0% found this document useful (0 votes)
78 views

Design of Experiments - Applications 2013

Uploaded by

Daoud Issa
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
78 views

Design of Experiments - Applications 2013

Uploaded by

Daoud Issa
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 120

Chapter 1

Robust Design and Taguchi Method Application

Helder Jose Celani de Souza, Messias Borges Silva,


Cinthia B. Moyses, Fernando Lopes Alberto,
Fabrício J. Pontes, Ubirajara R. Ferreira,
Roberto N. Duarte and
Carlos Eduardo Sanches da Silva

Additional information is available at the end of the chapter

http://dx.doi.org/10.5772/56580

1. Introduction

The objective of this chapter is to present an application of Taguchi Experimental Design


Method. A healthcare case was chosen for this purpose. It is specifically applied to Molecular
Assays in Clinical Laboratories and the main target is to determine the best parameters
adjustment of a Molecular Assays Process in order to obtain the best diagnostic result for
Venous Thromboembolism investigation [1].

1.1. Venous thromboembolism investigation by molecular assays process

Disorders of haemostatic mechanisms that predispose a person to thrombotic episodes are


generally referred to as thrombophilia [2]. The incidence of one such disorder, Venous
Thromboembolism, increases with age, ranging from 1 in 10,000 among children to 1 in 100
among elderly. Its most common clinical manifestations are deep vein thrombosis of the lower
limbs and pulmonary embolism. Origins of thrombophilia risk factors can be both acquired
and genetic, making the thromboembolic disease a complex, multifactorial trait [3].
The acquired risk factors include pregnancy, surgery, trauma, immobilization, advanced age,
as well as previous episodes of thrombosis. The genetic risk factors most relevant are two
mutations: the Factor V Leiden mutation (1691G>A) and the 20210G>A point mutation in the
3’ untranslated region (UTR) of the Prothrombin gene. The first causes resistance to activated
protein C and the second is associated with increased plasma factor II levels [4]. Both mutations
act as gain of function, causing hypercoagulability.

© 2013 de Souza et al.; licensee InTech. This is an open access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits
unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
2 Design of Experiments - Applications

There are two basic methods for investigating Factor V Leiden: functional (Activated Protein
C Resistance) and molecular (such as PCR - Polymerase Chain Reaction - followed by restric‐
tion digestion, or real-time PCR). However, only the second method can be used to detect
Prothrombin mutation (the functional methods are unacceptable due to overlapping between
normal and carrier levels). Among molecular methods, real-time PCR offers many advantages
over conventional PCR: higher sensitivity, quicker turn-around-time, better uniformity and
objectivity in the analysis, and lower probability of contamination in the laboratory.

Real-time PCR with Fluorescence Resonance Energy Transfer (FRET) probes (also called
hybridization probes) employ two labeled probes, commonly called FRET and anchor probes.
These probes hybridize to the PCR product in head-to-tail fashion, at close proximity. Because
the acceptor fluorophore emits light in a longer wavelength, signal detection is possible. One
of these probes is labeled with a donor dye at the 3’ end and the other is labeled with an acceptor
dye at the 5’ end. Quenched-FRET assays are similar to FRET assays, except in what they
measure. Instead of measuring the increase in energy of the acceptor fluorophore, quenched-
FRET assays measure, during amplification, the decrease in energy of the donor fluorophore.
Use of a quencher molecule, such as black-hole quenchers, in place of an acceptor fluorophore
enables multiplexing of more than one fluorophore. This permits the analysis of a greater
number of mutations in the same tube. By performing a melting analysis after PCR to find the
amplicon-probe melting temperatures, genotyping is achieved. Variation may be shown
depending on the number of mismatches, the length of the mismatched duplex, the position
of the mismatch and neighboring base pairs. Studies previously published have confirmed the
efficiency of FRET real-time PCR for SNP detection and allelic discrimination of Factor V
Leiden and Prothrombin (factor II) [5-10].

The FRET system requires four oligonucleotides. Therefore to conduct a successful experiment
with reliable results two steps are necessary: careful design of the probes and primers and
assays optimization.

1.2. Taguchi experimental design

The experimental design is widely used to optimize process parameter values in order to
improve the quality properties of a product or a process. Full Factorial and One-Factor-at-the-
time (OFTA) experiments are design methods that can possibly be used but requires a large
number of experiments when the number of process parameters increases. Taguchi developed
the foundations of Robust Design introduced in the 1950s and 1960s and the application of his
method in electronics, automotive, photographic and many others industries has been an
important factor in the rapid industrial growth of Japanese industries [11].

Among the various approaches to quality engineering products and processes, the method of
Taguchi is identified for robust design [14]. The method deviates from the quality engineering
concerns when it considers the objective to ensure good quality products and good process
performance deliveries during the life cycle of these projects [12]. Taguchi methods are
distinguished from other approaches to quality engineering by some specific concepts, as
follow:
Robust Design and Taguchi Method Application 3
http://dx.doi.org/10.5772/56580

• Minimization of a quality loss function

• Maximization the signal to noise ratio

• Orthogonal Arrays

The strategy of experimental design used in the Taguchi method is based on orthogonal arrays
and fractional factorial, in which not all possible combinations of factors and levels are tested.
It is useful to estimate the effects of main factors on the process. The primary goal of this type
of strategy is to obtain as much information about the effect of the parameters on the process
with minimal experimental runs. In addition to the fact of requiring a smaller number of
experiments, the orthogonal arrays still allow to test the factors using a mixing of number of
levels.

Taguchi method uses a special design of Orthogonal Arrays that allows to study the whole
parameter space with a limited number of experiments [12]. Besides, this method provides
other advantages: it reduces economically the variability of the response variable, shows the
best way to find out the optimum process conditions during laboratory experiments, it is an
important tool for improving the productivity of the R&D activity and it can be applied to any
process.

The usual steps to apply Taguchi experimental design [13] are: (a) to select the output varia‐
ble(s) (response(s)) to be optimized; (b) to identify the factors (input variables) affecting output
variable(s) and to choose the levels of these factors; (c) to select the appropriate Orthogonal
Array; the arrays are found in literature [14]; (d) to assign factors and interactions to the
columns of the array; (e) to perform experiments; at this step it is important to randomize the
trials in order to minimize the systematic error; (f) to analyze the results using signal-to-noise
ratio (S/N) analysis and analysis of variance (ANOVA); (g) to determine the optimal process
parameters; (h) to perform confirmatory experiments, if it is necessary.

For the S/N ratio analysis, the appropriate S/N ratio function must be chosen: smaller-the-
better, larger-the-better, nominal-the-better. The S/N ratio is a logarithmic function used to
optimize the process or product design, minimizing the variability, as shown by Equation 1.

1 n 1
h = -10 log 10[ å ]
n i =1 yi2
(1)

In the equation (1), η is the signal to noise ratio, yi is the Quality Function Deviation, problem
type “larger-the-better”, which is the case of this application and, n corresponds the number
of experiments runs.

The S/N ratio can be also understood as the inverse of variance and the maximization of S/N
ratio allows reduction of the variability of the process against undesirable changes in neigh‐
bouring environment (also named uncontrollable factors or factors of noise). To minimize
variability, the level of factor which produces the greatest value of S/N ratio must be chosen.
4 Design of Experiments - Applications

The analysis of variance (ANOVA) is applied in order to test the equality of several means,
resulting in what process parameters (factors) are statistically significant.

In the methodology of experimental design, the test used to evaluate the significance of the
levels changes of a factor or an interaction is a hypothesis test. In the case of full factorial, this
test is an analysis of variance (ANOVA) [18]. When two levels of a factor generating have equal
statistically mean responses, it is assumed that the factor does not affect the response of interest.
When, instead, a significant difference is detected, the factor is important. For a full factorial
with two factors A and B and two levels (+1, -1), the correspondent model can be shown in
equation (2).

Yijk = m + Ai + Bj + ABij + e ijk (2)

Where:

i is the number of levels of the fator A;

j is the number of levels of the fator B and k, the number of replicas;

Y ijk is the (ijk)th observation obtained in the experiment;

μ is the overall mean;

Ai is the effect of the ith treatment of Factor A;

Bj is the effect of the jth treatment of Factor B;

ABij is the effect of the ij-th AB interaction between factors;

εijk is the component of random error.

The results of ANOVA are presented in a table that displays for each factor (or interac‐
tion) the values of the sum of squared (SS) deviations from the mean, the mean of
squares (MS) and the ratio between the mean of squares effect and the mean of squares
error (F). For background information many introductory texts on elementary statistical
theory are available in literature and can also be found in most of the statistical packages
for microcomputers [16-18].

In this chapter the Taguchi L27 Orthogonal Array employed for experimental design and data
analysis, considers the search for the best conditions of operation, the effects of the main factors
over the process, and the interactions among the factors. The Taguchi method was applied by
Ballantyne et al. [15] for the optimization of conventional PCR assays using an L16 Orthogonal
Array with four variables at two different levels each. The present research, however, is
considered a more complex Taguchi´s method application once it optimizes a process that uses
real-time PCR using FRET probes with six three-levels factors.
Robust Design and Taguchi Method Application 5
http://dx.doi.org/10.5772/56580

2. Material and methods

Distinct DNA pools for Factor V Leiden and Prothrombin were employed. Each was consti‐
tuted of samples from quality control programs whose genotypes were already known. The
mutation detection was performed by real-time PCR, followed by melting curve analysis with
adjacent fluorescent probes using the quenched-FRET principle.

With the exception of the reverse primers (Prothrombin: 5’- ATTACTGGCTCTTCCTGAGC3’;


Factor V Leiden:5’TGCCCAGTGCTTAACAAGAC-3’), the primer and probe sequences for
both Prothrombin and Factor V Leiden genotyping were the same as those described by von
Ahsen et al. [6] and Ameziane et al. [10], respectively. The Factor V Leiden detection probe,
which was specific for the mutated allele, was 3’-labeled with 6-carboxyfluorescein (FAM).
The adjacent probe, which functioned as an anchor, was 5’-labeled with Cy5 and phosphory‐
lated at its 3’ end; this was to prevent probe elongation by Taq polymerase [5-8].

The Prothrombin detection probe, which was complementary to the wild-type allele, was 3’-
labeled with 6-carboxy-4’,5’-dichloro-2’, 7’-dimethoxyfluorescein (JOE). The anchor probe was
5’-labeled with 6-carboxytetramethylrhodamine (TAMRA) and phosphorylated at its 3’ end.
About 240 ng of genomic DNA in a final PCR volume of 25 μL were amplified and detected
in the Rotor-Gene 3000 (Corbett Research, Australia), as shown in Figure 1.

Figure 1. Experiments Environment: Sample Preparation Chapel and Rotor Gene 3000

For standardization, PCR reactions were performed using distinct Master Mixes: MMA,
Promega PCR Master Mix (1.5 mM MgCl2); MMB, Promega PCR Master Mix (3.0 mM MgCl2);
MMC, QIAGEN PCR Master Mix (1.5 mM MgCl2), different concentrations of primers
(forward and reverse) and probes (FRET and anchor) and different PCR cycle numbers to test
for the best combination.

All six factors selected as “input variables” for standardization (Table 1) were investigated at
three different levels. These factors were selected for being essential components of a PCR.
Also, the levels tested cover the range suggested in the literature. Although a standard real-
time PCR usually uses a maximum of 45 to 50 cycles, some protocols, such as asymmetric PCR,
may require more.
6 Design of Experiments - Applications

Cycling and melting profiles were performed according to the following protocol: 95°C for 4
min as the initial denaturation step. This was followed by n cycles (n = 50, 65 or 85) of 95°C for
10 s, 53°C for 20 s and 72°C for 20 s. Thereafter, melting curve analysis of the duplex amplicon-
probe was performed. Analysis started at 49°C and proceeded until to 88°C, at a linear rate of
1°C every 5 s.

Column allocated to the factor in L27


Factor name Level 1 Level 2 Level 3 Unit
Taguchi Orthogonal Array

Composition/
Master Mix A MMA MMB MMC
supplier

Primer forward
B 0.1 0.5 1.0 µM
concentration (P1)

Primer reverse
E 0.1 0.5 1.0 µM
concentration (P2)

FRET probe concentration


J 0.2 0.3 0.4 µM
(S1)

Anchor probe
K 0.2 0.3 0.4 µM
concentration (S2)

Number of PCR cycles L 45 65 85 cycles

Table 1. Experiments Factors and Levels

The Rotor-Gene software calculated the negative derivative of the fluorescence ratio with
respect to temperature (-dF/dT), which was plotted against temperature (T°C). The melting
curves were then converted to melting peaks. The “output variable” was the melting peak
height measured after the melting analysis, which could be visualized in the negative deriv‐
ative plot (-dF/dT x T°C). This variable was chosen as the output because it reflected the
efficiency of the whole process, including both amplification and melting analysis.

PCR mix preparation, sample loading, and amplification reactions were carried out in three
separate rooms. All rooms were subject to temperature and humidity control. In order to
minimize the effect of pipetting errors between runs, amplification mix was prepared once and
then divided into aliquots. These were stored, protected from light, at -20°C. Each aliquot was
thawed only once at the time of use. In addition, in order to minimize the effect of inter-operator
variation, a single person was responsible for the execution of the whole process. In order to
maintain reagents and sample stability, each of the 27 experiments was performed over
consecutive days in quadruplicate.

Tubes were randomly loaded in the 36 carousel rotor. These procedures, performed inde‐
pendently, were adopted for both Factor V Leiden and Prothrombin genotyping. The research
equipment outputs fluorescence values at the origin point of the fluorescence curve. This
constraint may lead to low output values for curves of high resolution and high values for
Robust Design and Taguchi Method Application 7
http://dx.doi.org/10.5772/56580

curves of low resolution. This restriction was overcome by employing the derivative of the
curve for Fluorescence and defining the output as the peak mean values or the peak values.
Thus meaningful values for both Prothrombin genotyping and V Leiden were achieved.
The curve for Melting was generated with the use of Rotor-Gene 3000 equipment by using the
curve for Fluorescence of each sample. In order to estimate the individual and interaction
effects among the factors, a Taguchi L27 Orthogonal Array was employed, with four replicates
for each experiment.
The Taguchi method differs from other quality engineering tools in terms of some specifics
concepts, once it includes the minimization of the quality loss function, the maximization of
the noise-to-signal ratio, a quadratic loss function [14], and the usage of Orthogonal Arrays
[16-18]. The results were later compiled and analyzed through statistical methods using
Statistica9 software.

3. Results

Tables 2 and 3 show the L27 Orthogonal Array results considering four replicates per run.
Table 3 shows the experimental factors and the levels considered by Taguchi method and used
to determine the optimal adjustments for the best final results.
The Factors A, B, E, J, K AND L are assigned to columns 1, 2, 5, 9, 10 and 11 in the L27. The
Factors C, D, F, G, H, I, M and N are assigned to columns 3, 4, 6, 7, 8, 12, and 13 in L27 and
represent the interaction effects being treated as dummy factors.
The output variability is reduced when the signal-to-noise ratio is maximized. In this Taguchi
method application the design condition to reach this goal is larger is better.
In the sequence, Tables 2 and 3 are shown.
The same procedure is equally done for Factor V Leiden genotyping.
Figures 2 and 3 show the main effects for means and signal-to-noise ratio for Prothrombin
genotyping, as follow.

3.1. Results from prothrombin genotyping analysis

By distributing the mean output values among experimental setups, it was possible to evaluate
each experimental factor’s impact on the output. In this case, the experimental factors major
impact results in a descending order are E, B, A, H, L, K, G, J, F, N, M, C and D, varying from
60.29% to 1.83% respectively.
Statistical analysis was performed by applying Analysis of Variance (ANOVA) to the obtained
results. Each ANOVA factor adopted two degrees of freedom, which corresponds to the
number of levels adopted to a given experimental factor less one. Square sums of the two less
8 Design of Experiments - Applications

L27 Orthogonal Array and Replicates Results for Factor V Leiden

Replicas
Run A B C D E F G H J K L M N
1 2 3 4

1 1 1 1 1 1 1 1 1 1 1 1 1 1 0.00001 0.00001 0.00001 0.00001

2 1 1 1 1 2 2 2 2 2 2 2 2 2 0.09000 0.08500 0.08500 0.07500

3 1 1 1 1 3 3 3 3 3 3 3 3 3 0.20000 0.16500 0.19000 0.18500

4 1 2 2 2 1 1 1 2 2 2 3 3 3 0.00001 0.00001 0.00001 0.00001

5 1 2 2 2 2 2 2 3 3 3 1 1 1 0.02000 0.00001 0.01500 0.00001

6 1 2 2 2 3 3 3 1 1 1 2 2 2 0.05500 0.04500 0.05000 0.05000

7 1 3 3 3 1 1 1 3 3 3 2 2 2 0.00001 0.00001 0.00001 0.00001

8 1 3 3 3 2 2 2 1 1 1 3 3 3 0.00500 0.00001 0.00001 0.00500

9 1 3 3 3 3 3 3 2 2 2 1 1 1 0.05500 0.06000 0.05000 0.06000

10 2 1 2 3 1 2 3 1 2 3 1 2 3 0.00001 0.00001 0.00001 0.00001

11 2 1 2 3 2 3 1 2 3 1 2 3 1 0.04500 0.00001 0.00001 0.00001

12 2 1 2 3 3 1 2 3 1 2 3 1 2 0.08000 0.06000 0.06000 0.08500

13 2 2 3 1 1 2 3 2 3 1 3 1 2 0.00001 0.00001 0.00001 0.00001

14 2 2 3 1 2 3 1 3 1 2 1 2 3 0.00500 0.00500 0.02000 0.00001

15 2 2 3 1 3 1 2 1 2 3 2 3 1 0.02000 0.00001 0.02000 0.01000

16 2 3 1 2 1 2 3 3 1 2 2 3 1 0.00001 0.00001 0.00001 0.00001

17 2 3 1 2 2 3 1 1 2 3 3 1 2 0.00001 0.00001 0.00001 0.00001

18 2 3 1 2 3 1 2 2 3 1 1 2 3 0.02000 0.02000 0.00001 0.02000

19 3 1 3 2 1 3 2 1 3 2 1 3 2 0.00001 0.00001 0.00001 0.00001

20 3 1 3 2 2 1 3 2 1 3 2 1 3 0.07000 0.06500 0.05500 0.06500

21 3 1 3 2 3 2 1 3 2 1 3 2 1 0.10000 0.09000 0.08500 0.09500

22 3 2 1 3 1 3 2 2 1 3 3 2 1 0.00001 0.00001 0.00001 0.00001

23 3 2 1 3 2 1 3 3 2 1 1 3 2 0.00001 0.02000 0.00001 0.02500

24 3 2 1 3 3 2 1 1 3 2 2 1 3 0.04500 0.03500 0.04000 0.03500

25 3 3 2 1 1 3 2 3 2 1 2 1 3 0.01000 0.00001 0.00001 0.00001

26 3 3 2 1 2 1 3 1 3 2 3 2 1 0.00001 0.00001 0.00001 0.00001

27 3 3 2 1 3 2 1 2 1 3 1 3 2 0.04000 0.03000 0.04000 0.02500

Table 2. Factor Prothrombin Gene L27 Orthogonal Array Results

influential factors were employed to estimate errors, due to the fact that a saturated Taguchi
design was employed.
Robust Design and Taguchi Method Application 9
http://dx.doi.org/10.5772/56580

L27 Orthogonal Array and Replicates Results for Factor V Leiden

Replicas
Run A B C D E F G H J K L M N
1 2 3 4

1 1 1 1 1 1 1 1 1 1 1 1 1 1 0.00001 0.00001 0.00001 0.00001

2 1 1 1 1 2 2 2 2 2 2 2 2 2 0.00001 0.00001 0.00001 0.00001

3 1 1 1 1 3 3 3 3 3 3 3 3 3 0.00001 0.00001 0.00001 0.00001

4 1 2 2 2 1 1 1 2 2 2 3 3 3 0.54000 0.46000 0.51500 0.48000

5 1 2 2 2 2 2 2 3 3 3 1 1 1 0.00001 0.00001 0.00001 0.00001

6 1 2 2 2 3 3 3 1 1 1 2 2 2 0.00001 0.00001 0.00001 0.00001

7 1 3 3 3 1 1 1 3 3 3 2 2 2 0.43000 0.43500 0.35500 0.39000

8 1 3 3 3 2 2 2 1 1 1 3 3 3 0.08000 0.10500 0.08500 0.07500

9 1 3 3 3 3 3 3 2 2 2 1 1 1 0.00001 0.00001 0.00001 0.00001

10 2 1 2 3 1 2 3 1 2 3 1 2 3 0.00001 0.00001 0.00001 0.00001

11 2 1 2 3 2 3 1 2 3 1 2 3 1 0.00001 0.00001 0.00001 0.00001

12 2 1 2 3 3 1 2 3 1 2 3 1 2 0.00001 0.00001 0.00001 0.00001

13 2 2 3 1 1 2 3 2 3 1 3 1 2 0.26000 0.29000 0.25000 0.24000

14 2 2 3 1 2 3 1 3 1 2 1 2 3 0.00001 0.00001 0.00001 0.00001

15 2 2 3 1 3 1 2 1 2 3 2 3 1 0.00001 0.00001 0.00001 0.00001

16 2 3 1 2 1 2 3 3 1 2 2 3 1 0.25500 0.25000 0.25500 0.24500

17 2 3 1 2 2 3 1 1 2 3 3 1 2 0.10000 0.10000 0.07500 0.06500

18 2 3 1 2 3 1 2 2 3 1 1 2 3 0.00001 0.00001 0.00001 0.00001

19 3 1 3 2 1 3 2 1 3 2 1 3 2 0.00001 0.00001 0.00001 0.00001

20 3 1 3 2 2 1 3 2 1 3 2 1 3 0.00001 0.00001 0.00001 0.00001

21 3 1 3 2 3 2 1 3 2 1 3 2 1 0.00001 0.00001 0.00001 0.00001

22 3 2 1 3 1 3 2 2 1 3 3 2 1 0.39500 0.43500 0.41000 0.42500

23 3 2 1 3 2 1 3 3 2 1 1 3 2 0.00001 0.00001 0.00001 0.00001

24 3 2 1 3 3 2 1 1 3 2 2 1 3 0.00001 0.00001 0.00001 0.00001

25 3 3 2 1 1 3 2 3 2 1 2 1 3 0.55000 0.53500 0.53500 0.58000

26 3 3 2 1 2 1 3 1 3 2 3 2 1 0.15500 0.18000 0.14000 0.12500

27 3 3 2 1 3 2 1 2 1 3 1 3 2 0.00001 0.00001 0.00001 0.00001

Table 3. Factor V Leiden L27 Orthogonal Array Results

Therefore, error term was considered to have four degrees of freedom. Table 4 shows ANOVA
results for output average value in experiments involving Prothrombin genotyping. The
ANOVA analysis revealed which experimental factors were significant to the process output.
10 Design of Experiments - Applications

Figure 2. Means Main Effects for Prothrombin Genotyping Experiments

The decreasing order of significance for maximization of output for Prothrombin genotyping
is as follows: E (concentration of primer reverse); B (concentration of primer forward); H, A
(Master Mix), L (Number of PCR cycles), G, C, F, D, N and K (Anchor probe concentration).

By observing the interaction diagram of the L27 Taguchi method employed, it is evident that
columns H, G, C, F, D and N contain information about interaction between physical factors.
This suggests that interactions between the levels of physical factors significantly influence the
outcome of the process. The levels of factors that will maximize the output for Prothrombin
genotyping are displayed in the Table 5.

In order to estimate experimental conditions that maximize the robustness of the process, the
ANOVA test was carried out on experimental results obtained for signal-to-noise ratio, as
shown in Table 6.

For the same reasons presented before, square sums of the two less influential factors for
robustness, C and D, were employed to estimate errors. Once more the number of degrees of
the error was set to four, which corresponds to the sum of degrees of freedom of the factor
employed to estimate the error term.

The ANOVA analysis also revealed the order of significance for maximizing the process’s
robustness. The decreasing order of significance is as follows: E (concentration of primer
reverse); B (concentration of primer forward); A (Master Mix), H, L (Number of PCR cycles),
Robust Design and Taguchi Method Application 11
http://dx.doi.org/10.5772/56580

Figure 3. Signal-To-Noise Ratio Main Effects for Prothrombin Genotyping Experiments

K (Anchor probe concentration), G, J (FRET probe concentration), N, F and M. By observing


the interaction diagram of the L27 Taguchi method employed, it’s apparent that columns H,
G, N, F and M contain information about interaction between physical factors. This suggests
that interactions play a significant role in process robustness.

The levels of factors that will maximize robustness are also displayed in Table 5. For the factors
Master Mix, Primer Forward Concentration, and Primer Reverse Concentration, let us compare
their recommended levels for output optimization and robustness maximization. Levels that
maximize Prothrombin genotyping output are the same as those that maximize process
robustness. The remaining factors (Anchor probe concentration and number of PCR cycles)
have distinct levels maximize output and robustness.

3.2. Results from factor V leiden analysis

Analysis performed on results obtained for Prothrombin genotyping were integrally repeated
on results obtained for Factor V Leiden genotyping and the recommended values are shown
in Table 7.

In this case, the experimental factors major impact results in descending order were E, B, L, H,
A, F, C, N, J, M, D, G and K, varying from 61.49% to 0.41% respectively.
12 Design of Experiments - Applications

Analysis of Variance on Melting Peak Height Average

Mean =0 .027639 Sigma =0 .042695

Factors SS df MS F P
Result
(S – Source) Sum of Squares Degree of Freedom Mean Square F-Ratio P-Value

A 0.004019 2 0.002010 101.5351 0.000 Significant

B 0.011178 2 0.005589 282.3947 0.000 Significant

C 0.001388 2 0.000694 35.0614 0.003 Significant

D 0.001052 2 0.000526 26.5877 0.005 Significant

E 0.017559 2 0.008779 443.5877 0.000 Significant

F 0.001091 2 0.000545 27.5526 0.005 Significant

G 0.002310 2 0.001155 58.3509 0.001 Significant

H 0.004239 2 0.002119 107.0877 0.000 Significant

K 0.000796 2 0.000398 20.1140 0.008 Significant

L 0.002690 2 0.001345 67.9561 0.001 Significant

N 0.000994 2 0.000497 25.1140 0.005 Significant

Residual Error 0.000079 4 0.000020

Table 4. ANOVA table for output values for Prothrombin Genotyping Experiments

The maximization of output for coagulation Factor V Leiden, in descending order of signifi‐
cance, is as follows: E (Primer reverse Concentration); B (Primer forward Concentration) and
L (Number of PCR cycles), H, A (Master Mix), F, C, G, N, J (FRET probe concentration).

The interaction diagram of the L27 Taguchi method reveals that columns H, F, C, G and N
contain information about interaction between physical factors. This suggests that interactions
between the levels of physical factors significantly influence the outcome of the process [11].

3.3. Confirmation experiments

Confirmation experiments were conducted using six samples, each of them in two replicates
and are shown in the table 8. Also included were the factors adjusted to the recommended
levels for process optimization and control samples.
Robust Design and Taguchi Method Application 13
http://dx.doi.org/10.5772/56580

Taguchi Factor Taguchi Factor


Physical
Levels Physical Value Levels
Factor Factor Value linked
recommended for linked to recommended for Unit
Index Name to Factor
output Factor Level robustness
Level
optmization maximization

Composition
A Master Mix 1 MMA 1 MMA
/supplier

Primer forward
B 1 0.1 1 0.1 µM
Concentration (P1)

Primer reverse
E 3 1 3 1 µM
Concentration (P2)

FRET probe Not Not


J 1 0.2 µM
concentration (S1) significant significant

Anchor probe
K 3 0.4 2 0.3 µM
concentration (S2)

Number of PCR
L 3 85 2 65 cycles
cycles

Table 5. Factor levels recommended for output optimization or robustness maximization for Prothrombin Genotyping
Experiments

The expected results are positive values and as much higher as possible to be considered good
results for clinical significance and diagnostics qualitative analysis. The reproducibility is
another important result for this application and the lowest standard deviation among
replicates is also desirable which is also shown in the table 8. The results disclosed significant
“responses,” with values above zero. Such a finding clearly demonstrates that the recommen‐
dations about the conditions for the best process adjustments obtained by the Taguchi method
meet the requirements and goals of this study.

A significant advantage to using the Taguchi method is the time and cost saved. Using the
standard factorial design (or a non-formal method), will produce a much higher number of
assays than will a fractional factorial as the Taguchi method uses. Extensively used to optimize
engineering processes, the method incorporates one primary experiment to study the main
effects of each factor, modeling some of the important interactions. Secondary Taguchi arrays
can then be designed from the primary results, to narrow the optimal windows for each factor.

The method’s strength lies in its Orthogonal Array design; each level of each factor occurs in
an equal number of times across the entire array. Its potential savings are apparent when
compared to factorial design. With the Taguchi method only 27 experiments were needed. For
the same number of factors and levels examined, full factorial design requires 729 experiments
[15, 16, 18].
14 Design of Experiments - Applications

Analysis of Variance on S/N Ratio (Larger- the – Better)

Mean = -100.16 Sigma = 55.1392

Factors SS df MS F P
Result
(S - Source) Sum of Squares Degree of Freedom Mean Square F-Ratio P-Value

A 8271.62 2 4135.81 406.00 0.000 Significant

B 9470.42 2 4735.21 464.84 0.000 Significant

E 39531.31 2 19765.66 1940.33 0.000 Significant

F 2633.31 2 1316.65 129.25 0.000 Significant

G 2674.61 2 1337.31 131.28 0.000 Significant

H 3034.27 2 1517.13 148.93 0.000 Significant

J 2655.79 2 1327.89 130.35 0.000 Significant

K 2688.69 2 1344.34 131.97 0.000 Significant

L 2828.24 2 1414.12 138.82 0.000 Significant

M 2570.21 2 1285.10 126.15 0.000 Significant

N 2649.50 2 1324.75 130.05 0.000 Significant

Residual Error 40.75 4 10.19

Table 6. ANOVA results for Signal-To-Noise ratios for Prothrombin Genotyping Experiments

This work suggests new studies of similar processes employing the full factorial DOE techni‐
que [16] or RSM - Response Surface Method [20] using the Taguchi method. Such studies
should yield a better, more accurate estimation of the significance of experimental factors and
interactions among factor levels on process outputs. It must be emphasized that the results
obtained in this research should not be extrapolated to other clinical processes.

4. Conclusions

The most relevant genetic risk factors associated with thrombophilia are the Factor V Leiden
and the 20210G>A point mutation in the Prothrombin gene. Employing the Taguchi method,
the study successfully optimized a screening method for Prothrombin genotyping and for
Factor V Leiden mutation detection. The Taguchi Experimental Design method [16] proved
an efficient tool in determining the different levels that maximize the process output. Here that
is defined as the melting peaks at the derivative plot (-dF/dT x T°C) and the relevance of factors
obtained by Taguchi method.
Regarding Prothrombin genotyping, data analysis uncovered the most significant factors for
maximizing the process’s output and robustness. Those factors, in decreasing order, are:
Primer Reverse Concentration, Primer Forward Concentration, Master Mix Type, and number
of cycles in PCR. In addition, the adjustment levels for maximization of the process output are:
Robust Design and Taguchi Method Application 15
http://dx.doi.org/10.5772/56580

Taguchi Factor Taguchi


Physical
Levels Factor Levels Physical Value
Factor Factor Value linked
recommended for recommended for linked to Unit
Index Name to Factor
output robustness Factor Level
Level
optmization maximization

Composition
A Master Mix 3 MMC 3 MMC
/supplier

Primer forward
B 3 1 3 1 µM
Concentration (P1)

Primer reverse
E 1 0.1 1 0.1 µM
Concentration (P2)

FRET probe Not Not


J 2 0.3 µM
concentration (S1) Significant Significant

Number of PCR
L 3 85 3 85 cycles
cycles

Table 7. Factor levels recommended for output optimization or robustness maximization for Factor V Leiden
Genotyping Experiments

primer reverse concentration = 1 μM, primer forward concentration = 0.1 μM, master mix type
MMA (Promega PCR Master Mix) and number of PCR cycles = 85 cycles. FRET probe concen‐
tration was considered non-significant.

Data analysis for Factor V Leiden genotyping uncovered the most significant factors for
maximizing the process’s output. Those factors, in decreasing order, are: Primer Reverse
Concentration, Primer Forward Concentration, Number of Cycles in the reaction, Master Mix
Type and FRET probe concentration. The adjustment levels that lead to maximizing process
output are: Primer Reverse Concentration = 0.1 μM, Primer Forward Concentration = 1 μM,
number of cycles = 85, Master Mix Type MMC and FRET probe concentration equal to 0.2 μM.
Anchor probe concentration was considered as non-significant.

The same kind of analysis was performed for process robustness for both Prothrombin
genotyping and Factor V Leiden. The proper levels, as well as the recommended levels of the
experimental factors, for maximizing robustness were pointed out and revealed as significant.

Analysis also showed that interactions among factor levels play a significant role in maximiz‐
ing both process output and robustness for both Prothrombin genotyping and Factor V Leiden.
The nature and intensity of this interaction should be further investigated. One other thing is
worth mentioning. All reactions for Factor V Leiden and Prothrombin genotyping described
in this paper were performed independently. However, multiplexing (simultaneously
conducting both reactions in the same tube) may be enabled through the use of different
fluorophores (FAM and JOE) for Factor V and Prothrombin probe labeling. This permits the
operator to load more samples in the equipment. Usually, different conditions of an assay
16 Design of Experiments - Applications

Run Prothrombin (Factor II) Standard Deviation Fator V Leiden Standard Deviation

1 0.350 0.480
0.014 0.021
1 0.330 0.450

2 0.280 0.550
0.028 0.099
2 0.320 0.690

3 0.195 0.460
0.007 0.028
3 0.185 0.500

4 0.155 x
0.025 x
4 0.190 x

5 x 0.600
x 0.011
5 x 0.615

6 0.320 0.760
0.000 0.049
6 0.320 0.830

am ctrl FII 0.150 x


0.018 x
am ctrl FII 0.175 x

am ctrl FV x 0.580
x 0.004
am ctrl FV x 0.585

Table 8. Confirmation Results for Prothrombin and Factor V Leiden using the Taguchi recommended Factors Levels

optimization are tested independently, in different assays, in which all conditions are kept
constant except for the one being tested.
This process is usually costly and time-consuming. Neither does it assure that all possible
combinations are tested. Therefore, the Taguchi method offers several advantages over the
traditional optimization process; it allows for the performing different experiments, testing
different levels for each factor in just a few days. This saves and reduces the time needed for
the complete optimization and standardization processes of new diagnostic tests. In addition,
it provides a mathematical support not only for the choice of the condition that generates the
best result but also for the determination of the significant factors in the reaction. Such a benefit
allows researchers to eliminate the non-relevant experimental factors for posterior fine-scale
adjustments using the full factorial DOE technique [16] or Response Surface Methodology [19],
when necessary.
The DOE methods can also be applied to a variety of quantitative tests. In conclusion, in clinical
analysis laboratories that develop in house diagnostic tests, especially in the R&D area,
applying the Taguchi method is an alternative and efficient approach for fast, low-cost assays
optimization. It is important to clarify that Taguchi Method will not supply the final diagnos‐
tics for the patient but allows the best and optimal clinical assays factors adjustments to support
a subsequent qualitative analysis by the clinical technician.
Robust Design and Taguchi Method Application 17
http://dx.doi.org/10.5772/56580

Acknowledgements

The authors are grateful to CAPES, Process PE024/2008 (Pro-Engineering Program - a Brazilian
Government Program) and to Fleury Diagnostics.

Author details

Helder Jose Celani de Souza1*, Messias Borges Silva2,3, Cinthia B. Moyses4,


Fernando Lopes Alberto4, Fabrício J. Pontes3, Ubirajara R. Ferreira3, Roberto N. Duarte5 and
Carlos Eduardo Sanches da Silva6

*Address all correspondence to: [email protected]

1 Siemens Healthcare Diagnostics, Sao Paulo State University – UNESP, Production Engi‐
neering Department, Guaratingueta, SP, Brazil

2 São Paulo University – USP, Lorena, SP, Brazil

3 Sao Paulo State University, UNESP, Guaratingueta, SP, Brazil

4 Fleury Diagnostics, São Paulo, SP, Brazil

5 CEFET - São Joao da Boa Vista, SP, Brazil

6 Federal University of Itajuba, Itajuba, MG, Brazil

References

[1] Molecular assay optimized by Taguchi experimental design method for venous
thromboembolism investigation, Molecular and Cellular Probes Journal, 2011, 25:
231-237.

[2] British Committee for Standards in Haematology, Guidelines on investigation and


management of thrombophilia. J. Clin Pathol 1990; 43: 703-10.

[3] Rosendaal F.R., Venous thrombosis: a multicausal disease. Lancet 1999; 353: 1167-73.

[4] Franco R.F., Reitsma P.H., Genetic risk factors of venous thrombosis. Hum Genet
2001; 109: 369-84.

[5] Lay M.J., Wittwer C.T., Real-time fluorescence genotyping of factor V Leiden during
rapid-cycle PCR. Clin Chem 1997; 43: 2262–7.
18 Design of Experiments - Applications

[6] von Ahsen N., Schütz E, Armstrong V.W., Oellerich M., Rapid detection of pro‐
thrombotic mutations of Prothrombin (G20210A), Factor V Leiden (G1691A), and
methylenetetrahydrofolate reductase (C677T) by real-time fluorescence PCR with the
LightCycler. Clin Chem 1999; 45: 694-6.

[7] Neoh S.H., Brisco M.J., Firgaira F.A., Trainor K.J., Turner D.R., Morley A.A., Rapid
detection of the factor V Leiden (1691 G>A) and haemochromatosis (845 G>A) muta‐
tion by fluorescence resonance energy transfer (FRET) and real time PCR. J Clin Path‐
ol 1999; 52: 766-9.

[8] Sevall J.S., Factor V Leiden genotyping using real-time fluorescent polymerase chain
reaction. Mol Cell Probes 2000; 14: 249–53.

[9] Parks S.B., Popovich B.W., Press R.D., Real-time polymerase chain reaction with fluo‐
rescent hybridization probes for the detection of prevalent mutations causing com‐
mon thrombophilic and iron overload phenotypes. Am J Clin Pathol 2001; 115:
439-47.

[10] Ameziane N., Lamotte M., Lamoril J., Lebret D., Deybach J.C., Kaiser T., de Prost D.,
Combined Factor V Leiden (G1691A) and Prothrombin (G20210A) genotyping by
multiplex real-time polymerase chain reaction using fluorescent resonance energy
transfer hybridization probes on the Rotor-Gene 2000. Blood Coagul Fibrinolysis
2003; 14: 421-4.

[11] Padke M.S., Quality Engineering Using Robust Design. Prentice Hall, Englewood
Cliffs, NJ; 1989.

[12] Ross P.J., Taguchi Techniques for Quality Engineering. McGraw-Hill, USA, 43–73;
1996.

[13] Barrado E., Vega M., Grande P., Del Valle J.L., Optimization of a purification ethod
for metal-containing wastewater by use of a Taguchi experimental design. 1996; 30:
2309–2314.

[14] Taguchi, G., Konishi, S., Taguchi Methods: Orthogonal Arrays and Linear Graphs.
American Supplier Institute, USA; 1987.

[15] Ballantyne K.N., van Oorschot R.A., Mitchell R.J., Reduce optimisation time and ef‐
fort: Taguchi experimental design methods. Forensic Sci Int: Genetics 2008; Suppl
Series 1: 7-8.

[16] Montgomery D.C., Design and Analysis of Experiments. NY, John Wiley & Sons;
2003.

[17] Taguchi G., Elsayed E.A., Hsiang T., Quality Engineering in the Production Systems,
McGraw-Hill; 1987.

[18] Montgomery D.C., Runger G.C., Applied Statistics and Probability for Engineers.
New York: John Wiley & Sons; 2007.
Robust Design and Taguchi Method Application 19
http://dx.doi.org/10.5772/56580

[19] Vining, G.G., Myers, R.H., Combining Taguchi and response surface philosophies: a
dual response approach. Journal of Quality Technology 22: 38-45, 1990.
Chapter 2

On the Effect of Fabrication and Testing Uncertainties in


Structural Health Monitoring

H. Teimouri, A. S. Milani and R. Seethaler

Additional information is available at the end of the chapter

http://dx.doi.org/10.5772/56530

1. Introduction

Sensitive engineering structures are designed to be safe such that catastrophic failures can be
avoided. Traditionally, this has been achieved by introducing safety factors to compensate for
the lack of considering a structure’s full-scale behavior beyond the expected loads. Safety
factors create a margin between real-time operational loading and residual strength remaining
in the structure. Historically, although fail-safe and safe-life methodologies were among
design strategies for many years, the increasing impact of economical considerations and
emerging inspection technologies led to a new design strategy called damage tolerance
strategy [1]. Damage tolerant designed structures have an added cost which is related to the
frequency and duration of inspections. For such structures, inspection intervals and damage
thresholds are estimated and at every inspection the structure’s health is investigated by
looking for a maximum flaw, crack length and orientation. If necessary, modified investigation
times are proposed, especially at vulnerable locations of the structure. Other limitations of the
damage tolerant strategy include a lack of continuous assessment of the structure’s health
status and the need to pause the regular operation of the structure during off-line inspections.
Over time, beside some historical catastrophic failures, the advancement of nondestructive
technologies and economical benefits have directed designers to the introduction of the
concept of Structural Health Monitoring (SHM). It may be hard to find a comprehensive and
consistent definition for SHM, but as Boller suggested in [1], “SHM is the integration of sensing
and possibly actuation devices to allow the loading and damage state of the structure to be
monitored, recorded, analyzed, localized, quantified and predicted in a way that nondestruc‐
tive testing becomes an integral part of the structure”. This definition contains two major
elements: load monitoring and damage diagnosis as the consequence of operational loading
(which is often subject to a stochastic nature).

© 2013 Teimouri et al.; licensee InTech. This is an open access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits
unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
22 Design of Experiments - Applications

The review of literature shows an increasing number of research programs devoted to the
development of damage identification systems to address problems such as assuming cost-
effective methods for optimal numbering and positioning of sensors; identification of features
of structures that are sensitive to small damage levels; the ability to discriminate changes
caused by damage from those due to the change of environmental and testing conditions;
clustering and classification algorithms for discrimination of damaged and undamaged states;
and comparative studies on different damage identification methods applied to common
datasets [2]. These topics are currently the focus of various groups in major industries including
aeronautical [3, 4], civil infrastructure [5], oil [6, 7], railways [8], condition monitoring of
machinery [9, 10], automotive and semiconductor manufacturing [2]. In particular, new multi-
disciplinary approaches are increasingly developed and used to advance the capabilities of
current SHM techniques.

2. Motivation of this study

A standard SHM technique for a given structure compares its damaged and healthy behaviors
(by contrasting signals extracted from sensors embedded at specific points of the structure) to
the database pre-trained from simulating/testing the behavior of the structure under different
damage scenarios. Ideally, the change in the vibration spectra/stress-strain patterns an be
related to damage induced in the structure, but it is possible at the same time that these
deviations from a healthy pattern are caused by imperfect manufacturing processes including
uncertainty in material properties or misalignment of fibers inside the matrix (in the case of
composite structures), an offset of an external loading applied to the structure during testing,
etc. Based on a strained-based SHM, this article addresses the important effect of manufac‐
turing/testing uncertainties on the reliability of damage predictions. To this end, as a case study
a benchmark problem from the literature is used along with a finite element analysis and
design of experiments (DOE) method. Among several existing DOE experimental designs (e.g.,
[11-16]) here we use the well-known full factorial design (FFD).

3. Case study description

The structure under investigation is a composite T-joint introduced in [17], where a strain-
based structural health monitoring program, GNAISPIN (Global Neural network Algorithm
for Sequential Processing of Internal sub Networks), was developed using MATLAB and
NASTRAN-PATRAN. The T-joint structure, shown in Figure 1, consists of four major segments
including the bulkhead, hull, over-laminates and the filler section. The finite element model
of the structure is assumed to be two-dimensional (2D) and strain patterns are considered to
be identical in the thickness direction of the structure. The geometrical constraints and applied
load are also shown in Figure 1. The left-hand side constraint only permits rotation about the
z-axis and prevents all other rotational and translational degrees of freedom. The right-hand
side constraint permits translation along the x-axis (horizontal direction) and rotation about
On the Effect of Fabrication and Testing Uncertainties in Structural Health Monitoring 23
http://dx.doi.org/10.5772/56530

the z-axis. The displacement constraints are positioned 120mm away from the corresponding
edges of the hull. The structure is subjected to a pull-off force of 5 kN. In [17], several delami‐
nations were embedded in different locations of the structure, but in this study only a single
delamination case is considered between hull and the left overlaminate. The strain distribution
is then obtained for nodes along the bond-line (the top line of the hull between the right- and
left-hand constraints), which are the nodes most affected by the presence of embedded
delamination.

Left Right
constraint constraint

Figure 1. Geometry of the T-joint considered in the case study [17]

Using ABAQUS software, two dimensional orthotropic elements were used to mesh surfaces
of the bulkhead, hull, and overlaminates, whereas isotropic elements were used to model the
filler section. The elastic properties of the hull, bulkhead, and the overlaminates [17] corre‐
spond to 800 grams-per-square of plain weave E-glass fabric in a vinylester resin matrix (Dow
Derakane 411-350). The properties of the filler corresponded to chopped glass fibers in the
same vinylester resin matrix as summarized in Table 1.

Elastic Properties Hull and Bulkhead Overlaminate Filler (quais-isotropic)

E1 (GPa) 26.1 23.5 2.0

E2 (GPa) 3.0 3.0

E3 (GPa) 24.1 19.5

v12=v23 0.17 0.17 0.3

v13 0.10 0.14

G12=G23 (GPa) 1.5 1.5 0.8

G13 (GPa) 3.3 2.9

Table 1. Elastic properties of the T-joint components

In order to verify the developed base ABAQUS model, strain distributions along the bond-line
for the two cases of healthy structure and that with an embedded delamination are compared
to the corresponding distributions presented in [17]. Figures 2.a and 2.b show a good accord‐
24 Design of Experiments - Applications

ance between the current simulation model and the one presented in [17] using NASTRAN-
PATRAN. The only significant difference between the two models is found at the middle of
the T-joint where results in [17] show a significant strain drop compared to the ABAQUS
simulation. Figure 3 also illustrates the 2D strain distribution obtained by the ABAQUS model
for the healthy structure case.

900 Healthy
700
Damaged

Micro strain
500
300
100
-100 0 100 200 300 400 500
-300
Nodes
b) The strain pattern obtained via ABAQUS model (the
a) Strain patterns in [17] via NASTRAN- delamination size and location were identical to the
PATRAN model NASTRAN-PATRAN model)

Figure 2. Comparison of strain distributions along the bond-line of the T-joint for different cases

Figure 3. Strain field in the healthy T-joint via ABAQUS model (notice the symmetrical pattern)

Next, using the ABAQUS model for the DOE study, fiber orientations in the bulkhead, hull
and overlaminate as well as the pull-off loading offset were considered as four main factors
via a full factorial design, which resulted in sixteen runs for each of the health states (healthy
and damaged structure). Two levels for each factor were considered: 0 or +5 degrees counter-
clockwise with respect to the x-axis (Figure 4). Table 2 shows the assignment of considered
On the Effect of Fabrication and Testing Uncertainties in Structural Health Monitoring 25
http://dx.doi.org/10.5772/56530

factors and their corresponding levels. Table 3 represents the full factorial design for the two

structural health cases.

Factors Coding Levels (in degrees)

Overlaminate A 0 or 5

Regions of fiber
Bulkhead B 0 or 5
angle error (misalignment)

Hull C 0 or 5

Loading offset Loading angle D 0 or 5

Table 2. Factors and the corresponding levels considered in the DOE study

Figure 4. Schematic of study factors along with the position of the first, middle and the last nodes considered during
the first DOE analysis
26 Design of Experiments - Applications

Factors (all angles in degrees)

run A B C D Case

1 0 0 0 0

2 5 0 0 0

3 0 0 5 0

4 5 0 5 0

5 0 5 5 0

6 5 5 5 0

No Delamination
7 0 5 0 5

8 5 5 0 5

9 0 0 0 5

10 5 0 0 5

11 0 0 5 5

12 5 0 5 5

13 0 5 5 5

14 5 5 5 5

15 0 5 0 0

16 5 5 0 0

17 0 0 0 0

18 5 0 0 0

Delamination of 50mm long at 200mm from left edge


19 0 0 5 0

20 5 0 5 0

21 0 5 5 0

22 5 5 5 0

23 0 5 0 0

24 5 5 0 0

25 0 0 0 5

26 5 0 0 5

27 0 0 5 5

28 5 0 5 5

29 0 5 5 5

30 5 5 5 5

31 0 5 0 5

32 5 5 0 5

Table 3. Full factorial design resulting in a total of 32 simulations (24 for the healthy structure and 24 for the damaged
structure)
On the Effect of Fabrication and Testing Uncertainties in Structural Health Monitoring 27
http://dx.doi.org/10.5772/56530

In order to illustrate the importance of the effect of uncertainty in fiber misalignment (e.g.,
during manufacturing of the structure’s components), one can readily compare the difference
between the strain distributions obtained for a case containing, e.g., 5o misalignment in the
overlaminate (i.e., run # 2 in Table 3) and that for the perfectly manufactured healthy case (run
# 1). A similar difference can be plotted between the case without any misalignment but in the
presence of delamination (damage)-- which corresponds to run # 17 – and the perfectly
manufactured healthy case (run # 1). These differences are shown in Figure 5.

0.00015 0.0006

1E-04 0.0004
Actual strain

Actual strain
0.0002
5E-05
0
-1E-18
-0.0002 0 100 200 300 400 500
0 200 400
-5E-05 -0.0004
-0.0001 -0.0006
Nodes Nodes

(a) Run # 2 – Run # 1 (b) Run # 17 – Run # 1

Figure 5. Differences in strain distributions of sample runs in Table 3

By comparing the strain distributions in Figures 5.a and 5.b one can conclude that 5 degrees
misalignment of fibers in the overlaminate (run # 2) has resulted in a significant deviation from
the base model (run # 1) compared to the same deviations caused by the presence of delami‐
nation (run # 17); and hence, emphasizing the importance of considering fiber misalignment
in real SHM applications and database developments. The next section is dedicated to perform
a more detailed factorial analysis of results and obtain relative effects of the four alignment
factors A, B, C, and D as samples of uncertainty sources in practice.

4. DOE effects analysis

Two different approaches are considered in the effects analysis; a point-to-point and an integral
analysis. In the point-to-point approach, the difference between the horizontal strain values at
three locations along the bond-line (first, middle and the last node in Figure 4) and those of
the ideal case are considered as three output variables. On the other hand, the integral approach
continuously evaluates the strain along the bond line where the number of considered points
(sensors) tends to infinity. In fact the strain values obtained from the FE analysis would
correspond to the strain data extracted from sensors embedded in the T-joint. The integral
analysis for each given run, calculates the area under the strain distribution along the bond
line, minus the similar area in the ideal case. The comparison of the two approaches, hence,
provides an opportunity to assess the impact of increasing the number of sensors on the
performance of SHM in the presence of manufacturing errors (here misalignments). For each
28 Design of Experiments - Applications

approach, the most dominant factors are identified via comparing their relative percentage
contributions on the output variables as well as the corresponding half-normal probability
plots (see [16] for more theoretical details). Subsequently, ANOVA analysis was performed to
statistically determine the significance (F-value) of key factors.

4.1. Point-to-point analysis results

Figure 4 shows the position of nodes assigned for the point-to-point analysis strategy. The first
and last sensor points are considered to be 50mm away from the nearest constraint on the
contact surface of hull and overlaminate. The middle point is located below the pull-off load
point. Table 4 shows the results of FE runs based on the factor combinations introduced in
Table 3. As addressed before, the presented data for the first group of runs (i.e., for healthy
structures – runs 1 to 16) are the difference between strain values of each run and run 1; while
the corresponding data for the second group (damaged T-joint – runs 17 to 32) represent the
difference between strain values for each run and run 17. Table 5 represents the ensuing
percentage contributions of factors and their interactions at each node for the two cases of
healthy and delaminated T-joint. For the first node, which is close to the most rigid constraint
on the left hand side of the structure, the only important factors are the misalignment of fibers
in the hull (factor C) and its interaction with the loading angle offset (CD). This would be
explained by the type of constraints imposed on the structure which is free horizontal
translation of the opposite constraint on the right side. Figure 6 shows the half normal
probability plot of the factor effects for the 1st node, confirming that factors C and CD are
distinctly dominant parameters affecting the strain response at this node.

Figure 6. Half normal probability plot using the response at the 1st node during point-to-point analysis (for healthy
structure)

Logically, one would expect that the mid node response would be strongly influenced by any
loading angle offset as it can produce a horizontal force component and magnify the effect of
On the Effect of Fabrication and Testing Uncertainties in Structural Health Monitoring 29
http://dx.doi.org/10.5772/56530

the free translation boundary condition on the neighboring constraint; therefore, for the middle
point response, the misalignment of fibers in the hull (C) and the loading angle error (D) and
their interactions (CD) are the most significant factors, as also shown from the corresponding
half normal probability plot in Figure 7. Finally, due to the short distance of the last (3rd)
measuring node to the right constraint point and the strong influence of the large hull section
beneath this measuring node, the parameter C was found to be the most dominant factor,
followed by D, CD, AC, AD, and ACD (Figure 8).

Figure 7. Half normal probability plot using the response at the 2nd node during the point-to-point analysis (for
healthy structure)

Figure 8. Half normal probability plot using the response at the 3rd sensor point during point-to-point analysis (for
healthy structure)
30 Design of Experiments - Applications

Structure’s
Run Factors Response
health status

A B C D @1st node @middle node @end node


1 0 0 0 0 0 0 0
2 5 0 0 0 1.0979E-06 2.273E-06 0.000013536
3 0 0 5 0 4.23422E-05 3.0625E-05 4.04549E-05
4 5 0 5 0 4.4637E-05 0.000029522 5.78129E-05
5 0 5 5 0 4.23426E-05 0.000032361 4.04549E-05

No Delamination (Healthy)
6 5 5 5 0 4.46377E-05 3.1389E-05 5.78129E-05
7 0 5 0 5 2.58877E-05 0.000040385 1.21364E-05
8 5 5 0 5 2.71377E-05 0.000038519 5.23E-07
9 0 0 0 5 2.58911E-05 0.000036949 0.000012135
10 5 0 0 5 2.71419E-05 0.000034988 5.219E-07
11 0 0 5 5 2.17078E-05 0.000111352 2.26219E-05
12 5 0 5 5 2.16311E-05 0.000105259 3.74989E-05
13 0 5 5 5 2.17102E-05 0.000115452 2.26229E-05
14 5 5 5 5 0.000021634 0.000109486 3.74999E-05
15 0 5 0 0 5E-10 1.445E-06 0
16 5 5 0 0 1.0987E-06 3.83E-06 1.35358E-05
A B C D @1st node @middle node @end node
17 0 0 0 0 0 0 0
18 5 0 0 0 8.428E-07 1.744E-06 1.35359E-05
19 0 0 5 0 4.22965E-05 0.000030471 4.04562E-05
Delamination of size 50mm at 210mm from left
20 5 0 5 0 4.43366E-05 0.000028817 5.78142E-05
21 0 5 5 0 4.22971E-05 0.000032214 4.04562E-05
22 5 5 5 0 4.43376E-05 0.00003069 5.78142E-05
23 0 5 0 0 8E-10 1.416E-06 1E-10
24 5 5 0 0 8.44E-07 3.272E-06 1.35357E-05
25 0 0 0 5 2.61841E-05 0.000035177 1.21353E-05
26 5 0 0 5 0.000027744 3.2725E-05 5.221E-07
27 0 0 5 5 2.61841E-05 0.000035177 1.21353E-05
28 5 0 5 5 2.09678E-05 0.000103816 3.75002E-05
29 0 5 5 5 2.13567E-05 0.000114459 2.26242E-05
30 5 5 5 5 2.09723E-05 0.000107997 3.75012E-05
31 0 5 0 5 2.61794E-05 0.000038553 1.21366E-05
32 5 5 0 5 0.000027738 0.000036197 5.233E-07

Table 4. Results of the DOE runs for the point-to-point analysis (A: Overlaminate – B: Bulkhead – C: Hull– D: Loading
angle)
On the Effect of Fabrication and Testing Uncertainties in Structural Health Monitoring 31
http://dx.doi.org/10.5772/56530

@first node @middle node @last node


Factors
Healthy Damaged Healthy Damaged Healthy Damaged

A 0.13868 0.017835 0.043177 1.01244 4.91255 6.414703

B 8.15E-12 0.03857 0.117004 2.8447 1.95E-08 0.113719

C 38.60064 38.8124 40.42626 33.93042 73.58083 66.59797

D 0.457217 0.827449 51.83837 42.73814 6.411934 8.096834

AB 8.79E-11 0.038593 5.28E-05 1.694425 2.63E-10 0.113632

AC 0.000112 0.066135 0.054639 1.098861 3.868746 5.223829

AD 0.032741 0.112498 0.083222 0.983084 3.214382 2.070652

BC 2.67E-07 0.038292 0.000938 1.810764 9.47E-11 0.113615

BD 3.63E-08 0.038687 0.01842 2.126322 2.33E-08 0.113723

CD 60.72826 59.65124 7.417231 3.218366 5.848022 7.467763

ABC 2.51E-09 0.038622 6.35E-07 1.713334 2.63E-10 0.113615

ABD 1.15E-09 0.038568 1.08E-07 1.716435 1.05E-11 0.113619

ACD 0.04235 0.204216 0.000548 1.6494 2.163531 3.219085

BCD 2.87E-07 0.038282 0.000141 1.748334 5.16E-10 0.113611

ABCD 3.12E-09 0.038622 4.12E-08 1.714975 1.05E-11 0.113628

Table 5. Percentage contributions of the factors from the point-to-point analysis results in Table 4; all values are in %;
the bold numbers refer to the high contributions.

Source DF Seq SS Adj SS Adj MS F P


A 1 291.69 291.69 291.69 20.44 0.002
C 1 4368.92 4368.92 4368.92 306.09 0.000
D 1 380.71 380.71 380.71 26.67 0.001
A*C 1 229.71 229.71 229.71 16.09 0.003
A*D 1 190.86 190.86 190.86 13.37 0.005
C*D 1 347.23 347.23 347.23 24.33 0.001
Error 9 128.46 128.46 14.27
Total 15 5937 .57

Table 6. Results of ANOVA for the 3rd node response, considering the identified factors from Figure 8 for the block of
healthy runs

Next, based on the identified significant factors from the above results for the 3rd node, an
ANOVA analysis (Table 6) was performed considering the rest of insignificant effects embed‐
ded in the error term. As expected, the p-value for the factor C is zero and the corresponding
values for factors D and CD are 0.001. The p-value for all other factors is greater than 0.001.
Therefore, assuming a significance level of 1%, for the 3rd node response, much like the 1st and
middle nodes, factors C, D and their interaction CD can be reliably considered as most
32 Design of Experiments - Applications

significant. Table 7 shows the ANOVA results for all the three nodes when only these three
factors were included.

One interesting observation during the above analysis was that we found no significant
deviation of main results when we repeated the analysis for the block of runs with delamina‐
tion (compare the corresponding values under each node in Table 5 for the two healthy and
damage cases). This indicated that the effects of misalignment (manufacturing and testing error)
factors between the healthy and damaged structures at each specific node are generally identical, in the
present case study.

@1st node

Source DF Seq SS Adj SS Adj MS F P

C 1 1451.4 1451.4 1451.4 2165.69 0.000

D 1 17.2 17.2 17.2 25.65 0.000

C*D 1 2283.4 2283.4 2283.4 3407.16 0.000

Error 12 8.0 8.0 0.7

Total 15 3759.9

@Middle node

Source DF Seq SS Adj SS Adj MS F P

C 1 10356.0 10356.0 10356.0 1524.83 0.000

D 1 13279.4 13279.4 13279.4 1955.28 0.000

C*D 1 1900.1 1900.1 1900.1 279.77 0.000

Error 12 81.5 81.5 6.8

Total 15 25616.9

@Last node

Source DF Seq SS Adj SS Adj MS F P

C 1 4368.9 4368.9 4368.9 62.36 0.000

D 1 380.7 380.7 380.7 5.43 0.038

C*D 1 347.2 347.2 347.2 4.96 0.046

Error 12 840.7 840.7 70.1

Total 15 5937.6

Table 7. Results of ANOVA analysis for factors C, D and CD – point-to-point analysis approach

Figures 9.a – 96.f represent the main factor and interaction plots for the point-to-point analysis.
For the first and last points, the lines for interaction of hull fiber misalignment and the loading
angle offset are crossed, which indicates a high interaction between those parameters at the
corresponding node. This interaction indication agrees well with the high F-value provided
by the ANOVA analysis for CD in Table 7 for the first node. For the middle node, the individual
lines for C and D in the main plots are in the same direction but with a small difference in their
slopes. For the last (3rd) node, the main factor plots for parameters C and D have slopes with
opposing signs, suggesting that for this node, the fiber misalignment angle and loading angle
offset have opposite influences on the strain response. This again could be explained by the
imposed type of constraint on the right side of the T-joint.
On the Effect of Fabrication and Testing Uncertainties in Structural Health Monitoring 33
http://dx.doi.org/10.5772/56530

(a) (b)

(c) (d)

(e) (f)

Figure 9. The main factor and interaction plots for the point-to-point analysis considering C, D and CD factors.

4.2. Integral analysis results

In this approach the objective function for each run was considered as the area between the
curve representing the strain distribution of the nodes lying on the bond line and that of the
base case. For the first group of runs (healthy structure, run#1-16), the first run is the base
curve, whereas for the second group (embedded delamination case, run # 17 – 32) the 17th run
(i.e., only delamination and no other fiber misalignment or loading angle error) is considered
as the base. Table 8 lists the objective values for each run during this analysis. Table 9 represents
34 Design of Experiments - Applications

the obtained percentage contribution of each factor. The parameters C and CD again play the
main role on the strain distribution, but to be more accurate one may also consider other factors
such as A, D, AD, and AC.

Structure’s
Run A B C D Integral method response
state
1 0 0 0 0 0
2 5 0 0 0 1.79422E-05
3 0 0 5 0 4.33694E-05
4 5 0 5 0 5.6027E-05
5 0 5 5 0 4.33843E-05
6 5 5 5 0 5.60299E-05

No Delamination
7 0 5 0 5 3.73717E-05
8 5 5 0 5 3.14578E-05
9 0 0 0 5 3.72118E-05
10 5 0 0 5 3.14519E-05
11 0 0 5 5 3.0095E-05
12 5 0 5 5 3.77188E-05
13 0 5 5 5 3.04696E-05
14 5 5 5 5 3.80525E-05
15 0 5 0 0 1.31538E-07
16 5 5 0 0 1.79444E-05
17 0 0 0 0 0
18 5 0 0 0 1.79696E-05
19 0 0 5 0 4.35521E-05
Delamination of size 50mm at 210mm from left

20 5 0 5 0 5.66002E-05
21 0 5 5 0 4.35663E-05
22 5 5 5 0 5.66009E-05
23 0 5 0 0 1.32937E-07
24 5 5 0 0 1.79724E-05
25 0 0 0 5 3.7407E-05
26 5 0 0 5 3.15725E-05
27 0 0 5 5 3.7407E-05
28 5 0 5 5 3.9519E-05
29 0 5 5 5 3.28869E-05
30 5 5 5 5 3.98452E-05
31 0 5 0 5 3.7563E-05
32 5 5 0 5 3.15788E-05

Table 8. Results of the DOE runs for the integral analysis (A: Overlaminate – B: Bulkhead – C: Hull– D: Loading angle)
On the Effect of Fabrication and Testing Uncertainties in Structural Health Monitoring 35
http://dx.doi.org/10.5772/56530

In order to show the dominant factors graphically, the corresponding half normal probability
plot (Figure 10) was constructed; Figure 10 recommends considering AC as the last dominant
factor. Next, a standard ANOVA analysis was performed (Table 10) and results suggested
ignoring the effect of factors AC and D with a statistical significance level of α=0.01. Never‐
theless, recalling the percentage contributions in Table 9 it is clear that the top two main factors
are C and CD, as it was the case for the point-to-point analysis. However in the point-to-point
analysis, D was also highly significant at the selected nodes, whereas in the integral method
it shows much less overall contribution. This would mean that the number and locations of sensors
during SHM can vary the sensitivity of the prediction results to particular noise/uncertainty factors,
such as D (the loading angle offset). Figure 11 illustrates the main and interaction plots for the
factors A, C, and D. From Figure 11.a, unlike in the point-to-point analysis (Figure 9), the slope
of every main factor, including D, is positive in the current analysis. This indicates that
increasing each noise factor magnitude also increases the deviation of the structure’s overall
response from the base model. The interaction plot for C and D in Figure 11.b confirms an
overall high interference of these two main factors; which is interesting because according to
Figures 9 the lines of these factors cross each other mainly at the first node. This suggests that
only for a few number of points near the left constraint point the interactive effect of noise
factors (here C and D) may be notable; A potential hypothesis from these results for a future
work would be: the more dispersed the positions of the sensors, perhaps the less likelihood of imposing
interactive effects of noise (uncertainty) factors on the overall prediction results.

Structure’s health state


Factors
Healthy Damaged

A 6.552184733 5.319084821
B 0.001652565 0.02290527
C 41.0309489 46.98622851
D 2.388791028 4.01506981
AB 0.000177577 0.031520485
AC 0.423871764 0.189479205
AD 5.197090974 6.353769585
BC 0.000285795 0.030478626
BD 0.000820031 0.026597215
CD 42.21458426 35.4607182
ABC 8.33724E-05 0.039747913
ABD 4.48647E-06 0.035628966
ACD 2.188823941 1.425288598
BCD 0.000680545 0.027279407
ABCD 2.77746E-08 0.036203388

Table 9. Percentage contributions of the factors from the integral analysis in Table 8; all values are in %; the bold
numbers refer to the high contributions
36 Design of Experiments - Applications

Figure 10. Half normal probability plot – integral approach (Healthy structure).

Source DF Seq SS Adj SS Adj MS F P

A 1 260.75 260.75 260.75 26.90 0.001

C 1 1632.87 1632.87 1632.87 168.43 0.000

D 1 95.06 95.06 95.06 9.81 0.012

A*C 1 16.87 16.87 16.87 1.74 0.220

A*D 1 206.82 206.82 206.82 21.33 0.001

C*D 1 1679.97 1679.97 1679.97 173.28 0.000

Error 9 87.25 87.25 9.69

Total 15 3979.60

Table 10. Results of ANOVA analysis based on dominant factors in Figure 10 for the integral approach

(a) (b)

Figure 11. Main factor and interaction plots for the integral analysis approach (considering factors A, C, D and their
interactions).
On the Effect of Fabrication and Testing Uncertainties in Structural Health Monitoring 37
http://dx.doi.org/10.5772/56530

Finally, similar to the point-to-point analysis, comparing the contribution percentage values
for the two blocks of runs in Table 9 (healthy vs. damaged structure), the delamination seems
to have no major interaction with the other four uncertainty factors. In order to statistically
prove this conclusion, a 25 full factorial was performed, considering delamination as a new
fifth factor E. Ignoring the 3rd order interactions and embedding them inside the body of error
term, ANOVA results were obtained in Table 11. It is clear that the E (damage) factor itself has
a significant contribution but not any of its interaction terms with noise factors.

Source DF Seq SS Adj SS Adj MS F P

A 1 626.54 626.54 626.54 48.33 0.000

B 1 17.71 17.71 17.71 1.37 0.260

C 1 2817.34 2817.34 2817.34 217.30 0.000

D 1 274.12 274.12 274.12 21.14 0.000

E 1 12.22 12.22 12.22 0.94 0.346

A*B 1 12.82 12.82 12.82 0.99 0.335

A*C 1 28.51 28.51 28.51 2.20 0.158

A*D 1 1.49 1.49 1.49 0.12 0.739

A*E 1 13.53 13.53 13.53 1.04 0.322

B*C 1 13.22 13.22 13.22 1.02 0.328

B*D 1 16.58 16.58 16.58 1.28 0.275

B*E 1 13.06 13.06 13.06 1.01 0.331

C*D 1 1.02 1.02 1.02 0.08 0.782

C*E 1 12.65 12.65 12.65 0.98 0.338

D*E 1 13.08 13.08 13.08 1.01 0.330

Error 16 207.44 207.44 12.97

Total 31 4081.34

Table 11. Results of ANOVA analysis considering delamination as the 5th factor for integral approach.

5. Conclusions

Two different approaches, a point-to-point analysis and an integral analysis, were considered
in a case study on the potential effect of uncertainty factors on SHM predictability in composite
structures. The point–to-point (discrete) analysis is more similar to real applications where the
number of sensors is normally limited and the SHM investigators can only rely on the data
extracted at specific sensor locations. The integral approach, on the other hand, calculates the
area of a continuous strain distribution and, hence, simulates an ideal situation where there
are a very large number of sensors embedded inside the structure. The comparison of the two
approaches showed the impact of increasing the number of strain measurement points on the
behavior of the prediction model and the associated statistical results. Namely, for all sensor
38 Design of Experiments - Applications

positions considered in the point-to-point (discrete) analysis, the main factors were the
misalignment of fibers in the hull and the loading angle offset, but for the integral (continuous)
approach, the aggregation of smaller factors over the bond line resulted in increasing signifi‐
cance of other parameters such as overlaminate misalignment angle and its interaction with
other factors. However the top contributing factors remained the same between the two
analyses, indicating that increasing the number of sensors does not eliminate the noise effects
from fabrication such as misalignment of fibers and loading angle offset. Another conclusion
from this case study was that, statistically, there was no sign of significant deviation in
contribution patterns of factors between the healthy and damaged structure. This suggests that
different sensor positioning scenarios may change the sensitivity of the response to noise
factors but the deviation would be regardless of the absence or presence of delamination. In
other words the relative importance of studied noise factors would be nearly identical in the
healthy and damaged structure. Finally, results suggested that that the absolute effect of
individual manufacturing uncertainty factors in deviating the structure’s response can be as
high as that caused by the presence of delamination itself when compared to the response of
the healthy case, even in the absence of misalignment errors. Hence, a basic SHM damage
prediction system under the presence of pre-existing manufacturing/testing errors may lead
to wrong decisions or false alarms. A remedy to this problem is the use of new stochastic SHM
tools.

Acknowledgements

Authors are grateful to Dr. J. Loeppky from Irving K. Barber School of Arts and Sciences at
UBC Okanagan for his useful suggestions and discussions. Financial support from the Natural
Sciences and Engineering Research Council (NSERC) of Canada is also greatly acknowledged.

Author details

H. Teimouri, A. S. Milani* and R. Seethaler

*Address all correspondence to: [email protected]

School of Engineering, University of British Columbia, Kelowna, Canada

References

[1] Christian BOLLER, Norbert MEYENDORF. “State-of-the-Art in Structural Health


Monitoring for Aeronautics” Proc. of Internat. Symposium on NDT in Aerospace,
Fürth/Bavaria, Germany, December 3-5, 2008.
On the Effect of Fabrication and Testing Uncertainties in Structural Health Monitoring 39
http://dx.doi.org/10.5772/56530

[2] Charles R. FARRAR, Keith WORDEN. “An Introduction to Structural Health Moni‐
toring” Phil. Trans. R. Soc. A 365, 303–315, 2007.

[3] C. Boller, M. Buderath. “Fatigue in aerostructures – where structural health monitor‐


ing can contribute to a complex subject” Phil. Trans. R. Soc. A 365, 561–587, 2007.

[4] R. Ikegami. “Structural Health Monitoring: assessment of aircraft customer needs”


Structural Health Monitoring 2000, Proceedings of the Second International Work‐
shop on Structural Health Monitoring, Stanford, CA, September 8-10, Lancaster –
Basel, Technomic Publishing Co, Inc, pp. 12-23, 1999.

[5] J.M.W. BROWNJOHN. “Structural Health Monitoring of Civil Infrastructure” Phil.


Trans. R. Soc. A 365, 589-622, 2007.

[6] Light Structures AS. “Exploration & Production: The Oil & Gas Review, Volume 2”
2003.

[7] Ved Prakash SHARMA, J.J. Roger CHENG. “Structural Health Monitoring of Syn‐
crude’s Aurora II Oil Sand Crusher” University of Alberta, Department of Civil &
Enviromental Engineering, Structural Engineering Report No 272, 2007.

[8] D. BARKE, W.K. CHIU. “Structural Health Monitoring in Railway Industry: A Re‐
view” Structural Health Monitoring 4, 81-93, 2005.

[9] B.R. RANDALL. “State of the Art in Monitoring Rotating Machinery – Part I” J.
Sound and Vibrations 38, March, 14-21, 2004.

[10] B.R. RANDALL. “State of the Art in Monitoring Rotating Machinery – Part II” J.
Sound and Vibrations 38, May, 10-17, 2004.

[11] B. Tang, “Orthogonal array-based Latin hypercubes” Journal of the American Statis‐
tical Association, 88(424):1392–1397, 1993.

[12] J.-S. Park, “Optimal Latin-hypercube designs for computer experiments” Journal of
Statistical Planning and Inference, 39:95–111, 1994.

[13] X. Qu, G. Venter, R.T. Haftka, “New formulation of minimumbias central composite
experimental design and Gauss quadrature” Structural and Multidisciplinary Opti‐
mization, 28:231–242, 2004.

[14] R. Jin, W. Chen, A. Sudjianto, “An efficient algorithm for constructing optimal design
of computer experiments” Journal of Statistical Planning and Inference, 134:268–287,
2005.

[15] T.W. Simpson, D.K.J. Lin, W. Chen, “Sampling strategies for computer experiments:
Design and analysis” International Journal of Reliability and Applications, 2(3):209–
240, 2001.

[16] R.H. Myers, D.C. Montgomery, “Response Surface Methodology—Process and Prod‐
uct Optimization Using Designed Experiments” New York: Wiley, 1995.
40 Design of Experiments - Applications

[17] A. Kesavan, S. John, I. Herszberg, “Strain-based structural health monitoring of com‐


plex composite structures” Structural Health Monitoring, 7:203-213, 2008.
Chapter 3

Influential Parameters to the Database Performance —


A Study by Means of Design of Experiments (DoE)

Eduardo Batista de Moraes Barbosa and


Messias Borges Silva

Additional information is available at the end of the chapter

http://dx.doi.org/10.5772/56546

1. Introduction

The growth of the Organization’s data collections, due to the development of new materials
and advanced computing devices, puts the database (Db) technology at the forefront. Conse‐
quentially to its popularity, different options of database management systems (DBMS) can
be found on the market to store one of the most important Organization’s assets, the data.
Among the factors that may influence its choice (advanced features, interoperability, etc.),
could be highlighted the cost-benefit provided by fierce competition between different
software philosophies – proprietary (Oracle, MS SQL Server, IBM DB2, etc.) and public domain
(PostgreSQL, MySQL, Firebird, etc.) – and, also the system performance in critical computing
environments.

Performance measurements in the computer systems area (processors, operating systems,


compilers, database systems, etc.) are conducted through benchmarks (a standardized
problem or test used as basis for evaluation or comparison) widely recognized by the industry.
There are a lot of the benchmarks consortia with specific evaluation criteria, metrics, pricing
and results communication, highlighting: Open Source Database Benchmark (OSDB) (http://
osdb. sourceforge.net), System Performance Evaluation Cooperative (SPEC) (http://
www.spec.org) and Transaction Processing Performance Council (TPC) (http://www.tpc.org).

In the academic scope, the TPC benchmarks are widely recognized [1; 2; 3; 4; 5; 6; 7] due its
exactness for definition of tests implementations, price measurements and results reporting.
The TPC began from two ad hoc benchmarks formalization (DebitCredit and TP1) which
resulted in the TPC BMTM and the TPC BMTM B [1]. Currently, with the benchmarks advance,
its possible performs complex queries, batch and operational aspects of systems for transac‐

© 2013 Barbosa and Silva; licensee InTech. This is an open access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits
unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
42 Design of Experiments - Applications

tions processing through different benchmark standards, such as TPC-C (simulates a complete
computing environment where a population of users executes transactions against a Db), TPC-
DS (models several generally applicable aspects of a decision support system), TPC-E (uses a
database to model a brokerage firm with customers who generate transactions related to the
business), TPC-H (consists of a suite of business oriented ad-hoc queries and concurrent data
modifications), TPC-VMS (leverages the TPC benchmarks by adding the methodology and
requirements for running and reporting performance metrics for virtualized databases) and
TPC-Energy (contains the rules and methodology for measuring and reporting an energy
metric in TPC benchmarks).

In this chapter we intend to present a study on the Db performance by means of statistical


techniques for planning and analysis of experiments (DoE), applied in the computing scope.
The objective of this study is use two DoE techniques (2k full factorial and 2k-p fractional
factorial) to investigates the influence of different parameters (related with Db memory tuning)
in the Db performance. The DoE methodology will be applied at the case study, where the Db
parameters will be simultaneously combined and tested and its results analyzed by means of
full factorial and fractional factorial designs, and to assist in the investigations to determine
how each parameter may explain (or take influence in) the Db performance. Thus, will be also
addressed a comparison of results between the both techniques chosen. It should be noted that,
in the scope of this study, the Db technology will be used as a vehicle to demonstrate how the
DoE methodology can help in the design of experiments and its analysis and its use as a
promising tool in several scopes, like in the computing science field.

The paper is structured as follows: Section 2 shows an introduction in the benchmark tech‐
nology, with emphasis on the TPC-H standard. The DoE methodology is introduced in Section
3, where can be found a overview over full factorial and fractional factorial designs. The Section
4 is devoted to the case study to investigate the influence of different Db parameters (from
PostgreSQL DBMS) in its performance through DoE designs (2k full factorial and 2k-p fractional
factorial). This Section also presents the analysis and comparison of results. Some related work
are presented in Section 5 and the final considerations are in Section 6.

2. Benchmark overview

Performance tests in the computing scope are a valuable tool to assist the decision makers in
the hardware and/or software settings. Such tests, usually called as benchmark, can ensure
that software does not present problems or unavailability due to insufficient resources (i.e.:
memory, processor, disk, etc.).

According to the Merriam-Webster dictionary (http://www.merriam-webster.com), bench‐


mark is “a standardized problem or test that serves as a basis for evaluation or comparison (as of
computer system performance)”. In the computing scope, benchmark is typically a software to
perform pre-defined operations and returns a metric (i.e.: workload, throughput, etc.) to
describe the system behavior.
Influential Parameters to the Database Performance — A Study by Means of Design of Experiments (DoE) 43
http://dx.doi.org/10.5772/56546

Some generic benchmarks have become widely recognized (i.e.: TPC), such that vendors
advertise new products performance based in its results. Benchmarks are important tools in
evaluating computer system performance and price/performance. However, to be really useful
[1] prescribes some key criteria that should be considered during the benchmarks’ choice and/
or use:

• Relevance (must measure the peak performance and price/performance of systems when
performing typical operations within that problem domain);
• Portability (should be easy to implement on many different systems and architectures);
• Scalability (should apply to small and large computer systems); and
• Simplicity (must be understandable).

Benchmark softwares, usually, simulates scenarios from the real world (i.e.: TPC-C, TPC-DS,
TPC-E, TPC-H and TPC-VMS) where systematic procedures are performed to test, collect and
analysis the system performance. It’s use is strongly recommended, because the cost of
implementing and measuring specific applications on different systems/platforms is usually
prohibitive [1].

2.1. TPC-H Standard

TPC-H benchmark represent a generic decision support benchmark, with the main features:
capacity to manage very large amounts of data, the power to analyze it with a high degree of
complexity and the flexibility to answers critical business questions.
Figure 1, illustrates the logical schema of the TPC-H specification and shows the business and
application environment. According to the TPC official documentation [8], “TPC-H does not
represent the activity of any particular business segment, but rather any industry which must manage,
sell, or distribute a product worldwide (i.e.: car rental, food distribution, parts, suppliers, etc.)”.
In this schema (Figure 1), the Db consists of eight tables simulating a realistic application
involving customers, parts, lineitems, suppliers and orders. The prefix of the table columns is
expressed into parentheses, the relationships between tables are represented by arrows and
the number/formula below each table name are the cardinality (number of rows) of the table,
factored by scale factor (SF). That is, the SF determines the size of the raw data outside the Db
(i.e.: SF = 100 means that the sum of all base tables equals 100GB).
To be compliant with TPC-H benchmark, [8] recommends that the Db must be implemented
using a commercially available DBMS, with support to queries and refresh functions against
all tables on a 7 days of week, 24 hours by day (7x24). The minimum required to run the
benchmark holds business data from 10.000 suppliers, with almost ten million rows repre‐
senting a raw storage capacity of about 1GB (i.e.: SF = 1).
The performance metric reported by TPC-H is called TPC-H Composite Query-per-Hour
Performance Metric (QphH), and reflects multiple aspects of the system’s capability to process
queries. TPC-H benchmark is composed by 22 ad-hoc business-oriented queries (16 of which
carried from other TPC benchmarks) that include a variety of operators and selectivity
44 Design of Experiments - Applications

(SOURCE: TPC BenchmarkTM H documentation, URL: http://www.tpc.org)

Figure 1. TPC-H database schema.

constraints, whose the objective is to assist the decisions makers in the business analysis
(pricing and promotions, supply and demand management, profit and revenue management,
customer satisfaction study, market share study and shipping management) [3; 8]. A typical
query (Table 1) uses tables “join” and, in most cases, aggregate functions and “group by”
clause. The workload of benchmark consists of a data load, the execution of queries in both
single and multi-user mode and two refresh functions.

3. Design of experiments overview

In science, the researchers' interest is focused on systems (processes) investigations where,


usually, there are several variables for analysis. Often, the investigations are centered on
individual changes produced by the variables, as well in their interactions (Figure 2).
Traditionally, in an investigation, experiments are planned to study the effects of a single
variable (factor) in a process. However, the combined study of multiple factors represents a
Influential Parameters to the Database Performance — A Study by Means of Design of Experiments (DoE) 45
http://dx.doi.org/10.5772/56546

Group Sub
Query Join Aggregate functions
by query

Avg() Count() Max() Min() Sum()

Q1 ✓ ✓ ✓ ✓

Q2 ✓ ✓ ✓

Q3 ✓ ✓ ✓

Q4 ✓ ✓ ✓ ✓

Q5 ✓ ✓ ✓

Q6 ✓

Q7 ✓ ✓ ✓ ✓

Q8 ✓ ✓ ✓ ✓

Q9 ✓ ✓ ✓ ✓

Q10 ✓ ✓ ✓

Q11 ✓ ✓ ✓ ✓

Q12 ✓ ✓ ✓

Q13 ✓ ✓ ✓ ✓

Q14 ✓ ✓

Q15 ✓ ✓ ✓ ✓ ✓

Q16 ✓ ✓ ✓ ✓

Q17 ✓ ✓ ✓ ✓

Q18 ✓ ✓ ✓ ✓

Q19 ✓ ✓

Q20 ✓ ✓ ✓

Q21 ✓ ✓ ✓ ✓

Q22 ✓ ✓ ✓ ✓ ✓ ✓

Table 1. TPC-H queries’ characteristics.

way to determine the main effects, as well as the interaction effects among the factors under‐
lying the process. The DoE is a framework of statistical techniques, such as the results can
produce valid and objective conclusions [9].
46 Design of Experiments - Applications

(SOURCE: NIST/Sematech, 2006)

Figure 2. A classical process.

DoE methodology have been used very successfully in the verification, improvement and
reducing the processes variability with impacts on costs and development time [9; 10]. A
relevant class of DoE techniques is called factorial design, whose goal is to study and analyze
the results (effects) produced by multiple variables of a process.

The beginning of a factorial design is a careful selection of a fixed number of levels for each
set of factors. The experiments should be performed with all combinations factor/level. For
example, if there are l1 levels to the first variable, l2 for the second,..., lk for the k-th factor, the
full array of l1, l2,..., lk plays will be classified as factorial design l1 x l2 x... x lk.

The default schema for designs with two levels uses the notation "–" (negative) and "+"
(positive) to denote the low and high levels of each factor, respectively [9; 10; 11]. For example,
a 2x2 factorial design with two factors (X1 and X2) and two levels (low and high), requires four
experimental plays (Table 2).
Influential Parameters to the Database Performance — A Study by Means of Design of Experiments (DoE) 47
http://dx.doi.org/10.5772/56546

Exp. X1 X2 Result

1 – – Y1

2 + – Y2

3 – + Y3

4 + + Y4

Table 2. Experimental matrix.

3.1. Full factorial design

When all combinations of factors are running at the same number of times for each level, the
experiment is classified as 2k full factorial design. Thus, the factorial design presented in Table
2 is classified as 2k (k = 2) full factorial design [9; 10]. The most intuitive approach to study such
factors would be vary the factors of interest in a full factorial design (trying all possible
combinations of settings). For example, a 23 full factorial with three factors (X1, X2, and X3) at
two levels requires eight experimental plays (Table 3), while to study 5 factors at two levels,
the number of runs would be 25 = 32, and 26 = 64, and so on. So, the number of runs required
for 2k full factorial design grows geometrically as k increases, and therefore even the number
of factors is small, a full factorial design can become big quickly. In these circumstance, it is
recommended [9; 10] to use fractional factorials designs.

Exp. X1 X2 X3 Result

1 – – – Y1
2 + – – Y2
3 – + – Y3
4 + + – Y4
5 – – + Y5
6 + – + Y6
7 – + + Y7
8 + + + Y8

Table 3. (k = 3) full factorial design.

3.2. Fractional factorial design

Fractional factorial designs represents one way where only a fraction of appropriate combi‐
nations required for 2k full factorial designs is selected for execution. Fractional designs are
commonly used when one wants to investigate k factors with smaller number (2k-p) of experi‐
ments, where p is the reduction factor [9; 10]. For example, the 23 full factorial design (Table
23
3) can be re-written as a fractional factorial design23−1
III = = 4, where 4 is the number of
2
48 Design of Experiments - Applications

experimental plays required (Table 4). In the current example, the design is described as 23-1
design of resolution III (three). This means that you study overall k = 3 factors, however, p = 1
of those factors were generated from the interactions of 2[(3-1) = 4] full factorial design.

Exp. X1 X2 X3 Result

1 – – + Y1

2 + – – Y2

3 – + – Y3

4 + + + Y4

Table 4. (k = 3, p = 1) fractional factorial design.

The design does not give full resolution, that is, there are certain interaction effects that are
confounded with (identical to) other effects. However, fractional designs requires a smaller
number of plays as compared to the full factorial design, but they assumption implicitly that
higher-order interactions do not matter. Therefore interactions greater than two-way partic‐
ularly could escape of detection.

4. Case study

To illustrate the effectiveness of DoE methodology we will apply it in the Db scope, through
a case study to know the influence of parameters in the Db performance. This case study will
be divided by phases: the first, comprehends a study with a full factorial design at two levels,
requiring 2k (k = 5), 32 experimental plays. The second phase deals with a fractional factorial
design 2k-p (k = 5 and p = 1) resolution V, requiring 16 experimental plays. All proposed experi‐
ments will be performed at the same computing environment according to the techniques
previously chosen.

Thus, this case study uses the PostgreSQL DBMS (version 8.4.11), through the implementation
of a database of 1GB, populated with dbgen application (SF = 1) from TPC-H benchmark.
Between the 22 queries provided by TPC-H benchmark, we choose to use four queries with a
common SQL feature (i.e.: tables “join”, aggregate functions and commands to grouping and
ordering data) and mostly related to the customer satisfaction study:
• Q10 – identifies customers who might be having problems with the parts that are shipped
to them;

• Q13 – seeks relationships between customers and the size of their orders;

• Q18 – ranks customers based on their having placed a large quantity order; and

• Q22 – identifies geographies where there are customers who may be likely to make a
purchase.
Influential Parameters to the Database Performance — A Study by Means of Design of Experiments (DoE) 49
http://dx.doi.org/10.5772/56546

In this study, the parameters selected (Table 5), intuitively, looks be significant to the Db
performance according to the queries characteristics.

Parameters Low (–) High (+)

A shared_buffers 32MB 1024MB

B temp_buffers 8MB 64MB

C work_mem 1MB 1536MB

D wall_buffers 64KB 1MB

E effective_cache_size 128MB 1536MB

Table 5. Design factors.

The PostgreSQL parameters (experiments factors, Table 5) were set according to the sugges‐
tions from the PostgreSQL official documentation (http://www.postgres.org), and the values
from low level, are standards of installation, while the high level values, were customized
according to the computing environment characteristics (a virtual machine implemented over
Intel CoreTM i5 360 3.20GHz CPU, GNU/Linux i386 openSUSE 11.3, 2GB RAM and hard disc
50 GB). That is, shared_buffers (amount of memory reserved for data cache) was set to 50% of
total memory; work_mem (amount of memory used for sort operations and hash tables) and
effective_cache_size (amount of memory available for disk cache used by the operating system
and Db) were set to 75% of total memory; temp_buffers (maximum number of temporary buffers
used by each Db session) and wal_buffers (useful for systems with high need to write to disk)
have 64MB and 1MB, respectively.

4.1. Phase I – 2k full factorial design

The experiments performed in this phase were structured with five factors at two levels (Table
5), resulting in a 25 full factorial (32 experimental plays). Each experiment is composed of two
replicates and a sample of the experimental matrix, whose the results are the execution time
(in seconds) – average time of queries answers 2kIII− p – is presented in Table 6. In this table (Table
6), each column contains – (negative) or + (positive) signs to indicate the setting of the respective
factor (low or high, respectively). For example, in the first run of the experiment, set all factors
A through E to the plus setting, in the second run, set factors A to D to the positive setting,
factor D to the negative setting, and so on.

In Table 7 can be found the main effects of factors ( μ = ( 1


N
N
)
∑ ti , N = 3 , where E = effect, f = factor
i=1

[A..E] and Q = query), measured from each query (Q10, Q13, Q18 and Q22). The effects of
factors were calculated by the sum of multiplying levels (– and +) by execution time (Y) across
all 32 rows. Thus, for query Q10, the effect of factors A and B were estimated as:
50 Design of Experiments - Applications

Exp. Factors Execution time

A B C D E Q10 Q13 Q18 Q22

1 – – – – – 0.132 4.122 0.109 0.840

2 – – – – + 0.126 21.710 0.109 1.067

3 – – – + – 0.137 4.198 0.113 1.029

4 – – – + + 0.118 22.052 0.112 1.069

5 – – + – – 0.185 3.033 0.117 2.553

6 – – + – + 0.160 3.148 0.119 2.052

7 – – + + – 0.223 4.097 0.115 1.776

8 – – + + + 0.169 3.121 0.139 2.857

9 – + – – – 0.133 4.257 0.116 1.336

10 – + – – + 0.120 23.552 0.118 1.170

11 – + – + – 0.132 4.131 0.108 0.830

12 – + – + + 0.134 27.506 0.113 1.124

13 – + + – – 0.185 2.992 0.121 2.473

14 – + + – + 0.163 3.056 0.112 2.223

15 – + + + – 0.206 3.152 0.127 2.662

16 – + + + + 0.136 3.373 0.120 1.841

17 + – – – – 0.336 11.871 0.185 4.062

18 + – – – + 0.273 14.873 0.147 1.421

19 + – – + – 0.360 10.997 0.247 4.760

20 + – – + + 0.265 17.241 0.166 1.451

21 + – + – – 0.279 7.402 0.151 3.458

22 + – + – + 0.293 8.605 0.182 5.824

23 + – + + – 0.305 7.537 0.159 4.149

24 + – + + + 0.320 8.408 0.154 4.020

25 + + – – – 0.281 10.905 0.177 5.236

26 + + – – + 0.287 12.144 0.164 1.380

27 + + – + – 0.313 11.118 0.195 4.722

28 + + – + + 0.256 18.553 0.169 1.382

29 + + + – – 0.272 7.460 0.157 3.746

30 + + + – + 0.302 7.957 0.154 4.772

31 + + + + – 0.316 7.488 0.165 3.327

32 + + + + + 0.307 7.718 0.157 5.582

Table 6. Experimental matrix.


Influential Parameters to the Database Performance — A Study by Means of Design of Experiments (DoE) 51
http://dx.doi.org/10.5772/56546

E fi Qj , i = 1..5; j = 1..4 Similarly, the same methodology was employed to estimate all others
effects of factors.

We use the analysis of variance (ANOVA) to know the influence of factors in the Db perform‐
ance. According to the ANOVA (Table 8) it appears that the effect of factor A is statistically
significant (p<.05) for queries Q10, Q18 and Q22, and marginally significant (p<.01) for query
Q13. It also stands out that the factors C and E are marginally significant for query Q10 and
statistically significant for query Q13. However, such factors do not seems to show influence
for query Q18. On the other hand, for query Q22 the factor C is statistically significant, while
the factor E is marginally significant.

Factors Q10 Q13 Q18 Q22

A (shared_buffers) 0.144 2.049 0.054 2.024

B (temp_buffers) 0.008 0.184 0.003 0.088

C (work_mem) 0.026 8.168 0.006 1.277

D (wall_buffers) 0.011 0.850 0.007 0.064

E (effective_cache_size) 0.023 6.141 0.008 0.483

Table 7. Effects of factors.

After estimate the effects of each factor and analyze them through the ANOVA, we used a
analysis of sensitivity of factors (Table 9), suggested by [5], whose goal is create a rank of the
factors. This methodology consists of a “sorting method, where the effects are normalized with
respect to the maximum effect, rounded to the first decimal point, and sorted in descending order” [5].

For example, the sensitivity effect

EAQ10 = | 1
N
1 4.764 2.460
∑ Y + − N ∑ Y − = 16 − 16 = 0.298 − 0.154 = 0.144 | and

EB Q10 = | 3.544 3.679


16

16
|
= 0.008 . of factors A and B for query Q10 were estimated as
(S f i Qj = E fi Qj / MAX (E f i Qj ), i = 1..5; j = 1..4) and SAQ10 = 0.144 / 0.144 = 1.0. All others sensitivity
effects were estimated in the same way (Table 8).

Once the sensitivity effect of factors was estimated, they can be rated with respect to its range
of influence (Figure 3) based on number of factors studied (i.e.: 5, Table 5). According to this
range, each factor has 0.2 units of influence and, therefore such factors with the same normal‐
ized effect can be assigned at the same rank. For example, factors with sensitivity effect 0.2
(factor E for query Q10) and 0.3 (factor A for query A13) will be at the same ranking.

The ranking of sensitivity effect of factors is presented in Table 10. These results corroborates
with the ANOVA analysis (Table 8) and reveals that, factors statistically significant (i.e.: factor
52 Design of Experiments - Applications

(a) Q10 (b) Q13

Factors SS df MS F p Factors SS df MS F p

A 0.498 1 0.498 188.789 0.000 A 100.717 1 100.717 4.550 0.036

B 0.002 1 0.002 0.653 0.421 B 0.814 1 0.814 0.037 0.848

C 0.016 1 0.016 6.100 0.015 C 1601.020 1 1601.020 72.331 0.000

D 0.003 1 0.003 1.058 0.306 D 17.343 1 17.343 0.784 0.378

E 0.013 1 0.013 4.821 0.031 E 905.090 1 905.090 40.890 0.000

Error 0.237 90 0.003 Error 1992.105 90 22.135

Total SS 0.768 95 Total SS 4617.089 95

(c) Q18 (d) Q22

Factors SS df MS F p Factors SS df MS F p

A 0.069 1 0.069 89.169 0.000 A 98.355 1 98.355 65.706 0.000

B 0.000 1 0.000 0.304 0.583 B 0.188 1 0.188 0.126 0.724

C 0.001 1 0.001 1.192 0.278 C 39.146 1 39.146 26.152 0.000

D 0.001 1 0.001 1.733 0.191 D 0.099 1 0.099 0.066 0.797

E 0.001 1 0.001 1.924 0.169 E 5.592 1 5.592 3.736 0.056

Error 0.070 90 0.001 Error 134.720 90 1.497

Total SS 0.143 95 Total SS 278.100 95

Table 8. ANOVA table.

Factors Q10 Q13 Q18 Q22

A 1.0 0.3 1.0 1.0

B 0.1 0.0 0.1 0.0

C 0.2 1.0 0.1 0.6

D 0.1 0.1 0.1 0.0

E 0.2 0.8 0.1 0.2

Table 9. Sensitivity effect of factors.

0.0 |– 0.2 |– 0.4 |– 0.6 |– 0.8 |– 1.0

Figure 3. Range of influence of factors.


Influential Parameters to the Database Performance — A Study by Means of Design of Experiments (DoE) 53
http://dx.doi.org/10.5772/56546

Factors Q10 Q13 Q18 Q22

A 1 4 1 1

B 5 5 5 5

C 4 1 5 3

D 5 5 5 5

E 4 2 5 4

Table 10. Sensitivity effect of factors.

A for queries Q10, Q18 and Q22) are the most sensitivity (close to 1.0), while those effects
marginally significant (factors C and E for query Q10) have low influence (close to 0.0). Here
also these factors do not looks have influence for query Q18.

(a) Query Q10 (b) Query Q13

(c) Query Q18 (d) Query Q22

Figure 4. Effect of factors.

Such observations can be highlighted by graphs of the changes of effects versus factors levels
(Figure 4). They confirms the hypothesis that the factor A is the most significant for queries
Q10, Q18 and Q22. Through a visual inspection, it should be noted that the factors classified
with low influence are very close to the average (i.e.: factors B, C, D and E for query Q18). The
graphs also confirms that factors C and E are significant for queries Q13 and Q22.
54 Design of Experiments - Applications

4.2. Phase II – 2k-p fractional factorial design

The second phase of this study case uses a SB Q10 = 0.008 / 0.144 = 0.1 fractional factorial (16
experimental plays). Here, it is employed the concept of design resolution, such as the study
overall k = 5 factors, however, p = 1 of those factors were generated from the interactions of a
full 2[(5-1) = 4] factorial design. As result, the design does not give full resolution, that is, there are
certain interaction effects that are confounded with other effects (i.e.: factor E, generated as
result of one-way interactions between factors A, B, D and D).

As mentioned before, the experiments are composed of two replicates performed at the same
computing environment used during the Phase I (Section 4.1). A sample of the experimental
matrix with execution time (in seconds) – average time of queries answers – is presented in
Table 11.

Exp. Factors Execution time

A B C D E Q10 Q13 Q18 Q22

1 – – – – + 0.126 21.710 0.109 1.067

2 – – – + – 0.137 4.198 0.113 1.029

3 – – + – – 0.185 3.033 0.117 2.553

4 – – + + + 0.169 3.121 0.139 2.857

5 – + – – – 0.133 4.257 0.116 1.336

6 – + – + + 0.134 27.506 0.113 1.124

7 – + + – + 0.163 3.056 0.112 2.223

8 – + + + – 0.206 3.152 0.127 2.662

9 + – – – – 0.336 11.871 0.185 4.062

10 + – – + + 0.265 17.241 0.166 1.451

11 + – + – + 0.293 8.605 0.182 5.824

12 + – + + – 0.305 7.537 0.159 4.149

13 + + – – + 0.287 12.144 0.164 1.380

14 + + – + – 0.313 11.118 0.195 4.722

15 + + + – – 0.272 7.460 0.157 3.746

16 + + + + + 0.307 7.718 0.157 5.582

Table 11. Experimental matrix.

In Table 12 are presented the effects of factors for each query (Q10, Q13, Q18 and Q22). These
effects were calculated with the same methodology used in the Phase I (Section 4.1), but here
the sum of multiplying levels (– and +) with execution time (Y) across all 16 rows.
Influential Parameters to the Database Performance — A Study by Means of Design of Experiments (DoE) 55
http://dx.doi.org/10.5772/56546

Factors Q10 Q13 Q18 Q22

A (shared_buffers) 0.140 1.708 0.052 2.008

B (temp_buffers) 0.000 0.113 0.004 0.027

C (work_mem) 0.021 8.295 0.001 1.678

D (wall_buffers) 0.005 1.182 0.003 0.173

E (effective_cache_size) 0.018 6.059 0.003 0.344

Table 12. Effects of factors.

The influence of factors were studied with ANOVA (Table 13). It’s noteworthy that factor A
is statistically significant for queries Q10, Q18 and Q22, but it does not seems influential for
query Q13. By the other hand, the factors C and E are statistically significant for query Q13.
We also note that, with the fractional factorial experiments, there are no factors marginally
significant for query Q10, so this query, as well as query Q18 have only one factor significant
(factor A), while for query Q22 the factors A and C are statistically significant.

(a) Q10 (b) Q13

Factors SS df MS F p Factors SS df MS F p

A 0.237 1 0.237 91.951 0.000 A 34.996 1 34.996 1.283 0.264

B 0.000 1 0.000 0.000 1.000 B 0.154 1 0.154 0.006 0.941

C 0.005 1 0.005 2.016 0.163 C 825.760 1 825.760 30.268 0.000

D 0.000 1 0.000 0.127 0.723 D 16.758 1 16.758 0.614 0.438

E 0.004 1 0.004 1.527 0.223 E 440.609 1 440.609 16.150 0.000

Error 0.108 42 0.003 Error 1145.839 42 27.282

Total SS 0.354 47 Total SS 2464.116 47

(c) Q18 (d) Q22

Factors SS df MS F P Factors SS df MS F p

A 0.033 1 0.033 42.577 0.000 A 48.394 1 48.394 31.541 0.000

B 0.000 1 0.000 0.195 0.661 B 0.009 1 0.009 0.006 0.939

C 0.000 1 0.000 0.035 0.853 C 33.790 1 33.790 22.022 0.000

D 0.000 1 0.000 0.170 0.682 D 0.361 1 0.361 0.235 0.630

E 0.000 1 0.000 0.183 0.671 E 1.417 1 1.417 0.924 0.342

Error 0.033 42 0.001 Error 64,.442 42 1.534

Total SS 0.066 47 Total SS 148.413 47

Table 13. ANOVA table.


56 Design of Experiments - Applications

After known the ANOVA results, we also employee the analysis of sensitivity of factors to
rank them (Table 14) according to the range of influence (Figure 3). The results reveals that
such factors classified as statistically significant by ANOVA (Table 13) (i.e.: factor A for queries
Q10, Q18 and Q22) are the most sensitivity. It stands out that A is the only factor that seems
influential for queries Q10 and Q18.

Factors Q10 Q13 Q18 Q22

A 1 4 1 1

B 5 5 5 5

C 5 1 5 2

D 5 5 5 5

E 5 3 5 4

Table 14. Sensitivity effect of factors.

Through the graphs of the changes of effects versus factors levels (Figure 5) it can be noted
that the factor A is the most significant for queries Q10, Q18 and Q22. The a visual inspection
stands out the factors classified with low influence are very close to the average (i.e.: factors
B, C, D and E for queries Q10 and Q18). The graphs also highlights that factors C and E are
significant for queries Q13 and Q22.

4.3. Analysis of results

Through the present study were made several experiments using two DoE techniques (2k full
factorial design and 2k-p fractional factorial design) to investigates how different Db parameters
can influence in its performance.

The Phase I (Section 4.1) comprehends a study with a 2k full factorial design (k = 5), whose
results highlighted the influence of the factors and rated them in concordance with its
sensitivity. According to the ANOVA (Table 8) there are factors statistically significant for one
query, but marginally significant for others. So, we employed the analysis of sensitivity (Table
10), that corroborated with the ANOVA results. Thus, according to the queries characteristics
used in this case study, the results suggests the factor A as the most significant, followed by
factors C and E rated as very significant and significant, respectively, while the others (factors
B and D) looks have low influence in the Db performance.

In the Phase II (Section 4.2) a same research was conducted, but using a 2k-p fractional factorial
design (k = 5, p = 1). With the fractional design we come to the results with half of the work
required by full design and, through them, we also know the influence of each factor (Table
14). The results were similar to those succeeded before (Section 4.1) and rated the factor A as
the most significant, followed by factors C and E as very significant and significant, respec‐
tively, while the others (factors B and D) with low influence in the Db performance.
Influential Parameters to the Database Performance — A Study by Means of Design of Experiments (DoE) 57
http://dx.doi.org/10.5772/56546

(a) Query Q10 (b) Query Q13

(c) Query Q18 (d) Query Q22

Figure 5. Effect of factors.

To perform comparison of results between both techniques, it’s noteworthy that even with
similar results, full design is more accurate. For example, it stands out such factors classified
as marginally significant by ANOVA (Table 8) from full design (i.e.: C and E for query Q10),
do not appear in fractional design. However, despite the accuracy, the full design is more
laborious and, therefore should require more resources (depending on the number of factors).
Anyway, we could state that, in this study, both techniques proved to be effective for identi‐
fication and classification of influential factors (parameters) to the Db performance.

In this study, we assume that all queries have same importance. So intuitively it seems that
factor A (shared_buffers, amount of memory reserved for data cache) is one of the most
significant to improve the Db performance, as it appears as rated first for three queries out of
five with both techniques chosen. The factor C (work_mem, amount of memory used for sort
operations and hash tables) also seems very significant, as it was rated as first and second for
two queries (Q13 and Q22, respectively), while the factor E (effective_cache_size, amount of
memory available for disk cache used by the operating system and Db) seems marginally
significant. Since their rate can vary according to the query. Another interesting observation
is that factors B and D (temp_buffers, related to the maximum number of temporary buffers
used by each Db session, and wall_buffers, useful for systems with high need to write to disk,
respectively) never seems important for the individual queries. Therefore, the results suggests
that these two parameters should have low impact to improve the Db performance. All results
are summarized in Table 15.
58 Design of Experiments - Applications

Influence Parameter

shared_buffers
High
work_mem

Medium effective_cache_size

temp_buffers
Low
wall_buffers

Table 15. Parameters influence.

5. Related work

A quick search on the contemporary literature reveals some works addressing to the use of
DoE in the several scopes. At the computer science area, the use of DoE is explored by [12]
through a comprehensive study about techniques for software engineering experimentation.
Other works [13; 14] are devoted to the algorithmic optimizations by means of DoE.

There are also a lot of works approaching the Db performance subject. For example, [15]
approaches the optimizations of Db systems through a statement of a new problem, that is the
Web-based interactive applications. [16] report a performance study with different Db
architectures and provide useful information for the enterprise architects and database
administrator in determining the appropriate Db architecture. Techniques to automate the
setting of tuning parameters in specifics software applications could be found in [17], as well
as in [18]. The importance of best practices and the database administrator knowledge for
autonomic Db tuning is pointed by [19]. In [20] is introduced a algorithm to select a small
subset of Db statistics, such that it can improve the benefits over maintaining base-table
statistics. To [21] the challenge in making Db systems truly self-tuning is a tall task, due the
different abstractions for workloads and different constraints on the desired solution (i.e.: the
complexity of internal components of the Db architecture). In [22] is discussed a way to avoid
the trial and error process of SQL tuning, through by choosing a small set of experiments in
order to reach a satisfactory plan to execute queries.

The o use of DoE techniques is formally explored in the Db scope. In the [5; 6], the data‐
base performance evaluation was studied by a statistical approached. The authors define
a statistical methodology, which may be useful to minimize the effort related with data‐
base tuning activities. Following in this line, the study presented by [7] describes a soft‐
ware application, whose purpose is to automate the database parameters configuration by
means of DoE.

In summary, in the Db performance area there are much of the effort to take the tests and
results comparison, however only a little portion of the studies uses the DoE methodology to
planning and analysis of the experiments.
Influential Parameters to the Database Performance — A Study by Means of Design of Experiments (DoE) 59
http://dx.doi.org/10.5772/56546

6. Final considerations

This chapter presented a study to investigate the influence of Db parameters in its performance.
Two DoE techniques (full factorial design and fractional factorial design) were applied in a
case study with PostgreSQL DBMS and TPC-H benchmark, to assist in the investigations of
how each parameter may influence in the Db performance.

To the case study, were selected five parameters mostly related with the Db tuning and
conducted different experiments with the DoE techniques chosen. At the Phase I, we
studied the influence of parameters through a 2k full factorial design, whose the analysis
suggests, with high degree of confidence, the parameter shared_buffer as the most signifi‐
cant, while work_mem and effective_cache_size can be classified as very significant and
significant, respectively. According to the analysis, the others parameters (temp_buffers
and wall_buffers) looks have low influence in the Db performance. The Phase II compre‐
hended a similar study, but using 2k-p fraction factorial design. The results were very simi‐
lar with those suggested in Phase I, that is the shared_buffer, work_mem and
effective_cache_size looks have influence in the Db performance, while the others not. It
stands out in Phase II, that those parameters marginally significant with full design, do
not appear in fractional design. This characteristics leading us to conclude that, although
being the most laborious, full design is more accurate. But, by the other hand, according
to the analysis of case study results, it is also feasible to reach the same conclusions with
fractional design using half of the work required by the full design.

It should be noted that Db technology was used in this study as a vehicle to demonstrate how
the DoE methodology can help in the design of experiments and its analysis and used as tool
in several scopes, like in the computing science field. We also emphasizes that this study did
not aim to close the subject about the use of DoE in the computing scope, instead it we sought
disclose the effectiveness of this methodology applied in this context. Thus, we can conclude
that DoE methodology is a promising to assist in quantitative analysis, for example in the
investigation of influential parameters in the Db performance.

Author details

Eduardo Batista de Moraes Barbosa1* and Messias Borges Silva1,2

*Address all correspondence to: [email protected]

1 São Paulo State University “Júlio de Mesquita Filho” – UNESP, School of Engineering at
Guaratinguetá – FEG, Guaratinguetá, SP, Brazil

2 University of São Paulo – USP, School of Engineering at Lorena – EEL, Estrada Municipal
do Campinho, s/n – Lorena, SP, Brazil
60 Design of Experiments - Applications

References

[1] Gray, J. (Ed.) The Benchmark Handbook for Database and Transaction Systems. 2nd.
Edition. Morgan Kaufmann, 1993.

[2] Leutenegger, S. T.; Dias, D. A Modeling Study of the TPC-C Benchmark. ACM SIG‐
MOD Record, Vol. 22, Issue 2, p. 22-31, 1993.

[3] Poess, M., Floyd, C. New TPC Benchmarks for Decision Support and Web Com‐
merce. ACM SIGMOD Vol. 29 Issue 4, p. 64-71, 2000.

[4] Hsu, W. W.; Smith, A. J.; Young. H. C. I/O Reference Behavior of Production Data‐
base Workloads and the TPC Benchmarks – An Analysis at the Logical Level. ACM
Transactions on Database Systems (TODS), Vol. 26, Issue 1, p. 96-143, 2001

[5] Debnath, B. K.; Lilja, D. J.; Mokbel, M. F. Sard: A Statistical Approach for Ranking
Database Tuning Parameters. In: IEEE 24th International Conference on Data Engi‐
neering Workshop (ICDEW), pp. 11-18, 2008.

[6] Debnath, B. K.; Mokbel, M. F.; Lilja, D. J. Exploiting the Impact of Database System
Configuration Parameters: A Design of Experiments Approach. In: IEEE Data Eng.
Bull., pp. 3-10, 2008.

[7] Duan, S.; Thummala, V.; Babu, S. Tuning Database Configuration Parameters with
iTuned. In: Proceedings of Very Large Database Endowment (PVLDB), pp. 1246-125,
2009.

[8] TPC BenchmarkTM H (Decision Support) Standard Specification Revision 2.8.0. URL:
http:// www.tpc.org (Accessed: Dec., 2012).

[9] NIST/SEMATECH. e-Handbook of Statistical Methods. 2006. URL: http://


www.itl.nist.gov/ div898/handbook. (Accessed: Dec., 2012)

[10] Montgomery, D. C. Design and Analysis of Experiments (5th Edition). John Wiley &
Sons Inc., 2001.

[11] Box, G. E. P.; Hunter, W. G.; Hunter, J. S. Statistics for Experimenters (1 Ed.). John
Wiley & Sons, 1978.

[12] Juristo, N.; Moreno, A. M. Basics of Software Engineering Experimentation. Springer,


2001.

[13] Adeson-Diaz, B.; Laguna, M. Fine-Tuning of Algorithms Using Fractional Experi‐


mental Designs and Local Search. Operations Research, Vol. 54, No. 1, p. 99-114,
2006.

[14] Arin, A.; Rabadi, G.; UNAL, R. Comparative studies on design of experiments for
tuning parameters in a genetic algorithm for a scheduling problem. Int. Journal of
Experimental Design and Process Optimisation, Vol. 2, N. 2, p. 103-124, 2011.
Influential Parameters to the Database Performance — A Study by Means of Design of Experiments (DoE) 61
http://dx.doi.org/10.5772/56546

[15] Florescu, D., Kossmann, D. Rethinking Cost and Performance of Database Systems.
ACM SIGMOD Record, Vol. 38, No. 1, p. 43–48, 2009.

[16] Chen, S., Ng, A., Greenfield. P. Concurrency and Computation: Practice and Experi‐
ence. Concurrency Computat.: Pract. Exper. doi: 10.1002/cpe.2891. 2012.

[17] Stillger, M.; Lohman, G.; Markl, V.; Kandil, M. Leo – DB2’s Learning Optimizer. In:
Proceedings of Very Large Database Endowment (PVLDB), p. 19-28, 2001.

[18] Badu, S. Towards Automatic Optimization of MapReduce Programs. In: Proceedings


of the 1st ACM symposium on Cloud computing (SoCC '10), p. 137-142, 2010.

[19] Wiese, D.; Rabinovitch, G; Reichert, M; Arenswald, S. Autonomic Tuning Expert – A


framework for best-practice oriented autonomic database tuning. In: Proceedings of
the 2008 conference of the center for advanced studies on collaborative research:
meeting of minds (CASCON '08), p. 3:27-3:41, 2008.

[20] Bruno, N., Chaudhuri, S. Exploiting Statistics on Query Expressions for Optimiza‐
tion. In: Proceedings of the 2002 ACM SIGMOD international conference on Manage‐
ment of data, p. 263-274, 2002.

[21] Chaudhuri, S., Narasaaya, V. Self-Tuning Database Systems: A Decade of Progress.


In: Proceedings of the 33rd international conference on Very large data bases, p. 3-14,
2007.

[22] Herodotou, H.; Badu, S. Automated SQL Tuning through Trial and (sometimes) Er‐
ror. In: Proceedings of the Second International Workshop on Testing Database Sys‐
tems (DBTest '09), article No. 12, 2009.
Chapter 4

Optimization of Multiple Responses in Quench


Hardening and Tempering Process in Steel Wires by
Means Design of Experiments and Desirability Method

Cristie Diego Pimenta, Messias Borges Silva, Rosinei Batista Ribeiro,


Roberto Campos Leoni, Ricardo Batista Penteado,
Fabrício Maciel Gomes and Valério Antonio Pamplona Salomon

Additional information is available at the end of the chapter

http://dx.doi.org/10.5772/56544

1. Introduction

This research aims to show factors influence study and optimization of multiple mechanical
properties responses of thermal treatment process quench hardening and tempering in steel
wires used in manufacturing automotive springs. For the data collection and process statistical
modeling, it was used the following methodologies: design of experiments and multiple linear
regression. In this case, these methods were used to assist in a statistical modeling development
which might replace the traditional way to adjust the input variables of thermal treatment
process. This process setup is currently done by means of mechanical tests of pilot samples
which is referred to laboratory analysis, after going by all stages of a thermal treatment for
quenching hardening and tempering. Results obtained in this stage, are used to regulate the
annealing furnace, implying considerable analysis and standby time, reducing, this way, the
process productivity.

2. Bibliografic review

2.1. Thermal treatment and mechanical tests

According to Mayers and Chawla (1982), in a tensile strength test, the specimen is fixed on a
testing machine head, which applies an effort that tends to elongate it up to rupture, where

© 2013 Pimenta et al.; licensee InTech. This is an open access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits
unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
64 Design of Experiments - Applications

deformations are measured by means of a device called extensometer. The test is carried out
on a specimen with standardized dimensions, so that the obtained results can be compared,
reproduced and quantified at the machine itself. Normally, the test occurs up to the material
failure (which is classified as destructive) and allows measuring the material strength and
deformation depending on the applied strain. Above a certain strain level, materials start to
deform plastically until there is a rupture, point where it is obtained the traction resistance
limit. Universal testing machine for traction is the most used and the most common force units
are kilogram-force per square millimeter (Kgf/mm2) or MegaPascal (MPa).

Yield is the attribute presented by certain materials when undergoing large plastic transfor‐
mations before their break when subjected to traction tension. In steel specimens, yield is
measured by reduction of cross-sectional area which occurs before rupture. Yield is given by
the ratio between variation of cross-sectional area of specimen (initial area - final area) and the
value of initial area of cross-section (MAYERS; Chawla, 1982). Yield or area reduction is usually
expressed as a percentage, showing how much of cross-sectional area of resistive section of
specimen was reduced after force application in tensile test.

According to Callister (2002), hardness is a metal resistance measure to penetration. The most
common methods to determine a metal hardness are Brinell, Vickers and Rockwell. In this
research, only the Brinell method (BH) is used. Brinell hardness values (BH), as shown in
Figure 1, are calculated by dividing applied load by penetration area. The diameter penetrator
(D) is a hardened steel ball for materials of medium or low hardness, or tungsten carbide for
high hardness materials. The test machine has a light microscope which makes the circle
diameter measurement (d, in mm), which corresponds to the spherical cap projection printed
on the sample. Brinell hardness (BH) is given by the applied load (P, in kgf) divided by the
print area, as shown in equation 1.

Figure 1. Brinell hardness (BH) method Illustration.

Source: Authors elaboration.


Optimization of Multiple Responses in Quench Hardening and… 65
http://dx.doi.org/10.5772/56544

2P é kgf mm 2 ù
BH =
æ ö ëê úû (1)
p D ç D - D2 - d2 ÷
è ø

2.2. Statistical methods used

According to Lima et al. (2011), Silva and Silva (2008) and Granato et al. (2011), the design of
experiments (DOE) is very adequate to study several process factors and their interactions
complexity in order to solve problems by means of statistical analysis. According to Mont‐
gomery (2010) and Benyounis and Olabi (2008), blocking is a technique used to improve
comparison accuracy among interest factors and can be used in conjunction with the multiple
linear regression technique for process statistical modeling. Blocking can be employed in
factorial planning when it is necessary to control variability coming from disturbing sources
known, which may influence the results.

Montgomery and Runger (2003) state that multiple linear regression is used for situations
involving more than one regressor, and the models can include interaction effects. An
interaction between two variables can be represented by a cross term, for if we assume that x3
= x1x2 and β3= β12, then the model, including interaction terms, will be as shown in equation 2.

Y = b 0 + b1x1 + b 2 x2 + b 3 x3 + ... + e (2)

In this expression, Y is the dependent variable; the independent variables are represented by
x1, x2, ..., xn and ε is the random error term. The term "linear" is used because the equation is
a linear function of the unknown parameters β0, β1, β2 and βn. In this model, the parameter β0
is the plane intersection; β1, β2 and βn are the regression partial coefficients.

The desirability method is a method used for determining the best conditions for process
adjustment, making possible simultaneous optimization of multiple responses. This being so,
the best responses conditions are obtained simultaneously minimizing, maximizing or seeking
nominal values of specifications, depending on the most convenient situation for the process
(WANG, WAN, 2009).

Each one of responses (Y1, Y2...Yk) of original set is transformed, such that di belongs to interval
0 ≤ di≤ 1. The di value increases when the ith response approaches the imposed limits. Equation
3 is used to find the D global index, from combination of each one responses processed through
a geometric mean.

1
D = ( d1 (Y1 ) ´ d2 (Y2 )... ´ dk (Yk ) ) k (3)

As a result of geometric mean represented by equation 3, the value D evaluates, in a general


way, the levels of the combined set of responses. It is an index also belonging to interval [0, 1]
66 Design of Experiments - Applications

and will be maximized when all responses approach as much as possible of its specifications.
The closer of one D is, the closer the original responses will be of their respective specification
limits. The general optimal point of system is the optimal point achieved by maximizing the
geometric mean, calculated from individual desirability functions (Paiva, 2008). According to
Paiva (2008), advantage of using geometric mean is to make the overall solution is achieved
in a balanced way, allowing all responses can achieve the expected values and forcing
algorithm to approach the imposed specifications.
According to Derringer and Suich (1980), the algorithm will depend on the optimization type
desired for response (maximization, minimization or normalization) of desired limits within
the specification and the amounts (weights) of each one response, which identifies the main
characteristics of different optimization types, as follows:

• Minimize Function: The desirability function value increases as the original response value
approaches a minimum target value;
• Normalize Function: When response moves toward the target, the desirability function
value increases;
• Maximize Function: The desirability function value increases when the response value
increases.

Paiva (2008) and WU (2005) state that when a response maximization is wished, the transfor‐
mation formula is shown in equation 4:

ì Ù
ï 0 Yi < LSL
ï R
ïé Ù ù
ïê Yi - Li ú Ù
di = í ê ú Li £ Yi £ Ti (4)
ï ê Ti - Li ú
ï ë û
ï Ù
ï 1 Yi > Ti
î

Where: Li, Ti and Hi are, respectively, the values of major, minor and acceptable target for the
ith response.
The R value, in Equation 4, indicates a preponderance of the superior limit (LSL). Values higher
than unity should be used when the response (Yi) increases rapidly above Li. Therefore, di
increases slowly, while the response value is being maximized. Consequently, to maximize D,
the ith response must be much larger than Li. One can choose R <1, when it is critical to find
values for the response below the fixed limits.
In cases where the objective is to reach a target value, the transformation formulation stops
being unilateral and becomes bilateral. The bilateral formulation, represented by equation 5,
occurs when the interest response has two restrictions: one maximum and the other one
minimum.
Optimization of Multiple Responses in Quench Hardening and… 67
http://dx.doi.org/10.5772/56544

ì
ï
ï Ù Ù
ï 0 Yi < Li ouYi > H i
ï
ïé R
Ù ù
ïïê H i - Yi ú Ù
di = í ê ú Ti £ Yi £ H i (5)
ï ê Hi - Ti ú
ïë û
ïé Ù R
ï ê Y - Li ùú Ù
ïê i ú Li £ Yi £ Ti
ï ê Ti - Li ú
îï ë û

3. Materials and methods

3.1. Material, factors selection and experimental organization

The material used was SAE 9254 steel wire, with diameter gauges 2.00 mm and 6.50 mm.
Factors investigated in this research are:
• Speed of wire passage inside the furnace (in m/s);

• Polymer concentration, quenching medium (in %);

• Lead temperature in tempering (in °C).


The steel wire diameter was also considered as an important factor, for there was assumption
that its mass could influence results of investigated mechanical properties. Nevertheless, in
this research, it was used the blocks analysis methodology, that is, for block 1, it was allocated
experiments related only to diameter 2.00 mm, and for block 2, experiments related to 6.50 mm
diameter as shown in Table 1.

Experiments Speed Lead Temperature % Polymer

1 - - -
2 + - -
3 - + -
4 + + -
5 - - +
6 + - +
7 - + +
8 + + +

Table 1. Factorial Matrix 23


68 Design of Experiments - Applications

Factors such as speed, lead temperature and polymer concentration were tested by means of
the factorial planning, using the matrix 23.

For experiments planning accomplishment, reduced variables (β) were used rather than
physical variables (real adjustments) of investigated factors, in order to preserve the confi‐
dential data of the company which funds the research. Variables reduction was calculated
according to Montgomery and Runger (2003), using the physical value (α) that one wants to
test subtracted from the mean (μ) between the minimum and maximum of factors adjustments.
The result was divided by half the amplitude (R) between the minimum and maximum values
of factors adjustment. Thus, the reduced variables dimensionality was restricted to the range
[-1 to 1], according to equation 6 and Table 2.

a -m
b=
R (6)
2

Values Values
Input variables
(physical units) (reduced variables)

Speed (m/s) Minimum / Maximum -1 / 1

Lead temperature (ºC) Minimum / Maximum -1 / 1

Polymer concentration (%) Minimum / Maximum -1 / 1

Table 2. Transformation of physical variables to reduced variables

4. Results and discussion

4.1. Sequence of experiments and statistical analysis

In the experiments, all replicas related to block 1 were initially carried out, and then the ones
corresponding to block 2. Six replicas were used for each experimental condition. Replications
were randomized and sequenced using a notation from 1 to 8, corresponding to each experi‐
ment order for each block individually. This experimental sequence is displayed in parentheses
and in subscript format next to values obtained from mechanical properties as displayed in
Tables 3, 4 and 5.

Experiments Replica 1 Replica 2 Replica 3 Replica 4 Replica 5 Replica 6

1/Block 1 2149 (1) 2148 (1) 2146 (2) 2161 (8) 2167 (1) 2160 (6)

2/Block 1 2157 (4) 2155 (7) 2157 (3) 2151 (7) 2157 (4) 2157 (2)

3/Block 1 1924 (3) 1922 (3) 1920 (1) 1921 (5) 1920 (6) 1918 (4)
Optimization of Multiple Responses in Quench Hardening and… 69
http://dx.doi.org/10.5772/56544

Experiments Replica 1 Replica 2 Replica 3 Replica 4 Replica 5 Replica 6

4/Block 1 1924 (2) 1924 (8) 1922 (8) 1943 (6) 1945 (8) 1945 (5)

5/Block 1 2108 (6) 2106 (5) 2108 (7) 2104 (2) 2102 (7) 2109 (8)

6/Block 1 2136 (5) 2127 (4) 2127 (4) 2136 (3) 2134 (3) 2127 (3)

7/Block 1 1927 (7) 1926 (2) 1944 (5) 1935 (4) 1946 (2) 1947 (7)

8/Block 1 1946 (8) 1946 (6) 1946 (6) 1953 (1) 1951 (5) 1946 (1)

1/Block 2 1968 (1) 1974 (1) 1962 (3) 1971 (4) 1971 (8) 1974 (5)

2/Block 2 1980 (7) 1976 (4) 1988 (6) 1978 (2) 1980 (3) 1988 (2)

3/Block 2 1771 (3) 1764 (3) 1763 (7) 1773 (5) 1771 (5) 1764 (4)

4/Block 2 1796 (8) 1784 (2) 1797 (8) 1781 (3) 1796 (2) 1784 (3)

5/Block 2 1949 (5) 1963 (6) 1947 (1) 1951 (1) 1949 (4) 1947 (6)

6/Block 2 1992 (4) 1980 (5) 1976 (4) 1994 (8) 1980 (7) 1992 (7)

7/Block 2 1760 (2) 1768 (7) 1766 (5) 1763 (7) 1766 (6) 1763 (8)

8/Block 2 1787 (6) 1793 (8) 1785 (2) 1784 (6) 1784 (1) 1785 (1)

Table 3. Tensile strength results (MPa)

Experiments Replica 1 Replica 2 Replica 3 Replica 4 Replica 5 Replica 6

1/Block 1 50 (1) 51 (1) 51 (2) 50 (8) 50 (1) 50 (6)

2/Block 1 50 (4) 50 (7) 50 (3) 50 (7) 50 (4) 50 (2)

3/Block 1 58 (3) 58 (3) 58 (1) 58 (5) 58 (6) 58 (4)

4/Block 1 58 (2) 58 (8) 58 (8) 56 (6) 56 (8) 56 (5)

5/Block 1 53 (6) 53 (5) 53 (7) 53 (2) 53 (7) 53 (8)

6/Block 1 51 (5) 52 (4) 52 (4) 51 (3) 51 (3) 52 (3)

7/Block 1 58 (7) 58 (2) 56 (5) 58 (4) 56 (2) 56 (7)

8/Block 1 56 (8) 56 (6) 56 (6) 55 (1) 56 (5) 56 (1)

1/Block 2 42 (1) 41 (1) 42 (3) 42 (4) 42 (8) 41 (5)

2/Block 2 41 (7) 41 (4) 40 (6) 41 (2) 41 (3) 40 (2)

3/Block 2 47 (3) 46 (3) 46 (7) 47 (5) 47 (5) 46 (4)

4/Block 2 44 (8) 45 (2) 44 (8) 45 (3) 44 (2) 45 (3)

5/Block 2 56 (5) 42 (6) 56 (1) 56 (1) 56 (4) 56 (6)

6/Block 2 40 (4) 41 (5) 41 (4) 40 (8) 41 (7) 40 (7)

7/Block 2 46 (2) 47 (7) 47 (5) 46 (7) 47 (6) 46 (8)

8/Block 2 44 (6) 44 (8) 45 (2) 45 (6) 45 (1) 45 (1)

Table 4. Yield point results in percentage (%)


70 Design of Experiments - Applications

Experiments Replica 1 Replica 2 Replica 3 Replica 4 Replica 5 Replica 6

1/Block 1 608 (1) 606 (1) 606 (2) 611 (8) 611 (1) 611 (6)

2/Block 1 608 (4) 608 (7) 608 (3) 608 (7) 608 (4) 608 (2)

3/Block 1 544 (3) 542 (3) 542 (1) 542 (5) 542 (6) 542 (4)

4/Block 1 544 (2) 544 (8) 542 (8) 550 (6) 550 (8) 550 (5)

5/Block 1 594 (6) 594 (5) 594 (7) 594 (2) 594 (7) 594 (8)

6/Block 1 603 (5) 600 (4) 600 (4) 603 (3) 603 (3) 600 (3)

7/Block 1 544 (7) 544 (2) 550 (5) 547 (4) 550 (2) 550 (7)

8/Block 1 550 (8) 550 (6) 550 (6) 553 (1) 550 (5) 550 (1)

1/Block 2 556 (1) 558 (1) 556 (3) 556 (4) 556 (8) 558 (5)

2/Block 2 558 (7) 558 (4) 561 (6) 558 (2) 558 (3) 561 (2)

3/Block 2 500 (3) 497 (3) 497 (7) 500 (5) 500 (5) 497 (4)

4/Block 2 508 (8) 503 (2) 508 (8) 503 (3) 508 (2) 503 (3)

5/Block 2 550 (5) 556 (6) 550 (1) 550 (1) 550 (4) 550 (6)

6/Block 2 564 (4) 558 (5) 558 (4) 564 (8) 558 (7) 564 (7)

7/Block 2 497 (2) 500 (7) 500 (5) 497 (7) 500 (6) 497 (8)

8/Block 2 506 (6) 506 (8) 503 (2) 503 (6) 503 (1) 503 (1)

Table 5. Hardness results (Brinell Hardness)

Factors significance was tested at a 95% confidence level (p <0.05). This analysis was carried
out separately so that factors significance for each response of studied mechanical properties
could be verified, as shown in Tables 6, 7 and 8.

Terms Effect Coefficient T p

Constant 1955.29 1782.89 0.000

(D) 165.62 82.81 80.09 0.000

(A) 17.42 8.71 7.94 0.000

(B) -198.54 -99.27 -90.52 0.000

(C) -8.04 -4.02 -3.67 0.000

(A)(B) -0.54 -0.27 -0.25 0.805

(A)(C) 5.62 2.81 2.56 0.012

(B)(C) 14.08 7.04 6.42 0.000

(A)(B)(C) -6.25 -3.13 -2.85 0.005

Table 6. Significance test for resistance limit, by means of the Minitab Statistical Software (in MPa)
Optimization of Multiple Responses in Quench Hardening and… 71
http://dx.doi.org/10.5772/56544

By means of the significance test performed for the mechanical property called tensile strength
(shown in Table 6), it was found that the significant factors (where p <0.05) are: wire diameter
(represented by letter D and tested by means of Blocks), speed (represented by letter A), lead
temperature (represented by letter B), polymer concentration (represented by letter C), second
order interactions among speed and polymer concentration, polymer concentration and
temperature and a third-order interaction among speed, lead temperature and polymer
concentration.

Terms Effect Coefficient T p

Constant 49.458 201.94 0.000

(D) 9.426 4.713 201.94 0.000

(A) -2.750 -1.375 -5.61 0.000

(B) 3.583 1.792 7.32 0.000

(C) 1.750 0.875 3.57 0.001

(A)(B) 1.250 0.625 2.55 0.012

(A)(C) -1.667 -0.833 -3.40 0.001

(B)(C) -2.250 -1.125 -4.59 0.000

(A)(B)(C) 1.667 0.833 3.40 0.001

Table 7. Significance test for yield, by means of the Minitab Statistical Software (in percentage)

When analyzing the significance test for the mechanical property Yield (shown in Table 7), it
is possible to note that the influential factors (where p <0.05) are: wire diameter (tested by
blocks), speed, lead temperature, polymer concentration, second order interactions among
speed and lead temperature, speed and polymer concentration, temperature and polymer
concentration and a third-order interaction among speed, lead temperature and polymer
concentration.

Terms Effect Coefficient T p

Constant 552.09 1650.05 0.000

(D) 46.86 23.43 74.26 0.000

(A) 4.85 2.43 7.25 0.000

(B) -55.81 -27.91 -83.40 0.000

(C) -2.19 -1.09 -3.27 0.001

(A)(B) 0.10 0.05 0.16 0.877

(A)(C) 1.65 0.82 2.46 0.016

(B)(C) 4.06 2.03 6.07 0.000

(A)(B)(C) -2.35 -1.18 -3.52 0.001

Table 8. Significance test for hardness, by means of the Minitab Statistical Software (in BH)
72 Design of Experiments - Applications

Analyzing the significance test for hardness mechanical property (displayed in Table 8), it is
possible to state that the influential factors (in which p <0.05) are: wire diameter (tested by
means of blocks), speed, lead temperature, polymer concentration, second order interactions
among speed and polymer concentration, temperature and polymer concentration and a third-
order interaction between lead temperature and polymer concentration.

4.2. Statistical modeling for multiple responses


Using coefficients calculated using the significance test, by means of the Minitab Statistical
Software, it was possible to build statistical models which represent the relationship between
process input variables (factors) and output variables (mechanical properties). Such statistical
models are defined in equations 7, 8 and 9.

RL =1955.29 + 82.81( D ) + 8.71( A ) – 99.27 ( B ) – 4.02 ( C ) + 2.81( A )( C ) + 7.04 ( B )( C ) –3.13 ( A )( B )( C ) (7)

Y =49.458 + 4.713 ( D ) – 1.375 ( A ) + 1.792 ( B ) + 0.875 ( C ) + 0.625 ( A )( B ) – 0.833 ( A )( C ) –1.125 ( B )( C ) + 0.833 ( A )( B )( C ) (8)

H =552.09 + 23.43 ( D ) + 2.43 ( A ) – 27.91( B ) – 1.09 ( C ) + 0.82 ( A )( C ) + 2.03 ( B )( C ) –1.18 ( A )( B )( C ) (9)

Where:
• RL: corresponds to the response variable called tensile strength;
• Y: corresponds to the variable called yield response;
• H: corresponds to the response variable called Hardness.

4.3. Application of desirability function for optimization


For process optimization by means of desirability function, firstly, it was necessary to formu‐
late the specifications required for the studied mechanical properties. To this, blocks were
analyzed separately, that is, the response variables were optimized primarily for the wire
diameter 2.00 mm and then the same procedure was carried out to diameter 6.5 mm.
Specifications (minimum, nominal and maximum) concerning the diameter the 2.00 mm
diameter are presented in Table 9. In that case, one seeks nominal values (target) for mechanical
properties such as traction resistance limit and hardness and, for the mechanical property
called yield, one seeks to maximization, for the higher the value, the better the product itself.

The composite desirability (D) is the overall index calculated from combination of each
response variables processed through a geometric mean and this index is responsible for
showing the best condition to optimize all responses variables at the same time. To obtain the
highest possible value for D, which reflects in the best condition of response variables in
relation to their specifications care (displayed in Figure 2), the best adjustments using factors
reduced variables [-1 to 1] are:
Optimization of Multiple Responses in Quench Hardening and… 73
http://dx.doi.org/10.5772/56544

Yield Hardness
Tensile strength (MPa)
(%) (BH)

Nominal Maximum Nominal


Minimum Maximum Minimum Nominal Minimum Maximum
(target) (target) (target)

1930 2040 2150 40 45 ≥ 50 545 572 600

Table 9. Specifications for 2.00 mm gauge

• Speed, fit in -1.0;

• Lead temperature fit in -0.0909;

• Polymer concentration fit in 1.0.

Figure 2. Desirability function applied in multiple responses (Minitab Statistical Software-2.00 mm diameter)

Looking at Figure 2, it can be seen that D value belonging to [0-1] interval, is maximized when
all responses are close to their specifications, for the closer D is of 1, the closer the original
responses will be of their respective specification limits. The optimal general point of the
system is the optimum point achieved by geometric mean maximization calculated from
individual desirability functions (d), which in this case are values for each one of response
variables given below:
74 Design of Experiments - Applications

• For response variable called tensile strength, d=0.90455;

• For response variable called yield, d=1.0;

• For response variable called hardness, d=0.96916.


Values obtained for desirability (D) and individual desirability (d), show that the process was
well optimized, since these indices are found to be very close to the optimum condition (1.0).
Thus, it was possible to find that values obtained for this optimized condition are in accordance
with required specifications and are:
• For tensile strength (y= 2029.5 MPa);

• For yield (y= 54.8182 %);

• For hardness (y= 572.8636 BH).


By analyzing Figure 2, it was found that speed factor, when increased, also causes increased
amounts of response variables tensile strength (MPa) and hardness (BH). Also, the increased
speed affects yield response variable reduction (%) and desirability (D) composite reduction.

Regarding the lead temperature factor, with increasing temperature, one realizes values
reduction of response variables tensile strength (MPa), Hardness (BH) and desirability
composite (D). On the other hand, yield value increases (%).

By observing increase in polymer concentration factor, one can see that there will be decrease
in response variables values called tensile strength (MPa) and hardness (BH), yield increase
(%) and desirability composite (D).

In Table 10, it is shown specifications (minimum, nominal and maximum) relative to 6.50 mm
diameter. Also one searches nominal values (target) for mechanical properties called tensile
strength and hardness, and for mechanical property called yield, one seeks maximization.

Yield Hardness
Traction resistance limit (MPa)
(%) (BH)

Nominal Maximum Nominal


Minimum Maximum Minimum Nominal Minimum Maximum
(target) (target) (target)

1770 1875 1980 40 48 ≥ 56 500 530 560

Table 10. Specifications for 6.50 mm gauge

As shown in Figure 3, for obtaining the highest possible value for desirability composite (D),
the best factors adjustments are:
• Speed, fit at -1.0;

• Lead temperature, fit at -0.1919;

• Polymer concentration, fit at 1.0.


Optimization of Multiple Responses in Quench Hardening and… 75
http://dx.doi.org/10.5772/56544

Figure 3. Desirability function applied in multiple responses (Minitab Statistical Software- 6.50 mm diameter)

By Figure 3 analysis, it is possible to realize that:

• For response variable called tensile strength, d=0.99448;

• For response variable called yield, d=1.0;

• For response variable called Hardness, d=0.99293.

It is also possible to observe that values obtained for this optimized condition comply with
required specifications, which are:

• For tensile strength, (y= 1875.5791 MPa);

• For yield, (y= 50.7710 %);

• For hardness, (y= 529.7879 BH);

Regarding the speed factor, by increasing the speed one obtains values increase of response
variable called tensile strength (MPa) and hardness (BH). Also, with increasing speed factor,
it is observed a response variable reduction called yield (%) and desirability composite
reduction (D).
76 Design of Experiments - Applications

Regarding the lead temperature factor, the increase means that there is all response variables
decrease, including the desirability composite (D). By observing the polymer concentration
factor, it is found that the increase will cause decrease of response variables tensile strength
and hardness, increasing yield and desirability composite (D).

The red line (vertical) contained in Figure 3, can be interpreted as follows: in case it is moved,
it will change the response values, and this will directly affect the composite desirability (D)
values and individual desirability (d). For instance, by moving the red line, contained in the
space relative to the lead temperature factor to the right, it will provide drop in the desirability
composite (D), and all response variables (shown in Figure 3). It is possible to realize the drop
in desirability composite (D) by observing the slope of straight contained in the location
indicated previously. This decrease in D would represent optimization reduction of multiple
responses and consequently no use of responses at their best factors adjustment conditions.

5. Conclusions

The design of experiments methodology with analysis in blocks applied to quench hardening
and tempering process in SAE 9254 drawn steel wires with 2.00 mm and 6.50 mm diameters
provided a wide understanding of factors influence in mechanical properties called tensile
strength, hardness and yield.

By means of significance test (through of the Minitab Statistical Software), it was possible to
find that factors such as diameter, speed, tempering temperature and polymer concentration
have a significant influence on the studied mechanical properties and by statistical methods
application it was possible to model the process, obtaining the best factors adjustment
condition, which in turn, provided simultaneously multiple responses optimization.

Through the findings generated by this study, one seeks to fit in a planned way the quench
hardening furnace set-up in a productive environment, obtaining, this way, reduction of initial
laboratory tests amount and waiting time of these results, whose cost impacts directly the
company financial indicators.

Author details

Cristie Diego Pimenta1, Messias Borges Silva1, Rosinei Batista Ribeiro2, Roberto Campos Leoni1,
Ricardo Batista Penteado1, Fabrício Maciel Gomes1 and Valério Antonio Pamplona Salomon1

*Address all correspondence to: [email protected]

1 FEG UNESP – SP / Brasil, Guaratinguetá-SP, Brasil

2 FATEA – SP / Brasil, Lorena – SP, Brasil


Optimization of Multiple Responses in Quench Hardening and… 77
http://dx.doi.org/10.5772/56544

References

[1] Benyounis, K. Y, & Olabi, A. G. Optimization of different welding processes using


statistical and numerical approaches- A reference guide, Science Direct, (2008). , 39,
483-496.
[2] Callister, J. R. W. D. Uma introdução a engenharia e a ciências dos materiais, 5ª edição,
editora LTC, (2002). , 589.

[3] Derringer, G, & Suich, R. Simultaneous Optimization of Several Response Variables,


Journal of Quality Technology, n 4, (1980). , 12, 214-219.

[4] Granato, D, Branco, G. F, & Calado, V. M. A. Experimental design and application of


response surface methodology for process modeling and optimization: A review,
Food Research International, (2011). , 1, 0-14.

[5] Lima, V. B. S, Balestrassi, P. P, & Paiva, A. P. Otimização do desempenho de amplifi‐


cadores de radio frequência banda larga: uma abordagem experimental, Produção, n.
1, jan/mar, (2011). , 21, 118-131.

[6] Mayers, A. M, & Chawla, K. K. Princípios de metalurgia mecânica, 2ª edição, Edgard


Blucher, (1982). p.

[7] Montgomery, C. D. Design and analysis of experiments, 7 edition, John Wiley & Sons,
th

(2010). p.

[8] Montgomery, D. C, & Runger, G. C. Estatística aplicada e probabilidade para engenheiros,


2ª edição, editora LTC, (2003). p., 2003, 230-320.

[9] Paiva, E. J. Otimização de Manufatura com Múltiplas Respostas baseadas em índices de ca‐
pacidade, Dissertação, Universidade Federal de Itajubá, (2008). p.

[10] Silva, H. A, & Silva, M. B. Aplicação de um projeto de Experiments (DOE) na solda‐


gem de tubos de zircaloy-4; Produção & Engenharia, n. 1, set./dez. (2008). , 1, 41-52.

[11] Wang, J, & Wan, W. Application of desirability function based on neural network for
optimizing biohydrogen production process, international journal o f hydrogen energy,
(2009). , 34, 1253-1259.

[12] Wu, F. C. optimization of correlated multiple quality characteristics using desirabili‐


ty function. Quality engineering, n 1, (2005). , 17, 119-126.
Chapter 5

Taguchi Method Applied to Environmental Engineering

Ana Paula Barbosa Rodrigues de Freitas, Leandro Valim de Freitas,


Carla Cristina Almeida Loures, Marco Aurélio Reis dos Santos,
Geisylene Diniz Ricardo, Fernando Augusto Silva Marins,
Hilton Túlio Lima dos Santos, Gisella Lamas Samanamud,
Mateus Souza Amaral and Messias Borges Silva

Additional information is available at the end of the chapter

http://dx.doi.org/10.5772/56531

1. Introduction

Over the last decades, environmental concerns have become more critical and frequent. This
is, mainly, due to population growth and the increase of industrial activities in which anthro‐
pogenic actions have reached catastrophic proportions resulting in changes of soil, air, and
water quality [1].

Environmental pollution by industrial effluent is being characterized as one of the major causes
of the aggravation of this problem. Residues, in general, produce diversified compounds,
containing, frequently, pollutants that are toxic and resistant to conventional treatments such
as coagulation/flocculation or biodegradation [2], and they are eventually discharged, in most
of the cases, in an inadequate way causing severe damages. Regarding the environmental
problem, researchers were driven to study the feasibility of new techniques and methodolo‐
gies, as well as, the emission and pollutant discharge control. In order to apply the pollution
control and to attend environmental legislation, patterns and quality indicators were estab‐
lished. In terms of water quality: oxygen concentration, phenols, Hg, pH, temperature, among
other requirements [3].

Companies search for new environmental alternatives to treat generated residuals. The
environmental reality is demanding for further actions to mitigate industrial impacts on water.
Therefore, water treatment has become a mandatory investment to industries, institutions, and
others with the aim to attending environmental laws, as well as ISO 14000 series.

© 2013 de Freitas et al.; licensee InTech. This is an open access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits
unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
80 Design of Experiments - Applications

In this context, textile sector can be referred because of its great industrial area that gener‐
ates a high volume of effluent deeply colored and containing high concentration of organ‐
ic compounds, which if not treated, may cause serious damage to environmental
contamination [4].
Hazardous waste treatment and the presence of organic pollutants in water have increased
the use of alternatives to environmental matrixes such as the use of Advanced Oxidation
Processes (AOPs) to residual water treatment [5].
This work features the application of Design of Experiments; Taguchi L9 Orthogonal Array; in
the effluent treatment of polyester resin that is originated from textile industries and through
the application of Advanced Oxidation Processes (Heterogeneous Photocatalysis - UV/TiO2)
in the study of chemical oxygen demand.

2. Advanced oxidation processes

Advanced Oxidation Processes (AOP’s) and electrochemical methodologies are developed to


treat the contaminants of drinking water and industrial effluents. The oxidation processes are
based on reactive species generation that degrades a great variety of organic pollutants, in a
quick and non-selective way. Reactive species are unstable and must be generated continu‐
ously "in situ", through chemical or photochemical reactions [6].
AOPs are defined as processes with great capacity of producing hydroxyl radicals (•OH), that
are reactive species. The high standard potential of radical’s reduction is demonstrated by
Equation 1. This radical is capable of oxidizing a great variety of organic compounds to CO2,
H2O and inorganic ions originated from heteroatoms [7-8].

•OH + e - + H+ ® H 2O Eo = 2,730 V (1)

Its destructive process is one of its great advantages. Contaminants are chemically destroyed
instead of undergoing a phase change that happens, for instance, in physical-chemical
processes of adsorption, filtration, precipitation, coagulation, flocculation, sedimentation,
flotation, membrane use, organic and inorganic adsorption, centrifugation, reverse osmosis,
extraction, distillation and evaporation [9]. The final disposition of solid phases continues
being a problem without any solution; therefore, a passive agent [10]. This reagent is very few
selective, electrophilic character, easy to produce and detains kinetic reaction control [11].
The hydroxyl radicals can be obtained from strong oxidants, as H2O2 and O3 combined or not
with UV radiation, with salts of Iron II or III, combined or not, with radiation, photocatalysis
with TiO2 or water photolosys with UV radiation [12].
The organic matter (OM) present in the system is attacked by hydroxyl radical at the moment
that it is generated, and as a consequence of this process, the effluent is degraded to other
intermediate products described in Equation 2[13].
Taguchi Method Applied to Environmental Engineering 81
http://dx.doi.org/10.5772/56531

•OH + OM ® Intermediates (2)

The several AOPs are split into two groups: Homogenous Processes and Heterogeneous
Processes. The former occur in one single phase and use ozone, H2O2 or Fenton reagent
(mixture of H2O2 with salts of Fe2+) as hydroxyl radical generators. The latter uses semicon‐
ductors as catalysts (titanium dioxide, zinc oxide, etc.)[14].

3. Heterogeneous photocatalysis

Practical studies using TiO2 have been developed; however, the reaction mechanism is not
totally understandable, yet. Nevertheless, most of researchers agree on some mechanisms
steps such as: the excitation of semiconductors species and the formation of h+BV and e-BC,
the recombination process among them, O2, H2O adsorption and organic species on the
semiconductor surface, “trapping” where chemical species donate or accept a pair of electrons
e-/h+ preventing the recombination. It is believed that O2 is the main responsible specie to give
continuity to the reactions started during the photo-oxidation process, reacting as a formed
organic radical and promoting a complete mineralization [15-16]. Figure 1 shows the excitation
scheme of the semiconductors.

Figure 1. Schematic illustration of electricity generation and hydrogen production by solar energy conversion using
semiconducting materials. CB: Conduction band, VB: Valence band Source: [17].

Direct oxidation process occurs when a photogerated gap in the valence band of semiconductor
reacts directly with the organic compound (Equation 3) [18].

R 1 ( ads ) + h+BV ® R 1 ( ads ) (3)

Indirect oxidation process occurs when a photogerated gap in the valence band of semicon‐
ductor reacts with H2O molecule adsorbed on the semiconductor surface producing hydroxyl
radical that will oxide the organic material (Equation 4) [18-19].
82 Design of Experiments - Applications

•OH + R 1 ® R 2 (4)

Photocatalytic process has been efficiently used to degrade innumerable recalcitrant substan‐
ces prior to the biological treatment.

4. Benefits of advanced oxidation processes

Advanced Oxidation Processes offer several advantages when compared to conventional


oxidation processes [20-21].

• Assimilate a large variety of organic compounds;


• Complete mineralization of pollutants;
• Destroy resistant refractory compounds to other treatments, as for example, biological
treatment;
• May be used in other processes as a pre or post-treatment;
• Used in effluents with high toxicity that can entail a certain difficulty in the biological process
treatment;
• Enable in situ treatment;
• Do not create reaction by-products;
• Improve the organoleptic properties of the treated water;
• Contain oxidizing power with elevated kinetic reaction.

5. Chemical Oxygen Demand (COD)

Chemical Oxygen Demand (COD) measures the amount of oxygen consumed through the
organic material in water and, also represents an essential parameter in the characterization
study of sanitary wastewater and industrial effluents. COD is crucial when used along with
BOD to analyze and evaluate wastewater biodegradability [22].
By determining COD, the oxidation-reduction reaction is performed in a closed system using
potassium dichromate due to its high oxidative capacity and to its application in a large variety
of samples and operational feasibility [23].
Sample results of COD using potassium dichromate as an oxidation agent are superior to BOD,
because the high oxidative power of the potassium dichromate is greater if compared to the
action of micro-organisms, except in rarely cases, as aromatic hydrocarbonetes and pyridine.
BOD measures only the biodegradable fraction. The more this value approximates to COD
more easily biodegradable the effluent is [22, 24-25].
Taguchi Method Applied to Environmental Engineering 83
http://dx.doi.org/10.5772/56531

6. Design of Experiments (DOE)

Design of Experiments has been widely used to optimize processes parameters and to improve
the quality of products with the application of engineering concepts and statistics [26].
Design of Experiments is defined as a set of applied statistical planning techniques, conducting,
analyzing and interpreting controlled tests with the aim to find and define factors that may
influence values of a parameter or of a group of parameters [27].
DOE considers interaction among variables and may be used to optimize operational param‐
eters in multivariable systems [28].
According to [29], design of experiments was studied as a relevant mathematical tool in the
area of Advanced Oxidation Processes. Taguchi’s Orthogonal Array L9 was used in this work
for the degradation of organic material of the polyester resin effluent and the percentage
reduction of the total organic carbon obtained in the treatment was 39.489%. This removal of
organic load corresponds to an average ratio of TOC removal. This condition is inclusive of
the weight ratio of hydrogen peroxide at 183g, pH = 3, TiO2 = 0.250 g/L and lamp intensity =
21 W.
Design of experiments was used by [30] in the degradation of organic material of the polyester
resin effluent by advanced oxidation processes. Taguchi’s Orthogonal Array L16 was used to
select statistically the most significant factors in the process; being optimized, lately. It was
concluded that more influent variables permitted a reduction of 34% COD of the polyester
resin effluent.

7. Taguchi method

According to [31], Taguchi’s method is a powerful mathematical tool capable to find significant
parameters of an ideal process through multiple qualitative aspects.
The application of Taguchi’s method [32] consists of:

• Selecting the variable response to be optimized;


• Identifying factors (entry variables) and choosing the levels;
• Selecting the appropriate orthogonal array according to literature [33];
• Performing random experiments to avoid systematic errors;
• Analyzing results by using signal-to-noise ratio (S/N) and analysis of variance (ANOVA);
• Finding the best parameter settings.

There are independent variables or entries in the signal-to-noise ratio that compromises the
performance of a process. For this reason, two categories are defined: controllable and non-
controllable factors [34].
84 Design of Experiments - Applications

Figure 2. Tubular reactor used for photochemical treatment Source: [28]

Taguchi’s method uses orthogonal arrays to study diverse factors with a reduced number of
experiments [35]. Besides that, the method can offer other advantages as: process variability
reduction, conformity of the expected result and, consequently, operational cost reduction [36].
The analysis of variance (ANOVA) is applied to Taguchi’s statistical method to evaluate the
significance of parameters used in the process [37].

8. Materials

The polyester resin effluent was conditioned in a chamber at 4 ºC. The oxidation reaction of
the effluent was performed in a tubular reactor of Germetec brand, Model GPJ-463/1, with
nominal volume of approximately 1L, receiving radiation from a low-pressure mercury lamp
type GPH-463T5L emitting UV radiation of 254 mm intensity of 15 W and 21 W, protected by
a quartz pipe according to Figure 2.
The design of experiments followed these steps:

• 1L of effluent for 2L of distilled water was firstly added,


• Then, it was added TiO2,
• The system for the effluent recirculation was turned on,
Taguchi Method Applied to Environmental Engineering 85
http://dx.doi.org/10.5772/56531

• H2O2 was added, and

• Simultaneously, the UV lamp was turned on.

9. Results and discussion

The design of experiments of polyester resin effluent was performed in a Taguchi’s Orthogonal
Array L9. pH, titanium dioxide (TiO2), ultraviolet lamp and hydrogen peroxide with concen‐
tration of 30% w/w were used in this process as controlled variables. Table 1 shows the
variables and levels used in the degradation process.

Table 2 shows Taguchi’s Orthogonal Array L9, where experimental procedures were per‐
formed at random and, after each experimental procedure, chemical oxygen demand analysis
were performed on each experimental condition.

Controlled Variables
Level 1 Level 2 Level 3
(Factors)

A- Ph 3.0 5.0 7.0

B- TiO2 [g/L] 0.083 0.167 0.25

C- H2O2 [g]
*
120.0 151.0 182.0

D- UV [W] Without 15 21

Table 1. Controlled Variables and Levels

pH TiO2 H2O2 UV
Experiment
Factor A Factor B Factor C Factor D

1 1 1 1 1

2 1 2 2 2

3 1 3 3 3

4 2 1 2 3

5 2 2 3 1

6 2 3 1 2

7 3 1 3 2

8 3 2 1 3

9 3 3 2 1

Table 2. Taguchi’s Orthogonal Array L9, with 4 factors and 3 levels each
86 Design of Experiments - Applications

The COD of the effluent sample in natura was initially calculated with a mean value of
49990mg/L and, lately submitted to a pre-treatment. For each experiment, the COD of each
sample in natura was calculated to an equal period of 60-minute-reaction. Then, the percentage
of reduction of COD was calculated for each experiment and the results are shown in Table
3 and 4.

Replica 1 reduction of chemical


pH TiO2 H2O2 UV
Experiment oxygen demand
Factor A Factor B Factor C Factor D
(%)

1 1 1 1 1 73.44

2 1 2 2 2 78.39

3 1 3 3 3 72.77

4 2 1 2 3 82.35

5 2 2 3 1 69.81

6 2 3 1 2 80.70

7 3 1 3 2 71.13

8 3 2 1 3 78.71

9 3 3 2 1 71.13

Table 3. Result of replica 1 - percentage reduction obtained by experiments for an initial COD amount of 49990 mg/l.

pH TiO2 H2O2 UV Replica 2 reduction of chemical


Experiment
Factor A Factor B Factor C Factor D oxygen demand (%)

1 1 1 1 1 73.11

2 1 2 2 2 76.08

3 1 3 3 3 70.14

4 2 1 2 3 81.69

5 2 2 3 1 65.85

6 2 3 1 2 83.34

7 3 1 3 2 69.15

8 3 2 1 3 81.69

9 3 3 2 1 73.77

Table 4. Results of replica 2 – percentage reduction obtained by experiments, for an initial COD amount of 49990
mg/l.
Taguchi Method Applied to Environmental Engineering 87
http://dx.doi.org/10.5772/56531

For experiments performed in the first replica, it is noticeable that oxidative processes reduced
COD until 82.345% of the initial amount, being experiment 4 the one with best experimental
condition for the degradation experiment, consisting of pH of 5, titanium dioxide of 0.083
g/L, hydrogen peroxide of 151 g and ultraviolet lamp intensity of 21 watts.
The design experiments of the second replica featured that advanced oxidation processes
reduced COD until 83.34% of the initial amount, being experiment 6 the one with best
experimental variables conditions at pH of 5, titanium dioxide of 0.25g/L, titanium peroxide
of 120 g and ultraviolet lamp intensity of 15 Watts.

Factors Sum of Squares DF Mean Sum Fisher Test P-Value

Intercept 101741.1 1 101741.1 33172.66 0.000000

pH 40.2 2 20.1 6.56 0.017495

TiO2 0.2 2 0.1 0.03 0.975085

H2O2 264.7 2 132.3 43.15 0.000024

UV 149.6 2 74.8 24.39 0.000232

Error 27.6 9 3.1

Table 5. Analysis of Variance for polyester resin effluent degradation

Table 5 shows ANOVA factor involved in the polyester resin effluent treatment with the
Heterogeneous Photocatalytic Process. The analysis of variance with 95% trust, critical F equal
to 4.26 and p-value lower than 5% demonstrated that hydrogen peroxide (F= 6.56 and P-value=
1,7%), temperature (F= 43,15 and P-value= 0,0024%) and lamp intensity(F= 24,39 and P-value=
0,0232%), were significant in the COD removal process.
Taguchi’s L9 statistical design of experiment (Figure 3) showed more significant parameters
for the organic material degradation of the effluent, corresponding to pH=5 adjusted to
medium level, TiO2 adjusted to any level, H2O2 concentration = 120g and the ultraviolet lamp
intensity adjusted to maximum level of 21 W.
According to [38], the influence of peroxide and temperature is related to the efficiency ratio
in the use of this compound and its accelerated decomposition in the reactional medium.
Figure 4 shows the most significant factors to a percentage reduction of Chemical Oxygen
Demand. The graph of surface response shows an increase in the degradation of polyester
resin compounds by the increase in the UV lamp intensity for lower hydrogen peroxide ratio.
The highest percentage reduction is of 83%.

10. Conclusions

Advanced Oxidation Process (Heterogeneous Photocatalysis) for the Taguchi design of this
work was evaluated, in which values are found to be significant to the chemical oxygen
88 Design of Experiments - Applications

Figure 3. Graphic of Average Impact Factors

demand removal. This design of experiment verified that the highest COD reduction is related
to the increase in peroxide hydrogen concentration of 120g, pH=5 and use of UV lamp, since
the mechanism of photocatalysis requires energy to the degradation of organic matter of the
effluent. Taguchi L9 Orthogonal Array found was 83%, which demonstrates efficiency on the
use of design of experiments and alternative methodologies to the degradation of organic load
of polyester resin effluents.

Acknowledgements

The authors would like to thank Fundação para o Desenvolvimento Científico e Tecnológico
(FDCT) for translation support.
Taguchi Method Applied to Environmental Engineering 89
http://dx.doi.org/10.5772/56531

Figure 4. Graphic of influential factors on COD removal

Author details

Ana Paula Barbosa Rodrigues de Freitas2,3, Leandro Valim de Freitas1,2,


Carla Cristina Almeida Loures2,3, Marco Aurélio Reis dos Santos2, Geisylene Diniz Ricardo2,
Fernando Augusto Silva Marins2, Hilton Túlio Lima dos Santos3, Gisella Lamas Samanamud4,
Mateus Souza Amaral3 and Messias Borges Silva2,3

1 Petróleo Brasileiro SA (PETROBRAS), Brasil

2 São Paulo State University (UNESP), Brasil

3 University of São Paulo (USP), Brasil

4 University of Texas at San Antonio (UTSA), Brasil

References

[1] Mulbry, W.; Kondrad, S.; Pizarro, C.; Kebede-Westhead, E. Treatment of dairy man‐
ure effluent using freshwater algae: Algal productivity and recovery of manure nu‐
90 Design of Experiments - Applications

trients using pilot-scale algal turf scrubbers. Bioresource Technology, v. 99, p. 8137 –
8142, 2008.

[2] Al-Momani, F.; Touraud, E.; Degorce-Dumas, J.R.; ROUSSY, J.; THOMAS, O. Biode‐
gradability enhancement of texile dyes and textile wastewater by VUV photolysis.
Journal of Photochemistry and Photobiology, A: Chemistry, v. 153, p. 191– 197, 2007.

[3] Braga, B.; Hespanhol, I.; Lotufo, C.; Conejo, J. G.; Mierzwa, J. C.; De Barros, M. T. L.;
Spencer, M.; Porto, M.; Nucci, N.; Juliano, N.; Eiger, S. Introdução à Engenharia Am‐
biental. 2ª ed. São Paulo: Pearson Prentice Hall, 2005.

[4] Pelegrini, R., Peralta-Zamora, P., Andrade, A.R., Reyes, J., Duran, N., Appl. Catal. B:
Envorn.22 (1999) 83.

[5] Segura,Y.; Molina, R.; Martínez, F.; Melero, J. A. Integrated heterogeneous sono–pho‐
to Fenton processes for the degradation of phenolic aqueous solutions. Ultrasonics
Sonochemistry, v. 16, p. 417–424, 2009.

[6] Oliver, J. H.; Hynook, K.; Pen-Chi, C. Decolorization of wastewater, Crit. Rev.Envi‐
ronmental Science Technology, v. 30, n.4, p. 499–505, 2000.

[7] Poulopoulos, S.G.; Arvanitakis, F.; Philippopoulos, C.J. Photochemical treatment of


phenol aqueous solutions using ultraviolet radiation and hydrogen peroxide. Journal
of Hazardous Materials, v. 129, p. 64–68, 2006.

[8] Kusic, H.; Koprivanac, N.; Srsan, L. Azo dye degradation using Fenton type process‐
es assisted by UV irradiation: A kinetic study. Journal of Photochemistry and Photo‐
biology A: Chemistry, v. 181 p. 195–202, 2007.

[9] Teixeira, C.P.A.B.; Jardim, W.F. Processos Oxidativos Avançados – Conceitos Teóri‐
cos. Campinas: Instituto de Química (IQ) e Laboratório de Química Ambiental
(LQA). Universidade de Campinas. (Caderno Temático, v. 3, 2004).

[10] Kunz, A., Peralta-Zamora, P. de Moraes, S. G., Duran, N., Novas Tendências no Tra‐
tamento de Efluentes Têxteis, Química Nova. v. 25, n. 1, p. 78-82, 2002. Disponível
em: http://www.scielo.br/pdf/qn/v25n1/10428.pdf Acesso em: 04/jan/2013.

[11] Oppenlander, T. Photochemical Purification of Water and Air. Weinheim: Wiley-Vch


Verlag, Germany, 2003.

[12] Ferreira, I. V. L.; Daniel, L. A. Fotocatálise heterogênea com TiO2 aplicada no trata‐
mento de esgoto sanitário secundário. Engenharia Sanitária Ambiental, v. 9, n. 4, p.
335-342, 2004.

[13] Khataee, A. R.; Vatanpour, V.; Ghadim, A. R. A. Decolorization of C.I. Acid Blue 9
solution by UV/Nano-TiO2, Fenton, Fenton-like, electro-Fenton and electrocoagula‐
tion processes: A comparative study. Journal of Hazardous Materials, v. 161, p. 1225–
1233, 2009.
Taguchi Method Applied to Environmental Engineering 91
http://dx.doi.org/10.5772/56531

[14] Tobaldi, D. M.; Tucci, A.; Camera-Roda, G.; Baldi d, G.; Esposito, L. Photocatalytic
activity for exposed building materials. Journal of the European Ceramic Society, v.
28, p. 2645–2652, 2008.

[15] Choi, W.; Hoffmann, M. R. Novel Photocatalytic Mechanisms of CHCl3, CHBr3, and
CCl3CO2- Degradation and the Fate of Photogenerated Trihalomethyl Radicals on
TiO2. Environmental Science Technology, v. 31, p. 89 – 95, 1997.

[16] Chen, J.; Ollis, D. F.; Rulkens, W. H.; Bruning, H. Photocatalyzed oxidation of alco‐
hols and organochlorides in the presence of native TiO2 and metalized TiO2 suspen‐
sions. Part (II): Photocatalytic mechanisms. Water Research, v. 33, n. 3, p. 669 – 676,
1999.

[17] López, C. M.; Choi, K.-S. “Enhancement of electrochemical and photoelectrochemica


properties of Fibrous Zn and ZnO electrodes” Chem. Commun. 2005, 3328-3330.

[18] Hoffmann, M.; Martin, S.T.; Choi, W; Bahnemann. Chem. Rev., v. 95, p. 69, 1995.

[19] Linsebigler, A. L.; Lu, G.; Yates Jr, J. T. Chem. Rev., v. 95, p. 735, 1995.

[20] Gabardo Filho,H. Estudo e projeto de reatores fotoquímicos para o tratamento de


efluentes químicos. 2005. Dissertação (Mestrado em Engenharia Química) –Facul‐
dade de Engenharia Química, Universidade Estadual de Campinas, Campinas.

[21] Domènech, X.; Jardim, W. F.; Litter, M. I. Procesos avanzados de oxidación para La
eliminación de contaminantes. In: Eliminacion de Contaminantes. La Plata: Rede CY‐
TED, 2001. Cap. 1.

[22] HU, Z.; GRASSO, D. Chemical Oxygen Demand. In: Water Analysis. 2nd ed. New
York: Elsevier Academic Press, 2005. p. 325-330.

[23] Peixoto, A. L. C.; Brito, R. A.; Salazar, R. F. S.; Guimarães, O. L. C.; Izário Filho, H. J.
Predição da demanda química de oxigênio no chorume maduro contend reagents de
fenton, por meio de modelo matemático emprírico gerado com planejamento factori‐
al complete. Química Nova, v. 31, n.7, p. 1641-1647, 2008.

[24] Piveli, R. P.; Morita, D.M. Caracterização de águas Residuárias / Sólidos. São Paulo:
Escola Politécnica/USP, 1998, 11p. (apostila).

[25] Aquino, S. F.; Silva, S. Q.; Chernicharo, C. A. L. Considerações práticas sobre o teste
de demanda química de oxigênio (DQO) aplicado a análise de efluentes anaeróbicos
(nota técnica). Engenharia Sanitária e Ambiental, v. 11, p. 295-304, 2006.

[26] Wang, T. Y., Huang, C.Y. Improving forecasting performance by employing the Ta‐
guchi method. European Journal of Operational Research, p. 1052-1065, 2007.

[27] Bruns, R. E.; Neto, B. B.; Scarminio, I. S. Como Fazer Experimentos. 4. ed. Porto Ale‐
gre: Editora Artmed, 2010. 401p.
92 Design of Experiments - Applications

[28] Ay, F.; Catalkaya, E.C.; Kargi, F. A statistical experiment design approach for ad‐
vanced oxidation of Direct Red azo-dye by photo-Fenton treatment. Journal of Haz‐
ardous Materials, v. 162, p. 230-236, 2009.

[29] Freitas, A. P. B. R. de.; Freitas, L. V. de.; Samanamud, G. L.; Marins, F. A. S.; Loures,
C. C. A.; Salman, F.; Santos, H. T. L. dos.; Silva, M. B. Book: Multivariate Analysis in
Advanced Oxidation Process. Ed:Intech, p. 73-90, 2012.

[30] Carneiro, L. M. Utilização de Processos Oxidativos Avançados na degradação de


efluentes provenientes das indústrias de tintas. 2007, 118 f. Dissertação (Mestrado em
Engenharia química) – Escola de Engenharia de Lorena, Universidade de São Paulo,
Lorena 2007.

[31] Chiang, Y. M.; Hsieh, H.H. The use of the Taguchi method with grey relational anal‐
ysis to optimize the thin-film sputtering process with multiple quality characteristic
in color filter manufacturing. Computers & Industrial Engineering, v. 56, p. 648-661,
2009.

[32] Barrado, E.; Vega, M.; Grande, P.; Del Valle, J.L. Optimization of a purification meth‐
od for metal-containing wastewater by use of a Taguchi experimental design. Water
Research, v. 30, p. 2309–2314, 1996.

[33] Taguchi, G.; Konish, S. Taguchi Methods: Orthogonal Arrays and Linear Graphs.
American Supplier Institute, 1987.

[34] Yang, H.J.; Hwang, P.J.; Lee, S.H. A study on shrinkage compensation of the SLS
process by using the Taguchi method. International Journal of Machine Tools &
Manufacture, v.42, p. 1203–1212, 2002.

[35] Sharma, P., Verma, A.; Sidhu, R. K.; Pandey, O. P. Process parameter selection for
strontium ferrite sintered magnets using Taguchi L9 orthogonal design. Journal of
Materials Processing Technology, p.147-151, 2005.

[36] Barros, N.; Bruns, R.E.; Scarminio, I. S. Otimização e planejamento de Experimentos.


Campinas : Editora da Unicamp, 1995, p.291.

[37] Rosa, J. L.; Robin, A.; Silva, M.B.; Baldan, C. A.; Peres, M. P. Electrodeposition of cop‐
per on titanium wires: Taguchi Experimental Design Approach. Journal of Materials
Processing Technology, p. II8I-II88, 2009.

[38] Malik, P. K., Saha, S.K. Oxidation of direct dyes with hydrogen peroxide using fer‐
rous ion as catalyst. Separation and Purification Technology, v. 31, p. 241-250, 2003.
Chapter 6

Application of 2K Experimental Design and Response


Surface Methodology in the Optimization of the Molar
Mass Reduction of Poly (3-Hydroxybutyrate-co-3-
Hydroxyvalerate) (PHBHV)

Sérgio Roberto Montoro, Simone de Fátima Medeiros,


Amilton Martins Santos, Messias Borges Silva and Marli Luiza Tebaldi

Additional information is available at the end of the chapter

http://dx.doi.org/10.5772/56532

1. Introduction

Biodegradable and biocompatible polymers have attracted great attention, both from scientific
and technological fields. Developing new biodegradable materials to replace petrochemical
derivatives is demanding and also a challenge for chemists worldwide as well as to developing
more efficient synthesis processes with the aim to reduce their production cost. Besides
environmental effects due to plastic wastes, there is great interest in the development of
biocompatible and biodegradable materials for biomedical applications or in other biomate‐
rials. Regarding such materials, polyhydroxyalkanoates (PHAs) are good examples among
them. They are polyesters of hydroxyalkanoic acid, globally manufactured in industrial scale
using microbial biosynthesis deriving from renewable carbon sources, in form of storage
materials as shows Figure 1. The accumulation of such polymers in granules shape are found
in the cell´s cytoplasm, their diameter show a wide range variation, from 0.2-0.5μm and they
work as glycogen synthesizers and are stored by mammals [1-3].

1.1. General PHAs properties

Awareness of PHAs physical, chemical and biological properties is important, mainly in


regards to the development of controlled release systems, once they directly influence, among
other factors, microencapsulation processes selection and drug release mechanisms [4-5].

© 2013 Montoro et al.; licensee InTech. This is an open access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits
unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
94 Design of Experiments - Applications

Figure 1. Exponential growth phase containing about 40 - 50% PHB (left) and final accumulation phase containing
about 93% PHB (right).

Usually, PHAs are crystalline structures, so their brittleness and low flexibility set limits their
application in some biomedical procedures. Thus, lack of superior mechanical proprieties,
require modifications, mainly, for medical applications [6].

PHAs molar mass is a crucial factor, once such parameter directly affects mechanical strength,
swelling capacity and the ability to undergo hydrolysis, as well as polymers biodegradation
rates. Molar mass is related to PHA´s crystallinity. Therefore, developing a controlled drug
delivery system using PHAs requires an essential preliminary molar mass reduction step. An
important factor showing molar mass dependence of biodegradable polymers degradation
rates dues to a direct proportionality between this parameter and the polymers Tg, i.e., the
lower the polymer molar mass, the lower the Tg value. In addition, degradation rates increasing
leads to complex ingredients release rates increasing, having these polymers as polymeric
matrixes, they will be promptly absorbed by the body [4]. Moreover, low molar mass PHAs
can be used as components on several architecture constructions, such as block and grafted
copolymers [7].

1.2. PHB and PHBHV copolymers

Poly(3-hydroxybutirate) (PHB) and its copolymers with hydroxyvalerate (HV) are the most
studied PHAs in literature [8]. PHB and PHBHV are completely biodegradable and produced
by a variety of bacteria´s fermentation, [1] degrading throughout natural biological processes,
turning them into excellent candidates for bioactive molecules release system´s production
[9-15]. Both poly(3-hydroxybutyrate) (PHB) and poly(3-hydroxybutyrate-co-3-hydroxyvaler‐
ate) (PHBHV) are biodegradable thermoplastic polyesters produced by a bacteria known as
Ralstonia eutropha or Alcaligenes latus [16]. PHBHV has emerged as a new generation of PHA
in which the surface morphology combined with its lower crystallinity when compared to PHB
homopolymers fastens degradation processes. Furthermore, copolymers physical properties
can be manipulated by varying the HB and HV’s composition [17]. Such advantages make the
use of PHBHV copolymers suitable for many applications, once compared to PHB homopol‐
ymers. Nevertheless, ISO 10993 highlighted such polymers as safe and non toxic materials
Application of 2K Experimental Design and Response Surface Methodology… 95
http://dx.doi.org/10.5772/56532

indicated to be used in animal´s controlled drug release tests [18]. The PHBHV structure is
shown in Figure 2.

O O

H O O O H
n m

Figure 2. Illustration of PHBHV chemical structure.

Polymers used as carrier agents play a very important role in active ingredients controlled
delivery systems, determining, among other factors, drug release rates. In fact, drug release
can be performed by different mechanisms: diffusion throught the swelled polymer network,
erosion/biodegradation of polymer chains as well as a combination of mechanisms. Basically,
the difference between erosion and biodegradation mechanisms is established based on the
macromolecule degradation ones. Polymer matrix erosion results, in a macroscopic level, in
mass loss, with no modifications on macromolecular units. It can happen in two different ways:
either by breaking intermolecular bonds in cross-linked systems, where matrixes are gradually
eroded from the external surface, or by main chain´s side group hydrolysis, resulting in
polymers dissolution, without reducing its molar mass [19].
According to such context, biodegradable polymers are those where chain´s breaking results
in monomeric units in which molar masses are small enough to be eliminated by normal
metabolic pathways. Such breakage can occur by hydrolysis (hydrolytic degradation) or
enzymatic attack (enzymatic degradation). Erosive or degradable systems, particularly those
that degrade in biological mediums (biodegradable) have found great utility in controlled
release systems development.
Polymers natural elimination, after total drug release, is an advantage once it avoids the
inconvenience of surgical interventions to remove it. Thus, micro and nano-structured as well
as biodegradable and biocompatible systems (microspheres, microcapsules, nano-capsules,
nano-spheres) have been developed for drug controlled release [20].
The role that polymers play during the formulation (modulation) of these controlled release
systems is very different if compared to an inert conventional excipient for pharmaceutical
formulations. Polymers influence not only drug kinetics release, as expected, but also the drug
´s stability, toxicity and the compatibility between biopolymers and living organism.
Innumerous techniques have been proposed in literature, regarding polymeric micro and
nanostructured materials for drug controlled delivery systems preparation [21].
The most common method used for systems based on PHAs, such as PHB and PHBHV, is
called micellization, i.e., - preparation of small micelles through self-assemblage of amphiphilic
chains in water [7]. Inside amphiphilic structures of polymeric micelles, hydrophobic drug
molecules are distributed within the hydrophobic cores, whereas the shell keeps a hydration
96 Design of Experiments - Applications

barrier that protects the integrity of each micelle. The use of amphiphilic block copolymers is
advantageous because they possess unique physicochemical features such as self-assembly
and thermodynamic stability in aqueous solution [22]. In order to get amphiphilic structures,
surface changes on the hydrophobic segment with a hydrophilic, which is able to stabilize
particles, nontoxic and blood compatible materials essential to avoid macrophages recogni‐
tion, prolonging blood circulation time and sustaining encapsulated drugs release. Many
hydrophilic polymers have been suggested for such application. Poly(ethylene glycol) (PEG),
for example, is widely used as a hydrophilic nontoxic segment once combined with hydro‐
phobic biodegradable aliphatic polyesters. It was found that incorporated hydrophilic mPEG
groups, showing resistance against opsonization and phagocytosis, also presenting prolonged
residence time in blood if compared to nanoparticles prepared without mPEG. Nevertheless,
it has been demonstrated that surface modifications of a polymer with this nontoxic material
reduces side effects risk in comparison to the non-modified polymers [15].
Low molar mass biodegradable block copolymers, in form of amphiphilic micro and nano‐
particles, were a suggestion of use as sustained release for a variety of hydrophobic drugs [22].
Encapsulate active ingredients in polymeric nanoparticles aims to turn the delivery of effective
doses of pharmacologically active substance to a particular site possible, mainly in tumors, for
a sustained period of time, avoiding innumerous side effects associated with multiple drug
dosing. The defective and leaky structure of tumor vessels and impaired lymphatic system
facilitates internalization of polymeric nanoparticles containing drugs, which enhances active
agent local effects and protects healthy cells [4].

1.3. Why PHB and PHBHV need modifications?

Besides PHBHV lower cristallinity when compared to other PHAs, its crystalline percentage
(55–80%) also needs to be considered. Moreover, it may suffer degradation by conventional
melt processing, which limits its use in many specific applications [15]. In order to minimize
such problems, PHB and PHBHV are often blended [13-14, 23-26] or used with a mixture of
substances such as natural rubber, it is also used in the preparation of composites, [27] or it
can be changed through a number of strategies such as using click chemistry [28-29] or
modifying the surface and subsequent graftization in a series of monomers [30-35] as well as
along with agents: plasticizers, lubricants, antioxidants, photostabilizers and other miscible
polymers [36]. PHBHV were modified with natural rubber producing composites with
enhanced mechanical proprieties [27]. Ke et al. [33] studied thermal properties and in vitro
degradation of amide, amine, and collagen-modified PHBHV films aiming to improve
biodegradation rates on cytocompatible biomaterials. Biodegradation rates of modified
PHBHV were greater than pure PHBHV, offering an alternative to improve such materials
properties.
Linhart and co-authors [37] showed that amorphous calcium phosphate (ACP) composites and
PHB or PHBHV (PHB-ACP or PHBHV-ACP) would be potential bone substitution materials.
As it is known, PHAs intrinsic hydrophobic properties restrict some of their applications in
vivo. Consequently, these materials could be improved by either chemical modification with
functional group’s introduction or by modifying the topographic surface. PHBHV surfaces
Application of 2K Experimental Design and Response Surface Methodology… 97
http://dx.doi.org/10.5772/56532

were modified with triarylsulfonium salts upon UV irradiation. The process forms species that
abstract hydrogen atoms from the PHBHV surface, generating primary radicals which are able
to initiate monomer’s polymerization by UV-mediation allowing wettability control of
produced films, improving their ability for cellular interaction [32]. Vergnol G. et al. [10]
described the use of PHAs as stent coatings containing the sirolimus drug. Natural PHBHV,
poly(3-hydroxyoctanoate) functionalized with carboxylic groups,PHO75COOH25, and diblock
copolymer PHBHV-b-(lactic acid) were sprayed onto metallic stents. P(HBHV-b-LA) as
coating, enhanced the drug release profile by limiting sirolimus release. Bilayer systems were
proposed, it seemed to be very promising, especially in systems with PHBHV and P(HBHV-
b-LA). Gracida J. et al. [24] studied blends of PHBHV/PHEMA´s degradation by fungal activity
using the ASTM method and CO2 measurements to determine biodegrability. Studies showed
that PHBHV/PHEMA blends are biodegradable in a ASTM method context.

As previously mentioned, to tailor PHB thermal and mechanical proprieties, its copolymeri‐
zation with 3HV is commonly performed. Currently, much research work has been published
reporting various methods of obtaining a range of PHBHV copolymers with different 3HV
content using different carbon nutrition conditions [1,38]. However, molar mass in biosyn‐
thesis is typically high and not suitable for systems of drug controlled release. Moreover,
commercial PHBHV shows some disadvantages, such as poor thermal stability and high
melting temperature. PHBHV´s thermal degradation temperature is close to 160°C and their
melting temperature is around 150°C, resulting in a small processing window [39].

In addition, in PHBHV´s biosynthesis only highly hydrophobic polymers are produced and
this is unfavorable to the interaction between a biomaterial surface and cells or some other in
vivo applications. Such polymers need much more versatile modifications in order to obtain
new materials with improved mechanical and thermal properties, besides increasing the
hydrophilic character [1].

To achieve this goal, the main procedure aims to perform PHBHV molar mass reduction.

1.3.1. Molar mass reduction and further modifications

In this context, aiming to solve the aforementioned problems, polymers molar mass reduction
is a fundamental requirement. Such procedure offers, as its main advantage, the possibility to
carry a series of modifications including polymer functionalization with terminal vinyl groups,
which are highly reactive, in further modification reactions [40].

Many efforts have been made in order to provide PHB molar mass reduction and to improve
its copolymers properties or to prepare the material for further modifications.

PHB and PHBHV molar mass reductions can be obtained by thermal degradation [34,41], acid
hydrolysis [4, 42-43], transesterification with glycols [44] reduction with NaBH4 [6, 45] or also
in vivo esterification with PEG [46].

One promising approach to improve their physical properties, adjusting degradation rates,
dues to synthesizing block copolymers using telechelic PHB or PHBHV of low molar mass
through chemical routes. These modifications involve reactions with bromide or chloride
98 Design of Experiments - Applications

Br
O O O
H
PHBHV H2N O O O
m n

TEA, DMAP PHBHV-Br


EDC/NHS/CH2Cl2
R N3 click reaction CH2Cl2/ 50ºC-24h

conditions
O

ATRP
Br
R N O OH Br R
O
R H
N O
N O O n
m *
PHBHV O
HEMA R
CH3OH,H2SO4
BPO/H2O
OH CH2Cl2
OH
HO OH

O O OH
H3C
OH
OH O O n
HO m
O
OH

OH Sn(oct)2 O
OH
OH O

HO
O

Figure 3. Possible modification reactions in PHBHV with low molar mass.

molecules turning these polymers macro-initiators, which can trigger a new polymerization
with various monomers in order to obtain new materials type graft [30-31] or block
[12,29,47-48] copolymers with specific properties, for example, amphiphilic systems for drug
carrier. Figure 3 shows some possible modifications that can be done to improve PHBHV with
low molar mass proprieties.

Arslan H. and co-authors prepared lower molar mass PHB-Cl by using a depolymerization
process (heating it under reflux with 1,2-dichlorobenzene) and by subsequent choration by
means of passing chlorine gas through PHB solutions. The chlorinated PHB (PHB-Cl) were
used as macro-initiators in methyl methacrylate (MMA) polymerization aiming to obtain PHB-
g-PMMA graft copolymers by the atom transfer radical polymerization (ATRP) method [31].
ABA triblock copolymers were prepared trough three consecutive steps. Firstly, natural PHB
with high molar mass, was converted into low molar mass PHB-diol by trans-esterification
with diethylene glycol. In the next step, PBH-diol pre-polymers were reacted with 2-bromo-2-
methylpropionylbromide to obtain PHB-Br macro-initiators which were used to carry out the
tert-butyl acrylate (tBA) polymerization by ATRP. The degradation rate was adjusted accord‐
ing to PHB contents [48]. Spitalský, Z. et al. [44] prepared PHB oligomers by alcoholysis using
two types of alcohol in the presence of p-toluene sulfonic acid as catalyst, which can be used
for further crosslinking and chain-extension reactions. Reeve, MS. et al. [49] synthesized PHB
macro-initiators of low molar mass by methanolysis followed by reactions with AlEt3, which
were used to obtain biodegradable diblock copolymers. Hirt, TD. et al. [50] obtained telechelic
OH- termined PHB and PHBHV by trans-esterification in order to prepare precursors with
reactive end groups which were used to synthesize high-molar mass block copolymers by
chain extension. PHB oligomers were prepared and reacted with 2-hydroxyethyl methacrylate
Application of 2K Experimental Design and Response Surface Methodology… 99
http://dx.doi.org/10.5772/56532

(HEMA) to form macro-monomers with two unsaturated end groups and afterwards graftized
with methyl methacrylate to obtain materials that can be used as constituents in acrylic bone
cements for use in orthopaedic applications [34]. Oliveira, AM. and co-authors synthesized
PHBHV-b-PNIPAAm block copolymers reacting hydroxyl-caped PHBHV of low molar mass
and carboxyl-caped PNIPAAm obtained via reversible addition-fragmentation chain transfer
(RAFT) polymerization. The thermo-responsive particles were loaded with dexametasone
acetate (DexAc) and showed drug delivery behaviour dependent of temperature, suggesting
that these polymeric micelles can be utilized as drug delivery systems [12]. Baran, ET. et al. [45]
prepared PHBHV of low molar mass via mechanisms of degradation by sodium borohydride
(NaBH4). Nanocapsules of PHBHV of low molar mass was prepared and tested for the
entrapment of therapeutically active proteins such as those used in cancer therapy. The studies
indicated that the use of low molar mass PHBHV was more favorable in increasing entrapment
and entrapment efficiency and enzyme activity [46]. Montoro, SR. et al. [42] used the methods
of acid hydrolysis and trans-esterification with ethylene and hexyleneglycol and also by
reductions with sodium borohydride [4,6] to obtain PHBHV with molar mass reduced in order
to develop materials suitable to be used as carriers in active systems. Liu,Q. et al. [39] synthe‐
sized telechelic PHBHV-diols with various molar mass by trans-esterification with ethylene
glycol. The results showed that PHBHV-diol was more stable than original PHBHV and the
melt-processing window increase gradually with molar mass decrease.
Lemechko, P. at al. prepared dextran-graft-PHBHV amphiphilic copolymers using two
‘‘grafting onto’’ methods. In the first one, PHBHV oligomers were reacted with SOCl2 to obtain
chloride terminated PHBHV with subsequent esterification with dextran. In the second
method, PHBHV oligomers were functionalized with alkyne end groups and graftized onto
functionalized dextran via click chemistry reaction. The presence of reactive groups could be
interesting to bind bioactive molecules in order to develop heterofunctional nanoparticles [28].
Babinot, J. at al. synthesized amphiphilic diblock copolymers with different PHAs of low molar
mass. The authors firstly prepared the PHAs oligomers by thermal treatment (190°C) varying
the time of reaction and after that, the oligomers were functionalized with alkine function by
click chemistry reaction conducting to graphitization with MeO-PEG [29].
The reduction of PHB´s molar mass in vivo is another strategy, which was used by Ashby
RD. et al. [46]. The authors controlled PHB´s molar mass by adding PEG segments in the
incubation medium. PEG interacts with the cellular biosynthetic system which is responsible
for P3HB synthesis and regulates the molar mass. A series of PEGs with different molar mass
were added to the Alcaligenes latus DSM 1122 incubation medium. Such strategy resulted in
products of P3HB-PEG diblock copolymers type with reduced molar mass.
Shah et al. [15], synthesized amphiphilic biodegradable core–shell nanoparticles by emul‐
sification–solvent evaporation technique using poly(3-hydroxybutyrate-co-3-hydroxyvaler‐
ate) or poly(3-hydroxybutyrate-co-4hydroxybutyrate) diblock copolymers. Copolymers were
coupled to monomethoxy poly(ethylene glycol) (mPEG) via trans-esterification reactions.
Nanoparticles were found to be assembled in aqueous solution into an outer hydrophilic shell
of mPEG, connected to the interior hydrophobic polyhydroxyalkanoate (PHA) copolymer
core. Moreover, the morphological examination, by means of atomic force microscope,
100 Design of Experiments - Applications

revealed the nanoparticle’s smooth spherically shape. The average particle sizes and zeta
potentials of amphiphilic nanoparticles were in the range of 112–162 nm and -18 to -27 mV,
respectively. Finally, a hydrophobic drug (thymoquinone) was encapsulated in the nanopar‐
ticles and its release kinetics was studied.

In this context, this section presents a study on optimization of ideal PHBHV molar mass
reduction due to temperature changes and in concentration of the reducing agent (NaBH4).
From a statistical experimental design (2k Full Factorial) and Response Surface Methodology
(RSM), it was determined which of these variables had a greater influence in reducing the
molar mass of PHBHV.

Actually, these PHAs are produced in Brazil (pilot-scale), and are considered one of the most
promising alternatives due to its properties and low cost.

2. 2k factorial design

Factorial designs are often used in experiments involving several factors that demand the study
of their total effects over a certain response. However, special cases regarding factorial design
- in general - are important due to the fact that they are widely used by researchers and because
they represent the basis for other considerably valorous planning.

K factor’s case is the most important one among them all. Each one presents only two levels.
Such levels may be quantitative - two temperature, pressure or time values, etc. - or qualitative
- two machines, two operators, a factor’s "high" and "low" level-, or, yet the presence and
absence of a factor. A complete replication of planning requires 2 x 2 x... x 2 = 2k observations
and is known as 2k factorial design.

2k design is particularly useful in some experiment’s early stages, when many factors are,
probably, observed. It provides a lower amount of turns in which k factors can be studied - by
means of a complete factorial design - once there are only two levels of each factor. We must
assume that the response is basically linear, considering the chosen factor’s ranges [51-54].

2.1. 22 design

2k factorial design simplest type is the 22 – two factors, A and B, each one of them holding two
levels. We usually think about such levels as “low” and “high” values. Figure 4 illustrates the
22 planning. Note that “plans” can be geometrically represented as squares in which 22 = 4 runs
- or treatment combinations, forming the square’s vertices. Regarding 22 planning, it is usual
to highlight A and B factors as “low” and “high” levels, using ( - ) and ( + ) signs to demonstrate
them, respectively. Sometimes it is called “geometric concept for planning”.

A special concept is used to underline treatment combinations. In general, a treatment


combination is represented by a series of lowercase fonts. If a certain font is shown, the
corresponding factor is ran at that treatment combination’s high level; if it is absent, the factor
is ran at its low level. For example, treatment combination (a) indicates that factor A is at high
Application of 2K Experimental Design and Response Surface Methodology… 101
http://dx.doi.org/10.5772/56532

level and that factor B is at low level. The treatment combination using both factors at low level
is represented by (1). Such notation will be used throughout the whole 2k design’s series. For
example, a 24 treatment, having A and C at high level, as well as B and D at low level, is
highlighted by (ac) [51,52].

Treatment
A B
combination
(1) - -
a + -
b - +
ab + +

Figure 4. Treatment combinations in a 22 design [adapted 51]

The interest in 22 factorial design’s effects regards A and B effects, as well as AB second order’s
interaction factor. According to cases in which fonts (1), a, b, ab are the total of all (n) observa‐
tions performed over these planning points. It is easy to estimate such factor’s effects. In order
to estimate A factor’s main effect, it is necessary to find the observation’s average on the right
side of the square (Figure 4), - having A at high level – and subtract such average from the
observation’s average on the left side of the square, where A is at low level, or:

A factor’s main effect: 22 Factorial design

a + ab b + ( 1) 1
A = y A+ - y A- = - = é a + ab - b - ( 1) ù (1)
2n 2n 2n ë û

Similarly, B’s main effect is found taking the comments’ average at the top of the square, being
- having B at high level -, and subtract the observations’ average at the bottom of the square -
having B at low level:

B factor’s main effect: 22 Factorial design

b + ab a + ( 1) 1
B = y B+ - y B- = - = éb + ab - a - ( 1) ù (2)
2n 2n 2n ë û
102 Design of Experiments - Applications

Finally, AB interaction is estimated by finding the difference from diagonal’s averages seen on
Figure 4, or:

AB effect’s interaction: 22 Factorial design

ab + ( 1) a+b 1
AB = - = é ab + ( 1) - a - b ù (3)
2n 2n 2n ë û

The equations quantities in brackets (1), (2) and (3) are called contrasts. For example, A contrast
is: ContrastA = a + ab - b - (1).

According to such equations, the contrasts’ coefficients are always (+1) or (-1). A plus (+) and
minus (-) signs table, such as on Table 1, can be used to determine the sign of each treatment
combination for a particular contrast. The columns names on Table 1 are A and B main effects,
AB interaction and I - representing the total. The lines names are treatment combinations. Note
that signs on the AB column are the product of A and B columns. In order to generate the
contrast from this table, it is demanding to multiply the signals from the appropriate column
on Table 1 by the treatment combinations listed on the lines and add. For example, con‐
trastAB = [(1)] + [a] + [b] + [ab] = ab + (1) - a - b [51,52].

Treatment Factorial Effects


Combination I A B AB

(1) + - - +

a + + - -

b + - + -

ab + + + +

Table 1. Algebraic signs for calculating effects in 22 Design.

Contrasts are used to calculate effects estimations and the squares sums for A, B and AB
interaction. Regarding any 2k design with (n) replications, effects estimations are calculated
from:

Relation between a contrast and an effect

Contrast
Effect = (4)
n2 k - 1

And, the sum of any effect’s square is:

Any effect’s square sum


Application of 2K Experimental Design and Response Surface Methodology… 103
http://dx.doi.org/10.5772/56532

Figure 5. Design with central points [51].

(Contrast )
2

SS = (5)
n2 k

There is a level of freedom associated to each effect (two levels minus one), so that the error’s
mean square to each effect is equal to the sum of the squares. The variance analysis is completed
by calculating the total sum of squares SST (with 4n - 1 level of freedom), as usual, and by
getting the squares’ error sum SSE (with (4n - 1) levels of freedom) by subtraction means [51,52].

2.2. Adding central points to 2k designs

A potential concern in the use of two levels factorial designs is the linearity assumption of
linearity in factors effects. Naturally, perfect linearity is unnecessary and the 2k system will
work out well, even when linearity’s assumption is approximately kept. However, there is a
method to replicate certain points in the 2k factor. It avoids bending as well as allows estima‐
tion, regardless the errors that can be obtained. The method consists in adding points to the
2k central planning. They consist on replicas races n C = 0 at point x i (i = 1, 2,..., k). An important
reason to add replicated races to the planning’s center, due to the fact that the central point do
not affect usual estimations regarding 2k planning effects. We consider k factors as quantitative
ones. Aiming to illustrate the approach, it was considered a 22 plan, with one observation on
each one of the factorial points (-,-), (+,-), (-,+) and (+,+) and (n C) observations on the central
points (0,0). Figure 5 illustrates the situation. ȳ F is the average of four runs on the four factorial
points and ȳ C is the average of n C runs at the midpoint [51,52]
104 Design of Experiments - Applications

If the difference ȳ F − ȳ C is small, the central point will be at or near the flat plane passing
through the factorial points and, therefore, there will be no quadratic curve. On the other hand,
if ȳ F − ȳ C is large, then a quadratic curve will be present. Squares sums –with an unique
freedom degree – to a curve is given by:

Sum of squares sums for curves

2
æ ö
( )
2
nF nC y F - yC ç ÷
ç y F - yC ÷
SSPure _ quadratic = =ç ÷ (6)
nF + nC
ç 1 + 1 ÷
ç n nC ÷ø
è F

when, in general, n F is the amount of factorial design points. Such quantity can be compared
to error’s mean square error in order to test the curve. Note that when the Equation (6) is
divided by σ̑ 2 = M SE the result will be similar to t-statistic’s square, used to compare two means.
To be more specific, when points are added to the center of 2k design, the model that can be
found is:
k k
Y = β0 + ∑ βj xj + ∑ ∑ βij xi xj + ∑ β jj xj 2 + ε
j=1 i< j j=1

once βjj are the pure quadratic effects.

Such squares sum may be incorporated to ANOVA and may be compared to error’s mean
square, aiming to test pure quadratic curves. When points are added to the center of the 2k
design the matrix for curve (using equation 6) actually tests the hypotheses:
k
H 0 : ∑ β jj = 0
j=1
k
H 1 : ∑ β jj ≠ 0
j=1

Furthermore, if the factorial design points are not replicated, n C central point can be used in
order to find an error estimation with n C - 1 level of freedom. A t-test can also be used to test
curves [51,52].

3. Response surface planning and methods (RSM)

Response surface methodology, or RSM, is a collection of mathematical and statistical


techniques that are useful for modeling and analyzing applications in which the interest
response is influenced by several variables and the target is to optimize this response. For
example, think of a chemical engineer willing to find temperature degrees (x1) and pressure
Application of 2K Experimental Design and Response Surface Methodology… 105
http://dx.doi.org/10.5772/56532

(x2) to maximize a process’ performance (y). The process performance is a function between
temperature degrees and pressure, such as in:

Y = f (x1,x2) +ε

where ε represents the noise or the observed error in the response Y. If we denote the expected
response by E(Y) = ƒ(x1,x2) = η, then the surface represented by η = ƒ(x1,x2) is called “response
surface”.

We usually, graphically, represent “response surface” as shown on Figure 6, where η is plotted


against the x1 and x2 levels. Such response surface plots were seen represented on a surface
graph in a three dimensional environ.

Figure 6. A three-dimensional response surface showing the expected performance (η) as a function between tem‐
perature (x1) and pressure (x2) [52].

Aiming to observe a response surface plot - particularly in the chapters on factorial designs -
to help visualizing its shape, we often plot the response surface’s contour, as shown on Figure
7. Regarding the contour’s plot, constant response lines are drawn in the x1,x2 plane. Each
contour corresponds to a response surface particular height. We have seen the utility of
contours plots already.

In most of RSM problems, the relation between response and independent variables is
unknown. Thus, RSM’s first step means finding an adequate rapprochement to the real
relationship between Y and the independent variables. Generally, a polynomial of low degree
is applied to some independent variables areas. If the answer is well modeled by independent
variables linear functions, then the rapprochement function will be the first-order model:
106 Design of Experiments - Applications

Figure 7. A contour plot of a response surface [52].

Y = b 0 + b1x1 + b 2 x2 + ... + b k xk + e (7)

If there is curve in the system, then a higher degree polynomial must be used, such as in the
second-order model:

k k
Y = b 0 + å b i xi + å b ii xi 2 + åå b ij xi x j + e (8)
i =1 i =1 i< j

Almost all RSM problems use one or both of these models. Of course, it is not feasible that a
polynomial model could be a reasonable rapprochement to a real functional relationship
regarding the whole independent variables environ. However, regarding a relatively small
area, they usually work out quite well.

The minimum squares method is used to estimate parameters to polynomial rapprochements.


Response surface analysis is then performed in terms of adjusted surfaces. If the adjusted
surface is an adequate rapprochement of the response’s true functions, the adjusted surfaces
will be almost equivalent to the real system analysis. The model parameters can be estimated
most effectively if proper experimental design is used in order to collect data. A design for
adjusted response surface is called response surface design [51,52].

RSM is a sequential procedure. Often, whenever we are located on a point on a response surface
far from optimum - such as the current operating conditions in Figure 8 -, there is little curving
Application of 2K Experimental Design and Response Surface Methodology… 107
http://dx.doi.org/10.5772/56532

Figure 8. The sequential nature of RSM [52].

in the system and the first-order model will be appropriate. Our goal here is to fast and
efficiently lead the experimentalist to optimum’s surroundings. Once optimum’s region has
been found, a more elaborate model - such as the second-order model -, may be applied, and
an analysis may be performed to locate the optimum. On Figure 8, we see that the analysis of
a response surface can be seen as "climbing a hill" - the top of the hill represents the point of
maximum response. If a real optimum is a point of minimum response, then we may think of
it as "going down a valley".

RSM further goal dues to determine optimum operating conditions for systems far from the
real optimum or to determine an area in the factorial environ, in which operating requirements
are fulfilled. Also note that the word "optimum" in RSM is used in a particular sense. “Climbing
a hill" RSM procedures aiming to ensure convergence only to an “optimum” place [51,52].

More extensive RSM presentations can be found in Myers and Montgomery (2002), Khuri and
Cornell (1996), and Box and Draper (1987). And review paper by Myers et al. (2004) is also a
useful reference.

3.1. Steepest ascent method

Frequently, optimal operating conditions initial estimation to the system will be far from real
optimum. In such circumstances, the experimentalist’s goal is to rapidly move to optimum’s
general surroundings. We wish to use a simple and economically efficient experimental
procedure. When we are away from the optimum, we usually assume that a first-order model
is an adequate rapprochement to the true surface in X’s small region [51,52].
108 Design of Experiments - Applications

Figure 9. First-order response surface and path of steepest ascent [51,52].

The steepest ascent method is a procedure to sequentially move towards a maximum increase
in the response. Of course, if minimization is desired, then we call the technique “steepest
descent” method. The adjusted first-order model is:

k
yˆ = bˆ0 + å bˆi xi (9)
i =1

and the first-order response surface, that is, ^y contours, a series of parallel lines such as those
shown on Figure 9. Steepest ascent direction is the one in which ^y rapidly increases. The
direction is normal due to adjusted response surface contours. We usually take the line that
passes through the center of the interest area and that also is normal to adjusted surface
contours as the steepest ascent path. So, steps taken along the path are proportional to the
regression coefficients β^ i . The real step size is determined by the experimentalist, based on
process knowledge or other practical considerations.

Experiments are done throughout the steepest ascent path, until no more increase is observed
in the response. Then a new first-order model can be adjusted, a new direction to the steepest
Application of 2K Experimental Design and Response Surface Methodology… 109
http://dx.doi.org/10.5772/56532

ascent is determined, and the procedure continues. Eventually, the experimentalist will reach
optimum’s surroundings. It is usually indicated by first-order model’s lack of adjustment. At
this point, additional experiments are performed in order to obtain a more precise optimum
estimation [51,52]

4. Experimental methods

4.1. Solvents and reagents


PHBHV (Biocycle®) was the PHA used in the current work, containing 6% HV. The used
polymer had a weight average (Mw) and number average (Mn) molar masses of 294.275 and
198.168, respectively, polydispersity index (PI) of the 1,48, melting temperature of 164°C and
crystallinity of 55%. The reducing agent used was sodium borohydride, NaBH4 (Colleman)
with 97% purity. Solvent chloroform was used as PA (purity > 99%) and to polymer purification
it was used methyl alcohol PA (Anidrol) (~ 96% purity). All solvents and other chemicals were
used without prior purification by presenting analytical purity.

4.2. General methodology to reduce PHBHV molar mass


Reducing PHBHV molar mass was done by NaBH4 reduction. The methodology used in the
procedure was described in Montoro’s, SR et al. work [4,6,55]

4.3. Statistical design


To optimize the conditions of the current process, we used an experimental design, which
included a 22 factorial design, with high (+) and low (-) levels, three central points (average)
(Table 2), resulting in seven experiments (Table 3).

Factors Low Level (-) Medium level (0) High level (+)

A: NaBH4 concentration (%) 2 4 6

B: Temperature (ºC) 50 52,5 55

Table 2. Factors and their respective control levels.

Molar mass and the polydispersity index (PI) were determined by means of Gel Permeation
Chromatography (GPC) in a Waters Breeze System equipment.

5. Results and analysis

The experimental matrix for the factorial design is illustrated in Table 4. It is noteworthy that
the experiments were performed randomly and an error experimental design was obtained
110 Design of Experiments - Applications

Factors
Experiment number
A B

1 - -

2 + -

3 - +

4 + +

5 0 0

6 0 0

7 0 0

Table 3. Parameters used in the 2k Full Factorial method.

through the mean and standard deviations on repeated central points. The use of factorial
design and statistical analysis allowed expressing effectiveness of PHBHV molar mass
reduction in molar mass as a linear and quadratic response that can be described as a function
with significant variables.

Experiment % NaBH4 Temperature (ºC) Mn (Da) Mw (Da) PI

1 2 50 5804 7576 1,31

2 6 50 4269 4766 1,11

3 2 55 4356 6267 1,44

4 6 55 3848 4052 1,05

5 4 52,5 4521 5190 1,15

6 4 52,5 4545 5244 1,15

7 4 52,5 2994 3920 1,30

Table 4. An experimental matrix for factorial design.

According to results expressed in Table 4 and using Statistica software, there was values
regarding parameters for each effect were found (% of NaBH4 and temperature) due to the
effectiveness of PHBHV molar mass (Mn and Mw) reduction process. We conducted an analysis
parameters influence, based on two responses. Therefore, it was necessary to determine which
parameters influence really showed statistical significance at a 95% level, it can be observed
using a Pareto diagram (Figures 10 and 11).

It can be seen that NaBH4 concentration and temperature variables were statistically significant
in response Mn (Figure 11). However, response Mw (Figure 10) showed that NaBH4 percentage
showed higher significance if compared to temperature, therefore, both parameters reached
significant ranges of statistical significance, adopting 95%. It was observed that the interaction
Application of 2K Experimental Design and Response Surface Methodology… 111
http://dx.doi.org/10.5772/56532

Figure 10. Pareto diagram by Mw.

between NaBH4 variables and temperature showed no importance the PHBHV molar mass
reduction process.

Data from factorial design also underwent variance and regression analysis as well as F0
testing. It has been found - according to data presented on Table 5 - that a PHBHV molar mass
reduction model presents coefficients (P-value) and satisfactory regression statistically
significant at 95% confidence.

The use of RSM allows the investigation of two variables simultaneously [54] determining
regions and molar mass maximum reduction. Figures 12 and 13 show, respectively, the
response surface regarding Mw and Mn results, all obtained in PHBHV molar mass reduction
experiments, using NaBH4 as the reducing agent.

Results obtained by the experiments have confirmed NaBH4 efficiency, both in reducing
PHBHV molar mass and in the uniformity of splitting polymer chains, thereby generating low
polydispersity index (PI) values - as presented in Table 4. Montoro et al. [6] also showed
NaBH4 effectiveness, in both in reducing PHBHV molar mass of PHBHV and the uniformity
of splitting polymer chains, if compared to other molar mass reduction means, such as acid
hydrolysis and trans-esterification with catalyzed glycols acid.

It was observed that NaBH4 temperature and concentration parameters have strong influence
on PHBHV molar mass reduction processes. The response surface analysis gotten from results
(Figures 12 and 13) revealed by NaBH4 temperature and concentration higher levels showed
112 Design of Experiments - Applications

Figure 11. Pareto diagram by Mn.

Levels of
Source of Variation Sum of Squares Mean Square F0 P-Value
Freedom
(1) NaBH4 2098152 1 2098152 113,6328 0,001765
Mn (2) Temperature 1853682 1 1853682 100,3927 0,002116
1X2 7482 1 7482 0,4052 0,569649
Error 55393 3 18464
SS TOTAL 4014710 6
Levels of
Source of Variation Sum of Squares Mean Square F0 P-Value
Freedom
(1) NaBH4 6648662 1 6648662 68,74822 0,003675
Mw (2) Temperature 1161006 1 1161006 12,00499 0,040498
1X2 53592 1 53592 0,55415 0,510633
Error 290131 3 96710
SS TOTAL 8153392 6

Table 5. Analysis on variances for table 4 experiment.

greater reduction in PHBHV molar mass. In the current study’s specific case, it was found that
molar mass reduction optimization occurred in a PHBHV reaction under a 55°C temperature,
using 6% NaBH4.
Application of 2K Experimental Design and Response Surface Methodology… 113
http://dx.doi.org/10.5772/56532

Figure 12. A three-dimensional response surface showing PHBHV molar mass reduction (Mw) as a NaBH4 and temper‐
ature function.
114 Design of Experiments - Applications

Figure 13. A three-dimensional response surface showing PHBHV molar mass reduction (Mn) as a NaBH4 and tempera‐
ture function.

6. Conclusion

Factorial designs are often used in experiments involving several factors where it is necessary
to study the joint effect of factors on a response. However, several special cases of factorial
design, in general, are important because they are widely used in research and because they
form the basis for other considerable practical value’s plans.
Application of 2K Experimental Design and Response Surface Methodology… 115
http://dx.doi.org/10.5772/56532

The 2k design is particularly useful in experimental work early stages, when many factors are
probably investigated. It provides the lowest number of runs in which k factors can be studied
due to a complete factorial design. There are only two levels of each factor, we have to assume
that the response is approximately linear in the range of chosen factors levels.

The use of RSM allows the investigation of two variables, simultaneously, thus determining
regions and the maximum reduction in PHBHV molar mass.

The results obtained from the experiments have confirmed the efficiency of NaBH4, both in
reducing PHBHV molar mass of and in the uniformity of splitting polymer chains, thereby
generating low polydispersity index (PI) values.

It was observed that NaBH4 temperature and concentration parameters have strong influence
on PHBHV molar mass reduction processes. The analysis of the response surface gotten from
final outcomes revealed NaBH4 temperature and concentration high levels, it increases
PHBHV molar mass reduction.

Based in the 22 factorial design, ANOVA and RSM techniques, all optimized to reduce PHBHV
molar mass. Regression models - the 95% confidence limit – explained data variation (P-Value)
for Mw and Mn values. Regarding the response surface analysis, it was found that PHBHV
molar mass reduction optimization happened in higher levels of temperature (55°C) and
NaBH4 concentration (6%). In general, increasing levels of temperature and NaBH4 concen‐
tration resulted in major reductions of PHBHV molar mass.

Acknowledgements

The authors thank CNPq and FAPESP (Process 141794/2010-0 and 2010/15680-9, respectively).
We thank the student Ana Valéria Freitas Maia for your collaboration in this work.

Author details

Sérgio Roberto Montoro1,2*, Simone de Fátima Medeiros1, Amilton Martins Santos1,


Messias Borges Silva1 and Marli Luiza Tebaldi3

*Address all correspondence to: [email protected] ; [email protected]

1 Department of Chemical Engineering, Lorena Engineering School - University of São Pau‐


lo, Lorena, São Paulo, Brasil

2 UNESP - Univ Estadual Paulista, Guaratinguetá Engineering School, Department of Mate‐


rials and Technology, Guaratinguetá, São Paulo, Brasil

3 Federal University of Itajubá-UNIFEI, Advanced Campus of Itabira, Minas Gerais, Brasil


116 Design of Experiments - Applications

References

[1] Salehizadeh H, Van Loosdrecht MCM. Production of polyhydroxyalkanoates by


mixed culture: recent trends and biotechnological importance. Biotechnology Advan‐
ces 2004; 22, 261-279.

[2] Sudesh K, Abe H, Doi Y. Synthesis, structure and properties of polyhydroxy alka‐
noates:biological polyesters. Progress in Polymer Science 2000; 25,1503-1555.

[3] Chandra R, Rustgi R. Biodegradable Polymers Progress in Polymer Science 1998;


23:1273–1335.

[4] Montoro S. Redução da massa molar do poli(3-hidroxibutirato-co-3-hidroxivalerato)


(PHBHV) para sua posterior utilização no desenvolvimento de sistemas de liberação
controlada. PhD Thesis. Engineering School of Lorena 2005.

[5] Terada M, Marchessault M H. Determination of solubility parameters for poly(3-hy‐


droxyalkanoates). International Journal of Biological Macromolecules 1999; 25(1-3)
207–215.

[6] Montoro S R, Sordi M L T, Santos A M, Ré M I. Estudo Cinético da Redução da Mas‐


sa Molar do Poli(3-Hidroxibutirato-co-3-Hidroxivalerato) (PHBHV). Polímeros: Ciên‐
cia e Tecnologia 2010; 20(1) 19-24.

[7] Riess G. Micellization of block copolymers. Progress and Polymer Science 2003; 25(8)
1107–1170.

[8] Vidhate S, Innocentini-Mei L, Souza N A. Mechanical and Electrical Multifunctional


Poly(3-hydroxybutyrate-co-3-hydroxyvalerate)-Multiwall Carbon Nanotubes Nano‐
composites, Polymer Engineering and Science 2012; 52(6)1367–1374.

[9] Grillo R, Pereira AES, Melo NFS, Porto RM, Feitosa LO, Tonello PS, Dias NLF, Rosa
AH, Lima R, Fraceto LF. Controlled release system for ametryn using polymer micro‐
spheres: Preparation, characterization and release kinetics in water. Journal of Haz‐
ardous Materials 2011 186, 1645-1651.

[10] Vergnol G, Sow H, Renard E, Haroun F, Langlois V. Multilayer approach for tuning
the drug delivery from poly(3-hydroxyalkanaoate)s coatings. Reactive & Functional
Polymers 2012; 72, 260-267.

[11] Kurth N, Renard E, Brachet F, Robic D, Guerin Ph, Bourbouze R. Poly(3-hydroxyoc‐


tanoate) containing pendant carboxylic groups for the preparation of nanoparticles
aimed at drug transport and release. Polymer 2002; 43, 1095-1101.

[12] Oliveira AM, Oliveira PC, Santos AM, Zanin MHA, Ré MI. Synthesis And Character‐
ization of Thermo-Responsive Particles of Poly (Hydroxybutirate-co-Hydroxyvaler‐
ate)-b-Poly(N-Isopropylacrylamide). Brazilian Journal of Physics 2009; 39, 217-222.
Application of 2K Experimental Design and Response Surface Methodology… 117
http://dx.doi.org/10.5772/56532

[13] Simioni AR, Vaccari C, Re MI, Tedesco AC. PHBHV/PCL microspheres as biodegrad‐
able drug delivery systems (DDS) for photodynamic therapy (PDT). Journal of Mate‐
rials Science 2008; 43(2) 580-585.

[14] Poletto FS, Jäger E, Ré MI, Guterres SS, Pohlmann AR. Rate-modulating
PHBHV/PCL microparticles containing weak acid model drugs. International Journal
of Pharmaceutics 2007; 345(1) 70-80.

[15] Shah M, Naseer M I, Choi M H, Kim M O, Yoon S C. Amphiphilic PHA–mPEG co‐


polymeric nanocontainers for drug delivery:Preparation, characterization and in vi‐
tro evaluation. International Journal of Pharmaceutics 2010; 400,165 -175.

[16] John L, Foster R. Biosynthesis, properties and potential of natural–synthetic hybrids


of polyhydroxyalkanoates and polyethylene glycols. Applied Microbiology and Bio‐
technology 2007; 75,1241-1247.

[17] Pouton C W, Akhtar S. Biosynthetic polyhydroxyalkanoates and their potential in


drug delivery. Advanced Drug Delivery Reviews 1996; 28(1)133 -162.

[18] Pötter M, Steinbüchel A. Poly(3-hydroxybutyrate) granule-associated proteins: im‐


pacts on poly(3-hydroxybutyrate) synthesis and degradation. Biomacromolecules
2005; 6(2) 552-560.

[19] Porte H, Couarraze G. Microencapsulation processes for the manufacture of systems


providing modified release of the active constituent. In: Chulia D, Delail M, Pource‐
lot Y. (eds) Powder technology and pharmaceutical processes. Elsevier Science, Am‐
sterdam 1994; 513-543.

[20] Benoit M A. Biodegradable Microspheres: Advances in Production Technology, In:


Benita S. (ed) Microencapsulation: Methods and Industrial Applications. Marcel Dek‐
ker Inc., NY 1996; 35-72.

[21] Poletto F S, Fiel L A,Donida B, Ré M I, Guterres S S, Pohlmann A R. Controlling the


size of poly(hydroxybutyrate-co-hydroxyvalerate) nanoparticles prepared by emulsi‐
fication–diffusion technique using ethanol as surface agent. Colloids and Surfaces A:
Physicochemical and Engineering Aspects 2008; 324(2) 105-112.

[22] Liechty W B, Kryscio D R, Slaughter D V, Peppas N A. Polymers for Drug Delivery


Systems. Department of Chemical Engineering, University of Texas, Austin, Texas
78712-1062. Annual Review of Chemical and Biomolecular Engineering 2010;
1,149-173.

[23] Srubar III WV, Wright ZC, Tsui A, Michel AT, Billington SL, Frank CW. Characteriz‐
ing the effects of ambient aging on the mechanical and physical properties of two
commercially available bacterial thermoplastics. Polymer Degradation and Stability
2012, 97, 1922-1929.

[24] Gracida J, Alba J, Cardoso J, Perez-Guevara F. Studies of biodegradation of binary


blends of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBHV) with poly(2-hy‐
118 Design of Experiments - Applications

droxyethyl metacrilate) (PHEMA). Polymer Degradation and Stability 2004; 83,


247-253.
[25] Wang S, Ma P, Wang R, Wang S, Zhang Y, Zhang Y. Mechanical, thermal and degra‐
dation properties of poly(d,l-lactide)/poly(hydroxybutyrate-co-hydroxyvalerate)/
poly(ethyleneglycol) blend. Polymer Degradation and Stability 2008; 93, 1364-1369.
[26] Shi Q, Chen C, Gao L, Jiao L, Xu H, Guo W. Physical and degradation properties of
binary or ternary blends composed of poly(lactic acid), thermoplastic starch and
GMA grafted POE. Polymer Degradation and Stability 2011; 96, 175-182.
[27] Coelho JFJ, Góis JR, Fonseca AC, Gil MH. Modification of Poly(3-hydroxybutyrate)-
co-Poly(3-hydroxyvalerate) with Natural Rubber. Journal of Applied Polymer Sci‐
ence 2010; 116: 718-726.
[28] Lemechko P, Renard E, Guezennec J, Simon-Colin C, Langlois V. Synthesis of dex‐
tran-graft-PHBHV amphiphilic copolymer using click chemistry approach. Reactive
& Functional Polymers 2012; 72, 487-494.
[29] Babinot J, Renard E, Langlois V. Controlled Synthesis of Well Defined Poly(3- hy‐
droxyalkanoate)s-based Amphiphilic Diblock Copolymers Using Click Chemistry.
Macromolecular Chemistry and Physic 2011; 212, 278-285.
[30] Lao HK, Renard E, Linossier I, Langlois V, Vallée-Rehel K. Modification of Poly(3-
hydroxybutyrate-co-3-hydroxyvalerate) Film by Chemical Graft Copolymerization”
Biomacromolecules 2007, 8, 416-423.
[31] Arslan H, Yesilyurt N, Hazer B. The Synthesis of Poly(3-hydroxybutyrate)-
gpoly(methylmethacrylate) Brush Type Graft Copolymers by Atom Transfer Radical
Polymerization Method. Journal of Applied Polymer Science 2007, 106, 1742–1750.
[32] Versace DL, Dubot P, Cenedese P, Lalevée J, Soppera O, Malval JP, Renard E, Lan‐
glois V. Natural biopolymer surface of poly(3-hydroxybutyrate-co-3-hydroxyvaler‐
ate)-photoinduced modification with triarylsulfonium salts. Green Chemistry
2012,14, 788-798.
[33] Ke Y, Wang Y, Ren L, Wu G, Xue W. Surface modification of PHBV films with differ‐
ent functional groups: Thermal properties and in vitro degradation. Journal of Ap‐
plied Polymer Science 2010; 118(1) 390-398.
[34] Nguyen S, Marchessault RH. Synthesis and Properties of Graft Copolymers Based on
Poly(3-hydroxybutyrate) Macromonomers. Macromolecular Bioscience 2004; 4,
262-268.
[35] Koseva NS, Novakov CP, Rydz J, Kurcok P, Kowalczuk M. Synthesis of aPHB-PEG
Brush Co-polymers through ATRP in a Macroinitiator-Macromonomer Feed System
and Their Characterization. Designed Monomers & Polymers 2010; 13, 579-595.
[36] Srubar III WV, Wright ZC, Tsui A, Michel AT, Billington SL, Frank CW. Characteriz‐
ing the effects of ambient aging on the mechanical and physical properties of two
Application of 2K Experimental Design and Response Surface Methodology… 119
http://dx.doi.org/10.5772/56532

commercially available bacterial thermoplastics. Polymer Degradation and Stability


2012; 97, 1922-1929.

[37] Linhart W, Lehmann W, Siedler M, Peters F, Schilling AF, Schwarz K, Amling M,


Rueger JM, Epple M. Composites of amorphous calcium phosphate and poly(hy‐
droxybutyrate) and poly(hydroxybutyrateco-hydroxyvalerate) for bone substitution:
assessment of the biocompatibility. Journal of Materials Science 2006; 41, 4806-4813.

[38] Bonartsev AP, Myshkina VL, Nikolaeva DA, Furina EK, Makhina TA, Livshits VA,
Boskhomdzhiev AP, Ivanov EA, Iordanskii AL, Bonartseva GA. Biosynthesis, biode‐
gradation, and application of poly(3-hydroxybutyrate) and its copolymers - natural
polyesters produced by diazotrophic bacteria. Communicating Current Research and
Educational Topics and Trends in Applied Microbiology 2007 (2).

[39] Liu Q, Shyr TW, Tung CH, Liu Z, Zhan G, Zhu M,Deng B. Particular thermal propri‐
eties of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) oligomers. Journal Polymer
Researcher 2012; 19(1) 1-9.

[40] Hazer DB, Kiliçay E, Hazer B. Poly(3-hydroxyalkanoate)s: Diversification and bio‐


medical applications A state of the art review. Materials Science and Engineering C
2012; 32, 637–647.

[41] Nguyen S, YU G, Marchessault RH. Thermal degradation of poly(3-hydroxyalka‐


noates): preparation of well-defined oligomers. Biomacromolecules 2002; 3, 219-224.

[42] Montoro SR, Tebaldi ML, Alves GM, Barboza JCS. Redução da massa molecular e
funcionalização do Poli(3-Hidroxibutirato-co-3-Hidroxivalerato) (PHBHV) via hidról‐
ise ácida e transesterificação com glicóis. Polímeros 2011; 21(3) 182-187.

[43] Lauzier C, Revol JF, Debzi EM, Marchessault RH. Hydrolytic degradation of isoled
poly(β-hydroxybutyrate) granules. Polymer 1994; 35: 4156-4162.

[44] Spitalský Z, Lacík I, Lathová E, Janigov I, Chodák I. Controlled degradation of poly‐


hydroxybutyrate via alcoholysis with ethylene glycol or glycerol. Polymer Degrada‐
tion and Stability 2006; 91, 856-861.

[45] Baran ET; Ozer N, Hasirci V. Poly(hydroxybutyrate-co-hydroxyvalerate)nanocap‐


sules as enzyme carriers for cancer therapy: an in vivo study. Journal of Microencap‐
sulation 2002; 19, 363-376.

[46] Ashby RD, Shi F, Gross RA. Use of Poly(ethylene glycol) to Control the End Group
Structure and Molecular Weight of Poly(3-hydroxybutyrate) Formed by Alcaligenes
latus DSM 1122. Tetrahedron 1997; 53(45)15209-15223.

[47] Zhang X, Yang H, Liu Q, Zheng Y, Xie H, Wang Z, I Cheng R. Synthesis and Charac‐
terization of Biodegradable Triblock Copolymers Based on Bacterial Poly[(R)-3-hy‐
droxybutyrate] by Atom Transfer Radical Polymerization. Journal of Polymer
Science: Part A: Polymer Chemistry 2005, 43, 4857- 4869.
120 Design of Experiments - Applications

[48] Adamus G, Sikorska W, Janeczek H, Kwiecien M, Sobota M, Kowalczuk M. Novel


block copolymers of atactic PHB with natural PHA for cardiovascular engineering:
Synthesis and characterization. European Polymer Journal 2012; 48, 621-631.

[49] Reeve MS, McCarthy SP, Gross RA. Preparation and Characterization of (R)-Poly(β-
hydroxybutyrate)-Poly(ε-caprolactone) and (R)-Poly(3-hydroxybutyrate)-Poly(lac‐
tide) Degradable Diblock Copolymers. Macromolecules 1993; 26, 888-894.

[50] Hirt TD, Neuenschwander P, Suter UW. Telechelic diols from poly[(R)-3-hydroxybu‐
tiric acid] and poly{[(R)-3-hydroxybutiric acid]-co-[(R)-3-hydroxyvaleric acid]}. Mac‐
romolecular Chemistry and Physics 1996; 197, 1609-1614.

[51] Montgomery DC, Runger GC. Estatística Aplicada e Probabilidade para Engen‐
heiros, 5ª ed. Rio de Janeiro: LTC; 2012.

[52] Montgomery DC. Design and Analysis of Experiments, 6ª Ed. EUA: John Wiley &
Sons, Inc; 2005.

[53] Dean AM, Voss DT. Design and Analysis of Experiments. EUA: Springer; 1999.

[54] Neto BB, Scarminio IS, Bruns RE. Como Fazer Experimentos - Pesquisa e Desenvolvi‐
mento na Ciência e na Indústria, 4ª ed. Porto Alegre: Bookman; 2010.

[55] Montoro SR, Maia AVF, Benini KCCC, Tebaldi ML, Silva MB. 11° CBPol 2011: confer‐
ence proceedings, October, 16-20, 2011, Campos do Jordão/SP-Brazil.

You might also like