No Hyacinth fire Leaves of hyacinth Hyacinthus spp. L. Hyacinthaceae
and Beyma
B. tulipae Lind No Tulip fire Leaves, stems, and flowers Tulipa spp. L. Liliaceae
of cultivated tulips
B. elliptica (Berk.) Yes Lily fire Leaves, stems, and flowers Lilium spp. L. Liliaceae
Cooke of cultivated lilies
B. squamosa Walker Yes Onion leaf blight Leaves of onion Allium cepa Alliaceae
B. aclada (Fresen.) No Gray-mould neck rot Bulbs of onion, garlic, Allium spp. L. Alliaceae
Yohalem and leek
B. alliia(Munn) Yohalem No Gray-mould neck rot Bulbs of onion, garlic, Allium spp. L Alliaceae
and leek
B. byssoidea Walker/ Yes Mycelial neck rot Bulbs of onion, garlic, Allium spp. L. Alliaceae
B. allii (Sawada) and leek
Yamamoto
B. globosa Raabe Yes Neck rot Wild garlic Allium ursinum. Alliaceae
B. porri Buchw. Yes Bulbs of garlic, leek Allium spp. L. Alliaceae
B. sphaerosperma Yes Blight Three-cornered Leek Allium triquetrum Alliaceae
Buchw. (White-flowered Onion)
B. narcissicola Kleb. Ex Yes Smoulder mould Bulbs of narcissus Narcissus spp. L. Amaryllidaceae
Westerd. and Beyma
B. polyblastis Dowson Yes Narcissus fire Leaves of narcissus Narcissus spp. L. Amaryllidaceae
B. galanthina No Blight Snowdrop Galanthus spp. L. Amaryllidaceae
(Berk. and Br.) Sacc.
B. convoluta Whetzel Yes Botrytis rhizome rot Rhizomes of cultivated iris Iris spp. L. Iridaceae
and Drayton
B. croci Cooke and Massee No Crocus blight Leaves of cultivated crocus Crocus spp. L. Iridaceae
B. gladiolorum Timm. / Yes Gladiolus blight Stems of cultivated Gladiolus spp. L. Iridaceae
B. draytonii (Budd. and gladiolus
Wakef.) Seaver
a
Hybrid species according to Yohalem, Nielsen, and Nicolaisen 2003.

indicative of ancient coevolution, a reciprocal process in nuclear ribosomal internal transcribed spacer (ITS) DNA
which characteristics of one organism evolve in response sequences and concluded that the Botryotinia teleomorph
to specific characteristics of another. The process of along with Botrytis anamorphs constitute a monophyletic
coevolution between pathogen and host is often based on lineage. However, the relationships among members of the
gene-for-gene relationships, in which resistance gene genus Botrytis could not be resolved because of the limited
alleles in the host are matched by virulence gene alleles phylogenetically informative ITS sequence characters.
in the pathogen (Flor 1955; Heath 1991; Thompson and In this study, we made use of fragments of three single-
Burdon 1992; Kniskern and Rausher 2001). Coevolution is copy nuclear DNA (nDNA) genes encoding glyceralde-
more likely expected between obligate biotrophic patho- hyde-3-phosphate dehydrogenase (G3PDH), Heat-shock
gens or symbionts and their host plants than it is with Protein 60 (HSP60), and DNA-dependent RNA polymerase
necrotrophic pathogens. Obligate parasites do not kill host subunit II (RPB2). All three genes encode enzymes that are
cells but get their nutrients either by penetrating living involved in basic cellular processes, and both G3PDH and
cells or by establishing close contact with them. Necro- RPB2 evolve at moderate evolutionary rates (Smith 1989;
trophic pathogens such as Botrytis need to kill host cells Berbee, Pirseyedi, and Hubbard 1999; Liu, Whelen, and
before the cells are invaded by the fungus (Clark and Hall 1999; Liu and Hall 2004). The first objective was to
Lorbeer 1976; van Baarlen, Staats, and van Kan 2004), clarify the evolutionary history of the genus Botrytis and
which might suggest absence or a low degree of coevolu- investigate whether DNA sequence data support the
tion. There is very limited knowledge about the phyloge- classical species delineation. Second, the effect of the
netic relationships among members of the genus Botrytis. hybrid species B. allii on tree structure was examined
Holst-Jensen, Vaage, and Schumacher (1998) analyzed because hybrids may cause topological changes, especially
 Phylogeny of the Fungal Genus Botrytis 335

when parents are distantly related (McDade 1992). The third son to a 100-bp DNA Ladder (GibcoBRL). PCR products
objective was to trace the evolution of the reproductive were purified using the QIAquick PCR purification kit
mode and the host-range spectrum within the genus Botrytis. (Qiagen) following manufacturer’s instructions. Purified
PCR products were sequenced (BaseClear Holding B.V.,
Leiden, The Netherlands) in both directions using
Materials and Methods
M13(-20) forward and M13 reverse primers.
Fungal Isolates
Six PCR products were cloned because the yield of
A set of 52 isolates (table 2) was chosen to represent all amplified product was insufficient for direct sequencing:
the recognized Botrytis species. Most strains were obtained M. fructigena 9201 (locus RPB2), B. hyacinthi MUCL442
from the Belgian Coordinated Collections of Microorgan- (loci RPB2, HSP60 and G3PDH), B. byssoidea MUCL94
isms (BCCM, Belgium, Brussels). Additional strains were (locus HSP60), and B. calthae MUCL1089 (locus G3PDH).
obtained from the Centraalbureau voor Schimmelcultures Furthermore, multiple alleles of allopolyploid B. allii
(CBS, Utrecht, The Netherlands) and personal collections. strains MUCL403 and MUCL1150 were cloned as well.
Single isolates of Sclerotinia sclerotiorum and Monilinia PCR products were extracted from 1% agarose gel using

Downloaded from http://mbe.oxfordjournals.org/ at University of California, Santa Cruz on February 10, 2015
fructigena were selected as outgroups on the basis of the GFX PCR purification kit (Amersham Biosciences).
a phylogenetic study by Holst-Jensen, Vaage, and Schu- PCR products were then ligated into a pGemT-Easy Vector
macher (1998). Strains were grown on malt agar (Oxoid) for (Promega) using standard protocols and introduced into
10 to 14 days in the dark at 188C. electrocompetent Escherichia coli DH5a cells. Trans-
formed cells were spread on LB-plates, each containing
100 mg/ml ampicillin, 20 mg/ml X-gal, and 0.1 mM IPTG
DNA Extraction, Amplification, and Sequencing
and incubated at 378C overnight. White colonies were
Mycelial tissue was harvested, lyophilized, submerged screened for correct insert size using gene-specific PCR
in liquid nitrogen and ground into a powder. Genomic primers. To distinguish between alleles of each locus,
DNA was extracted from 10 to 20 mg dry tissue using the 20 positive clones of B. allii strains MUCL1150 and
Puregene DNA isolation kit (Gentra systems Inc./Biozym MUCL403 were selected for restriction digestion. Restric-
systems, Landgraaf, The Netherlands) according to the tion enzymes were selected based on polymorphic sites
manufacturer’s instructions. DNA pellets were dissolved between aligned sequences of each locus of the presumed
in 100 ml of TE (10mM Tris-HCl [pH 8.0], 1mM EDTA) parental species B. aclada (isolate MUCL8415) and
and stored at 48C or 2208C. B. byssoidea (isolate MUCL94). Predicted restriction
Primer combinations (table 3) were designed or profiles were compared with digestion patterns of cloned
modified to amplify regions of three nuclear DNA genes fragments of both parental species, as well as both B. allii
(G3PDH, HSP60, and RPB2). PCR primers to amplify the strains. G3PDH and HSP60 fragments were digested with
RPB2 region that have been described previously by Liu, the restriction enzyme EcoRV (Promega), whereas RPB2
Whelen, and Hall (1999) were slightly modified. To fragments were digested with HindIII (Promega). Sub-
amplify G3PDH and HSP60, forward and reverse primers sequently, individual clones, containing different alleles,
were designed based on homologous gene sequences from were selected for sequencing based on restriction profiles.
GenBank and a Botrytis cinerea cDNA library (Geno- Clones were sequenced in both directions using SP6 and T7
scope, Centre National de Séquençage, France). For primers (see table 3).
amplification of ITS region, primers ITS1 and ITS4 were
used (White et al. 1990). To facilitate batch sequencing Phylogenetic Analysis
of different PCR products, primers were extended with
M13(-20) forward primers or M13 reverse primers. Automated sequence outputs were imported into
PCR amplification was carried out in a 50-ml reaction Vector NTI suite 8.0 (InforMax, Inc.) for visual inspection
mixture that contained 10 to 50 ng of genomic DNA, 1X of chromatographs and assembly of the contigs. For un-
GeneAmp PCR buffer (PerkinElmer, Norwalk, Conn.), resolved basepairs, the IUPAC nucleotide coding system
200 mM of each deoxynucleoside triphosphate (Promega, was used. Sequences were compared between complemen-
Madison, Wis.), 0.2 pmol of each primer (Amersham tary strands for reading errors and aligned using ClustalX
Pharmacia Biotech), 2 mM MgSO4 and 1.0 U of AmpliTaq version 1.8 (Thompson et al. 1997). Alignments were
DNA polymerase (PerkinElmer). Amplifications were visually inspected and adjusted manually when necessary.
carried out in a Peltier Thermal Cycler-200 (Biozym, Land- Regions of sequences with ambiguous alignment were
graaf, The Netherlands). The following thermocycling excluded from all analyses (table 4). The full alignment
pattern was used to amplify HSP60 and RPB2 gene containing all three loci is deposited in TREEBASE
fragments: 948C for 5 min (1 cycle); 948C for 30 s, 558C (accession number S1170). Individual sequences are de-
for 30 s, and 728C for 90 s (35 cycles), and then 728C for posited in GenBank under accession numbers AJ704990
10 min (1 cycle). The same program with an annealing to AJ705044, AJ716290 to AJ716305, AJ716046 to
temperature of 648C was used for G3PDH gene fragments. AJ716103, and AJ745662 to AJ745716 (see table 2).
For amplification of the ITS region, an amplification proto- The basic data set for each locus consisted of 50 taxa:
col was used as described by White et al. (1990). The PCR 48 Botrytis specimens and two outgroup species. Phylo-
products were separated on a 1% agarose-Tris-borate- genetic analyses were conducted for each of the three loci
EDTA (13 TBE) gel, containing ethidium bromide. The (RPB2, HSP60, and G3PDH) and for a combined data
fragment size of the PCR product was verified by compari- matrix of all three. To assess the impact of hybrids on tree
336 Staats et al.

Table 2
Isolates of Botrytis, Origin, Year of Collection, and GenBank Accession Numbers for DNA Sequences Used in This Study
GenBank Accession Number of Sequences
Species Collection Number Geographic Origin Year ITS RPB2 HSP60 G3PDH
B. aclada PRI006a — — AJ716295 AJ745665 AJ716051 AJ704993
MUCL3106b,c USA 1961 N.D.j AJ745663 AJ716049 AJ704991
MUCL8415b,c Germany 1965 N.D. AJ745664 AJ716050 AJ704992
B. allii MUCL403b,c The Netherlands 1957 N.D. AJ745666 (allele 1) AJ716055 (allele 1) AJ704996 (allele 1)
AJ745667 (allele 2) AJ716056 (allele 2) AJ704997 (allele 2)
AJ716057 (allele 3)
AJ716058 (allele 4)
MUCL1150b,c Norway 1960 N.D. AJ745668 (allele 1) AJ716052 (allele 1) AJ704994 (allele 2)
AJ745669 (allele 2) AJ716053 (allele 2) AJ704995 (allele 1)
AJ716054 (allele 3)
B. byssoidea MUCL94b,c,d USA 1923 N.D. AJ745670 AJ716059 AJ704998
B. calthae CBS 175.63e USA 1961 AJ716302 AJ745671 AJ716060 AJ704999
MUCL1089b

Downloaded from http://mbe.oxfordjournals.org/ at University of California, Santa Cruz on February 10, 2015
Belgium 1960 N.D. AJ745672 AJ716061 AJ705000
MUCL2830b USA 1961 N.D. AJ745673 AJ716062 AJ705001
B. convoluta 9801f The Netherlands, Lisse 1998 AJ716304 AJ745679 AJ716068 AJ705007
MUCL11595b USA 1968 N.D. AJ745680 AJ716069 AJ705008
B. cinerea SAS56g Italy — AJ716294 AJ745677 AJ716067 AJ705006
SAS405g Italy — N.D. AJ745678 AJ716066 AJ705005
B05.10h — 1994 N.D. AJ745674 AJ716063 AJ705002
BC7i The Netherlands 1970 N.D. AJ745675 AJ716064 AJ705003
MUCL87b,d The Netherlands 1928 N.D. AJ745676 AJ716065 AJ705004
B. croci MUCL436b The Netherlands 1968 N.D. AJ745681 AJ716070 AJ705009
B. elliptica BE9714f The Netherlands, Elsloo — AJ716300 AJ745684 AJ716073 AJ705012
BE9610f The Netherlands — N.D. AJ745683 AJ716072 AJ705011
BE0022f The Netherlands, Smilde 2001 N.D. AJ745682 AJ716071 AJ705010
B. fabae CBS 109.57e The Netherlands 1957 AJ716303 AJ745685 AJ716074 AJ705013
MUCL98b,d Spain 1929 N.D. AJ745686 AJ716075 AJ705014
B. ficariarum CBS 176.63d,e Belgium 1960 AJ716296 AJ745687 AJ716076 AJ705015
MUCL376b Belgium 1957 N.D. AJ745688 AJ716077 AJ705016
B. galanthina MUCL435b The Netherlands 1958 N.D. AJ745689 AJ716079 AJ705018
MUCL3204b The Netherlands 1963 N.D. AJ745690 AJ716078 AJ705017
B. gladiolorum 9701f — 1997 N.D. AJ745691 AJ716080 AJ705019
MUCL3865b The Netherlands, Andijk 1963 N.D. AJ745692 AJ716081 AJ705020
B. globosa MUCL444b Belgium 1958 N.D. AJ745693 AJ716083 AJ705022
MUCL21514b UK 1963 N.D. AJ745694 AJ716082 AJ705021
B. hyacinthi 0001f The Netherlands, Lisse 1999 AJ716297 AJ745695 AJ716084 AJ705023
MUCL442b The Netherlands, Breezand 1958 N.D. AJ745696 AJ716085 AJ705024
B. narcissicola MUCL18857b UK 1972 N.D. AJ745698 AJ716086 AJ705025
MUCL2120b Canada 1961 N.D. AJ745697 AJ716087 AJ705026
B. paeoniae MUCL16084b Belgium 1970 N.D. AJ745700 AJ716089 AJ705028
0003k The Netherlands 2002 AJ716298 AJ745699 AJ716088 AJ705027
B. pelargonii CBS 497.50d,e Norway 1949 AJ716290 AJ745662 AJ716046 AJ704990
MUCL1152b Norway 1960 N.D. AJ745701 AJ716090 AJ705029
B. polyblastis MUCL21492b UK 1963 N.D. AJ745703 AJ716092 AJ705031
CBS287.38d,e UK 1938 AJ716291 AJ745702 AJ716091 AJ705030
B. porri MUCL3234b,d — 1926 AJ716292 AJ745704 AJ716093 AJ705032
MUCL3349b Belgium 1963 N.D. AJ745705 AJ716094 AJ705033
B. ranunculi CBS178.63d,e USA 1963 N.D. AJ745706 AJ716095 AJ705034
B. sphaerosperma MUCL21481b UK 1963 AJ716293 AJ745708 AJ716096 AJ705035
MUCL21482b UK 1963 N.D. AJ745709 AJ716097 AJ705036
B. squamosa PRI026a — — AJ716299 AJ745707 AJ716100 AJ705039
MUCL1107b,d USA 1923 N.D. AJ745710 AJ716098 AJ705037
MUCL9112b The Netherlands 1966 N.D. AJ745711 AJ716099 AJ705038
B. tulipae BT9830f The Netherlands 2000 AJ716301 AJ745713 AJ716102 AJ705041
BT9001f The Netherlands 2000 N.D. AJ745712 AJ716101 AJ705040
BT9901f The Netherlands, Apeldoorn 2000 N.D. AJ745714 AJ716103 AJ705042
B. anthophila CBS122.26d,e The Netherlands 1926 AJ716305 N.D. N.D. N.D.
M. fructigena 9201l — 1992 N.D. AJ745715 AJ716047 AJ705043
S. sclerotiorum 484l — — N.D. AJ745716 AJ716048 AJ705044
a
Dr. P. van den Boogert, Plant Research International, Wageningen.
b
Belgium Coordinated Collection of Microorganisms (BCCM).
c
Yohalem, Nielsen, and Nicolaisen 2003.
d
Type, neotype or epitype specimen.
e
Centraalbureau voor Schimmelcultures, Fungal Biodiversity Center (CBS-KNAW).
f
Applied Research Plant and Environment, Research Unit Flower Bulbs.
g
Faretra, Antonacci, and Pollastro 1988.
h
Büttner et al. 1994.
i
Van der Vlugt-Bergmans et al. 1992.
j
N.D. ¼ Not Determined.
k
Applied Research Plant and Environment, Research Unit Glasshouse Horticulture.
l
Department of Biological Farming systems, Wageningen University.
 Phylogeny of the Fungal Genus Botrytis 337

Table 3
Primers Used for PCR Amplification and Sequencing
Primer Name Target Region Primer Sequence (59–39) Reference or Position
G3PDHfor1 G3PDH gtgactgtaaaacgacggccagtATTGACATCGTCGCTGTCAACGA 790–817a
G3PDHrev1 gtgaccaggaaacagctatgaccACCCCACTCGTTGTCGTACCA 1769–1789a
HSP60for1 HSP60 gtgactgtaaaacgacggccagtCAACAATTGAGATTTGCCCACAAG 651–674b
HSP60rev1 gtgaccaggaaacagctatgaccGATGGATCCAGTGGTACCGAGCAT 1750–1776b
RPB2for1 RPB2 gtgactgtaaaacgacggccagtGATGATCGTGATCATTTCGG Modified from Yajuan et al. (1999)
RPB2rev1 gtgaccaggaaacagctatgaccCCCATAGCTTGCTTACCCAT
ITS11 ITS gtgactgtaaaacgacggccagtTCCGTAGGTGAACCTGCGG Modified from White et al. (1990)
ITS41 gtgaccaggaaacagctatgaccTCCTCCGCTTATTGATATGC
M13 (220) forward — TGTAAAACGACGGCCAGT
M13 Reverse — CAGGAAACAGCTATGACC
SP6 SP6 promotor GATTTAGGTGACACTATAG
T7 T7 promotor TAATACGACTCACTATAGGG
a

Downloaded from http://mbe.oxfordjournals.org/ at University of California, Santa Cruz on February 10, 2015
Base pair coordinates in homologous gene in Sclerotinia sclerotiorum (AF417110).
b
Base pair coordinates in homologous gene in Coccidioides immitis (U81786).

structure, separate analyses were performed for the three supported clades (
63%). Search type was set to ‘‘fast’’
DNA regions with and without hybrid taxa. Basic data sets stepwise-addition (for individual loci) or full heuristic (for
plus five to eight hybrids were analyzed separately. All combined analysis). Jackknife values were generated by
alleles of each locus of B. allii MUCL1150 and B. allii randomly deleting 37% of the characters for 10,000
MUCL403, as well as of B. aclada MUCL3106 were replicates and using ‘‘Jac’’ resampling (Farris et al. 1996).
treated as hybrid taxa. Because multiple alleles were found Bayesian analyses were performed using MrBayes
for hybrid taxa, combined analysis was performed with the version 3.0b4 (Ronquist and Heulsenbeck 2003). Each run
basic data set only. consisted of four incrementally heated Markov chains run
Parsimony analyses were carried out using the simultaneously, with heating values set to default (0.2).
software package PAUP* version 4.0b10 (Swofford 2002) Default uniform priors were used for all model parameters
on a G4 Power Macintosh. The following settings were (six substitution rates, four base frequencies, proportion of
used: heuristic search with tree bisection-reconnection invariable sites, and alpha value of gamma distribution).
(TBR) branch swapping, with MULPARS (keeping all Data partitions were set up for all coding and noncoding
equally most-parsimonious trees) on, 1,000 replicates of regions of each locus. HSP60 and G3PDH both contained
random taxon-addition order, and all character trans- two introns and two exons. For both loci individually, the
formations treated as equally likely (Fitch parsimony two introns were pooled, and the two exons were pooled
[Fitch 1971]). To minimize the time spent searching large and analyzed as two partitions. Likelihood model param-
numbers of trees, a limit of five trees was set for each eters were separately optimized during MCMC searches
replicate. After completing the replicates, all trees found for each data partition. Markov chains were initiated from a
were then used as starting trees for another round of random tree and run for five-million generations; samples
swapping, with no limit to the number of trees. Gaps were were taken every 100th generation. Convergence among
treated as fifth character state, and multistate characters chains was monitored by examining plots of log-likelihood
were treated as uncertain. A jackknife analysis was carried values. Burn-in period (i.e. lack of improvement of log-
out to assess data structure and identify significant likelihood values) was evaluated visually. All samples
taken before burn-in were discarded in PAUP*, and the
remaining samples were used to determine posterior prob-
Table 4 ability (PP) distributions. Each run was performed twice.
Summary of the RPB2, HSP60, G3PDH, and Combined Bayesian 50% majority-rule consensus trees were gener-
Sequence Alignments
ated in PAUP*. Branches with at least 63% jackknife
HSP60 G3PDH RPB2 Combined support and with at least 0.95 Bayesian PP were considered
Total/mean as well supported.
positionsa 983/977 890/886 1096/1093 2969/2956 Concordance of combined data sets was evaluated by
Total intron comparing jackknife topologies via visual inspection and
size (bp)/number
of introns 88/2 121/2 31/1 240/5
partition homogeneity tests (PHT [Farris et al. 1995])
Excluded 4–8 none none 1100–1104 implemented with PAUP*. Visual inspection permits the
positionsb 15–19 1111–1115 precise location of areas of strong discordance (branches
183–192 1279–1288 conflicting with jackknife values at least 85% and Bayes PP
Phylogenetic at least 0.95) between phylogenies generated by different
informative
characters data sets. PHTs were carried out for all pairwise combina-
(substitutions/ tions of the three data sets and for all data sets combined
indels) 158 (157/1) 126 (125/1) 203 (201/2) 487 (483/4) using heuristic search (TBR) with 100 random-addition
a
Total positions in the alignment/mean number of positions averaged across
replicates and informative characters only. The null hypoth-
taxa. esis of congruence was rejected if P , 0.001 (Darlu and
b
Excluded positions caused by ambiguous alignment. Lecointre 2002; Dettman, Jacobson, and Taylor 2003).
338 Staats et al.

with listed Botrytis cinerea or Sclerotinia sclerotiorum

sequences. The ITS sequence of B. anthophila Bondartsev,
a species reported in Jarvis (1977), was identical to
Rhizoctonia sp. ITS sequences, and this sequence was,
therefore, excluded from further analyses. An alignment
of ITS characters, consisting of 453 nucleotide positions
of the sequences listed here (table 2) and of sequences of
Botrytis species reported by Holst-Jensen, Vaage, and
Schumacher (1998), contained a limited number of single-
tons and phylogenetic informative characters (data not
shown). Therefore, ITS sequence data were excluded from
further analyses.

Analysis of G3PDH Sequence Data and the Influence

Downloaded from http://mbe.oxfordjournals.org/ at University of California, Santa Cruz on February 10, 2015
of Hybrid Taxa on Tree Structure
The basic sequence matrix (table 4) consists of 890
sites, of which 186 (21%) were variable characters and 126
(14%) were potentially parsimony informative. Analysis of
G3PDH sequences with equal (Fitch) weights resulted
in two equally most-parsimonious trees of 312 steps, with
a consistency index (CI) of 0.73 and a retention index (RI)
of 0.89. Relationships among the main clades were
topologically identical in MP and Bayesian consensus
trees (data not shown), except for some minor differences.
Comparison between replicate Bayesian analyses resulted
in identical majority-rule consensus trees, with only
marginally lower mean log-likelihood values (22998.75
and 23025.33). Bayesian PP and jackknife percentages of
branches are included on the MP semistrict consensus tree
in figure 1. The semistrict consensus tree topology of the
FIG. 1.—Semistrict consensus of two most-parsimonious trees based
on G3PDH data. This tree was compatible overall in highly supported two most-parsimonious trees (MPTs) contains 24 nodes
lineages to the Bayesian 50% majority-rule consensus tree. Jackknife with at least 63% jackknife and at least 95% PP support.
frequencies (10,000 replicates) are shown above each node; Bayesian The G3PDH data set plus hybrids consists of 53 taxa,
posterior probabilities (PP) are shown below each node. Letters indicate including two alleles of both B. allii MUCL1150 and B.
major clades with significant or strong support (see table 5). A dash
indicates support for the branch was less than 50% jackknife and less than
allii MUCL403. The heuristic search yielded 11 MPTs
0.50 PP. with higher tree length and slightly lower CI (L ¼ 323, CI
¼ 0.71, and RI ¼ 0.89). MP and Bayesian analyses resulted
Functional characters were mapped onto the molecular in almost identical trees (data not shown). The semistrict
phylogeny using MacClade version 4 (Maddison and consensus of those fundamental trees recovers the same
Maddison 2000): reproductive mode (two states; strictly major clades as in the G3PDH data sets without hybrid
asexual or asexual and sexual); host-plant group (two states; taxa, and branch support was only marginally lower (table
monocotyledons or eudicotyledons) and host-plant family 5). Within these trees, one allele of B. allii strain
(10 states; Hyacinthaceae, Liliaceae, Alliaceae, Amarylli- MUCL1150 (allele 1) and two alleles of B. allii strain
daceae, Iridaceae, Paeoniaceae, Geraniaceae, Ranuncula- MUCL403 (alleles 1 and 2) are placed in a clade together
ceae, Fabaceae, or Polyphagous on eudicotyledons). All with B. aclada (strains MUCL8415, MUCLPRI006, and
characters were equally weighted under parsimony. Char- MUCL3106). Allele 2 of B. allii strain MUCL403 is
acter states from literature (Jarvis 1977, 1980; Hennebert placed together with B. byssoidea.
and Groves 1963; Hennebert 1973) are listed in table 1.
Analysis of HSP60 Sequence Data and the Influence
Results of Hybrid Taxa on Tree Structure
In preliminary experiments, sequence data of eight The basic sequence matrix consists of 983 characters,
protein-coding loci and the noncoding ITS region were from which 20 positions were removed because of ambi-
acquired for multiple isolates of three Botrytis species. The guity in the alignment (table 4). Of the remaining 963
three most-informative loci (G3PDH, HSP60, and RPB2) characters, 225 (23.4%) were variable, and 158 (16.4%)
were used as starting point for this study. A total of were potentially phylogenetically informative. The Fitch
188 new sequences of 54 specimens are reported here. parsimony recovered 320 shortest trees, each 373 steps
Sequences of protein-coding gene fragments and ITS long (CI ¼ 0.74, RI ¼ 0.90). The Bayesian tree was
sequences were first evaluated in a standard GenBank consistent with the consensus of these trees, and sepa-
Blast search. Nearly all obtained sequences corresponded rate Bayesian analyses resulted in identical trees (mean
 Phylogeny of the Fungal Genus Botrytis 339

0.73 0.89 312

0.71 0.89 323

0.74 0.90 373

0.69 0.89 404

0.73 0.91 439

0.70 0.91 459

0.72 0.89 1,151

Lowercase letters indicate significantly supported branches (jackknife branch support at least 63% and Bayesian PP at least 0.95). Capital letters indicate strongly supported branches (jackknife branch support at least 85% and
CI RI Steps

Bayesian PP at least 0.95). Dashes indicate unsupported branches (jackknife branch support less than 50% and Bayesian PP less than 0.95). Clades that, in addition to wild terminals, include hybrids are also considered recovered.
Most-Parsimonious
Cladograms
Number of

320
11

320

80
6
2

7
Basal to B. aclada and

Basal to B. aclada and

Basal to B. aclada and

Placement of Hybrids

B. byssoidea

B. byssoidea

B. byssoidea

Downloaded from http://mbe.oxfordjournals.org/ at University of California, Santa Cruz on February 10, 2015
—
—

—
—
—
T

T
T
t
t
Major Clades with Significant or Strong Support Recovered in Semistrict Consensusa

S
S
S

S
S
R
R
R

R
R
—
—
—

—
—

q
—
—

P
P

P
P
Cladistic Behavior of RPB2, HSP60, G3PDH, and Combined Data Sets with and Without Hybrid Taxa

O
O
O

O
O
—

—
—

—
N
N
M

M
M

M
M

M
—
—

—
—

l
l
—

—
—

—
—

—
k

FIG. 2.—Semistrict consensus of 320 most-parsimonious trees based

on HSP60 data. This tree was compatible overall in highly supported
—

—
—

J
J

lineages to the Bayesian 50% majority-rule consensus tree. Jackknife

—
—

frequencies (10,000 replicates) are shown above each node; Bayesian

I
i

i
i

posterior probabilities (PP) are shown below each node. Letters indicate
—

—
—

—
—

H
H

major clades with significant or strong support (see table 5). A dash
indicates support for the branch was less than 50% jackknife and less than
—
—
G
G

G
g

0.50 PP.
—

—
—

F
F

F
—

—
—

E
e
e

log-likelihood values 23357.89 and 23390.86 [data not

—

—
—

—
—

shown]). Bayesian PP and jackknife percentages of

—

—
—

branches are included on the MP semistrict consensus

c

tree in figure 2. The semistrict consensus tree topology of

—

—
—

the 320 MTPs contains 23 nodes with at least 63%

A
A

A
A

A
A

jackknife and at least 95% PP support.

Parsimony-Informative of Ingroup
Number

The HSP60 data set plus hybrids consist of 58 taxa,

Taxa
48
53

48
56

48
53

48

including three alleles of B. allii strain MUCL1150 and

four alleles of B. allii strain MUCL403. Fitch analysis
gave 320 trees of 404 steps, with CI ¼ 0.69 and RI ¼ 0.89.
Hybrid taxa had strong influence on tree structure in both
Number of

Characters

MP and Bayesian analyses, resulting in the collapse of

126
129

158
160

203
205

487

(sub)clades e, and k (table 5). MP and Bayesian analyses

resulted in almost identical topologies (data not shown);
however, there are also important differences. Bayesian
analysis strongly supported (100% PP) a large clade
G3PDH1 hybrid

HSP601 hybrid

containing members of clade e, B. convoluta, B. paeoniae,

RPB21 hybrid

and a subclade (98% PP) placing hybrids as basal members

Combined
Table 5

of their derived parents B. byssoidea and B. aclada. This

G3PDH

HSP60
Locus

RPB2

clade is highly supported by Bayesian posterior probabil-

a

ities but is not present at all in the jackknife tree.

340 Staats et al.

The RPB2 data set plus hybrids consisted of 55 taxa,

including two alleles of both B. allii strain MUCL1150 and
B. allii strain MUCL403. The heuristic search yielded six
MPTs with higher tree length and slightly lower CI (L ¼
459, CI ¼ 0.70, and RI ¼ 0.91). MP and Bayesian analyses
resulted in topologically identical trees (data not shown).
The semistrict consensus of those fundamental trees
recovers the same major clades as the basic data set (table
5). However, one extra clade was recovered, although with
low support (,50% jackknife and 94% PP), consisting of
clade O, B. aclada (MUCL8415, MUCLPRI006, and
MUCL3106), and B. allii (MUCL1150 allele 1 and
MUCL403 alleles 1 and 2). Allele 2 of B. allii strain
MUCL1150 was placed together with B. byssoidea.

Downloaded from http://mbe.oxfordjournals.org/ at University of California, Santa Cruz on February 10, 2015
Furthermore, as a result of hybrid taxa, jackknife branch
support for nodes E and G decreased from strongly
supported (86% and 87%, respectively) to well supported
(73% and 78%, respectively).

Assessment of Between–Data Sets Congruence

The G3PDH tree was largely congruent with the RPB2
tree; in both trees, there is good support for three main
(sub)clades (R, O, and G [figs. 1 and 3]), but arrangements
within each clade could not be clearly resolved. At the base
of the tree, some resolution is provided; however, branches
indicating relationships between clades are not supported
(fig. 3). In comparison to the RPB2 topology, more
resolution is provided by HSP60 at the base of the tree
FIG. 3.—Semistrict consensus of seven most-parsimonious trees
based on RPB2 data. This tree was compatible overall in highly supported
(figs. 2 and 3). Contrary to the RPB2 tree, the positions of B.
lineages to the Bayesian 50% majority-rule consensus tree. Jackknife galanthina and B. hyacinthi/B. croci have been exchanged,
frequencies (10,000 replicates) are shown above each node; Bayesian as well as of B. polyblastis and B. tulipae. As with RPB2,
posterior probabilities (PP) are shown below each node. Letters indicate HSP60 placed B. porri as part of a basal trichotomy.
major clades with significant or strong support (see table 5). A dash Jackknife topologies were used to test whether the three
indicates support for the branch was less than 50% jackknife and less than
0.50 PP. data sets have different underlying phylogenetic histories.
Strong incongruence (.85% jackknife and
0.95 PP)
between RPB2 and HSP60 phylogenies was evident in the
Analysis of RPB2 Sequence Data and the Influence of placement of B. cinerea strain B05.10 and B. polyblastis.
Hybrid Taxa on Tree Structure None of the strongly supported clades was incongruent
between the other data sets (RPB2 versus G3PDH and
The basic sequence matrix consists of 1096 positions, G3PDH versus HSP60). The PHT was used as an
of which 274 (25%) were variable and 203 (18.5%) were alternative method to determine whether each possible
potentially parsimony informative (table 4). Analysis of combination of loci differs significantly in phylogenetic
RPB2 sequences with equal (Fitch) weights resulted in structure. No significant conflict was detected for all
seven equally most-parsimonious trees of 439 steps, with pairwise comparisons of each locus (RPB2-HSP60,
a CI of 0.73 and an RI of 0.91. Relationships among the RPB2-G3PDH, and HSP60-G3PDH; 0.007
P
0.001)
main clades were topologically identical in MP and and the three combined (P ¼ 0.001).
Bayesian consensus trees (data not shown). Comparison
between replicate Bayesian analyses resulted in identical
Molecular Phylogeny Distinguishes Two Major Groups
majority-rule consensus trees, with only marginally lower
mean log-likelihood values (23955.80 and 23970.45; Because no significant between–data set incongru-
not shown). Bayesian PP and jackknife percentages of ence was detected and because the individual jackknife
branches are included on the MP semistrict consensus topologies produced nearly identical results, the three
tree in figure 3. Of the three individual regions, RPB2 regions were combined directly. Analysis of this combined
provided the highest number of significantly supported matrix resulted in 80 trees of 1,151 steps (CI ¼ 0.72 and RI
nodes (26 nodes with at least 63% jackknife and at least ¼ 0.89). The trees were 27 steps longer than the combined
95% PP support), which are mainly located at the terminal number of steps from the RPB2, HSP60, and G3PDH trees
branches. The RPB2 topology contains the three main (table 5). The Bayesian tree was consistent with the MP
(sub)clades (R, O, and E) that also occur in the combined tree, but as with the RPB2 MP tree, B. polyblastis was
analysis (table 5), although relationships among these strongly placed (Bayesian PP ¼ 0.99) as a sister taxa to B.
clades remained unresolved. narcissicola, B. gladiolorum, and B. byssoidea (see figures
 Phylogeny of the Fungal Genus Botrytis 341

Downloaded from http://mbe.oxfordjournals.org/ at University of California, Santa Cruz on February 10, 2015
FIG. 4.—Molecular phylogeny for 48 Botrytis taxa and two outgroup species based on combined G3PDH, HSP60, and RPB2 data. (A) Semistrict
consensus of 80 most-parsimonious trees. Jackknife frequencies (10,000 replicates) are shown above each node; Bayesian posterior probabilities (PP)
are shown below each node. Letters indicate major clades with significant or strong support (see table 5). A dash indicates the support for the branch
was less than 50% jackknife and less than 0.50 PP. Bars indicate the (sub)clades. (B) Bayesian inference showing a 50% majority-rule consensus tree
(mean log-likelihood ¼ 210389.27) from a five-million generation MCMC analysis.

3, 4A, and 4B). Furthermore, B. tulipae was placed basal to two isolates of B. hyacinthi did not appear to be mono-
the node tying B. globosa and B. sphaerosperma. The phyletic, because they lacked shared characters that dis-
relative branching order of ingroup species and mean log- tinguished them as a group (fig. 4B).
likelihood values were comparable among two replicate Based upon the semistrict consensus tree, two main
Bayesian analyses (210389.27 and 210402.63 [data not clades were identified in the genus Botrytis, and clade 2 was
shown]). In the combined molecular phylogeny, the divided into five subclades, as within this clade strongly
overall number of supported nodes was greater (26) than supported clusters of species could be identified. The base of
for the trees of each separate analysis. Also, most nodes the tree is characterized by a deep split leading to clade 1 and
had greater support, especially at the spine, and most were clade 2. Clade 1 consists of the species B. calthae, B. fabae,
supported strongly. The exception involved the positions B. cinerea, and B. pelargonii and is separated from clade
of the B. cinerea B05.10 and B. polyblastis, which were 2 by a relatively long branch. The internode separating
poorly resolved as a result of discordant positions of both B. pelargonii from B. cinerea was very short, reflecting the
species in separate analyses (see figures 2 and 3). In high amount of interspecific sequence similarity between
contrast to other relationships in the genus, placement of B. both species. There was only one unique polymorphism on
polyblastis and B. tulipae was unresolved. a total of 2,955 bp between both species.
Multiple isolates of the same species usually clustered B. aclada and B. paeoniae are less closely related to
together, and their gene sequences were identical or varied other taxa grouping at a basal position of clade 2 (81%
at fewer sites within species in the aligned sequence jackknife and 1.0 PP), and they were, therefore, assigned
positions than between species. Molecular phylogenetic to subclade 2a. Individual gene trees did not support this
analysis of the DNA sequences supports the traditional clade, although both species always grouped closely
morphological species classification. In addition, the hy- together. B. convoluta could not unambiguously be placed
brid status of B. allii (B. byssoidea 3B. aclada [Yohalem, in either subclade within clade 2 and has, therefore, been
Nielsen, and Nicolaisen 2003]) was confirmed (fig. 5). The assigned to subclade 2d. Both subclade 2b and subclade 2c
342 Staats et al.

Loss of Sexual Reproduction Has Evolved Three Times

Two important fitness traits, reproductive mode and
host-range spectrum, were expressed as multistate ‘‘char-
acters’’ and optimized on the cladogram (fig. 4A) using
parsimony. Sexual reproduction has not been found in
seven species, five of which parasitize monocot hosts and
two parasitize eudicot hosts (table 1). Based on repro-
ductive mode, sexual reproduction was reconstructed as
the ancestral condition (fig. 6A). Strict asexual reproduc-
FIG. 5.—Schematic representation of sequence alignment of multiple tion was inferred to be a homoplasious trait, and loss of sex
HSP60 alleles for allopolyploid B. allii (strains MUCL403 and appears to have occurred three times. Two groups, con-
MUCL1150) and its presumed parental species B. aclada (isolate
MUCL8415) and B. byssoidea (isolate MUCL94). Black and gray lines taining two and four strictly asexual reproducing Botrytis
indicate stretches of sequence polymorphisms of B. aclada MUCL8415 species are present in the tree (B. aclada/B. paeoniae
and B. byssoidea MUCL94, respectively. Black and gray arrows indicate and B. hyacinthi/B. croci/B. galanthina/B. tulipae). Within

Downloaded from http://mbe.oxfordjournals.org/ at University of California, Santa Cruz on February 10, 2015
EcoRV restriction endonuclease cleavage sites. clade 1, the asexual species B. fabae separates from a clade
predominated by sexual reproduction. There is indication
for a reversal from strictly asexual reproduction to sexual
were defined based on high support values (100/1.0
reproduction of six taxa in clade 2c.
and 99/1.0, respectively) in combined analysis and the
consistent support in separate analyses. The relationships
between B. ranunculi and B. ficariarum in subclade 2b and Host and Pathogen Phylogenies Are Not Congruent
between B. hyacinthi and B. croci in subclade 2c were
unresolved. Although B. porri is closely related, there was To assess the possible occurrence of cospeciation
no support for its placement in either subclade within clade patterns between Botrytis species and their hosts, the
2 in combined and separate nDNA analyses. B. porri distribution of host-plant family or angiosperm group
was, therefore, placed in a separate clade, designated as was mapped on the cladogram (fig. 6B and C). The order
subclade 2e. Asparagales is parasitized by 14 of the previously
recognized Botrytis species, the order Ranunculales by
three species, and the Liliales by two species. Three eudicot
The Allodiploid Hybrid B. allii May Contain Up to Four orders contain one specialist Botrytis species, and these
Different Alleles orders can be parasitized by the generalist B. cinerea as
To confirm earlier reports about the hybrid status of well. Botrytis species parasitizing either eudicot or mono-
B. allii (Nielsen and Yohalem 2001; Yohalem, Nielsen, cot hosts do not tend to cluster together (fig. 6B). Within
and Nicolaisen 2003) restriction profiles and sequence data clade 2, transitions from pathogens infecting monocot hosts
of cloned fragments were compared with those of its to eudicot hosts seem to have occurred twice. Furthermore,
parental species B. aclada and B. byssoidea. Clones of B. Botrytis species parasitizing hosts from the same plant
aclada strain MUCL8415 and B. byssoidea strain family appear to be unrelated (fig. 6C). The best example
MUCL94 could be distinguished based on the unique of incongruency occurs in the host-plant family Ranuncu-
digestion patterns among the two species. Among cloned laceae, containing three Botrytis species, of which B.
fragments of B. allii (strains MUCL1150 and MUCL403), calthae clusters in clade 1, and the species B. ficariarum/
digestion patterns of either the B. aclada-type or the B. B. ranunculi cluster in clade 2b.
byssoidea-type (data not shown) were detected for all three
loci, indicating the presence of the two parental alleles.
Discussion
However, in case of HSP60, divergent patterns were also
DNA Sequence Data Support the Morphological
detected. Fragment sizes could be explained by the
Species Delineation
presence of three restriction sites (fig. 5), of which two
sites are present in B. byssoidea and one is present in B. In the present study, we conducted molecular phylo-
aclada. Alleles were sequenced to verify this interpreta- genetic analyses of 22 Botrytis species and one hybrid. Our
tion. For HSP60, four alleles were identified for B. allii analysis provides the first comprehensive phylogenetic
strain MUCL403 and three alleles were identified for B. study of the entire genus. Our analysis further supports
allii strain MUCL1150. Hybrid alleles contained stretches monophyly of the genus Botrytis, as has previously been
of sequences originating from both parental alleles (fig. 5). proposed by Holst-Jensen, Vaage, and Schumacher 1997.
For the G3PDH and RPB2 genes, hybrid alleles have also The phylogenetic analyses of DNA sequence data show
been found despite identical restriction patterns in both that the sequences from multiple isolates of the same
parental alleles. species group together and, therefore, support the classical
The HSP60 locus of B. aclada strain MUCL3106 was Botrytis species status (Hennebert 1973; Jarvis 1977).
identical to B. byssoidea except for two polymorphic sites, Morphological characters, together with DNA sequence
whereas both RPB2 and G3PDH were identical to B. information, can be used to identify Botrytis species; for
aclada strain MUCL8415. Because fragments of B. aclada instance, in a diagnostic key of Botrytis species. Such a key
strain MUCL3106 were directly sequenced, allelic variants may be a potentially powerful tool for diagnostics of this
have not been detected for each locus. important group of plant pathogens.
 Phylogeny of the Fungal Genus Botrytis 343

The combined analysis of all three loci supported two

main clades (fig. 4) and provides more resolution than
individual gene phylogenies (fig. 1–3). This result shows
the value of conducting phylogenetic analysis on multiple
genes, which is an established tool to address complex
phylogenetic questions (Rokas et al. 2003; Soltis, Soltis,
and Chase 1999; O’Donnell et al. 1998).
The taxonomic status of B. croci and B. hyacinthi
remains uncertain; both species exhibit high sequence
similarity, which makes the separation into distinct species
questionable. In this study, data of B. croci were based on
a single isolate, so additional sequencing is needed to re-
solve its status as a separate species.
Reports about the hybrid status of B. allii (Nielsen

Downloaded from http://mbe.oxfordjournals.org/ at University of California, Santa Cruz on February 10, 2015
and Yohalem 2001; Yohalem, Nielsen, and Nicolaisen
2003) were confirmed. Interspecific hybrid species were
identified by the presence of multiple HSP60, RPB2, and
G3PDH gene copies that consistently grouped with B.
aclada and B. byssoidea within the Botrytis phylogeny.
The occurrence of up to four different alleles per locus (fig.
5) is indicative of a diploid, dikaryotic genome. However,
higher ploidy levels or aneuploidy in these isolates cannot
be excluded. The selection of alleles for sequence analysis
was based on polymorphic digestion patterns in individual
clones of amplified loci; additional alleles that were
nonpolymorphic in restriction sites may have escaped
our attention. The mixture of parental and recombinant
alleles indicates that reciprocal recombination and gene
conversion have occurred several times during diversifi-
cation within the hybrid B. allii. These hybrids were placed
as basal members of the clade that includes their parents
(table 5). Major topological change was caused by hybrid
sequences in the HSP60 phylogeny, resulting in the
collapse of the portion of the cladogram that included
the hybrid’s parents. In case of RPB2 and G3PDH, the
cladistic relationships remained largely unchanged, caus-
ing only a slight decrease in support values in branches
leading to the hybrid’s parents. Except for B. alli, none of
the 22 Botrytis species appeared to be hybrids, nor was
there any indication from sequence data or host-plant
range that they arose by hybridization.

Incongruence of Host and Pathogen Phylogenies

Does Not Support Cospeciation
Comparison of the phylogenies of the angiosperm
families (APG 2003) and Botrytis (fig. 4) showed that
Botrytis species that parasitize hosts from one plant family
do not often cluster together. A prominent example is
found within the eudicot family Ranunculaceae, where B.
calthae on the one hand and B. ficariarium/B. ranunculi on
the other hand cluster apart in the Botrytis clades 1 and 2,
respectively (fig. 6C). Also, the six Botrytis species
infecting Alliaceae are widely dispersed over clade 2.
Conversely, the related species B. aclada and B. paeoniae,
clustering in clade 2a, are pathogens of monocot and
eudicot hosts, respectively. Thus, there is no evidence for
cospeciation of Botrytis species and their hosts. The FIG. 6.—Reconstructions of character-state evolution mapped onto
observed lack of congruence between pathogen and host the combined molecular phylogeny (the same topology as in figure 4A)
for Botrytis under parsimony: (A) reproductive mode, (B) host-plant
trees could be explained by host shifts. Host plants group, and (C) host-plant family.
occupying similar habitats and growing during the same
344 Staats et al.

period of year offer possibilities for host shifting (Roy secondary metabolite, tulipalin A, is toxic to all Botrytis
2001; Nikoh and Fukatsu 2000). Knowledge of the species, except B. tulipae (Schönbeck and Schlösser
distribution of genetic variation would have aided finding 1976). B. tulipae is the only Botrytis species able to infect
centers of origin of Botrytis species, and data on genetic/ tulip and it neutralizes tulipalin A enzymatically (our
geographical associations would allow us to perform unpublished data), suggesting a causal relation between
nested clade analyses to better delineate species based on host specificity and defense compound detoxification. We
sequence data. Unfortunately, detailed knowledge on the propose that Botrytis speciation was driven by host shifts,
geographic distribution, centers of origin, and fossil data of resulting from the acquisition of pathogenicity genes that
Botrytis species are lacking. In addition, information on confer novel or wider host specificity.
population dynamics and genetic variation is lacking for
most Botrytis species. Studies on genetic variation have
Loss of Sexual Reproduction in Botrytis Species May
thus far only been performed with small population sizes
Result from Negative Selection
(Van der Vlugt-Bergmans et al. 1993; Muňoz et al. 2002;
Huang et al. 2001), with one exception (Giraud et al. Parasitic sclerotiniaceous fungi differ from their

Downloaded from http://mbe.oxfordjournals.org/ at University of California, Santa Cruz on February 10, 2015
1997). saprophytic conspecifics in their ability to survive in the
The ability of Botrytis species to infect living host absence of hosts by means of sclerotia, whereas sapro-
plants may result from a combination of at least four phytes can only survive relatively mild adverse periods as
factors (see below): (1) possession of pathogenicity factors mycelium in decayed host tissues (discussed in Willetts
(e.g., toxins and cell-wall degrading enzymes) that confer [1997]). Furthermore, the sclerotia serve as maternal
the ability to kill and invade plant tissue (reviewed by parent in the production of apothecia, containing the
Prins et al. [2000]), (2) the ability to avoid or counteract sexual ascospores.
plant resistance mechanisms, (3) the ability to survive Sexual reproduction has at least three times been lost
outside host-plant tissue under less favorable (e.g., low in Botrytis (fig. 6A). It is most parsimonious to assume that
humidity, UV irradiation) conditions, and (4) the ability to sexual reproduction was the ancestral form of reproduction
reproduce and disperse. of early Botrytis species. Botryotinia teleomorphs are
generally found on decaying plant material in shaded
locations with high humidity. The warm, humid climates
Pathogenicity May Have Evolved from Saprotrophy via
that prevailed during the origin of present-day angiosperm
Acquisition of Pathogenicity Factors
Botrytis hosts were favorable for this form of reproduction
In the genera Cochliobolus (Turgeon 2000) and (Willetts 1997). In drier climates with more intense solar
Alternaria (Thomma 2003), the production of host-specific radiaton, the thin-walled, easily dehydrated ascospores are
toxins is an important factor that distinguishes the possibly not an efficient manner of dispersal. The thick-
necrotrophic pathogenic species from their saprophytic walled, dehydration-tolerant and UV-tolerant macroconi-
relatives. Such toxins mediate the currently described host- dia likely evolved as an adaptation to low humidity and
parasite specificity. It was proposed that plant pathogenic higher UV irradiation, conferring the capacity to Botrytis
Cochliobolus species evolved from saprophytic or weakly species to infect the aerial parts of plants. We propose that
pathogenic ancestors by the acquisition of genes involved loss of sexual reproduction in Botrytis may reflect habitat
in host-specific toxin production, possibly by horizontal adaptation. In present-day drier habitats and under condi-
gene transfer (Turgeon 2000). tions of low humidity, ascospores are not produced, and
Could plant pathogenic Botrytis species have evolved only the asexual macroconidia are formed. This condition
from saprophytic ancestors? Like saprophytic fungi, may result in negative selection against sexual reproduc-
Botrytis species produce oxalic acid, extracellular cell-wall tion. Under conditions adverse for sexual spore production
degrading enzymes (ten Have et al. 2002; Wubben et al. and dispersal, investment in the production of the energy-
1999), and oxidases (e.g., Edlich et al. 1989; Schouten et al. costly teleomorph (Willetts 1997) will be wasted and
2002; Rolke et al. 2004). Oxalic acid acidifies plant tissue selected against, leading to loss of sexual reproduction. It
to facilitate cell-wall hydrolysis (Dutton and Evans, 1996). should be noted that microconidia, the ‘‘male’’ spermatial
However, in the case of Botrytis, cell-wall degradation is gametes, and sclerotia are still formed in exclusively asex-
preceded by host-cell killing. Earlier studies of Botrytis ually reproducing Botrytis species. Although the capacity
diseases (reviewed by Brown [1965]) had already demon- to produce macroconidia confers a selective advantage in
strated that killing of plant cells and tissue maceration less humid habitats, the majority of Sclerotiniaceae spp. do
were distinct processes, likely with different causal agents. not produce macroconidia.
Brown (1965) proposed the involvement of a colloidal
toxin, possibly an enzyme with protease or lipase activity. Natural Interspecific Hybrids May Accelerate the Origin
This hypothesis was further supported by reports that
of Novel Species
B. cinerea secretes a phospholipase able to induce cyto-
plasmic leakage (Shepard and Pitt 1976). The production of The occurrence of natural hybrids in the group of
toxins conferring host specificity was reported for B. fabae Botrytis species causing onion neck rot and the resulting
infecting Vicia faba (Harrison 1980) and B. elliptica gene flow poses a difficulty for the maintenance of species
infecting lily (van Baarlen, Staats, and van Kan 2004). identity. Nielsen and Yohalem (2001) suggested that
Additional factors mediating host-parasite specificity polyploidization may have been the result of parasexual
are those that help to overcome plant resistance. The tulip hybridization of B. aclada and B. byssoidea coinfecting
 Phylogeny of the Fungal Genus Botrytis 345

onions. Alternatively, hybrid offspring may have been the Dutton, M. V., and C. S. Evans. 1996. Oxalate production by
result of interspecific sexual crosses (review by Schardl fungi: its role in pathogenicity and ecology in the soil
and Craven [2003]). Of the two parental species, only environment. Can. J. Microbiol. 42:881–895.
B. byssoidea has a sexual stage (table 1). During the Edlich, W., G. Lorenz, H. Lyr, E. Nega, and E.-H. Pommer.
1989. New aspects on the infection mechanism of Botrytis
hybridization events leading to the hybrid B. allii, the
cinerea. Pers. Neth. J. Plant Pathol. 95:53–62.
sclerotia of B. byssoidea have likely functioned as Faretra, F., E. Antonacci, and S. Pollastro. 1988. Sexual
recipient for the spermatia (microconidia) produced by behaviour and mating system of Botryotinia fuckeliana,
the presumed asexual B. aclada. At present, it is unknown teleomorph of Botrytis cinerea. J. Gen. Microbiol. 134:
whether the resulting hybrid offspring may only propagate 2543–2550.
vegetatively or whether backcrosses and crosses between Farris, J. S., V. A. Albert, M. Kallersjo, D. Lipscomb, and A. G.
hybrid offspring are possible. Repeated backcrossing to Kluge. 1996. Parsimony jackknifing outperforms neighbor-
the parents may not be possible because of unequal joining. Cladistics 12:99–124.
chromosome number (Futuyma 1986). The hybridization Farris, J. S., M. Källersjö, A. G. Kluge, and C. Bult. 1995.
event could be of recent origin because few mutations have Testing significance of incongruence. Cladistics 10:315–319.
Fitch, W. M. 1971. Toward defining the course of evolution:

Downloaded from http://mbe.oxfordjournals.org/ at University of California, Santa Cruz on February 10, 2015
accumulated in hybrid sequences, as was suggested pre-
minimum change for a specific tree topology. Syst. Zool.
viously by Nielsen and Yohalem (2001). Moreover, the 20:406–416.
observed differences in nucleotide sequence may originate Flor, H. H. 1955. Host-parasite interaction in flax rust:
from intraspecific variation present in both parental popu- its genetics and other implications. Phytopathology 45:
lations. There is no evidence that the hybridization events 680–685.
have led to host-range expansion within the B. byssoidea- Friesen, N., R. M. Fritsch, and F. R. Blattner. 2004. Phylogeny
aclada-allii complex, and hybrids do not exhibit increased and new intrageneric classification of Allium L. (Alliaceae)
pathogenicity to onion (Yohalem, Nielsen, and Nicolaisen based on nuclear ribosomal DNA ITS sequences. (in press)
2003). The combination of interspecific sex, gene flow, Futuyma, D. J. 1986. Evolutionary biology. Sinauer Associates,
and ploidy cycling gives ample opportunity for novel Sunderland, Mass.
genotypes to arise, eventually differentiating into novel Giraud, T., D. Fortini, C. Levis, P. Leroux, and Y. Brygoo. 1997.
RFLP markers show genetic recombination in Botryotinia
species (Kondrashov 1997). fuckeliana (Botrytis cinerea) and transposable elements reveal
two sympatric species. Mol. Biol. Evol. 14:1177–1185.
Harrison, J. G. 1980. The production of toxins by Botrytis fabae
Acknowledgments in relation to growth of lesions on field bean leaves at different
humidities. Ann. Appl. Biol. 95:63–72.
The authors are grateful to Wilbert Flier for assistance Heath, M. C. 1991. The role of gene-for-gene interactions in
in phylogenetic analyses and stimulating discussion, to determination of host species diversity. Phytopathology
Freek Bakker and Pedro Crous for critical review of the 81:127–130.
manuscript. This research was supported by the Dutch Hennebert, G. L. 1973. Botrytis and Botrytis-like genera.
Technology Foundation STW, applied science division Persoonia 7:183–204.
Hennebert, G. L., and J. W. Groves. 1963. Three new species of
of NWO and the technology program of the Ministry of
Botryotinia on Ranunculaceae. Can. J. Bot. 41:341–370.
Economic Affairs (project WEB.5564). Holst-Jensen, A., M. Vaage, and T. Schumacher. 1998. An
approximation to the phylogeny of Sclerotinia and related
genera. Nordic J. Bot. 18:705–719.
Literature Cited Huang, J., T. Hsieh, G. A. Chastagner, and T. Hsiang. 2001.
Clonal and sexual propagation in Botrytis elliptica. Mycol.
APG. 2003. An update of the angiosperm phylogeny group Res. 105:833–842.
classification for the orders and families of flowering plants: Jarvis, W. R. 1977. Botryotinia and Botrytis species; taxonomy,
APG II. Bot. J. Linn. Soc. 141:399–436. physiology and pathogenicity. Monograph No. 15, Canadian
Berbee, M. L., M. Pirseyedi, and S. Hubbard. 1999. Cochliobolus Department of Agriculture, Ottawa.
phylogenetics and the origin of known, highly virulent ———. 1980. Taxonomy. Pp. 1–18 in J. R. Coley-smith, K.
pathogens, inferred from ITS and glyceraldehyde-3-phosphate Verhoeff, W. R. Jarvis, eds. The biology of Botrytis.
dehydrogenase gene sequences. Mycologia 91:964–977. Academic Press, London.
Brown, W. 1965. Toxins and cell-wall dissolving enzymes in Kniskern, J., and M. D. Rausher. 2001. Two modes of host-
relation to plant disease. Annu. Rev. Phytopath. 3:1–21. enemy coevolution. Popul. Ecol. 43:3–14.
Büttner, P., F. Koch, K. Voigt, T. Quidde, S. Risch, R. Blaich, B. Kondrashov, A. S. 1997. Evolutionary genetics of life cycles.
Bruckner, and P. Tudzynski. 1994. Variations in ploidy Annu. Rev. Ecol. Syst. 28:391–435.
among isolates of Botrytis cinerea: implications for genetic Liu, Y., and B. D. Hall. 2004. Body plan evolution of
and molecular analyses. Curr. Genet. 25:445–450. ascomycetes, as inferred from an RNA polymerase II
Clark, C. A., and J. W. Lorbeer. 1976. Comparative histopathol- phylogeny. Proc. Natl. Acad. Sci. USA 101:4507–4512.
ogy of Botrytis squamosa and B. cinerea on onion leaves. Liu, Y., S. Whelen, and B. D. Hall. 1999. Phylogenetic
Phytopathology 66:1279–1289. relationships among ascomycetes: evidence from an RNA
Darlu, P., and G. Lecointre. 2002. When does the incongruence polymerase II subunit. Mol. Biol. Evol. 16:1799–1808.
length difference test fail? Mol. Biol. Evol. 19:432–437. MacFarlane, H. H. 1968. Review of Applied Mycology. Pp.
Dettman, J. R., D. J. Jacobson, and J. W. Taylor. 2003. A 820 in plant host-pathogen index to volumes 1–40 (1922–
multilocus genealogical approach to phylogenetic species 1968).
recognition in the model eukaryote Neurospora. Evolution Maddison, W. P., and D. R. Maddison. 2000. MacClade. Sinauer
57:2703–2720. Associates, Sunderland, Mass.
346 Staats et al.

Mansfield, J. W. 1980. The biology of Botrytis. Pp 181–218 in J. Shirane, N. M. Masuko, and Y. Hayashi. 1989. Light microscopy
R. Coley- Smith, K. Verhoeff, and W. R. Jarvis, eds. The observation of nuclei and mitotic chromosomes of Botrytis
biology of Botrytis. Academic Press, London. species. Phytopathology 79:728–730.
McDade, L. A. 1992. Hybrids and phylogenetic systematics II. Soltis, P. S., D. E. Soltis, and M. W. Chase. 1999. Angiosperm
The impact of hybrids on cladistic analysis. Evolution phylogeny inferred from multiple genes as a tool for
46:1329–1346. comparative biology. Nature. 402:402–404.
Muňoz G., P. Hinrichsen, Y. Brygoo, and T. Giraud. 2002. Smith, T. L. 1989. Disparate evolution of yeasts and filamentous
Genetic characterisation of Botrytis cinerea populations in fungi indicated by phylogenetic analysis of glyceraldehydes-
Chile. Mycol. Res. 106:594–601. 3-phosphate dehydrogenase genes. Proc. Natl. Acad. Sci.
Nielsen, K., and D. S. Yohalem. 2001. Origin of a polyploid USA 86:7063–7066.
Botrytis pathogen through interspecific hybridization between Swofford, D. L. 2002. PAUP*: phylogenetic analysis using
Botrytis aclada and B. byssoidea. Mycologia 93:1064–1071. parsimony (*and other methods), version 4.0b10. Sinauer
Nikoh, N., and T. Fukatsu. 2000. Interkingdom host jumping Associates, Sunderland, Mass.
underground: phylogenetic analysis of entomoparasitic fungi ten Have, A., K. B. Tenberge, J. A. E. Benen, P. Tudzynski,
of the genus Cordyceps. Mol. Biol. Evol. 17:629–638. J. Visser, and J. A. L. van Kan. 2002. The contribution of
O’Donnell, K., H. C. Kistler, E. Cigelnik, and R. C. Ploetz. 1998. cell wall degrading enzymes to pathogenesis of fungal plant

Downloaded from http://mbe.oxfordjournals.org/ at University of California, Santa Cruz on February 10, 2015
Multiple evolutionary origins of the fungus causing Panama pathogens. Pp. 341–358 in F. Kempken, ed. The Mycota, Vol.
disease of banana: concordant evidence from nuclear and 11. Springer-Verlag, Berlin, Heidelberg.
mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA Thomma, B. P. H. J. 2003. Alternaria spp.: from general
95:2044–2049. saprophyte to specific parasite. Mol. Plant Pathol. 4:225–236.
Prins, T. W., P. Tudzynski, A. von Tiedemann, B. Tudzynski, A. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin,
ten Have, M. E. Hansen, K. Tenberge, and J. A. L. van Kan. and D. G. Higgins. 1997. The CLUSTALX windows inter-
2000. Infections strategies of Botrytis cinerea and related face: flexible strategies for multiple sequence alignment aided
necrotrophic pathogens. Pp. 33–65 in J. W. Kronstad, ed. by quality analysis tools. Nucleic Acids Res. 25:4876–488.
Fungal pathology. Kluwer Academic Publisher, Dordrecht, Thompson, J. N., and J. J. Burdon. 1992. Gene-for-gene co-
The Netherlands. evolution between plants and parasites. Nature 360:121–125.
Rokas, A., B. L. Williams, N. King, and S. B. Carroll. 2003. Turgeon, B. G. 2000. Evolution of host specific virulence in
Genome-scale approaches to resolving incongruence in Cochliobolus heterostrophus. Pp. 93–126 in J. W. Kronstad,
molecular phylogenies. Nature 425:798–804. ed. Fungal pathology. Kluwer Academic Publisher, Dor-
Rolke, Y., S. Liu, T. Quidde, B. Williamson, A. Schouten, K. drecht, The Netherlands.
Weltring, V. Siewers, K. B. Tenberge, B. Tudzynski, and P. van Baarlen, P., M. Staats, and J. A. L. van Kan. 2004. Induction
Tudzynski. 2004. Functional analysis of H2O2-generating of programmed cell death in lily by the fungal pathogen
systems in Botrytis cinerea: the major Cu-Zn-superoxide Botrytis elliptica. Mol. Plant Pathol. (in press).
dismutase (BCSOD1) contributes to virulence on French Van der Vlugt-Bergmans, C. J. B., B. F. Brandwagt, J. W. van’t
bean, whereas a glucose oxidase (BCGOD1) is dispensable. Klooster, C. A. M. Wagemakers, and J. A. L. van Kan. 1993.
Mol. Plant Pathol. 5:17–27. Genetic variation and segregation of DNA polymorphisms in
Ronquist, F., and J. P. Heulsenbeck. 2003. MrBayes 3: Bayesian Botrytis cinerea. Mycol. Res. 97:1193–1200.
phylogenetic inference under mixed models. Bioinformatics White, T. J., T. Bruns, S. Lee, and J. Taylor. 1990. Amplification
19:1572–1574. and direct sequencing of fungal ribosomal RNA genes for
Roy, B. A. 2001. Patterns of association between crucifers and phylogenetics. Pp. 315–322 in M. A. Innis, D. H. Gelfand, J.
their flower-mimic pathogens: Host jumps are more common J. Sninsky, and T. J. White, eds. PCR protocols: a guide to
than coevolution or cospeciation. Evolution 55:41–53. methods and applications. Academic Press, San Diego.
Schardl, C. L., and K. D. Craven. 2003. Interspecific hybridiza- Willetts, H. J. 1997. Morphology, development and evolution of
tion in plant-associated fungi and oomycetes: a review. Mol. stromata/sclerotia and macroconidia of the Sclerotiniaceae.
Ecol. 12:2861–2873. Mycol. Res. 101:939–952.
Schönbeck, F., and E. Schlösser. 1976. Preformed substances as Wubben, J. P., W. Mulder, A. ten Have, J. A. L. van Kan, and
potential protectants. Pp. 653–678 in R. Heitefuss and P. H. J. Visser. 1999. Cloning and partial characterization of endopo-
Williams, eds. Physiological plant pathology. Springer- lygalacturonase genes from Botrytis cinerea. Appl. Environ.
Verlag, Berlin. Microbiol. 65:1596–1602.
Schouten, A., C. A. M. Wagemakers, F. Stefanato, R. M. van der Yohalem, D. S., K. Nielsen, and M. Nicolaisen. 2003. Taxo-
Kaaij, and J. A. L van Kan. 2002. Resveratrol acts as a natural nomic and nomenclatural clarification of the onion neck
profungicide and induces self-intoxication by a specific rotting Botrytis species. Mycotaxon 85:175–182.
laccase. Mol. Microbiol. 43:883–894.
Shepard, D. V., and D. Pitt. 1976. Purification of a phospholipase Spencer V. Muse, Associate Editor
from Botrytis cinerea and its effect on plant tissues.
Phytochemistry 15:1465–1470. Accepted October 4, 2004