See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/239792877

Arlequin ver 1.1

Article · January 1997

CITATIONS READS

17 1,673

4 authors, including:

Stefan Schneider David Roessli

University of Geneva University of Geneva
30 PUBLICATIONS   31,815 CITATIONS    14 PUBLICATIONS   11,529 CITATIONS   

SEE PROFILE SEE PROFILE

Laurent Excoffier
Universität Bern
348 PUBLICATIONS   94,832 CITATIONS   

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Swiss Residential Building Stock Model (SwissRes) View project

Post-doc in Population Genetics View project

All content following this page was uploaded by Laurent Excoffier on 09 February 2015.

The user has requested enhancement of the downloaded file.

ver 1.1
Manual Arlequin ver 1.1 2

ARLEQUIN ver 1.1

A software for population genetic data analysis

Authors:
Stefan Schneider, Jean-Marc Kueffer, David Roessli, and Laurent Excoffier

Genetics and Biometry Laboratory

Dept. of Anthropology and Ecology
University of Geneva
CP 511
1211 Geneva 24
Switzerland

E-mail : [email protected]
URL: http://anthropologie.unige.ch/arlequin

December 1997
Manual Arlequin ver 1.1 Table of contents 3

Table of contents:

1 Introduction 6
1.1 Why Arlequin? 6
1.2 Arlequin philosophy 6
1.3 About this manual 6
1.4 Data types handled by Arlequin 7
1.4.1 DNA sequences 8
1.4.2 RFLP Data 8
1.4.3 Microsatellite data 8
1.4.4 Standard data 8
1.4.5 Allele frequency data 9
1.5 Methods implemented in Arlequin 9
1.6 System requirements 10
1.7 Installing and uninstalling Arlequin 10
1.8 List of files included in the Arlequin package 11
1.9 Arlequin limitations 12
1.10 How to cite Arlequin 12
1.11 Acknowledgements 12
1.12 Bug report and comments 12
1.13 How to get the last version of the Arlequin software? 12
1.14 What is new in version 1.1 compared to version 1.0 13
1.15 Forthcoming developments 13
1.16 Remaining problem 14
2 Getting started 15
2.1 Preparing input files 15
2.2 Loading project files into Arlequin 15
2.3 Selecting analyses to be performed on your data 15
2.4 Creating and using Setting Files 15
2.5 Performing the analyses 16
2.6 Stopping the computations 16
2.7 Consulting the results 16
3 Input files 17
3.1 Format of Arlequin input files 17
3.2 Project file structure 17
3.2.1 Profile section 17
3.2.2 Data section 19
3.2.2.1 Haplotype list (optional) 19
3.2.2.2 Distance matrix (optional) 20
3.2.2.3 Samples 21
3.2.2.4 Genetic structure 23
3.3 Eexample of an input file 24
3.4 Automatically creating the outline of a project file 25
3.5 Conversion of data files 26
3.6 Arlequin batch files 27
4 Output files 28
4.1 Result file 28
Manual Arlequin ver 1.1 Table of contents 4

4.2 View your results in HTML browser 28

4.3 Arlequin Log file 28
4.4 Back-up file 29
4.5 Linkage Disequilibrium Result File 29
4.6 Variance components null distribution histograms 29
5 Examples of input files 30
5.1 Example of allele frequency data 30
5.2 Example of standard data (Genotypic data, unknown gametic phase, recessive alleles) 30
5.3 Example of DNA sequence data (Haplotypic) 31
5.4 Example of microsatellite data (Genotypic) 32
5.5 Example of RFLP data(Haplotypic) 33
5.6 Example of standard data (Genotypic data, known gametic phase) 34
6 Arlequin interface 35
6.1 Menus 35
6.1.1 File Menu 35
6.1.2 Edit Menu 35
6.1.3 Project Menu 35
6.1.4 Setup Menu 37
6.1.5 Special Menu 37
6.1.6 Window Menu 37
6.1.7 Help Menu 38
6.2 Toolbar 38
6.3 Status Bar 39
6.4 Dialog boxes 39
6.4.1 General Settings 39
6.4.2 Diversity indices 41
6.4.3 Neutrality tests 43
6.4.4 Gametic disequilibrium 44
6.4.5 Genetic structure 46
6.4.6 Launch Pad 48
7 Methodological outlines 50
7.1 Intra-population level methods 51
7.1.1 Standard diversity indices 51
7.1.1.1 Gene diversity 51
7.1.1.2 Number of usable loci 51
7.1.1.3 Number of polymorphic sites (S) 51
7.1.2 Molecular indices 51
7.1.2.1 Mean number of pairwise differences (π) 51
7.1.2.2 Nucleotide diversity or average gene diversity over L loci (RFLP and DNA data) 52
7.1.2.3 Theta estimators 52
7.1.2.3.1 Theta(Hom) 52
7.1.2.3.2 Theta(S) 53
7.1.2.3.3 Theta(k) 53
7.1.2.3.4 Theta( π ) 54
7.1.2.4 Mismatch distribution 54
7.1.2.5 Estimation of genetic distances between DNA sequences 55
7.1.2.5.1 Pairwise difference 56
Manual Arlequin ver 1.1 Table of contents 5

7.1.2.5.2 Percentage difference 56

7.1.2.5.3 Jukes and Cantor 56
7.1.2.5.4 Kimura 2-parameters 57
7.1.2.5.5 Tamura 57
7.1.2.5.6 Tajima and Nei 58
7.1.2.5.7 Tamura and Nei 58
7.1.2.6 Estimation of genetic distances between RFLP haplotypes 59
7.1.2.6.1 Number of pairwise difference 59
7.1.2.6.2 Proportion of difference 60
7.1.2.7 Estimation of distances between Microsatellite haplotypes 60
7.1.2.7.1 No. of different alleles 60
7.1.2.7.2 Sum of squared size difference 60
7.1.2.8 Estimation of distances between Standard haplotypes 61
7.1.2.8.1 Number of pairwise differences 61
7.1.3 Haplotype frequency estimation 61
7.1.3.1 Haplotypic data or Genotypic data with known Gametic phase 61
7.1.3.2 Genotypic data with unknown Gametic phase 61
7.1.4 Linkage disequilibrium between pairs of loci 62
7.1.4.1 Exact test of linkage disequilibrium (haplotypic data) 62
7.1.4.2 Likelihood ratio test of linkage disequilibrium (genotypic data, gametic phase unknown) 64
7.1.4.3 Measures of gametic disequilibrium (haplotypic data) 64
7.1.5 Hardy-Weinberg equilibrium. 65
7.1.6 Neutrality tests. 66
7.1.6.1 Ewens-Watterson homozygosity test 66
7.1.6.2 Ewens-Watterson-Slatkin exact test 66
7.1.6.3 Chakraborty’s test of population amalgamation 67
7.1.6.4 Tajima’s test of selective neutrality 67
7.2 Inter-population level methods 67
7.2.1 Population genetic structure inferred by analysis of variance (AMOVA) 67
7.2.1.1 Haplotypic data, one group of populations 69
7.2.1.2 Haplotypic data, several groups of populations 70
7.2.1.3 Genotypic data, one group of populations, no within- individual level 70
7.2.1.4 Genotypic data, several groups of populations, no within- individual level 71
7.2.1.5 Genotypic data, one population, within- individual level 72
7.2.1.6 Genotypic data, one group of populations, within- individual level 72
7.2.1.7 Genotypic data, several groups of populations, within- individual level 73
7.2.2 Population pairwise genetic distances 73
7.2.3 Exact tests of population differentiation 75
8 Appendix 76
8.1 Overview of input file keywords 76
9 References 79
Manual Arlequin ver 1.1 Introduction 6

1 INTRODUCTION

1.1Why Arlequin?

Arlequin is the French translation of "Arlecchino", a famous character of the Italian "Commedia dell’Arte". As a
character he has many aspects, but he has the ability to switch among them very easily according to its needs and
to necessities. This polymorphic ability is symbolized by his colorful costume, from which the Arlequin icon
was designed.

1.2Arlequin philosophy

The goal of Arlequin is to provide the average user in population genetics with quite a large set of methods and
statistical tests, in order to extract information on genetic and demographic features of a collection of population
samples.
The graphical interface has been designed such as to allow the user to rapidly select the different analyses he
wants to perform on his data. We felt important to be able to explore the data, to analyze several times the same
data set from different perspectives, with different selected options.
The statistical tests implemented in Arlequin have been chosen such as to minimize hidden assumptions and to
be as powerful as possible. Thus, they often take the form of either permutation tests or exact tests, with some
exceptions.
Finally, we wanted Arlequin to be able to handle genetic data under many different forms, and to try to carry out
the same types of analyses irrespective of the format of the data.
Because Arlequin has a rich set of features and many options, it means that the user has to spend some time in
learning them. However, we hope that the learning curve will not be that steep.
Arlequin is made available free of charge, as long as we have enough local resources to support the development
of the program.

1.3About this manual

The main purpose of this manual is to allow you to use Arlequin on your own, in order to limit as far as possible
e-mail exchange with us.
In this manual, we have tried to provide a description of
1. the data types handled by Arlequin
2. the way these data should be formatted before the analyses
3. the graphical interface
4. the impact of different options on the computations
5. methodological outlines describing which computations are actually performed by Arlequin.
Even though this manual contains the description of some theoretical aspects, it should not be considered as a
textbook in basic population genetics. We strongly recommend you to consult the original references provided
with the description of a given method if you are in doubt with any aspect of the analysis.
Manual Arlequin ver 1.1 Introduction 7

1.4Data types handled by Ar lequin

Arlequin can handle several types of data either in haplotypic or genotypic form. The basic data types are:
• DNA sequences
• RFLP data
• Microsatellite data
• Standard data
• Allele frequency data
By haplotypic form we mean that genetic data can be presented under the form of haplotypes (i.e. a combination
of alleles at one or more loci). This haplotypic form can result from the analyses of haploid genomes (mtDNA, Y
chromosome, prokaryotes), or from diploid genomes where the gametic phase could be inferred by one way or
another. Note that allelic data are treated here as a single locus haplotype.

Ex 1: haplotypic RFLP data : 100110100101001010

Ex 2: haplotypic standard HLA data : DRB1*0101 DQB1*0102 DPB1*0201

By genotypic form, we mean that genetic data is presented under the form of diploid genotypes (i.e. a
combination of pairs of alleles at one or more loci).
Ex1: genotypic DNA sequence data:

ACGGCATTTAAGCATGACATACGGATTGACA
ACGGGATTTTAGCATGACATTCGGATAGACA

Ex 2: genotypic Microsatellite data :

63 24 32
62 24 30

The gametic phase of a multi-locus genotype may be either known or unknown. If the gametic phase is known,
the genotype can be considered as made up of two well-defined haplotypes. For genotypic data with unknown
gametic phase, you can consider the two alleles present at each locus as codominant, or you can allow for the
presence of a recessive allele. This gives finally four possible forms of genetic data:
• Haplotypic data,
• Genotypic data with known gametic phase,
• Genotypic data with unknown gametic phase (no recessive alleles)
• Genotypic data with unknown gametic phase (recessive alleles).
Manual Arlequin ver 1.1 Introduction 8

1.4.1DNA sequences
DNA sequences of arbitrary length can be accommodated by Arlequin. Each nucleotide is considered as a
distinct locus. The four nucleotides "C", "T", "A", "G" are considered as unambiguous alleles for each locus, and
the "-" is used to indicate a deleted nucleotide. Usually the question mark "?" codes for an unknown nucleotide.
The following notation for ambiguous nucleotides are also recognized:
R: A/G (purine)
Y: C/T (pyrimidine)
M: A/C
W: A/T
S: C/G
K: G/T
B: C/G/T
D: A/G/T
H: A/C/T
V: A/C/G
N: A/C/G/T

1.4.2RFLP Data
RFLP haplotypes of arbitrary length can be handled by Arlequin. Each restriction site is considered as a distinct
locus. The presence of a restriction site should be coded as a "1", and its absence as a "0". The "-" character
should be used to denote the deletion of a site, not its absence due to a point mutation.

1.4.3Microsatellite data
The raw data consist here of the allelic state of one or an arbitrary number of microsatellite loci. For each locus,
one should in principle provide the number of repeats of the microsatellite motif as the allelic definition, if one
wants his data to be analyzed according to the step-wise mutation model (for the analysis of genetic structure). It
may occur that the absolute number of repeats is unknown. If the difference in length between amplified
products is the direct consequence of changes in repeat numbers, then the minimum length of the amplified
product could serve as a reference, allowing to code the other alleles in terms of additional repeats as compared
to this reference. If this strategy is impossible, then any other number could be used as an allelic code, but the
step-wise mutation model cold not be assumed for theses data.

1.4.4Standard data
Data for which the molecular basis of the polymorphism is not particularly defined, or when different alleles are
considered as mutationally equidistant from each other. Standard data haplotypes are thus compared for their
content at each locus, without taking special care about the nature of the alleles, which can be either similar or
different. For instance, HLA data (human MHC) enters the category of standard data.
Manual Arlequin ver 1.1 Introduction 9

1.4.5Allele frequency data

The raw data consist of only allele frequencies (mono-locus treatment), so that no haplotypic information is
needed for such data. Population samples are then only compared for their allelic frequencies.

1.5Methods implemented in Arlequin

The analyses Arlequin can perform on the data fall into two main categories: intra-population and inter-
population methods. In the first category statistical information is extracted independently from each population,
whereas in the second category, samples are compared to each other.

Intra-population methods: Short description:

Standard indices Some diversity measures like the number of polymorphic

sites, gene diversity.
Molecular diversity Calculates several diversity indices like nucleotide
diversity, different estimators of the population parameter
θ.
Mismatch distribution The distribution of the number of pairwise differences
between haplotypes based on computed inter-haplotypic
distances.
Haplotype frequency estimation Estimates the frequency of haplotypes present in the
population either by gene counting or by the maximum
likelihood method, depending on the type of data
(haplotypic or genotypic).
Linkage disequilibrium Test of non-random association of alleles at different loci.
Hardy-Weinberg equilibrium Test of non-random association of alleles within diploid
individuals.
Tajima’s neutrality test (infinite site model) Test of the selective neutrality of a random sample of
DNA sequences or RFLP haplotypes under the infinite site
model.
Ewens-Watterson neutrality test (infinite allele Tests of selective neutrality based on Ewens sampling
model) theory under the infinite alleles model.
Chakraborty’s amalgamation test (infinite allele A test of selective neutrality and population homogeneity.
model) This test can be used when sample heterogeneity is
suspected.

Inter-population methods: Short description:

Search for shared haplotypes between Comparison of population samples for their haplotypic
populations content. All the results are then summarized in a table.
AMOVA Different hierarchical Analyses of MOlecular VAriance to
evaluate the amount of population genetic structure.
Pairwise genetic distances FST based genetic distances for short divergence time.
Exact test of population differentiation Test of non-random distribution of haplotypes into
population samples under the hypothesis of panmixia.
Manual Arlequin ver 1.1 Introduction 10

1.6System requirements

• 486DX CPU, or higher

• Windows 95, Windows NT, or Win 3.1x with Win32s installed
• 8 MB RAM or more
• At least 4Mb free hard disk space

1.7Installing and uninstallin g Arlequin

• Win 3.1 installation

1. Because Arlequin is a pure 32-bit program, you need to first install the Win32s libraries on your
system. You can retrieve them from our Arlequin web site (http://anthropologie.unige.ch/arlequin) or
from some other web site. To install these libraries, download the Win32s zip file, unzip it in a
temporary directory and launch the Win32s setup application. It will install a 32-bit subsystem in your
windows directories. The unzipped temporary files can be removed after installation.
2. Then, unzip the Arlequin compressed file in the directory of your choice (e.g. c:\programs\Arlequin\).
The zip file contains 32 bit libraries, the Arlequin executable files, and the example files.
3. Use the file manager and the program manager to put Arlequin.exe in the program group of your
choice.
4. To launch Arlequin, simply click twice on Arlequin.exe icon.

• Win 3.1 uninstallation

Simply delete the Arlequin directory.

• Win95 and WinNT installation

Unzip the Arlequin compressed file in a temporary directory. Launch the setup file and follow its
instructions, step by step. The setup file will create a directory for Arlequin executable files, example
files, put the required system libraries in the appropriate directories, and create shortcuts in the explorer
structure of your choice.
In case of an Arlequin update, please first uninstall the obsolete version of Arlequin.

• Win95 and WinNT uninstallation

Use the Win95 Settings | Add-Remove programs feature, and select Arlequin 1.1. It will automatically
remove all files previously installed during Arlequin 1.1 setup.
Manual Arlequin ver 1.1 Introduction 11

1.8List of files included in th e Arlequin package

Required for
Arlequin to
Files Description run properly

Arlequin files
arlequin.exe Arlequin executable file ä
arlequin.hlp Arlequin help file
arlequin.cnt Arlequin help file organizer
arlequin.ini A file containing the description of the last custom
settings defined by the user
arlequin.log A file containing the last warning and error messages
issued by Arlequin
readme11.txt A text file containing a description of the last release of
Arlequin

Example files
batch\batch_ex.arb microsat\2popmic.arp haplfreq\hla_7pop.arp
batch\amova1.arp microsat\2popmic.ars haplfreq\hla_7pop.ars
batch\amova1.ars microsat\micdipl.arp
amova\amovahap.arp
batch\amova1mat.dis microsat\micdipl.ars
amova\amovahap.ars
batch\genotsta.arp microsat\micdipl2.arp
amova\amovadis.arp
batch\genotsta.ars microsat\micdipl2.ars
amova\amovadis.ars
batch\microsat.arp
dna\mtdna_hv1.arp amova\56hapdef.txt
batch\microsat.ars
dna\mtdna_hv1.ars amova\amovadis.dis
batch\missdata.arp
dna\nucl_div.arp
batch\missdata.ars disequil\hwequil.arp
dna\nucl_div.ars
batch\phenohla.arp disequil\hwequil.ars
batch\phenohla.ars neutrtst\chak_tst.arp disequil\ld_gen0.arp
batch\relfreq.arp neutrtst\chak_tst.ars disequil\ld_gen0.ars
batch\relfreq.ars neutrtst\ew_watt.arp disequil\ld_gen1.arp
neutrtst\ew_watt.ars disequil\ld_gen1.ars
freqncy\cohen.arp
disequil\ld_hap.arp
freqncy\cohen.ars
disequil\ ld_hap.ars

System libraries
owl501f.dll Dynamic link library installed in your system directory ä
bds501f.dll Dynamic link library installed in your system directory ä
cw3220.dll Dynamic link library installed in your system directory ä
Manual Arlequin ver 1.1 Introduction 12

1.9Arlequin limitations

The amount of data that Arlequin can handle mostly depends on the memory available on your computer.
However, a few parameters are limited to values within the range shown below.

Portions of Arlequin concerned Maximum

by the limitations Limited parameter value

All Number of population samples 1000

All Number of groups of populations 1000
Ewens-Watterson and Sample size 2000
Chakraborty’s neutrality tests
Ewens-Watterson and
Chakraborty’s neutrality tests Number of haplotypes 1000

1.10How to cite Arlequin

Stefan Schneider, Jean-Marc Kueffer, David Roessli, and Laurent Excoffier (1997) Arlequin ver. 1.1: A software
for population genetic data analysis. Genetics and Biometry Laboratory, University of Geneva, Switzerland.

1.11Acknowledgements

This program has been made possible by Swiss NSF grants No. 32-37821-93 and No 32.047053.96
Many thanks to:
André Langaney, Yannis Michalakis, Thierry Pun, Monty Slatkin, Peter Smouse, Alicia Sanchez-Mazas,
Isabelle Dupanloup, Giorgio Bertorelle, Michele Belledi, Evelyne Heyer, Erika Bucheli, Alex Widmer,
Philippe Jarne, Frédérique Viard, Peter de Knijff and all the beta-testers of Arlequin

1.12Bug report and comment s

Please report any bug through the bug report form available on
http://anthropologie.unige.ch/arlequin/bug-report.html
Other comments and suggestions will be also appreciated and can be communicated to us using the same web
page.

1.13How to get the last versio n of the Arlequin software?

Arlequin will be updated regularly and can be freely retrieved on

http://anthropologie.unige.ch/arlequin
Manual Arlequin ver 1.1 Introduction 13

1.14What is new in version 1. 1 compared to version 1.0

New features:
• Many bug corrections (see the list on our web site: http://anthropologie.unige.ch/arlequin/buglist.html).
• The input file is screened before being actually processed, removing unnecessary characters that lead to
some errors in the previous version.
• Search for shared haplotypes between populations.
• All results concerning the analysis of a specific project are now output into a separate directory having the
same name as the selected project, but with the [.res] extension.
• Implementation of an exact test of population differentiation, based on haplotype or genotype sample
frequencies.
• The results can now be translated in an HTML file and consulted in any web browser.
• The creation of new project outlines has been made easier by the use of a special dialog box.
• Tables of expected haplotype frequencies under the hypotheses of linkage equilibrium and Hardy-
Weinberg hypothesis are now included in the result file.
• The molecular diversity indices can now be calculated also for standard data.
• The matrix of pairwise distances used to compute the molecular diversity can optionally be printed in the
result file.
• The probability of the observed Tajima’s D value is calculated.
• It is now possible to import data from the GenePop version 3.0 format. In version 1.0, we considered only
Genepop version 1.0.
• The results of the permutation tests done in AMOVA are now given in three forms: P (rand < obs.), P
(rand = obs.) , P (rand ≤ obs.) for each statistic.
• The number of loci is now only limited by the available amount of memory. In version 1.0, the number of
loci was limited to 500. See 1.8 for more details.
• Harpending's raggedness index is now computed on relative counts instead of absolute counts.
• Hardy-Weinberg exact test is made impossible with recessive data, contrary to what was done in ver 1.0.

1.15Forthcoming developmen ts

n Improved user interface.

n Treatment of pure dominant data (RAPD, AFLP).
n Incorporation of additional population genetics methods.
Suggestions are welcome, but we only have one life...
n Development of a portable C++ version of Arlequin with a Java graphical interface, to allow its
deployment across different platforms.
Manual Arlequin ver 1.1 Introduction 14

1.16Remaining problem

Arlequin build-in text editor cannot handle more than 32 KB of text under Windows 95 or Win 3.1x. Therefore,
large files appears as if truncated. Under WinNT Arlequin windows can show the content of files of size up to 2
Mb, but it still cannot edit files larger than 32 kb.
Solution: Look at your result files with another text editor able to handle large data files. Even if the result file
appears truncated, it is not when you open it in a more capable text editor. If you have an HTML browser
(Netscape, Internet Explorer,...) installed on your machine, you can ask Arlequin to load the results into the
browser by selecting the menu item Window | View Results in HTML Browser. The first time you do this, you
are asked to locate the browser on your hard disk.
Manual Arlequin ver 1.1 Getting started 15

2GETTING STARTED

The first thing to do before running Arlequin for the first time is certainly to read the manual or consult the help
file. They will provide you with most of the information you are looking for. So, take some time to read them
before you seriously start analyzing your data.

2.1Preparing input files

The first step for the analysis of your data is to prepare an input data file for Arlequin. This input file is called
here a project file. As Arlequin is quite a versatile program able to analyze several data types, you have to
include some information about the properties of your data in the project file together with the raw data.
There are two ways to create Arlequin projects:
1) You can start from scratch and use a text editor to define your data using reserved keywords.
2) You can use Arlequin’s “Project Outline Wizard” by selecting the menu function Project | Build Project
Outline... . This calls a special dialog box where you can specify the type of project outline that should be
build. Once created, the project outline is loaded into Arlequin. The name of the target file should have a
"*.arp" extension (for ARlequin Project).

2.2Loading project files into Arlequin

Once the project file is built, you must load it into Arlequin. You can do this either by activating the menu
Project | Open, or by clicking on the Open project button on the toolbar. The Arlequin project files must have
the *.arp extension. If your project file is not valid, Arlequin will open the Arlequin Log file to help you pointing
out the problems. For each Arlequin session, Arlequin creates a log file called arlequin.log, where warnings and
error messages are issued. The log file also keeps track of all the operations performed during an Arlequin
session.
If your project file is valid, its main properties will be shown in the Project information window.
At this point, you just have to choose which analyses to perform on your data. The Project information window
can be visible or invisible by selecting the menu item Project | View Project Info.

2.3Selecting analyses to be p erformed on your data

The different analyses that can be performed on your data are selected using the launch pad dialog box. The
options of the different analyses are set using special dialog boxes accessible by clicking on appropriate toolbar
buttons, or by selecting the Setup menus. See the chapter on the description of the different dialog boxes.

2.4Creating and using Settin g Files

By settings we mean any alternative choice that can be made when using Arlequin. As you can choose different
types of analyses, as well as different options for each of these analyses, all these choices can be saved into
setting files. These files generally take the same name as the project files, but with the extension *.ars. Setting
files can be created at any time of your work by activating the menu Project | Settings | Save Settings.
Manual Arlequin ver 1.1 Getting started 16

Alternatively, if you activate the menu Project | Settings | Enable Save Settings on Close , the analyses and the
options that were validated when closing a project file will be automatically saved in a setting file. These setting
files are convenient when you want to repeat some analyses done previously, or when you want to make
different types of computations on several projects, as it is possible using batch files (see section 3.6) giving you
considerable flexibility on the analyses you can perform, and avoiding tedious and repetitive mouse-clicks.

2.5Performing the analyses

The selected analyses can be performed either by clicking on the Run button of the toolbar or by selecting the
Project | Run menu. If an error occurs in the course of the execution, Arlequin will write diagnostic
information in the log file. If the error is not too severe, Arlequin will open the log file for you. If there is a
memory error, Arlequin will shut down itself. In the latter case, you should consult the Arlequin log file before
launching a new analysis in order to get some information on where or at which stage of the execution the
problem occurred. The file Arlequin.log is located in Arlequin original directory.

2.6Stopping the computation s

The computations can be stopped at any time by pressing the Stop button on the toolbar. However, note that the
results may be incorrect if the computations did not terminate normally.
For very large project files, you may have to wait for a few seconds before the calculations are stopped.

2.7Consulting the results

When the calculations are over, Arlequin will create a result directory, which has the same name as the project
file, but with the *.res extension. This directory contains all the result files, particularly the main result file
with the same name as the project file, but with the *.arf extension. The main result file is viewed in Arlequin’s
build-in editor.
Caution: If the result file is larger than 32,000 bytes, the file may appear as truncated under Win 95 or Win
3.1x. In this case you should close the result file window without saving it and open the relevant *. arf file with
a text editor allowing to view large files.
If you have an HTML browser (Netscape, Internet Explorer,...) installed on your machine, you can ask
Arlequin to load the results into the browser, either by selecting the menu item Window | View Results in
HTML Browser, or by pressing the corresponding button on the toolbar.
Manual Arlequin ver 1.1 Input files 17

3INPUT FILES

3.1Format of Arlequin inpu t files

Arlequin input files are also called project files. The project files contain both descriptions of the properties
of the data, as well as the raw data themselves. The project file may also refer to one or more external data
files.
Note that comments beginning by a "#" character can be put anywhere in the Arlequin project file.
Everything that follows the "#"character will be ignored until an end of line character.

3.2Project file structure

Input files are structured into two main sections with additional subsections that must appear in the following
order:
1) Profile section (mandatory)
2) Data section (mandatory)
2a) Haplotype list (optional)
2b) Distance matrix (optional)
2c) Samples (mandatory)
2d) Genetic structure (optional)
We now describe the content of each (sub-) section in more detail.

3.2.1Profile section
The properties of the data must be described in this section. The beginning of the profile section is indicated by
the keyword [Profile] (within brackets).
One must also specify

• The title of the current project (used to describe the current analysis)
Notation: Title=
Possible value: Any string of characters within double quotes

Example: Title="An analysis of haplotype frequencies in 2 populations"

• The number of samples or populations present in the current project

Notation: NbSamples =
Possible values: Any integer number between 1 and 1000.

Example: NbSamples =3

• The type of data to be analyzed. Only one type of data is allowed per project
Notation: DataType =
Possible values: DNA, RFLP, MICROSAT, STANDARD and FREQUENCY

Example: DataType = DNA

Manual Arlequin ver 1.1 Input files 18

• If the current project deals with haplotypic or genotypic data

Notation: GenotypicData =
Possible values: 0 (haplotypic data), 1 (genotypic data)

Example: GenotypicData = 0

One can also optionally specify

• The character used to separate the alleles at different loci (the locus separator)
Notation: LocusSeparator =
Possible values: WHITESPACE, TAB, NONE, or any character other than "#", or the character
specifying missing data.

Example: LocusSeparator = TAB

Default value: WHITESPACE

• If the gametic phase of genotypes is known

Notation: GameticPhase =
Possible values: 0 (gametic phase not known), 1 (known gametic phase)

Example: GameticPhase = 1

Default value: 1

• If the genotypic data present a recessive allele

Notation: RecessiveData =
Possible values: 0 (co-dominant data), 1 (recessive data)

Example: RecessiveData =1

Default value: 0

• The code for the recessive allele

Notation: RecessiveAllele =
Possible values: Any string of characters within double quotes. This string can be explicitly used in the
input file to indicate the occurrence of a recessive homozygote at one or several loci.

Example: RecessiveAllele ="xxx"

Default value: "null"

• The character used to code for missing data

Notation: MissingData =
Possible values: A character used to specify the code for missing data, entered between single or double
quotes.

Example: MissingData =’$’

Default value: ’?’

• If haplotype or phenotype frequencies are entered as absolute or relative values

Notation: Frequency =
Manual Arlequin ver 1.1 Input files 19

Possible values: ABS (absolute values), REL (relative values: absolute values will be found by
multiplying the relative frequencies by the sample sizes)

Example: Frequency = ABS

Default value: ABS

• If a distance matrix needs to be computed from the original data, when calculating genetic structure
indices
Notation: CompDistMatrix =
Possible values: 0 (use the distance matrix specified in the DistanceMatrix sub-section), 1 (compute
distance matrix from haplotypic information)

Example: CompDistMatrix = 1

Default value: 0

• The number of significant digits for haplotype frequency outputs

Notation: FrequencyThreshold =
Possible values: A real number between 1e-2 and 1e-7

Example: FrequencyThreshold = 0.00001

Default value: 1e-5

• The convergence criterion for the EM algorithm used to estimate haplotype frequencies and linkage
disequilibrium from genotypic data
Notation: EpsilonValue =
Possible values: A real number between 1e-7 and 1e-12.

Example: EpsilonValue = 1e-10

Default value: 1e-7

3.2.2Data section
This section contains the raw data to be analyzed. The beginning of the profile section is indicated by the
keyword [Data] (within brackets).
It contains several sub-sections:

3.2.2.1Haplotype list (optional)

In this sub-section, one can define a list of the haplotypes that are used for all samples. This section is most
useful in order to avoid repeating the allelic content of the haplotypes present in the samples. For instance, it
can be tedious to write a full sequence of several hundreds of nucleotides next to each haplotype in each
sample. It is much easier to assign an identifier to a given DNA sequence in the haplotype list, and then use this
identifier in the sample data section. This way Arlequin will know exactly the DNA sequences associated to
each haplotype.
However, this section is optional. The haplotypes can be fully defined in the sample data section.
Manual Arlequin ver 1.1 Input files 20

An identifier and a combination of alleles at different loci (one or more) describe a given haplotype. The locus
separator defined in the profile section must separate each adjacent allele from each other.
It is also possible to have the definition of the haplotypes in an external file. Use the keyword EXTERN
followed by the name of the file containing the definition of the haplotypes. Read Example 2 to see how to
proceed. If the file "hapl_file.hap" contains exactly what is between the braces of Example 1, the two
haplotype lists are equivalent.
Example 1:
[[HaplotypeDefinition]] #start the section of Haplotype definition
HaplListName="list1" #give any name you whish to this list
HaplList={
h1 A T #on each line, the name of the haplotype is
h2 G C # followed by its definition.
h3 A G
h4 A A
h5 G G
}
Example 2:
[[HaplotypeDefinition]] #start the section of Haplotype definition
HaplListName="list1" #give any name you whish to this list
HaplList = EXTERN "hapl_file.hap"

3.2.2.2Distance matrix (optional )

Here, a matrix of genetic distances between haplotypes can be specified. This section is here to provide some
compatibility with earlier WINAMOVA files. The distance matrix must be a lower diagonal with zeroes on the
diagonal. This distance matrix will be used to compute the genetic structure specified in the genetic structure
section. As specified in AMOVA, the elements of the matrix should be squared Euclidean distances. In
practice, they are an evaluation of the number of mutational steps between pairs of haplotypes.
One also has to provide the labels of the haplotypes for which the distances are computed. The order of these
labels must correspond to the order of rows and columns of the distance matrix. If a haplotype list is also
provided in the project, the labels and their order should be the same as those given for the haplotype list.
Usually, it will be much more convenient to let Arlequin compute the distance matrix by itself.
It is also possible to have the definition of the distance matrix given in an external file. Use the keyword
EXTERN followed by the name of the file containing the definition of the matrix. Read Example 2 to see how
to proceed.
Example 1:
[[DistanceMatrix]] #start the distance matrix definition section
MatrixName= "none" # name of the distance matrix
MatrixSize= 4 # size = number of lines of the distance matrix
MatrixData={
h1 h2 h3 h4 # labels of the distance matrix (identifier of the
0.00000 # haplotypes)
2.00000 0.00000
1.00000 2.00000 0.00000
Manual Arlequin ver 1.1 Input files 21

1.00000 2.00000 1.00000 0.00000

}

Example2:
[[DistanceMatrix]] #start the distance matrix definition section
MatrixName= "none" # name of the distance matrix
MatrixSize= 4 # size = number of lines of the distance matrix
MatrixData= EXTERN "mat_file.dis"

3.2.2.3Samples
In this obligatory sub-section, one defines the haplotypic or genotypic content of the different samples to be
analyzed.
Each sample definition begins by the keyword SampleName and ends after a SampleData has been defined.
One must specify:

• A name for each sample

Notation: SampleName =
Possible values: Any string of characters within quotes.

Example: SampleName= "A first example of a sample name"

Note: This name will be used in the Structure sub-section to identify the different samples, which are
part of a given genetic structure to test.

• The size of the sample

Notation: SampleSize =
Possible values: Any integer value.

Example: SampleSize=732

Note: For haplotypic data, the sample size is equal to the haploid sample size. For genotypic data, the
sample size should be equal to the number of diploid individuals present in the sample. When
absolute frequencies are entered, the size of each sample will be checked against the sum of all
haplotypic frequencies will check. If a discrepancy is found, a Warning message is issued in the
log file, and the sample size is set to the sum of haplotype frequencies. When relative frequencies
are specified, no such check is possible, and the sample size is used to convert relative
frequencies to absolute frequencies.

• The data itself

Notation: SampleData =
Possible values: A list of haplotypes or genotypes and their frequencies as found in the sample, entered
within braces
Example:
SampleData={
id1 1 ACGGTGTCGA
id2 2 ACGGTGTCAG
id3 8 ACGGTGCCAA
Manual Arlequin ver 1.1 Input files 22

id4 10 ACAGTGTCAA
id5 1 GCGGTGTCAA
}
Note: The last closing brace marks the end of the sample definition. A new sample definition begins
with another keyword SampleName.
FREQUENCY data type:
If the data type is set to FREQUENCY, one must only specify for each haplotype its identifier (a string
of characters without blanks) and its sample frequency (either relative or absolute). In this case the
haplotype should not be defined.
Example:
SampleData={
id1 1
id2 2
id3 8
id4 10
id5 1
}

Haplotypic data
For all data types except FREQUENCY, one must specify for each haplotype its identifier and its sample
frequency. If no haplotype list has been defined earlier, one must also define here the allelic content of the
haplotype. The haplotype identifier is used to establish a link between the haplotype and its allelic content
maintained in a local database.
Once a haplotype has been defined, it needs not be defined again. However the allelic content of the same
haplotype can also be defined several times. The different definitions of haplotypes with same identifier are
checked for equality. If they are found identical, a warning is issued is the log file. If they are found to be
different at some loci, an error is issued and the program stops, asking you to correct the error.
For complex haplotypes like very long DNA sequences, one can perfectly assign different identifiers to all
sequences (each having thus an absolute frequency of 1), even if some sequences turn out to be similar to each
other. If the option Infer Haplotypes from Distance Matrix is checked in the General Settings dialog box,
Arlequin will check whether haplotypes are effectively different or not. This is a good precaution when one
tests the selective neutrality of the sample using Ewens-Watterson or Chakraborty’s tests, because these tests
are based on the observed number of effectively different haplotypes.

Genotypic data
For each genotype, one must specify its identifier, its sample frequency, and its allelic content. Genotypic data
can be entered either as a list of individuals, all having an absolute frequency of 1, or as a list of genotypes with
different sample frequencies. During the computations, Arlequin will compare all genotypes to all others and
recompute the genotype frequencies.
The allelic content of a genotype is entered on two separate lines in the form of two pseudo-haplotypes.
Examples:
Manual Arlequin ver 1.1 Input files 23

1):

Id1 2 ACTCGGGTTCGCGCGC # the first pseudo-haplotype

ACTCGGGCTCACGCGC # the second pseudo-haplotype
2)
my_id 4 0 0 1 1 0 1
0 1 0 0 1 1
If the gametic phase is supposed to be known, the pseudo-haplotypes are treated as truly defined
haplotypes.
If the gametic phase is not supposed to be known, only the allelic content of each locus is supposed to
be known. In this case an equivalent definition of the upper phenotype would have been:
my_id 4 0 1 1 0 0 1
0 0 0 1 1 1

3.2.2.4Genetic structure
The hierarchical genetic structure of the samples is specified in this optional sub-section. It is possible to define
groups of populations. This subsection starts with the keyword [[Structure]]. The definition of a genetic
structure is only required for AMOVA analyses.
One must specify:

• A name for the genetic structure

Notation: StructureName =
Possible values: Any string of characters within quotes.

Example: StructureName= "A first example of a genetic structure"

Note: This name will be used to refer to the tested structure in the output files.

• The number of groups defined in the structure

Notation: NbGroups =
Possible values: Any integer value.

Example: NbGroups = 5

Note: If this value does not correspond to the number of defined groups, then calculations will not be
possible, and an error message will be displayed.

• If we add the individual level in the variance analysis

Notation: IndividualLevel =
Possible values: 0 (no) or 1 (yes)

Example: IndividualLevel = 0

Note: Default value: 0. The value 1 is only possible with genotypic data.

• The group definitions

Notation: Group =
Manual Arlequin ver 1.1 Input files 24

Possible values: A list containing the names of the samples belonging to the group, entered within
braces. Repeat this for as many groups you have in your structure. It is of course not
allowed to put the same population in different groups.
Example ( NbGroups=2 ) :
Group ={
population1
population2
population3
}
Group ={
population4
population5
}

3.3Eexample of an input file

The following small example is a project file containing four populations. The data type is STANDARD
genotypic data with unknown gametic phase.

[Profile]
Title="Fake HLA data"
NbSamples=4
GenotypicData=1
GameticPhase=0
DataType=STANDARD
LocusSeparator=WHITESPACE
MissingData=’?’

[Data]

[[Samples]]
SampleName="A sample of 6 Algerians"
SampleSize=6
SampleData={
1 1 1104 0200
0700 0301
3 3 0302 0200
1310 0402
4 2 0402 0602
1502 0602
}
SampleName="A sample of 11 Bulgarians"
SampleSize=11
SampleData={
1 1 1103 0301
0301 0200
2 4 1101 0301
0700 0200
3 1 1500 0502
0301 0200
4 1 1103 0301
1202 0301
5 1 0301 0200
1500 0601
6 3 1600 0502
Manual Arlequin ver 1.1 Input files 25

1301 0603
}
SampleName="A sample of 12 Egyptians"
SampleSize=12
SampleData={
1 2 1104 0301
1600 0502
3 1 1303 0301
1101 0502
4 3 1502 0601
1500 0602
6 1 1101 0301
1101 0301
8 4 1302 0502
1101 0609
9 1 1500 0302
0402 0602
}
SampleName="A sample of 8 French"
SampleSize=8
SampleData={
219 1 0301 0200
0101 0501
239 2 0301 0200
0301 0200
249 1 1302 0604
1500 0602
250 3 1401 0503
1301 0603
254 1 1302 0604
}

[[Structure]]

StructureName="My population structure"

NbGroups=2
Group={
"A sample of 6 Algerians"
"A sample of 12 Egyptians"
}
Group={
"A sample of 11 Bulgarians"
"A sample of 8 French"
}

3.4Automatically creating th e outline of a project file

In order to help you setting up quickly a project file, Arlequin can create the outline of a project file for you.
In order to do this, use the Project outline wizard dialog box by activating the Project | Build Project Outline
menu. A special dialog box will appear, allowing to quickly define which type of data you have and some
specificities of the data.
• Data file
Specify the name of the target file (the new Arlequin project). It should have the extension “.arp”.
• Data type
Specify which type of data you want to analyze (DNA, RFLP, Microsat, Standard, or Frequency).
Specify if the data is under genotypic or haplotypic form.
Manual Arlequin ver 1.1 Input files 26

Specify if the gametic phase is known (for genotypic data only).

Specify if there are recessive alleles (for genotypic data only)
• Controls
Specify the number of population samples defined in the project
Choose a locus separator
Specify the character coding for missing data
Specify the code for the recessive allele
• Optional sections
Specify if you want to include a global list of haplotypes
Specify if you want to include a predefined distance matrix
Specify if you want to include a group structure
By pressing the OK button, an empty outline of a project file will be created for you. It will be automatically
loaded in Arlequin, and you can then paste your sample data.
Note that if you have large amount so f data, you should note use Arlequin text editor, due to its inability to
handle large data files

3.5Conversion of data files

By selecting the menu File | File Conversions, it is possible to translate data files from one format to the other.
This might be useful for users already having data files set up for other data software packages. It is also possible
to convert Arlequin data files into other formats.
The currently recognized data formats are:
• Arlequin ver. 1.1
• Gene Pop ver. 3.0,
• Biosys ver.1.0,
• Phylip ver. 3.5
• Mega ver. 1.0
• Win Amova ver. 1.55.
The translation procedure is simple:
1. Select your source file with the upper left Browse button.
2. Select the format of the source data file, as well as that of the target file.
3. A default name is automatically given to the target file, but you can change the target file name with the
upper right Browse button, or directly edit its name in the edit field.
4. The file conversion is started by pressing on the central button “>>>>”.
5. In some cases, you might be asked for some additional information, for instance if input data is
fractionated in several input files (like in WinAmova).
These conversion routines were done on the basis of the description of the input file format found in the user
manuals of each of aforementioned programs. The tests done with the example files given with these programs
worked fine. However, the original reading procedures of the other software packages may be more tolerant than
our owns, and some data may be impossible to convert. Thus, some small corrections will need to be done by
hand, and we apologize for that.
Manual Arlequin ver 1.1 Input files 27

3.6Arlequin batch files

A large number of data files can be analyzed one after the other using batch files.
A batch file (having usually the .arb extension) is simply a text file having on each line the name of the project
file that should be analyzed. The number of data files to be analyzed can be arbitrary large.
By selecting the menu item Project | Run batch file..., you open a dialog box that allows you to set up the
parameters for running your batch file.
You can either use the same options for all project files by selecting Use identical settings for all projects, or use
the setting file associated with each project file by selecting Use associated settings for each project. In the first
case, the same analyses will be performed on all project files listed in the batch file. In the second case, you can
perform different computations on each project file listed in the batch file, giving you much more flexibility on
what should be done. However, it implies that setting files have been prepared previously, recording the analyses
needing to be performed on the data, as well as the options of these analyses.
If the associated project file does not exist, the current settings are used.
Note that the batch file, the project files, and the setting files should all be in the same folder.
Manual Arlequin ver 1.1 Output files 28

4OUTPUT FILES

The output files are now all located in a special sub-directory, having the same name as your project, but with
the ".res" extension. This has been done to structure your result files according to different projects. For instance,
if your project file is called my_file.arp, then the result files will be in a sub-directory called [my_file.res]

4.1Result file

The file containing all the results of the analyses just performed. By default, it has the same name than the
Arlequin input file, with the extension (.arf) for Arlequin Result File. This file is opened in a text window at the
end of each run.
If the option Project | Output Files | Append Results is checked, the results of the current computations are
appended to the one of previous calculations, otherwise the results of previous analyses are erased, and only the
last results are overwritten in the result file.

4.2View your results in HTM L browser

For very large result files or result files containing the product of several analyses, it may be of practical interest
to view the results in an HTML browser. This can be simply done by activating the menu Window | View Results
in HTML Browser. This will trigger a translation of your result file (.arf) into html formatted files. These files
will then be loaded into your Internet browser. The first time you use this option, you are asked to locate the
browser on your hard disk. This can be done through the General Settings dialog box (see section 6.4.1). The
location of your browser is then stored in arlequin.ini.
It is also possible to have an automatic generation of the result files in HTML format by checking the option
Project | Output Files | Generate HTML Result File. This might be useful when running a batch file.
In the web browser, the main window is divided in three panes.
1. The upper pane lists all runs that have been output in the result file.
2. The lower left pane lists the inter-population analyses (Genetic structure, Shared haplotypes) or the
population samples that have been analyzed in the run selected in the upper pane.
3. The lower right pane, shows the results concerning the selected item in the lower left pane.
The results can be consulted in html form, once they have been created, even when Arlequin is not active. The
relevant files (*.htm) are located in the result sub-directory of your project, together with the conventional result
files (*.arf). There are several html files in this directory, but you should only load the file having the same name
as your project, but with the .htm extension. The other html files are called from this master file.

4.3Arlequin Log file

A file where run-time WARNINGS and ERRORS encountered during any phases of the current Arlequin session
are issued. By default, the file has the name Arlequin.log. You should consult this file if you observe any
warning or error message in your result file. If Arlequin has crashed then consult Arlequin.log before running
Manual Arlequin ver 1.1 Output files 29

Arlequin again. It will probably help you in finding where the problem was located. The content of Arlequin.log
can be emptied in the Special | Empty Log file menu of the main window.

4.4Back-up file

The name of a back-up file build from the data read in the input file. By default, it has the same name than the
Arlequin input file, with the extension (.bac). It also allows you to check if your data have been read properly.

4.5Linkage Disequilibrium R esult File

This file contains the results of pairwise linkage disequilibrium tests between all pairs of loci. By default, it has
the name LK_DIS.XL. As suggested by its extension, this file can be read with MS-Excel without modification.
A tabulator separates the columns.

4.6Variance components nu ll distribution histograms

Specifies the name of an output file where the histograms of the variance component null distributions are
output. By default, the name is set to AMO_HIST.XL. This tabulated text file can be read directly by MS-Excel,
for a graphical output of the distributions.
All values of the permuted statistics are found in files, having the same name as the project file, with *.va, *.vb,

*.vc and *.vd for σ a2 , σ b2 , σ c2 , and σ d2 , respectively.

Manual Arlequin ver 1.1 Examples of input files 30

5EXAMPLES OF INPUT FILE S

5.1Example of allele frequen cy data

The following example is a file containing FREQUENCY data. The allelic composition of the individuals is not
specified. The only information we have are the frequencies of the alleles.
[Profile]
Title="Frequency data"
NbSamples=2
GenotypicData=0
DataType=FREQUENCY
[Data]
[[Samples]]
SampleName="Population 1"
SampleSize=16
SampleData= {
000 1
001 3
002 1
003 7
004 4
}
SampleName="Population 2"
SampleSize=23
SampleData= {
000 3
001 6
002 2
003 8
004 4
}

5.2Example of standard data (Genotypic data, unknown gametic phase, recessive alleles)

[Profile]
Title="Genotypic Data, Phase Unknown, 5 HLA loci"
NbSamples=1
GenotypicData=0
DataType=STANDARD
LocusSeparator=WHITESPACE
MissingData=’?’
GameticPhase=0
RecessiveData=1
RecessiveAllele="xxx"
FrequencyThreshold=0.00001
EpsilonValue=0.000000001
[Data]
[[Samples]]
SampleName="Population 1"
SampleSize=63
SampleData={
MAN0102 12 A33 Cw10 B70 DR1304 DQ0301
A33 Cw10 B7801 DR1304 DQ0302
MAN0103 22 A33 Cw10 B70 DR1301 DQ0301
A33 Cw10 B7801 DR1302 DQ0501
MAN0108 23 A23 Cw6 B35 DR1102 DQ0301
A29 Cw7 B57 DR1104 DQ0602
Manual Arlequin ver 1.1 Examples of input files 31

MAN0109 6 A30 Cw4 B35 DR0801 xxx

A68 Cw4 B35 DR0801 xxx
}

5.3Example of DNA sequen ce data (Haplotypic)

[Profile]
Title="An example of DNA sequence data"
NbSamples=3
GenotypicData=0
DataType=DNA
LocusSeparator=NONE
[Data]
[[Samples]]
SampleName="Population 1"
SampleSize=6
SampleData= {
000 3 GACTCTCTACGTAGCATCCGATGACGATA
001 1 GACTGTCTGCGTAGCATACGACGACGATA
002 2 GCCTGTCTGCGTAGCATAGGATGACGATA
}
SampleName="Population 2"
SampleSize=8
SampleData= {
000 1 GACTCTCTACGTAGCATACGATGACGATA
001 1 GACTGTCTGCGTAGCATACGATGACGATA
002 1 GCCTGTCTGCGTAGCATACGATGACGATA
003 1 GCCTGTCTGCCTAGCATACGATCACGATA
004 1 GCCTGTCTGCGTACCATACGATGACGATA
005 1 GCCTGTCCGCGTAGCGTACGATGACGATA
006 1 GCCCGTGTGCGTAGCATACGATGGCGATA
007 1 GCCTGTCTGCGTAGCATGCGACGACGATA
}
SampleName="Population 3"
SampleSize=6
SampleData= {
023 1 GCCTGTCTGCGTAGCATACGATGACGGTA
024 1 GCCTGTCTGCGTAGCGTACGATGACGATA
025 1 GCCTGTCTGCGTAGCATACGATGACGATA
026 1 GCCTGTCCGCGTAGCATACGGTGACGGTA
027 1 GCCTGTCTGCGTGGCATACGATGACGATG
028 1 GCCTGTCTGCGTAGCATACGATGACGATA
}
Manual Arlequin ver 1.1 Examples of input files 32

5.4Example of microsatellite data (Genotypic)

[Profile]
Title="A small example of microsatellite data"
NbSamples=4
GenotypicData=1
DataType=MICROSAT
LocusSeparator=WHITESPACE
CompDistMatrix=1
[Data]
[[Samples]]
SampleName="MICR1"
SampleSize=28
SampleData= {
1 27 12 23
13 22
40 1 15 22
13 22
}
SampleName="MICR2"
SampleSize=59
SampleData= {
1 37 12 24
12 22
17 1 15 20
13 22
6 21 14 22
14 23
}
SampleName="MICR3"
SampleSize=30
SampleData= {
1 17 12 21
13 22
10 1 12 20
13 23
6 12 10 22
12 22
}
SampleName="MICR4"
SampleSize=16
SampleData= {
1 15 13 24
13 23
9 1 12 24
13 23
}
[[Structure]]
StructureName="Test microsat structure"
NbGroups=2
IndividualLevel=0
Group={
"MICR1"
"MICR2"
}
Group={
"MICR3"
"MICR4"
}
Manual Arlequin ver 1.1 Examples of input files 33

5.5Example of RFLP data(H aplotypic)

[Profile]
Title="A small example of RFLP data: 3 populations"
NbSamples=3
GenotypicData=0
DataType=RFLP
LocusSeparator=WHITESPACE
CompDistMatrix=1
MissingData=’?’
[Data]
[[HaplotypeDefinition]]
HaplListName="A fictive list of RFLP haplotypes"
HaplList= {
1 000011100111010011011001001011001101110100101101100
2 100011100111010011011001001011001101110100101100100
6 000011100111010010011001001011001101110100101101100
7 100011100111010011011001001011001101110100101101100
8 000011100111010011011001001001001101110100101101100
11 000001100111011011011001001011001101110100101111100
12 000011100111010011011001101011001101110100101101100
17 000011100111010011011001001011001100110100101101100
22 000011100111011011011001001011001101110100101100100
36 000011100111010011011001001010001100110100101101100
37 000011100111011011011001001111001101110100101100100
38 000111100111010011011001001011001101110100101101100
40 000011100111000011011001001011001101110100101101100
47 000011100111010011011001001011001101110100101100100
139 000011100111010011011001001011001111110100101001110
140 000011100111010011011001001011001101110100101100101
141 000011100111010010011001000011001101110100101100100
}
[[Samples]]
#1
SampleName="pop 1"
SampleSize=28
SampleData= {
1 27
40 1
}
#2
SampleName="pop 2"
SampleSize=75
SampleData= {
1 37
17 1
6 21
7 1
2 1
22 5
11 2
36 1
139 1
47 1
140 1
141 1
37 1
38 1
}
#3
Manual Arlequin ver 1.1 Examples of input files 34

SampleName="pop 3"
SampleSize=48
SampleData= {
1 46
8 1
12 1
}
[[Structure]]
StructureName="A single group of 3 samples"
NbGroups=1
Group={
"pop 1"
"pop 2"
"pop 3"
}

5.6Example of standard data (Genotypic data, known gametic phase)

[Profile]
Title="An example of Genotypic data with known Gametic phase"
NbSamples=3
GenotypicData=1
GameticPhase=1
RecessiveData=0
DataType=STANDARD
LocusSeparator=WHITESPACE
[Data]
[[Samples]]
SampleName="pop1"
SampleSize=20
SampleData= {
1 4 A D
B C
3 5 A B
A A
5 3 B B
B A
7 8 D C
D C
}
SampleName="pop2"
SampleSize=10
SampleData= {
8 5 A C
C B
9 5 B C
D B
}
SampleName="pop3"
SampleSize=15
SampleData= {
10 3 A D
C A
4 12 A C
B B
}
Manual Arlequin ver 1.1 Arlequin interface 35

6ARLEQUIN INTERFACE

6.1Menus

6.1.1File Menu
The menu by which you manipulate files input and output.

n New Open an empty text edit window. You can then save the content of the
active window with File | save as...
n Open Open the selected file in Arlequin’s text editor. You can then save any
modification with File | save.
Note that the file is just opened in text edit mode. To open it as a project,
and to make some analyses on it, use Project | Open…
n Close Close the active text edit window.

n Files conversions... This starts a dialog box that allows conversion between several formats.
This is useful if you wish to convert data file used by other genetic data
analysis programs into the Arlequin format.
n Save Save the content of the active text edit window with the current file
name.
n Save As... Save the content of the active window in a file

n Exit Exit Arlequin

6.1.2Edit Menu
A menu to access standard Edit command that can be performed on a text in a child window

n Undo Undo the last edit action.

n Cut Cut the highlighted text and put it into the clipboard.
n Copy Copy the highlighted text into the clipboard.
n Paste Paste the content of the clipboard.
n Clear All Delete the whole content of the active child window.
n Delete Delete the highlighted text without copying it into the clipboard.
n Find Find a given text string in the active child window.
n Replace Replace a given text string with another one in the active child window.
n Next Repeat the last Find action.

6.1.3Project Menu
The menu that contains functions related to the manipulations of the project.
n Run Run the current project file with the chosen settings. The progress of the
calculation is displayed on the bottom status line of Arlequin’s window.
n Stop Stop the current run. For very large data files, the user might have to wait
a little time before the program reacts. The results may be unreliable
Manual Arlequin ver 1.1 Arlequin interface 36

after an abnormal termination.

n Open Allow the opening and the loading of a project file. It can be edited by
selecting View Project File. Some information appears in the Project
information window, if the data file is valid. If the data file contains
some errors, Arlequin’s log file will be opened.
The dialog box that allows the project selection contains a history of the
last ten selected projects. To open a new one, use the button browse.
Clear list empties the list of recently selected projects. To open a listed
project, highlight it in the list and press the open button, or simply
double-click on it.
n Close Close the project file.
n Load settings Load a setting file. The setting files have usually the .ars extension. We
recommend creating these setting files by using the Save Settings
function. Only user familiar with Arlequin should try to create or modify
these files with the text editor.
By loading a setting file, you will lose the settings that have been set up
before. If you do not want to lose them you can save them with Save
Settings under a different name.
n Save settings Save the current settings in a file, such as to be able to recall them for a
later run.
n Restore Default Reset all settings to original default values.
Settings
n Enable Use of If this menu item is checked, Arlequin looks for a setting file having the
Associated Settings same name as the project file, but with the .ars extension, when a project
is loaded. This associated setting file should be in the same folder as the
project file.
Whether an associated setting file exists and whether it is used or not, is
indicated in the project information window.
n Enable Save Settings If this menu item is checked, the actual settings are saved when you
on Close close the project or open a new one. The settings are saved in a file
having the same name as the project file, but with the .ars extension.
n Run Batch File Run a series of Arlequin projects listed in a batch file. All projects will
be executed one after the other with the current settings or with the
settings specified in the associated setting files.
n Build Project Outline Build the outline of a project file. You have to customize it to make it a
valid project file. This is useful when creating new project files. The
outline will be saved under the name you specify (the extension .arp is
required).
n View Project Info If this menu item is checked, the project information window is visible,
otherwise it is invisible.
n Output files A sub-menu for the specification of the format of output files.
n Append results If this menu item is checked, the results of the actual computations are
appended to those of previous computations done on this project. If it is
unchecked, you will loose results of previous computations because the
result file will only contain the results of the last run.
n Generate DM file If this menu item is checked, the inter-haplotypic distance matrix that
might be computed (DM_out.txt) is not deleted, when you close the
project. If you need this matrix for other computations (like phylogenetic
reconstruction-programs), you should check this option.
Manual Arlequin ver 1.1 Arlequin interface 37

n Keep Null If this option is checked, the null distributions of σ a2 , σ b2 , σ c2 , and

Distributions
σ d2 generated by an Amova analysis are written in files having the same
name as the project file, but with the extensions .va, .vb, .vc, and .vd,
respectively.
n Generate Backup File If this option is checked, a file having the project file name with the .bac
extension is generated before the project is closed. This backup file
contains the data of the original data file in a standardized format.
n Generate HTML If this option is checked, the results will be output in a series of HTML
result File files that can be consulted in any web browser. The results of different
runs can be accessed by dynamic links in separate pane windows of the
browser.

6.1.4Setup Menu
Set up the different dialog boxes. The dialog boxes allow one to choose which tasks to perform on the data, and
to set up the options for each task. The dialog boxes are described in detail in paragraph 5 of this chapter.
n General Settings Opens the dialog box that contains the general settings. This dialog box
is described in detail in section 6.4.1.
n Diversity Indices Open the dialog box that sets up the parameters for standard indices,
molecular diversity, mismatch distribution, haplotype frequency
estimation and search for shared haplotypes between populations. This
dialog box is described in detail in section 6.4.2.
n Neutrality Tests Open the dialog box that sets up the parameters for selective neutrality
tests. This dialog box is described in detail in section 6.4.3.
n Tests of Open the dialog box that sets up the parameters for linkage
Disequilibrium disequilibrium test and Hardy-Weinberg equilibrium test. This dialog
box is described in detail in section 6.4.4.
n Genetic Structure Open the dialog box that sets up the parameters for AMOVA, pairwise
genetic distances and exact test of population differentiation. This dialog
box is described in detail in section 6.4.5.
n Launch Pad Give an overview of the selected tasks. This dialog box is described in
detail in section 6.4.6.

6.1.5Special Menu
A menu to perform some special actions
n Restore Tool Pad By tearing off the tool pad, the user might close it by inadvertence.
Selecting this option restores it at its original position.
n Empty Log File Empty the content of Arlequin’s log-file. This can be useful if you have
done several successive runs, and you want to trace more easily the
cause of some problems during the execution of a specific run

6.1.6Window Menu
The menu for handling windows and opening files related to the current project
n View Project File Open a window with the current active project file.
n View Result file Open a new window with the results of the last project run.
n View Results in This function translates the result file into HTML files that are then
Manual Arlequin ver 1.1 Arlequin interface 38

HTML Browser loaded in the internet web browser installed on your computer. The first
time you use this option, you are asked to locate the browser on your
hard disk. The location is then stored into Arlequin.ini.
n View Log file Open a window with the content of Arlequin.log, where Arlequin outputs
warnings and error messages.
n View Distance If a distance matrix is computed, it is possible to view it in an edit
Matrix window. If the file is too large, you can view the file DM_out.txt
containing the distance matrix in a more capable text editor. If no matrix
was calculated during the run, this item appears grayed.
n View group If the project file contains a genetic structure, it can be viewed by
Structure selecting this function. However to modify the genetic structure, you
have to edit the project file itself.
n Refresh Refresh the content of the project information window. Use it when for
some reason the content is not readable.
n Cascade Cascade child windows.
n Tile Tile child windows.
n Arrange Icon Arrange Child window icons.
n Close All Close all child windows.

6.1.7Help Menu
The menu to get access to the Help File System

n Content Open Arlequin Help File Welcome subject.

n Arlequin Overview Open Arlequin Help File Overview subject. It gives you an overview of
Arlequin look and functionalities.
n About Some information about Arlequin, its authors, contact address and the
Swiss NSF grants that supported its development.

6.2Toolbar

Arlequin’s toolbar contains icons that are shortcuts to some commonly used menu items as shown below.
Clicking on one of these icons is equivalent to activating the corresponding menu item.

File Open View Result file Diversity Indices Launch Pad

Project Open View Log file Neutrality Tests Project Run

File New View Project file General Settings Genetic Structure

File Save View results in Tests of Project Stop

HTML browser disequilibrium
Manual Arlequin ver 1.1 Arlequin interface 39

6.3Status Bar

A status bar is located at the bottom of the Arlequin program window. It issues brief information messages, or
the progress of the computations, when the pointing device is located on Arlequin pane window.

6.4Dialog boxes

Most of the tasks that Arlequin can perform are possible irrespective of the data type. Nevertheless, the testing
procedure that might be used for performing a given task (e.g. testing linkage disequilibrium) may depend on the
data type. The aim of this section is to give an overview of what happens in which situation and how to set up
the numerous options in an optimal way.
The items that appear «grayed» in Arlequin’s dialog boxes indicate that a given task is not possible in the current
situation. For example, if you open a project containing haplotypic data, it is not possible to test Hardy-Weinberg
equilibrium, and the task will appear as «grayed» in the dialog box. Or, for STANDARD data it is not possible to
set up the transversion, transition, and deletion weights.
The way inter-haplotypic distances are calculated depends also on the data type. According to the situation,
different lists of distance methods are presented in the dialog box.
Arlequin’s interactive graphical user interface should prevent the user from selecting tasks impossible to
perform, or from setting up parameters that are not taken into account in the analyses.
We do now describe in detail the six main dialog boxes that allow to select the options of the different possible
analyses.
We have used the following symbols to specify which type of input was expected in the dialog boxes:
[f] : parameter to be set in the dialog box as a floating number.
[i] : parameter to be set in the dialog box as an integer.
[b] : check box (two states: checked or unchecked).
[m] : multiple selection radio buttons.
[l] : List box, allowing the selection of an item in a downward scrolling list.
[r] : read only setting, cannot be changed by the user.

6.4.1General Settings
With this dialog box, the user can visualize some features of the data defined in the project file, and set up some
additional general parameters

• Project file [r]: The name of the file containing the data to be analyzed.

• Output files: The files containing the results of the analyses generated by Arlequin.
n Main result file [r]: The file containing all the results of the analyses just performed. It has the same
name as the project file, with the extension (.arf) for Arlequin Result File. This file is opened in a text
window at the end of each run.
n Backup file [r]: The name of a back-up file built from the data read in the input file. It has the same
name as the project, with the extension (.bac). It also allows you to check that your data have been
read properly.
Manual Arlequin ver 1.1 Arlequin interface 40

n Log file [r]: A file where run-time WARNINGS and ERRORS encountered during any phases of the
current Arlequin session are issued. It has the name arlequin.log. You should consult this file if you
observe any strange behavior of Arlequin. If Arlequin has crashed please consult this file located in
Arlequin’s installation directory before running Arlequin again. It will probably help you in finding
where the problem was located. The file content can be emptied in the Special | Empty Log file menu
of the main window.
n Amova histograms [r]: Specifies the name of an output file where the histograms of the variance
component null distributions are output. By default, the name is set to amo_hist.xl. It is a tabulated
text file which can be read directly by MS-Excel, for a graphical output of the distributions.
n Linkage disequilibrium [r]: The name of a tabulated text file where the results of pairwise linkage
disequilibrium tests between all pairs of loci are output. By default, it has the name lk_dis.xl. As
suggested by its extension, this file can be read with MS-Excel without modification.

• Project information:
n Project name[r]: The title of the project as entered in the project.
n Locus separator[r]: The character used to separate allelic information at adjacent loci.
n Missing data[r]: The character used to represent missing data at any locus. By default, a question
mark (?) is used for unknown alleles.
n Data type [r]: Data type in the input file.
n Genotypic data [r]: Specifies whether input data consist of diploid genotypic data or haplotypic
data. For genotypic data, the diploid information of each genotype is entered on separate lines in the
input file. The gametic phase of the genotype can be either assumed to be known or unknown. If the
gametic phase is known, then the treatment of the data will be essentially similar to that of
haplotypic data.
n Gametic phase [r]: Specifies whether the gametic phase is known or unknown when the input file is
made up of genotypic data.

• Polymorphism control:
n Allowed missing level per site [f]: Specify the fraction of missing data allowed for any locus to be
taken into account in the analyses. For instance, a level of 0.05 means that a locus with more than
5% of missing data will not be considered in any analysis. This option is especially useful when
dealing with DNA data where different individuals have been sequenced for slightly different
fragments. Setting a level of zero will force the analysis to consider only those sites that have been
sequenced in all individuals. Alternatively, choosing a level of one means that all sites will be
considered in the analyses, even if they have not been sequenced in any individual (not a very smart
choice, however).
n Deletion weight [f]: The weight given to deletions when comparing DNA or RFLP sequences.
n Transition weight [f]: The weight given to transitions when comparing DNA sequences.
n Transversion weight [f]: The weight given to transversions when comparing DNA sequences.
Manual Arlequin ver 1.1 Arlequin interface 41

n Infer haplotypes from distance matrix [m] or Use original haplotype definition [m]: With the first
option, similar haplotypes will be identified by computing a distance matrix based on the settings
chosen above. Selecting the second option has the consequence that haplotypes are identified
according to their original identifier.

• Haplotype frequencies: Some settings directly related to haplotype frequency estimation and output.
n Significant digits [i]: The number of significant digits shown for the estimated haplotype
frequencies in the result files.
n Epsilon value [f]: The criterion used to stop the EM algorithm when estimating haplotype
frequencies or linkage disequilibrium from genotypic data with unknown gametic phase (see section
7.1.3.2). The criterion is the difference in the sum of haplotypic frequency change between two
successive iterations. The default value is 1e-7.

• Internet browser location

n Use the Browse button to locate your Internet browser on your computer, if you want to be able to
view your results in an HTML file.

6.4.2Diversity indices

• Standard diversity indices [b]: Compute several common indices of diversity, like the number of
alleles, the number of segregating loci, the heterozygosity level, etc. (see section 7.1.1).

• Molecular diversity [b]: Check box for computing several indices of diversity at the molecular level.
n Molecular distance [l]: Choose the type of distance used when comparing haplotypes (see section
7.1.2.5 and below).
n Gamma a value [f]: Set the value for the shape parameter of the gamma function, when selecting a
distance allowing for unequal mutation rates among sites. This option is only valid for some distances
computed between DNA sequences. Note that a value of zero deactivates here the Gamma correction
of these distances, whereas in reality, a value of infinity would deactivate the Gamma correction
procedure.
n Print distance matrix [b]: If checked, the inter-haplotypic distance matrix used to evaluate the
molecular diversity is printed in the result file.

n Theta(Hom) [b]: An estimation of θ obtained from the observed homozygosity H (see section

7.1.2.3.1).

n Theta(S) [b]: An estimation of θ obtained from the observed number of segregating site S (see

section 7.1.2.3.2).

n Theta(k) [b]: An estimation of θ obtained from the observed number of alleles k (see section

7.1.2.3.3).

n Theta( π ) [b]: An estimation of θ obtained from the mean number of pairwise differences πˆ (see
section 7.1.2.3.4).
Manual Arlequin ver 1.1 Arlequin interface 42

• Mismatch distribution [b]: Compute the distribution of the observed differences between all pairs of
haplotypes in the sample (see section 7.1.2.4). It also estimates parameters of a sudden demographic
expansion according to the model presented in Rogers (1995) (see section 7.1.2.4).
n Molecular distance [l]: Here we only allow one genetic distance: the mere number of observed
differences between haplotypes.

• Haplotype frequency information

Depending on the data type, different methods are used to estimate the haplotypic frequencies.

Case a: Haplotypic data, or genotypic (diploid) data with known gametic phase
n Gene frequency estimation [b]: Estimate the maximum-likelihood haplotype frequencies from the
observed data using a mere gene counting procedure
n Allele frequencies at all loci: Estimate allele frequencies at all loci separately.

Case b: Genotypic data with unknown gametic phase

n Haplotype frequency estimation [b]: We estimate the maximum-likelihood (ML) haplotype
frequencies from the observed data using an Expectation-Maximization (EM) algorithm for multi-
locus genotypic data when the gametic phase is not known, or when recessive alleles are present (see
section 7.1.3.2).
n No. of initial conditions [i]: Set the number of random initial conditions from which the EM
algorithm is started to repeatedly estimate haplotype frequencies. The haplotype frequencies
globally maximizing the likelihood of the sample will be kept eventually. Figures of 100 or more
are usually in order.
n No. of bootstrap replicates [i]: Set the number of parametric bootstrap replicates of the EM
estimation process on random samples generated from a fictive population having haplotype
frequencies equal to previously estimated ML frequencies. This procedure is used to generate the
standard deviation of haplotype frequencies. When set to zero, the standard deviations are not
estimated.
n No. of initial conditions for bootstrap [i]: Set the number of initial conditions for the bootstrap
procedure. It may be smaller than the number of initial conditions set when estimating the
haplotype frequencies, because the bootstrap replicates are quite time-consuming. Setting this
number to small values is conservative, in the sense that it usually inflates the standard
deviations.
n Maximum no. of iterations [i]: Set the maximum number of iterations allowed in the EM
algorithm. The iterative process will have at most this number of iterations, but may stop before if
convergence has been reached. Here, convergence is reached when the sum of the differences
between haplotypes frequencies between two successive iterations is smaller than the epsilon
value defined in the general settings dialog box (section 6.4.1).
Manual Arlequin ver 1.1 Arlequin interface 43

n Recessive data [b]: Specify whether a recessive allele is present. This option applies to all loci.
The code for the recessive allele can be specified in the project file (see 3.2.1).
n Compact haplotypes [b]: Specify whether haplotypes can be compacted to get rid of
monomorphic loci. This option just saves up memory and has no effect on the estimation
procedure outcome.
n Sub-haplotypes [b]: Estimate haplotype frequencies for all haplotypes defined for all pairs of loci,
as well as for all loci taken separately. This option can be quite time-consuming when the number
of loci is large. The EM procedure is done with the same settings as those used for the haplotypic
frequency estimation.

• Search for shared haplotypes within and between populations [b]: Look for haplotypes that are
effectively similar after computing pairwise genetic distances according to the distance calculation
settings in the « general settings » dialog box (6.4.1). For each pair of populations, the shared haplotypes
will be printed out. Then will follow a table that contains, for every group of identified haplotypes, its
absolute and relative frequency in each population. This task is only possible for haplotypic data.

6.4.3Neutrality tests
Tests of selective neutrality, based either on the infinite-allele model or on the infinite-site model (see section
7.1.6).

• Ewens-Watterson neutrality tests [b]: Performs tests of selective neutrality based on Ewens sampling
theory in a population at equilibrium (Ewens 1972). These tests are currently limited to sample sizes of
2000 genes or less and 1000 different alleles (haplotypes) or less.
n Ewens-Watterson homozygosity test: This test, devised by Watterson (1978, 1986), is based on
Ewens’ sampling theory, but uses as a statistic the quantity F equal to the sum of squared allele
frequencies, equivalent to the sample homozygosity in diploids (see section 7.1.6.1).
n Exact test based on Ewens’ sampling theory: In this test, devised by Slatkin (1994b, 1996), the
probability of the observed sample is compared to that of a random neutral sample with same number
of alleles and identical size. The probability of the sample selective neutrality is obtained as the
proportion of random samples, which are less or equally probable than the observed sample.
n No. of random samples [i]: Number of random samples to be generated for the two neutrality tests
mentioned above. Values of several thousands are in order, and 16,000 permutations guarantee to have
less than 1% difference with the exact probability in 99% of the cases (see Guo and Thomson 1992).

• Chakraborty’s test of population amalgamation [b]: A test of selective neutrality and population
homogeneity and equilibrium (Chakraborty, 1990). This test can be used when sample heterogeneity is

suspected. It uses the observed homozygosity to estimate the population mutation parameter θ Hom . The
estimated value of this parameter is then used to compute the probability of observing k alleles or more in
a neutral sample drawn from a stationary population. This test is based on Chakraborty’s observation that
the observed homozygosity is not very sensitive to population amalgamation or sample heterogeneity,
whereas the number of observed (low frequency) alleles is more affected by this phenomenon.
Manual Arlequin ver 1.1 Arlequin interface 44

• Tajima’s test of selective neutrality [b]: This test described by Tajima (1989a, 1989b, 1993) compares
two estimators of the population parameter θ , one being based on the number of segregating sites in the
sample, and the other being based on the mean number of pairwise differences between haplotypes.
Under the infinite-site model, both estimators should estimate the same quantity, but differences can arise
under selection, population non-stationarity, or heterogeneity of mutation rates among sites (see section
7.1.6.4).

6.4.4Gametic disequilibrium

• Pairwise linkage disequilibrium [b]: Test for the presence of significant association between pairs of
loci.
This test can be done with all data types except FREQUENCY data type. The number of loci can be
arbitrary, but if there are less than two polymorphic loci, there is no point performing this test.
Different approaches will be used depending on the data type:
Case a): Genotypic data with unknown gametic phase :
A procedure for testing the significance of the association between pairs of loci when the gametic
phase is not known (see section 7.1.4.2). The likelihood of the sample under the hypothesis of no
association between loci (linkage equilibrium) is compared to the likelihood of the sample when
association is allowed (see Slatkin and Excoffier, 1996). The significance of the observed likelihood
ratio is found by computing the null distribution of this ratio under the hypothesis of linkage
equilibrium, using a permutation procedure.
n No. of permutations [i]: Number of random permuted samples to generate. Figures of several
thousands are in order, and 16,000 permutations guarantee to have less than 1% difference with the
exact probability in 99% of the cases (Guo and Thomson, 1992). A standard error for the estimated
P-value is estimated using a system of batches (Guo and Thomson, 1992).
n No. of initial conditions [i]: Sets the number of random initial conditions from which the EM is
started to repeatedly estimate the sample likelihood. The haplotype frequencies globally
maximizing the sample likelihood will be eventually kept. Figures of 100 or more are in order.
n Generate histogram and table [b]: Generates an histogram of the number of loci with which each
locus is in disequilibrium, and an s by s table (s being the number of polymorphic loci)
summarizing the significant associations between pairs of loci. This table is generated for different
levels of polymorphism, controlled by the value y: a locus is declared polymorphic if there are at

least 2 alleles with y copies in the sample (Slatkin, 1994a). This is done because the exact test is

more powerful at detecting departure from equilibrium for higher values of y (Slatkin 1994a).

n Significance level [f]: The level at which the test of linkage disequilibrium is considered
significant for the output table.
Case b): Exact test of linkage disequilibrium
A test analogous to Fisher’s exact test on a two-by-two contingency table but extended to a
contingency table of arbitrary size (see section 7.1.4.1).
Manual Arlequin ver 1.1 Arlequin interface 45

n No. of steps in Markov chain [i]: The maximum number of alternative tables to explore. Figures of
100,000 or more are in order. Larger values of the step number increases the precision of the P-value
as well as its estimated standard deviation.
n No. of dememorization steps [i]: The number of steps to perform before beginning to compare the
alternative table probabilities to that of the observed table. A few thousands steps are necessary to
reach a random starting point corresponding to a table independent from the observed table.
n Required precision on probability [f]: The precision required on the inferred probability of
linkage equilibrium. A system of batches (Guo and Thomson 1992) is used to constantly estimate
the standard-deviation of the probability. The estimation process is stopped once the required
precision has been reached, or once the maximal number of steps has been performed.
n Generate histogram and table [b]: Generates a histogram of the number of loci with which each
locus is in disequilibrium, and an s by s table (s being the number of polymorphic loci)
summarizing the significant associations between pairs of loci. This table is generated for different
levels of polymorphism, controlled by the value y: a locus is declared polymorphic if there are at

least 2 alleles with y copies in the sample (Slatkin, 1994a). This is done because the exact test is

more powerful at detecting departure from equilibrium for higher values of y (Slatkin 1994a).

n Significance level [f]: The level at which the test of linkage disequilibrium is considered
significant for the output table.

n D and D’ coefficients for all pairs of alleles [b]:

See section 7.1.4.3

1. D: The classical linkage disequilibrium coefficient measuring deviation from random

association between alleles at different loci (Lewontin and Kojima, 1960) expressed as
D = p ij − p i p j .

2. D’: The linkage disequilibrium coefficient D standardized by the maximum value it can take
(D ), given the allele frequencies (Lewontin 1964).
max

• Hardy-Weinberg equilibrium [b]: Test of the hypothesis that the observed diploid genotypes are the
product of a random union of gametes. This test is only possible for genotypic data. Separate tests are
carried out at each locus.
This test is analogous to Fisher’s exact test on a two-by-two contingency table but extended to a
contingency table of arbitrary size (see section 7.1.5). If the gametic phase is unknown the test is only
possible locus by locus. For data with known gametic phase, it is also possible to test the association at
the haplotypic level within individuals.
n No. of steps in Markov chain [i]: The maximum number of alternative tables to explore. Figures of
100,000 or more are in order.
Manual Arlequin ver 1.1 Arlequin interface 46

n No. of dememorization steps [i]: The number of steps to perform before beginning to compare the
alternative table probabilities to that of the observed table. A few thousands steps are necessary to
reach a random starting point corresponding to a table independent from the observed table.
n Required precision on probability [f]: The precision required on the inferred probability of linkage
equilibrium. A system of batches (Guo and Thomson 1992) is used to constantly estimate the
standard-deviation of the probability. The estimation process is stopped once the required precision
has been reached or once the maximal number of steps has been performed.
n Test association at [m]:
1. Locus level: Test the association of alleles at each locus within individuals.
2. Haplotype level: test the association of haplotypes within diploid individuals.
3. Both levels: Test both 1 and 2.

6.4.5Genetic structure
A dialog box to set up the options for the analysis of population genetic structure, and genetic distances between
populations. The genetic structure is analyzed using an analysis of variance framework (Weir and Cockerham,
1984; Excoffier et al. 1992; Weir, 1996).

• AMOVA [b]: Analysis of MOlecular VAriance framework. Estimate genetic structure indices using
information on the allelic content of haplotypes, as well as their frequencies (Excoffier et al. 1992). The
information on the differences in allelic content between haplotypes is entered as a matrix of Euclidean
squared distances. The significance of the variance components associated with the different possible
levels of genetic structure (within individuals, within populations, within groups of populations, among
groups) is tested using non-parametric permutation procedures (Excoffier et al. 1992). The type of
permutations is different for each variance component (see section 7.2.1).
The number of hierarchical levels of the variance analysis and the kind of permutations that are done
depend on the kind of data, the genetic structure that is tested, and the options the user might choose.
All details will be given in section 7.2.1.
n No. of permutations [i]: Enter the number of permutations used to test the significance of variance
components and fixation indices. A value of zero will not lead to any testing procedure. Values of
several thousands are in order for a proper testing scheme, and 16 000 permutations guarantee to have
less than 1% difference with the exact probability in 99% of the cases (Guo and Thomson 1992).
The number of permutations used by the program might be slightly larger. This is the consequence of
subdivision of the total number of permutation in batches for estimating the standard error of the P-
value.
Note that if several variance components need to be tested, the probability of each variance
component will be estimated with this number of permutation. The distribution of the variance
components is output into a tabulated text file called amo_hist.xl, which can be directly read into MS-
EXCEL .
n Include individual level for genotype data [b]: Include the intra-individual variance component of
genetic diversity, and its associated fixation indices. It thus takes into account the differences between
Manual Arlequin ver 1.1 Arlequin interface 47

genes found within individuals. This is another way to test for global departure from Hardy-Weinberg
equilibrium. The selection of this option is only possible for genotypic data with known gametic
phase.

• Compute population pairwise FST’s [b]: Compute FST statistics for all pairs of populations.

Transformed pairwise FST ‘s can be used as short term genetic distances between populations (Reynolds
et al. 1983; Slatkin, 1995).

The significance of the pairwise FST values is tested by permuting the haplotypes or individuals between
the populations. See section 7.2.2 for more details on the output results (genetic distances and migration
rates estimates between populations).
n Test significance [b]: Use a non-parametric permutation scheme to test for the significance of the
derived genetic distances. Note that this procedure is quite time consuming when the number of
populations is large.
n No. of permutations [i]: Enter the required number of permutations. If this number is set to zero, no
testing procedure will be performed.
n Use specified distance matrix [m] or Generate distance matrix [m]: Select the first option to use a
given matrix of Euclidean distances (computed by another program than Arlequin). The matrix can be
put directly into the Arlequin project, or it can be put into a separate file whose name has to be
defined in the project file. Select the second option to have the distance matrix generated directly by
Arlequin, from the definition of the haplotypes. This matrix can be generated either for haplotypic
data or genotypic data (Michalakis and Excoffier, 1996)
n Distance method [l]: Select a distance method to compute the distances between haplotypes.

n Gamma a value [f]: Set the value for the shape parameter a of the gamma function, when
selecting a distance allowing for unequal mutation rates among sites. See the Molecular diversity
section 7.1.2.5.

• Compute conventional F-statistics [b]: Estimate genetic structure indices using haplotype frequencies
only, without taking into account their allelic content and the molecular differences between these
haplotypes.
The distance matrix used for the calculations will simply have zeroes on its diagonal and ones elsewhere.
This is equivalent to a conventional treatment based on haplotype frequencies, and different from a
treatment averaged over all loci. By checking this, the three settings concerning the distance matrix are of
course ignored.

• Exact test of population differentiation [b]: We test the hypothesis of random distribution of the
individuals between pairs of populations as described in Raymond and Rousset (1995) and Goudet et al.
(1996). This test is analogous to Fisher’s exact test on a two-by-two contingency table, but extended to a
contingency table of size two by (no. of haplotypes). We do also an exact differentiation test for all
populations defined in the project by constructing a table of size (no. of populations) by (no. of
haplotypes). (Raymond and Rousset, 1995).
Manual Arlequin ver 1.1 Arlequin interface 48

 No. of steps in Markov chain [i]: The maximum number of alternative tables to explore. Figures of
100,000 or more are in order. Larger values of the step number increases the precision of the P-value
as well as its estimated standard deviation.
 No. of dememorization steps [i]: The number of steps to perform before beginning to compare the
alternative table probabilities to that of the observed table. A few thousands steps are necessary to
reach a random starting point corresponding to a table independent from the observed table.
 Required precision on probability [f]: The precision required on the inferred probability of non-
differentiation. A system of batches (Guo and Thomson, 1992) is used to constantly estimate the
standard deviation of the probability. The estimation process is stopped once the required precision
has been reached or once the maximal number of steps has been performed. Setting this value to zero
ensures that the total amount of specified steps is performed.
 Generate histogram and table [b]: Generates a histogram of the number of populations which are
significantly different from a given population, and a s by s table (s being the number of populations)
summarizing the significant associations between pairs of populations. An association between two
populations is considered as significant or not depending on the significance level specified below.
 Significance level [f]: The level at which the test of differentiation is considered significant for the
output table. If the P-value is smaller than the Significance level, then the two populations are
considered as significantly different.

6.4.6Launch Pad
In this dialog box, users can rapidly select which tasks they want to perform on their data set. The options of
each possible category can then be set by a series of other dialog boxes described below.
The population genetics methods of Arlequin have been grouped into four main categories:

• Population genetic diversity indices:

A series of diversity indices can be computed if these check-boxes are checked (see section 6.4.2).
n Standard indices [b]: Several common indices of diversity, like the number of alleles, the number of
segregating loci, gene diversity.
n Molecular diversity [b]: Computes the sample molecular diversity, the sample nucleotide diversity
for DNA data, and several estimators of the population mutation parameter θ.
n Mismatch distribution [b]: Computes the distribution of the number of pairwise differences.
n Haplotype frequency estimation [b]: Estimate haplotype frequencies and standard deviations.
n Search for shared haplotypes between populations [b]: Make a table of common haplotypes shared
between populations.

• Gametic disequilibrium:
Possibility of testing for pairwise linkage equilibrium and Hardy-Weinberg equilibrium (see section
6.4.4).
n Linkage disequilibrium [b]: Test the linkage equilibrium hypothesis for all pairs of loci.
Manual Arlequin ver 1.1 Arlequin interface 49

n Hardy-Weinberg-disequilibrium [b]: Test the Hardy-Weinberg equilibrium hypothesis at all loci

and/or at the whole haplotype level. This test is only possible for genotypic data.

• Selective neutrality tests: For details see section 6.4.3.

n Ewens-Watterson neutrality tests [b]: The exact or the homozygosity tests of selective neutrality
under the infinite allele model. These tests are not possible for microsatellite data
n Chakraborty’s test [b]: Chakraborty’s (1990) test of neutrality and population subdivision under the
infinite allele model.
n Tajima’s D [b]: Tajima’s test of selective neutrality under the infinite-site model. This test is only
meaningful on non-recombining DNA or RFLP data.

• Analysis of population genetic structure : See section 6.4.5 for details

n AMOVA [b]: Estimates and tests the amount of genetic structure among populations, using the
Amova framework for mono- or multi-locus data.
n Pairwise genetic distances [b]: Computes pairwise FST’s between all pairs of population samples.
n Exact test of population differentiation [b]: Test if the haplotypic composition of the populations is
significantly heterogeneous.
Manual Arlequin ver 1.1 Methodological outlines 50

7METHODOLOGICAL OUTL INES

The following table gives a rapid overview of the methods implemented in Arlequin. A ä indicates that the task
corresponding to the table entry is possible. Some tasks are only possible or meaningful if there is no recessive
data, and those cases are marked with a r

Data types

DNA and RFLP Microsat Standard Frequency

Types of computations G+ G- H G+ G- H G+ G- H

Standard indices r ä ä ä ä ä ä ä ä ä ä

Molecular diversity r ä ä ä ä ä ä ä ä ä

Mismatch distribution ä ä ä ä ä ä

Haplotype frequency estimation ä ä ä ä ä ä ä ä ä ä

Linkage disequilibrium ä ä ä ä ä ä ä ä ä

Hardy-Weinberg equilibrium r ä ä ä ä ä ä

Tajima’s neutrality test ä ä

Ewens-Watterson neutrality tests ä ä ä ä ä

Chakraborty’s amalgamation test ä ä ä ä ä

Search for shared haplotypes ä ä ä ä

between samples

AMOVA r ä ä ä ä ä ä ä ä ä ä

Pairwise genetic distances r ä ä ä ä ä ä ä ä ä ä

Exact test of population r ä ä ä ä ä ä ä ä ä ä

differentiation

G+: Genotypic data, gametic phase known,

G- : Genotypic data, gametic phase unknown,
H : Haplotypic data.
Manual Arlequin ver 1.1 Methodological outlines 51

7.1Intra-population level me thods

7.1.1Standard diversity indic es

7.1.1.1Gene diversity
Equivalent to the expected heterozygosity for diploid data. It is defined as the probability that two randomly
chosen haplotypes are different in the sample. Gene diversity and its sampling variance are estimated as

k
∑
n
Hˆ = (1 − pi2 )
n −1 i =1

2  k  k 
k k
2 )2 
V( Hˆ ) = 
n(n − 1) 
2 ( n − 2 ) ∑ p
i =1 i
3 − ( ∑ p 2
i
) 2  +∑ p
 i =1 i
2 − ( ∑ p i 
 i =1 i =1 
,

where n is the number of gene copies in the sample, k is the number of haplotypes, and pi is the sample

frequency of the i-th haplotype.

Reference:
Nei, 1987, p.180.

7.1.1.2Number of usable loci

Number of loci that present less than a specified amount of missing data. The maximum amount of missing
data must be specified in the General Settings dialog box.

7.1.1.3Number of polymorphic si tes (S)

Number of usable loci that present more than one allele per locus.

7.1.2Molecular indices

7.1.2.1Mean number of pairwise differences (π)

Mean number of differences between all pairs of haplotypes in the sample. It is given by

k
πˆ = ∑ ∑ pi p j dˆij ,
i =1 j < i

where d̂ ij is an estimate of the number of mutations having occurred since the divergence of haplotypes i and

j, , k is the number of haplotypes, and pi is the frequency of haplotype i. The total variance (over the
Manual Arlequin ver 1.1 Methodological outlines 52

stochastic and the sampling process), assuming no recombination between sites and selective neutrality, is
obtained as

3n(n + 1)πˆ + 2 (n 2 + n + 3)πˆ 2

V(πˆ ) = . (Tajima, 1991)
11(n 2 − 7 n + 6)
Note that similar formulas are also used for Microsat and Standard data, even though the underlying
assumptions of the model may be violated.
References:
Tajima, 1983
Tajima, 1991

7.1.2.2Nucleotide diversity or av erage gene diversity over L loci (RFLP and DNA data)
It is the probability that two randomly chosen homologous nucleotides are different. It is equivalent to the gene
diversity at the nucleotide level.

k
∑∑ pi p j dˆij
i =1 j < i
πˆ n =
L

n +1 2(n 2 + n + 3) 2
V(πˆ n ) = πˆ n + πˆ n
3(n − 1) L 9n(n − 1)

Note that similar formulas are used for computing the average gene diversity over L loci for Microsat and
Standard data, assuming no recombination and selective neutrality. As above, one should be aware that these
assumption may not hold for these data types.
References:
Tajima, 1983
Nei, 1987, p. 257

7.1.2.3Theta estimators
Several methods are used to estimate the population parameter θ = 2 Mu , where M is equal to 2 N for diploid
populations of size N , or equal to N for haploid populations, and u is the overall mutation rate at the haplotype
level.

7.1.2.3.1Theta(Hom)

The expected homozygosity in a population at equilibrium between drift and mutation is usually given by

1
H= .
θ +1
Manual Arlequin ver 1.1 Methodological outlines 53

However, Zouros (1979) has shown that this estimator was an overestimate when estimated from a single or a
few loci. Although he gave no closed form solution, Chakraborty and Weiss (1991) proposed to iteratively

solve the following relationship between the expectation of θˆH and the unknown parameter θ

 2(1 + θ ) 
E(θˆH ) = θ 1 +  (Zouros, 1979)
 (2 + θ )(3 + θ ) 

starting with a first estimate of θˆH of (1 − H ) / H , and equating it to its expectation.

Chakraborty and Weiss (1991) give an approximate formula for the standard error of θˆ as
H

(2 + θ ) 2 (3 + θ ) 2 s.d.( H )
s.d.(θˆH ) ≈ ,
H 2 (1 + θ )[(2 + θ )(3 + θ )(4 + θ ) + 10(2 + θ ) + 4]
where s.d.( H ) is the standard error of H given in section 7.1.1.1.

7.1.2.3.2Theta(S)

θˆS is estimated from the infinite-site equilibrium relationship (Watterson, 1975) between the number of

segregating sites (S), the sample size (n) and θ for a sample of non-recombining DNA:

S
θ=
a1

where

n −1
∑
1
a1 = .
i =1
i

The variance of θˆS is obtained as

a12 S + a2 S 2
V(θ S ) =
ˆ , (Tajima, 1989)
a12 (a12 + a2 )

where

n −1
∑
1
a2 =
i =1 i2

7.1.2.3.3Theta(k)

θˆk is estimated from the infinite-allele equilibrium relationship (Ewens, 1972) between the expected number
of alleles (k), the sample size (n) and θ :
Manual Arlequin ver 1.1 Methodological outlines 54

n −1 1
E(k ) = θ ∑
i =0 θ + i

Instead of the variance of θˆ , we give the limits ( θˆ and θˆ ) of a 95% confidence interval around θˆk ,
k 0 1
obtained from Ewens (1972)

Pr(less than k alleles | θ = θ 0 ) = 0.025

Pr( more than k alleles | θ = θ1 ) = 0.025 ,

These probabilities are obtained by summing up the probabilities of observing k’ alleles (k’=0,...,k), obtained as
(Ewens, 1972)

Sk θ k
n
Pr( K = k | θ ) =
S (θ )
n

where S nk is a Stirling number of the first kind (see Abramovitz and Stegun, 1970), and S n (θ ) is defined

as θ (θ + 1)(θ + 2)K(θ + n − 1) .

7.1.2.3.4Theta( π )

θˆπ is estimated from the infinite-site equilibrium relationship between the mean number of pairwise

differences ( πˆ ) and theta ( θ ):

E (πˆ ) = θ , (Tajima, 1983)

and its variance V (πˆ ) is given in section 7.1.1.1.

7.1.2.4Mismatch distribution
It is the distribution of the observed number of differences between pairs of haplotypes. This distribution is
usually multimodal in samples drawn from populations at demographic equilibrium, as it reflects the highly
stochastic shape of gene trees, but it is usually unimodal in populations having passed through a recent
demographic expansion (Rogers and Harpending, 1992; Hudson and Slatkin, 1991).
If one assumes that a stationary haploid population at equilibrium has suddenly passed τ generations ago from

a population size of N 0 to N1 , then the probability of observing S differences between two randomly chosen
non-recombining haplotypes is given by

j
θ1 + 1 S
τ [F (θ ) − F (θ )],
F S (τ ,θ 0 ,θ1 ) = F S (θ1 ) + exp(−τ
θ1
) ∑ j!
S− j 0 S− j 1 (Li, 1977)
j =0
Manual Arlequin ver 1.1 Methodological outlines 55

θS
where FS (θ ) = is the probability of observing two random haplotypes with S differences in a
(θ + 1) S +1
stationary population (Watterson, 1975), θ = 2uN 0 , θ 1= 2uN1 , τ = 2ut , and u is the mutation rate for
0
the whole haplotype.

Rogers (1995) has simplified the above equation, by assuming that θ 1→ ∞ , implying there are no coalescent
events after the expansion, which is only reasonable if the expansion size is large. With this simplifying
assumption, it is possible to derive the moment estimators of the time to the expansion ( τ ) and the mutation

parameter θ 0
, as

θˆ0 = v − m
, (Rogers, 1995)
τˆ = m − θˆ0
where m and v are the mean and the variance of the observed mismatch distribution, respectively. These

estimators can then be used to plot F S (τ ,θ 0, ∞) values. Note, however, that this estimation cannot be done
if the variance of the mismatch is smaller than the mean.
A simple chi-square test of goodness of fit can be performed to judge whether the observed distribution fits
with the predicted expansion scenario.
For convenience, we also compute the raggedness index of the observed distribution defined by Harpending
(1994) as

d +1
r= ∑ ( xi − xi −1 ) 2 ,
i =1

where d is the maximum number of observed differences between haplotypes, and the x’s are the observed
relative frequencies of the mismatch classes. This index takes larger values for multimodal distributions
commonly found in a stationary population than for unimodal and smoother distributions typical of expanding
populations.

7.1.2.5Estimation of genetic dista nces between DNA sequences

Definitions:

L: Number of loci
Gamma correction: This correction is proposed when the mutation rates cannot be assumed as
uniform for all sites. It had been originally proposed for mutation rates among
amino acids (Uzell and Corbin, 1971), but it seems also to be the case of the
control region of human mtDNA (Wakeley, 1993). In such a case, a Gamma
distribution of mutation rates is often assumed. The shape of this distribution
(the unevenness of the mutation rates) is mainly controlled by a parameter a,
which is the inverse of the coefficient of variation of the mutation rate.
The smaller the a coefficient , the more uneven the mutation rates. A uniform
Manual Arlequin ver 1.1 Methodological outlines 56

mutation rate corresponds to the case where a is equal to infinity.

nd Number of observed substitutions between two DNA sequences
:
ns Number of observed transitions between two DNA sequences
:
nv Number of observed transversions between two DNA sequences
:
ω G+C ratio, computed on all the DNA sequences of a given sample

7.1.2.5.1Pairwise difference

Outputs the number of loci for which two haplotypes are different

dˆ = nd

V (dˆ ) = dˆ ( L − dˆ ) / L

7.1.2.5.2Percentage difference

Outputs the percentage of loci for which two haplotypes are different

dˆ = nd / L

V (dˆ ) = dˆ (1 − dˆ ) / L

7.1.2.5.3Jukes and Cantor

Outputs a corrected percentage of nucleotides for which two haplotypes are different.
The correction allows for multiple substitutions per site since the most recent common ancestor of the two
DNA sequences. The correction also assumes that the rate of nucleotide substitution is identical for all 4
nucleotides A, C, G and T.

pˆ = nd / L
3 4
dˆ = − log(1 − pˆ )
4 3
pˆ (1 − pˆ )
V(dˆ ) =
4
(1 − pˆ ) 2 L
3
Gamma correction:

dˆ = − a [ (1 − p ) −1 / a − 1 ]
3 4
4 3

V(dˆ ) = p (1 − p )[ (1 − p ) − 2(1 / a +1) ]/ L

4
3
References:
Jukes and Cantor 1969
Jin and Nei 1990
Kumar et al. 1993
Manual Arlequin ver 1.1 Methodological outlines 57

7.1.2.5.4Kimura 2-parameters
Outputs a corrected percentage of nucleotides for which two haplotypes are different.
The correction also allows for multiple substitutions per site, but takes into account different substitution rates
between transitions and transversions. The transition-transversion ratio is estimated from the data.

n n
Pˆ = s , Qˆ = v
L L
c +c
c1 = (1 − 2 Pˆ − Qˆ ) − (1 / a +1) , c2 = (1 − 2Qˆ ) − (1 / a +1) , c3 = 1 2
2
1 1
dˆ = log(1 − 2 Pˆ − Qˆ ) − log(1 − 2Qˆ )
2 4
c12 P + c32 Qˆ − (c1 Pˆ + c3Qˆ ) 2
V(d ) =
ˆ
L
Gamma correction:

dˆ = [ (1 − 2 Pˆ − Qˆ ) −1 / a + (1 − 2Qˆ ) −1 / a − ]
a 1 3
2 2 2
c12 Pˆ + c32 Qˆ − (c1 Pˆ + c3Qˆ ) 2
V(d ) =
ˆ
L
References:
Kimura (1980)
Jin and Nei 1990

7.1.2.5.5Tamura

Outputs a corrected percentage of nucleotides for which two haplotypes are different.
The correction is an extension of Kimura 2-parameters method, allowing for unequal nucleotide frequencies.
The transition-transversion ratios, as well as the overall nucleotide frequencies are computed from the original
data.

n n
Pˆ = s , Qˆ = v
L L
1 1
c1 = , c2 = , c3 = 2ω (1 − ω )(c1 − c2 ) + c2
Pˆ 1 − 2Qˆ
1−
2ω (1 − ω )
Pˆ 1
dˆ = −2ω (1 − ω ) log(1 − − Qˆ ) − (1 − 2ω (1 − ω )) log(1 − 2Qˆ )
2ω (1 − ω ) 2
c 2 Pˆ + c32 Qˆ − (c1 Pˆ + c3Qˆ ) 2
V(dˆ ) = 1
L
References:
Tamura, 1992,
Kumar et al. 1993
Manual Arlequin ver 1.1 Methodological outlines 58

7.1.2.5.6Tajima and Nei

Outputs a corrected percentage of nucleotides for which two haplotypes are different.
The correction is an extension of Jukes and Cantor method, allowing for unequal nucleotide frequencies. The
overall nucleotide frequencies are computed from the data.

nd 4
pˆ 2
3 4 xij2
∑ ∑ ∑
1
pˆ = , b = (1 − g i2 + , c= ,
L 2 c 2gi g j
i =1 i =1 j = i +1
where the g’s are the four nucleotide frequencies, and xij is the relative frequency of the nucleotide pair i and j

pˆ
dˆ = −b log(1 − )
b
pˆ (1 − pˆ )
V(dˆ ) =
pˆ
(1 − ) 2 L
b
References:
Tajima and Nei, 1984,
Kumar et al. 1993

7.1.2.5.7Tamura and Nei

Outputs a corrected percentage of nucleotides for which two haplotypes are different.
Like Kimura 2-parameters, and Tajima and Nei distances, the correction allows for different transversion and
transition rates, but a distinction is also made between transition rates between purines and between
pyrimidines.

2 g A gG 2 g C gT 2 g A gG g R
c1 = , c2 = , c3 =
gR gY 2 g A g G g R − g R2 Pˆ1 − g A g G Qˆ

2 gT gC gY
c4 =
2 gT gC gY − gY2 Pˆ2 − gT gC Qˆ

2 g 2A g G
2
c5 =
g R (2 g A g G g R − g R2 Pˆ1 − g A g G Qˆ )

2 gT2 g C2
+
gY (2 gT g C gY − gY2 Pˆ2 − gT g C Qˆ )
Manual Arlequin ver 1.1 Methodological outlines 59

g R2 ( gT2 + g C2 ) + gY2 ( g 2A + g G
2)
+
2 g R2 gY2 − g R gY Q

n
Pˆ1 = ns ( A ↔ G ), Pˆ2 = ns (C ↔ T ), Qˆ = s
nd

Qˆ Pˆ1 Pˆ2 Qˆ
d̂ = − c1 log(1 − − ) − c2 log(1 − − )
c1 2 g R c2 2 gY

Q
− 2( g R gY − c1 gY − c2 g R ) log(1 − )
2 g R gY

c32 Pˆ1 + c42 Pˆ2 + c52Qˆ − (c3 Pˆ1 + c4 Pˆ2 + c5 Qˆ ) 2

V(d ) =
ˆ
L
Gamma correction:

Pˆ ˆ Pˆ ˆ
d̂ = 2a [ c (1 − 1 − Q ) −1 / a + c (1 − 2 − Q ) −1 / a
1 c1 2 g R 2 c2 2 gY
g g Qˆ
+ ( g R g Y − Y − R )(1 − ) −1 / a − 2 g A g G − 2 g T g C − 2 g R g Y ]
c1 c2 2 g R gY

c 2 Pˆ + c 2 Pˆ + c 2Qˆ − (c3 Pˆ1 + c4 Pˆ2 + c5 Qˆ ) 2

V(dˆ ) = 3 1 4 2 5
L
References:
Tamura and Nei, 1994,
Kumar et al. 1993

7.1.2.6Estimation of genetic dista nces between RFLP haplotypes

7.1.2.6.1Number of pairwise differenc e

We simply count the number of different alleles between two RFLP haplotypes.

L
dˆ xy = ∑δ xy (i)
i =1

where δ xy (i ) is the Kronecker function, equal to 1 if the alleles of the i-th locus are identical for both

haplotypes, and equal to 0 otherwise.

Manual Arlequin ver 1.1 Methodological outlines 60

When estimating genetic structure indices, this choice amounts at estimating weighted FST statistics over all
loci (Weir and Cockerham, 1984; Michalakis and Excoffier, 1996).

7.1.2.6.2Proportion of difference

We simply count the proportion of loci that are different between two RFLP haplotypes.

L
∑
1
dˆ xy = δ (i )
L i =1 xy

where δ xy (i ) is the Kronecker function, equal to 1 if the alleles of the i-th locus are identical for both

haplotypes, and equal to 0 otherwise.

When estimating genetic structure indices, this choice will lead to exactly the same results as the number of
pairwise differences.

7.1.2.7Estimation of distances be tween Microsatellite haplotypes

7.1.2.7.1No. of different alleles

We simply count the number of different alleles between two haplotypes.

L
dˆ xy = ∑ δ xy (i)
i =1

where δ xy (i ) is the Kronecker function, equal to 1 if the alleles of the i-th locus are identical for both

haplotypes, and equal to 0 otherwise.

When estimating genetic structure indices, this choice amounts at estimating weighted FST statistics over all
loci (Weir and Cockerham, 1984; Michalakis and Excoffier, 1996).

7.1.2.7.2Sum of squared size differenc e

Counts the sum of the squared number of repeat difference between two haplotypes (Slatkin, 1995).

L
dˆ xy = ∑ (a xi −a yi ) 2 ,
i =1

where a xi is the number of repeats of the microsatellite for the i-th locus.

When estimating genetic structure indices, this choice amounts at estimating an analog of Slatkin’s RST (1995)

(see Michalakis and Excoffier, 1996, as well as Rousset, 1996 , for details on the relationship between FST and

RST) .
Manual Arlequin ver 1.1 Methodological outlines 61

7.1.2.8Estimation of distances be tween Standard haplotypes

7.1.2.8.1Number of pairwise differenc es

Simply counts the number of different alleles between two haplotypes.

L
dˆ xy = ∑δ xy (i)
i =1

where δ xy (i ) is the Kronecker function, equal to 1 if the alleles of the i-th locus are identical for both

haplotypes, and equal to 0 otherwise.

When estimating genetic structure indices, this choice amounts at estimating weighted FST statistics over all
loci (Weir and Cockerham, 1984; Michalakis and Excoffier, 1996).

7.1.3Haplotype frequency est imation

7.1.3.1Haplotypic data or Genot ypic data with known Gametic phase

If haplotype i is observed xi times in a sample containing n gene copies, then its estimated frequency ( p̂i ) is
given by

x
pˆ i = i ,
n
whereas an unbiased estimate of its sampling variance is given by

pˆ (1 − pˆ i )
V ( pi ) = i .
n −1

7.1.3.2Genotypic data with unkn own Gametic phase

Maximum-likelihood haplotype frequencies are computed using an Expectation-Maximization (EM) algorithm
(see e.g. Dempster et al. 1977; Excoffier and Slatkin, 1995; Lange, 1997; Weir, 1996). This procedure is an
iterative process aiming at obtaining maximum-likelihood estimates of haplotype frequencies from multi-locus
genotype data when the gametic phase is unknown (phenotypic data). In this case, a simple gene counting is
not possible because several genotypes are possible for individuals heterozygote at more than one locus.
Therefore, a slightly more elaborate procedure is needed.

The likelihood of the sample (the probability of the observed data D, given the haplotype frequencies - p ) is
given by

n gi
L(D | p) = ∑ ∏ Gij ,
i =1 j =1
Manual Arlequin ver 1.1 Methodological outlines 62

where the sum is over all n individuals of the sample, and the product is over all possible genotypes of those

individuals, and Gij = 2 pi p j , if i ≠ j or Gij = pi2 , if i = j .

The principle of the EM algorithm is the following:

1. Start with arbitrary (random) estimates of haplotype frequencies.
2. Use these estimates to compute expected genotype frequencies for each phenotype, assuming Hardy-
Weinberg equilibrium (The E-step).
3. The relative genotype frequencies are used as weights for their two constituting haplotypes in a gene
counting procedure leading to new estimates of haplotype frequencies (The M-step).
4. Repeat steps 2-3, until the haplotype frequencies reach equilibrium (do not change more than a
predefined epsilon value).
Dempster et al (1977) have shown that the likelihood of the sample could only grow after each step of the EM
algorithm. However, there is no guarantee that the resulting haplotype frequencies are maximum likelihood
estimates. They can be just local optimal values. In fact, there is no obvious way to be sure that the resulting
frequencies are those that globally maximize the likelihood of the data. This would need a complete evaluation
of the likelihood for all possible genotype configurations of the sample. In order to check that the final
frequencies are putative maximum likelihood estimates, one has generally to repeat the EM algorithm from
many different starting points (many different initial haplotype frequencies). Several runs may give different
final frequencies, suggesting the presence of several "peaks" in the likelihood surface, but one has to choose
the solution that has the largest likelihood. It may also arise that several distinct peaks have the same
likelihood, meaning that different haplotypic compositions explain equally well the observed data. At this
point, there is no way to choose among the alternative solutions from a likelihood point of view. Some external
information should be provided to make a decision.
Standard deviations of the haplotype frequencies are estimated by a parametric bootstrap procedure (see e.g.
Rice, 1995), generating random samples from a population assumed to have haplotype frequencies equal to
their maximum-likelihood values. For each bootstrap replicate, we apply the EM algorithm to get new
maximum-likelihood haplotype frequencies. The standard deviation of each haplotype frequency is then
estimated from the resulting distribution of haplotype frequencies. Note however that this procedure is quite
computer intensive.

7.1.4Linkage disequilibrium between pairs of loci

Depending on whether the haplotypic composition of the sample is known or not, we have implemented two
different ways to test for the presence of pairwise linkage disequilibrium between loci.
We describe in detail below how the two tests are done.

7.1.4.1Exact test of linkage diseq uilibrium (haplotypic data)

This test is an extension of Fisher exact probability test on contingency tables (Slatkin, 1994a). A contingency
table is first built. The k1xk2 entries of the table are the observed haplotype frequencies (absolute values), with

k1 and k2 being the number of alleles at locus 1 and 2, respectively. The test consists in obtaining the
Manual Arlequin ver 1.1 Methodological outlines 63

probability of finding a table with the same marginal totals and which has a probability equal or less than the
observed table. Under the null-hypothesis of no association between the two tested loci, the probability of the
observed table is

n n
∏ ∏
n!
L0 = (ni * / n) i * (n*i / n) *i ,
∏ nij i i
i, j

where the nij’s denote the count of the haplotypes that have the i-th allele at the first locus and the j-th allele at

the second locus, ni* is the overall frequency of the i-th allele at the first locus (i=1,... k1) and n*i is the count
of the i-th allele at the second locus (i=1,... k2).
Instead of enumerating all possible contingency tables, a Markov chain is used to efficiently explore the space of
all possible tables. This Markov chain consists in a random walk in the space of all contingency tables. It is done
is such a way that the probability to visit a particular table corresponds to its actual probability under the null
hypothesis of linkage equilibrium. A particular table is modified according to the following rules (see also Guo
and Thompson, 1992; or Raymond and Rousset, 1995) :
1. We select in the table two distinct lines i1, i2 and two distinct columns j1, j2 at random.

2. The new table is obtained by decreasing the counts of the cells (i1, j1) (i2, j2) and increasing the counts of

the cells (i1, j2) (i2, j1) by one unit. This leaves the marginal allele counts ni unchanged.
3. The switch to the new table is accepted with a probability equal to

L1 ( ni , j + 1)(ni , j + 1)
R= = 1 2 2 1 ,
L0 ni , j ni , j
1 1 2 2

where R is just the ratio of the probabilities of the two tables.

The steps 1-3 are done a large number of times to explore a large amount of the space of all possible contingency
tables having identical marginal counts. In order to start from a random initial position in the Markov chain, the
chain is explored for a pre-defined number of steps (the dememorization phase) before the probabilities of the
switched tables are compared to that of the initial table. The number of dememorization steps should be enough
(some thousands) such as to allow the Markov chain to "forget" its initial state, and make it independent from its
starting point. The P-value of the test is then taken as the proportion of the visited tables having a probability
smaller or equal to the observed contingency table.
A standard error on P is estimated by subdividing the total amount of required steps into B batches (see Guo and

Thompson, 1992, p. 367). A P-value is calculated separately for each batch. Let us denote it by Pi (i=1,...,B).
The estimated standard error is then calculated as
B
∑ ( P − Pi ) 2
s.d .( P ) = i =1 .
B ( B − 1)
The process is stopped as soon as the estimated standard deviation is smaller than a pre-defined value specified
by the user.
Manual Arlequin ver 1.1 Methodological outlines 64

7.1.4.2Likelihood ratio test of lin kage disequilibrium (genotypic data, gametic phase
unknown)
For genotypic data where the haplotypic phase is unknown, the test based on the Markov chain described above
is not possible because the haplotypic composition of the sample is unknown, and is just estimated. Therefore,
linkage disequilibrium between a pair of loci is tested for genotypic data using a likelihood-ratio test, whose
empirical distribution is obtained by a permutation procedure (Slatkin and Excoffier, 1996). The likelihood of

the data assuming linkage equilibrium ( L ) is computed by using the fact that, under this hypothesis, the
H*
haplotype frequencies are obtained as the product of the allele frequencies. The likelihood of the data not

assuming linkage equilibrium ( L ) is obtained by applying the EM algorithm to estimate haplotype

H
frequencies. The likelihood-ratio statistic given by

L *
S = −2 log( H )
LH

should in principle follow a Chi-square distribution, with (k1-1) (k2-1) degrees of freedom, but it is not always
the case in small samples with large number of alleles per locus. In order to better approximate the underlying
distribution of the likelihood-ratio statistic under the null hypothesis of linkage equilibrium, we use the
following permutation procedure:
1. Permute the alleles between individuals at one locus only.

2. Re-estimate the likelihood of the data LH ’ by the EM algorithm. Note that LH * is unaffected by the
permutation procedure.

3. Repeat steps 1-2 a large number of times to get the null distribution of LH , and therefore the null

distribution of S.

Note that this test of linkage disequilibrium assumes Hardy-Weinberg proportions of genotypes, and the
rejection of the test could be also due to departure from Hardy-Weinberg equilibrium (see Excoffier and
Slatkin, 1998)

7.1.4.3Measures of gametic diseq uilibrium (haplotypic data)

• D and D’ coefficients:
1. D: The classical linkage disequilibrium coefficient measuring deviation from random association
between alleles at different loci (Lewontin and Kojima, 1960) is expressed as

Dij = p ij − p i p j ,

where p ij is the frequency of the haplotype having allele i at the first locus and allele j at the second

locus, and p i and p j are the frequencies of alleles i and j, respectively.

Manual Arlequin ver 1.1 Methodological outlines 65

2. D’ij : The linkage disequilibrium coefficient Dij standardized by the maximum value it can take

(D ), given the allele frequencies (Lewontin 1964), as

ij , max

Dij
D’ij = ,
Dij , max

where Dij , max takes one of the following values:

min ( pi p j , (1 − pi )(1 − p j ) ) if Dij < 0

min ( (1 − pi ) p j , pi (1 − p j ) ) if Dij > 0

7.1.5Hardy-Weinberg equilib rium.

To detect significant departure from Hardy-Weinberg equilibrium, we follow the procedure described in Guo
and Thompson (1992) using a test analogous to Fisher’s exact test on a two-by-two contingency table, but
extended to a triangular contingency table of arbitrary size. The test is done using a modified version of the
Markov-chain random walk algorithm described Guo and Thomson (1992). The modified version gives the same
results than the original one, but is more efficient from a computational point of view.
This test is obviously only possible for genotypic data. If the gametic phase is unknown, the test is only possible
for each locus separately. For data with known gametic phase, it is also possible to test for the non random
association of haplotypes into individuals. Note that this test assumes that the allele frequencies are given.
Therefore, this test is not possible for data with recessive alleles, as in this case the allele frequencies need to be
estimated.
A contingency table is first built. The kxk entries of the table are the observed allele frequencies and k is the
number of alleles. Using the same notations as in section 8.2.2, the probability to observe the table under the
null-hypothesis of no association is given by Levene (1949)
k
n! ∏ ni * !
i =1
L0 = 2H ,
k i
( 2n)!∏ ∏ nij !
i =1 j =1

where H is the number of heterozygote individuals.

Much like it was done for the test of linkage disequilibrium, we explore alternative contingency tables having
same marginal counts. In order to create a new contingency table from an existing one, we select two distinct
lines i1, i2 and two distinct columns j1, j2 at random. The new table is obtained by decreasing the counts of the

cells (i1, j1) (i2, j2) and increasing the counts of the cells (i1, j2) (i2, j1) by one unit. This leaves the alleles

counts ni unchanged. The switch to the new table is accepted with a probability R equal to :
Manual Arlequin ver 1.1 Methodological outlines 66

L ni j ni j (1 + δ i j )(1 + δ i j )
1. R = n +1 = 1 1 2 2 1 1 2 2
, if i ≠ j or i ≠ j
Ln ( ni j + 1)( ni j + 1) (1 + δ i j )(1 + δ i j ) 1 1 2 2
1 2 2 1 1 2 2 1

Ln +1 ni j ni 2 j 2
4
2. R= = 1 1
, if i1 = j1 and i2 = j2
Ln (ni j + 1)( ni j + 2) 1
1 2 2 1

Ln +1 ni j (ni j − 1)
1
3. R= = 1 1 2 2
, if i1 = j2 and i2 = j1
Ln (ni j + 1)( ni j + 1) 4
1 2 2 1
.

As usual δ denotes the Kronecker function. R is just the ratio of the probabilities of the two tables. The switch to

the new table is accepted if R is larger than 1.

The P-value of the test is the proportion of the visited tables having a probability smaller or equal to the

observed (initial) contingency table. The standard error on the P-value is estimated like in the case of linkage
disequilibrium using a system of batches (see section 7.1.4.1).

7.1.6Neutrality tests.

7.1.6.1Ewens-Watterson homozy gosity test

This test is based on Ewens (1972) sampling theory of neutral alleles. Watterson (1978) has shown that the
distribution of selectively neutral haplotype frequencies could be conveniently summarized by the sum of
haplotype (allele) frequencies (F), equivalent to the expected homozygosity for diploids. This test can be
performed equally well on diploid or haploid data, as the test statistic is not used for its biological meaning, but
just as a way to summarize the allelic frequency distribution. The null distribution of F is generated by
simulating random neutral samples having the same number of genes and the same number of haplotypes using
the algorithm of Stewart (1977). The probability of observing random samples with F values identical or
smaller than the original sample is recorded. This tests is currently limited to sample sizes of 2000 genes or less
and 1000 different alleles (haplotypes) or less. It can be used to test the hypothesis of selective neutrality and
population equilibrium against either balancing selection or the presence of advantageous alleles.

7.1.6.2Ewens-Watterson-Slatkin exact test

This test is essentially similar to that of Watterson (1978) test, but instead of using F as a summary statistic, it
compares the probabilities of the random samples to that of the observed sample (Slatkin 1994b, 1996). The
probability of obtaining a random sample having a probability smaller or equal to the observed sample is
recorded. The results are in general very close to those of Watterson’s homozygosity test. Note that the random
samples are generated as explained for the Ewens-Watterson homozygosity test.
Manual Arlequin ver 1.1 Methodological outlines 67

7.1.6.3Chakraborty’s test of popu lation amalgamation

This test is also based on the infinite-allele model, and on Ewens (1972) sampling theory of neutral alleles. By
simulation, Chakraborty (1990) has noticed that the number of alleles in a heterogeneous sample (drawn from
a population resulting from the amalgamation of previously isolated populations) was larger than the number of
alleles expected in a homogeneous neutral sample. He also noticed that the homozygosity of the sample was
less sensitive to the amalgamation and therefore proposed to use the mutation parameter inferred from the

homozygosity ( θ Hom
) (see section 7.1.2.3.1) to compute the probability of observing a random neutral

sample with a number of alleles similar or larger than the observed value ( Pr( K ≥ k obs ) (see section
7.1.2.3.3 to see how this probability can be computed). It is an approximation of the conditional probability of
observing some number of alleles given the observed homozygosity.

7.1.6.4Tajima’s test of selective n eutrality

Tajima’s (1989a) test is based on the infinite-site model without recombination, appropriate for short DNA
sequences or RFLP haplotypes. It compares two estimators of the mutation parameter theta ( θ = 2 Mu , with
M=2N in diploid populations or M=N in haploid populations of effective size N). The test statistic D is then
defined as

θˆπ − θˆ S
D= ,
Var (θˆπ − θˆ S )

n −1
where θˆπ = πˆ and θˆS = S / ∑ (1 / i ) , and S is the number of segregating sites in the sample. The
i =0

limits of confidence intervals around D may be found in Table 2 of Tajima’s paper (Tajima 1989a) for different
sample sizes. The P-value of the observed D under the hypothesis of population equilibrium and selective
neutrality is computed here assuming a beta-distribution limited by minimum and maximum possible D values
(see Tajima 1989a, p.589). Note that departure from the confidence interval can be due to factors other than
selective effects, like population expansion, bottleneck, or heterogeneity of mutation rates (see Tajima, 1993;
Aris-Brosou and Excoffier, 1996; or Tajima 1996, for further details).

7.2Inter-population level me thods

7.2.1Population genetic struc ture inferred by analysis of variance (AMOVA)

The genetic structure of population is investigated here by an analysis of variance framework, as initially
defined by Cockerham (1969, 1973), and extended by others (see e.g. Weir and Cockerham, 1984; Long 1986).
The Analysis of Molecular Variance approach used in Arlequin (AMOVA, Excoffier et al. 1992) is essentially
similar to other approaches based on analyses of variance of gene frequencies, but it takes into account the
number of mutations between molecular haplotypes (which first need to be evaluated).
Manual Arlequin ver 1.1 Methodological outlines 68

By defining groups of populations, the user defines a particular genetic structure that will be tested (see the
input file notations for more details). A hierarchical analysis of variance partitions the total variance into
components due to intra-individual differences, inter-individual differences, and/or inter-population differences.

See also Weir (1996), for detailed treatments of hierarchical analyses. The variance components ( σ 2 ’s) are used
i
to compute fixation indices, as originally defined by Wright (1951, 1965), in terms of inbreeding coefficients, or
later in terms of coalescent times by Slatkin (1991).
Formally, in the haploid case, we assume that the i-th haplotype frequency vector from the j-th population in the
k-th group is a linear equation of the form

x ijk = x + a k + b jk + c ijk .

The vector x is the unknown expectation of xijk, averaged over the whole study. The effects are a for group, b

for population, and c for haplotypes within a population within a group, assumed to be additive, random,

independent, and to have the associated variance components σ a2 , σ b2 , and σ c2 , respectively. The total

molecular variance ( σ 2 ) is the sum of variances due to differences among haplotypes within a population

( σ 2 ), the sum of variances due to differences among haplotypes in different populations within a group
c

( σ 2 ), and those due to differences among the G populations ( σ 2 ). The same framework could be extended
b a
to additional hierarchical levels, such as to accommodate, for instance, the variance component due to
differences between haplotypes within diploid individuals.
Note that in the case of a simple hierarchical genetic structure consisting of haploid individuals in populations,
the implemented form of the algorithm leads to a fixation index FST which is absolutely identical to the

weighted average F-statistic over loci, θˆw , defined by Weir and Cockerham (1984) (see Michalakis and
Excoffier 1996 for a formal proof). In terms of inbreeding coefficients and coalescence times, this FST can be
expressed as

f −f t −t
FST = 0 1 = 1 0 , (Slatkin, 1991)
1 − f1 t1

where f 0 is the probability of identity by descent of two different genes drawn from the same population, f1

is the probability of identity by descent of two genes drawn from two different populations, t1 is the mean

coalescence times of two genes drawn from two different populations, and t 0 is the mean coalescence time of
two genes drawn from the same population.
The significance of the fixation indices is tested using a non-parametric permutation approach described in
Excoffier et al. (1992), consisting in permuting haplotypes, individuals, or populations, among individuals,
populations, or groups of populations. After each permutation round, we recompute all statistics to get their
Manual Arlequin ver 1.1 Methodological outlines 69

null distribution. Depending on the tested statistic and the given hierarchical design, different types of
permutations are performed. Under this procedure, the normality assumption usual in analysis of variance tests
is no longer necessary, nor is it necessary to assume equality of variance among populations or groups of
populations. A large number of permutations (1,000 or more) is necessary to obtain some accuracy on the final
probability.
We have implemented here 6 different types of hierarchical AMOVA. The number of hierarchical levels varies
from two to four. In each of the situations, we describe the way the total sum of squares is partitioned, how the
variance components and the associated F-statistics are obtained, and which permutation schemes are used for
the significance test.
Before enumerating all the possible situations, we introduce some notations:
SSD(T) : Total sum of squared deviations.
SSD (AG) : Sum of squared deviations Among Groups of populations.
SSD (AP) : Sum of squared deviations Among Populations.
SSD (AI) : Sum of squared deviations Among Individuals.
SSD (WP) : Sum of squared deviations Within Populations.
SSD (WI) : Sum of squared deviations Within Individuals.
SSD (AP/WG) : Sum of squared deviations Among Populations, Within Groups.
SSD (AI/WP) : Sum of squared deviations Among Individuals, Within Populations.
G : Number of groups in the structure.
P : Total number of populations.
N : Total number of individuals for genotypic data or total number of gene copies for
haplotypic data.

Np : Number of individuals in population p for genotypic data or total number of gene

copies in population p for haplotypic data.

Ng : Number of individuals in group g for genotypic data or total number of gene copies

in group g for haplotypic data..

7.2.1.1Haplotypic data, one grou p of populations

Source of variation Degrees of freedom Sum of squares (SSD) Variance component

Among Populations P-1 SSD(AP)
nσ a2 + σ b2
Within Populations N-P SSD(WP)
σ b2
Total N-1 SSD(T)
σ T2

Where n and FST are defined by

N 2p
N− ∑ N
p
n= ,
P −1
Manual Arlequin ver 1.1 Methodological outlines 70

σ a2
FST = .
σ T2

• We test σ a2 and FST by permuting haplotypes among populations.

7.2.1.2Haplotypic data, several g roups of populations

Source of variation Degrees of freedom Sum of squares (SSD) Variance components

Among Groups G -1 SSD(AG)
n’’σ a2 + n’σ b2 + σ c2
Among Populations /
Within Groups
P-G SSD(AP/WG)
nσ b2 + σ c2

Within Populations N-P SSD(WP)

σ c2
Total: N-1 SSD(T)
σ T2

Where the n’s and the F-statistics are defined by:

N 2p N − SG
SG = ∑∑N , n=
P−G
,
g ∈G p∈g g

N 2p N g2
SG − ∑
N
N− ∑ N
p∈P g ∈G
n’= , n’’=
G −1 G −1

σ a2 σ b2 σ a2 + σ b2
FCT = , FSC = and FST =
σ T2 σ b2 + σ c2 σ T2

• We test σ c2 and FST by permuting haplotypes among populations among groups.

• We test σ b2 and FSC by permuting haplotypes among populations within groups.

• We test σ a2 and FCT by permuting populations among groups.

7.2.1.3Genotypic data, one group of populations, no within- individual level

Source of variation Degrees of freedom Sum of squares (SSD) Variance components

Among Populations P-1 SSD(AP)
nσ a2 + σ b2
Within Populations 2N - P SSD(WP)
σ b2
Total: 2N - 1 SSD(T)
σ T2
Manual Arlequin ver 1.1 Methodological outlines 71

Where n and FST are defined by

2 N 2p
2N − ∑
N
n= P ,
P −1
σ a2
FST = .
σ T2
If the gametic phase is know:
• We test σ 2 and FST by permuting haplotypes among populations.
a
If the gametic phase is unknown:
• We test σ 2 and FST by permuting individual genotypes among populations.
a

7.2.1.4Genotypic data, several g roups of populations, no within- individual level

Source of Variation Degrees of freedom Sum of squares (SSD) Variance components

Among Groups G -1 SSD(AG)
n’’σ a2 + n’σ b2 + σ c2
Among Populations /
Within Groups
P-G SSD(AP/WG)
nσ b2 + σ c2

Within Populations 2N - P SSD(WP)

σ c2
Total: 2N - 1 SSD(T)
σ T2

Where the n’s and the F-statistics are defined by:

2 N 2p 2 N − SG
SG = ∑∑ Ng
, n=
P−G
,
g ∈G p∈ g

2 N 2p 2 N g2
SG − ∑
N
2N − ∑ N
p∈P g ∈G
n’= , n’’= ,
G −1 G −1
σ a2 σ a2 + σ b2 σ b2
FCT = , FST = and FSC = .
σ T2 σ T2 σ b2 + σ c2
If the gametic phase is known:
• We test σ 2 and FST by permuting haplotypes among populations and among groups.
c
• We test σ 2 and FSC by permuting haplotypes among populations but within groups.
b

If the gametic phase is not known:

Manual Arlequin ver 1.1 Methodological outlines 72

• We test σ c2 and FST by permuting individual genotypes among populations and among groups.

• We test σ b2 and FSC by permuting individual genotypes among populations but within groups.

In all cases:
• We test σ a2 and FCT by permuting whole populations among groups.

7.2.1.5Genotypic data, one popu lation, within- individual level

Source of variation Degrees of freedom Sum of squares (SSD) Variance component

Among Individuals N-1 SSD(AI)
2σ a2 + σ b2
Within Individuals N SSD(WI)
σ b2
Total: 2N - 1 SSD(T)
σ T2

Where FIS is defined as:

σ a2
FIS = .
σ T2

• We test σ a2 and FIS by permuting haplotypes among individuals.

7.2.1.6Genotypic data, one group of populations, within- individual level

Source of Variation Degrees of freedom Sum of squares (SSD) Variance component
Among Populations P -1 SSD(AP)
nσ a2 + 2σ b2 + σ c2
Among Individuals /
Within Populations
N–P SSD(AI/WP)
2σ b2 + σ c2

Within Individuals N SSD(WI)

σ c2
Total 2N – 1 SSD(T)
σ T2

Where n and the F-statistics are defined by:

2 N 2p
2N − ∑ N
p∈ P
n=
P −1
σ a2 σ 2 + σ b2 σ b2
FST = , FIT = a and FIS = .
σ T2 σ T2 σ b2 + σ c2

• We test σ c2 and FIT by permuting haplotypes among individuals among populations.

Manual Arlequin ver 1.1 Methodological outlines 73

• We test σ b2 and FIS by permuting haplotypes among individuals within populations.

• We test σ a2 and FST by permuting individual genotypes among populations.

7.2.1.7Genotypic data, several g roups of populations, within- individual level

Source of Variation: Degrees of freedom Sum of squares (SSD) Variance component

Among Groups G -1 SSD(AG)
n’’σ a2 + n’σ b2 + 2σ c2 + σ d2
Among Populations /
Within Groups
P–G SSD(AP/WG)
nσ b2 + 2σ c2 + σ d2

Among Individuals /
Within Populations
N-P SSD(AI/WP)
2σ c2 + σ d2

Within Individuals N SSD(WI)

σ d2
Total: 2N – 1 SSD(T)
σ T2

Where the n's and the F-statistics are defined by:

2 N 2p (N − N g ) ∑ 2 N g2
2N − ∑∑ Ng ∑ Ng
∑ 2 N 2p 2N −
g ∈G
g ∈G p∈ g g ∈G p∈ g N
n= , n’= , n’’=
P−G N (G − 1) G −1

σ a2 σ a2 + σ b2 + σ c2 σ c2 σ b2
FCT = , FIT = , FIS = and FSC = .
σ T2 σ T2 σ c2 + σ d2 σ b2 + σ c2 + σ d2
• We test σ d2 and FIT by permuting haplotypes among populations and among groups.

• We test σ c2 and FIS by permuting haplotypes among individuals within populations.

• We test σ b2 and FSC by permuting individual genotypes among populations but within groups.

• We test σ a2 and FCT by permuting populations among groups.

7.2.2Population pairwise gen etic distances

The pairwise FST s can be used as short-term genetic distances between populations, with the application of a
slight transformation to linearize the distance with population divergence time (Reynolds et al. 1983; Slatkin,
1995).
The pairwise FST values are given in the form of a matrix.

The null distribution of pairwise FST values under the hypothesis of no difference between the populations is
obtained by permuting haplotypes between populations. The P-value of the test is the proportion of permutations
leading to a FST value larger or equal to the observed one. The P-values are also given in matrix form.

Three other matrices are computed from the FST values:

Manual Arlequin ver 1.1 Methodological outlines 74

• A matrix of coancestry coefficients (Reynolds et al. 1983):

Since FST between pairs of stationary haploid populations of size N having diverged t generations ago
varies approximately as
1 t
FST = 1 − (1 − ) ≈ 1 − e −t / N
N
The genetic distance D = − log(1 − FST ) is thus approximately proportional to t/N for short divergence
times.

• A matrix of Slatkin linearized FST’s (Slatkin 1995):

Slatkin considers a simple demographic model where two haploid populations of size N have diverged
τ generations ago from a population of identical size. These two populations have remained isolated ever
since, without exchanging any migrants. Under such conditions, FST can be expressed in terms of the

coalescence times t1 , which is the mean coalescence time of two genes drawn from two different

populations, and t 0 which is the mean coalescence time of two genes drawn from the same population.

Using the analysis of variance approach, the FST ’s are expressed as

t −t
FST = 1 0 (Slatkin, 1991, 1995)
t1

Because, t 0 is equal to N generations (see e.g. Hudson, 1990), and t1 is equal to τ + N generations, the
above expression reduces to
τ
FST = .
τ +N
Therefore, the ratio D = FST /(1 − FST ) is equal to τ / N , and is therefore proportional to the
divergence time between the two populations.

• A matrix of M values (M = Nm for haploid populations, M = 2Nm for diploid populations).

This matrix is computed under very different assumptions than the two previous matrices. Assume that
two populations of size N exchange a fraction m of migrants each generation, and that the mutation rate

u is negligible as compared to the migration rate m. In this case, we have the following simple
relationship at equilibrium between migration and drift,
1
FST =
2M + 1
Therefore, M, which is the absolute number of migrants exchanged between the two populations, can be
estimated by
1− FST
M=
2 FST
Manual Arlequin ver 1.1 Methodological outlines 75

7.2.3Exact tests of population differentiation

We test the hypothesis of a random distribution of k different haplotypes or genotypes among r populations as
described in Raymond and Rousset (1995). This test is analogous to Fisher’s exact test on a 2x2 contingency
table extended to a rxk contingency table. All potential states of the contingency table are explored with a
Markov chain similar to that described for the case of the linkage disequilibrium test (section 7.1.4.1). During
this random walk between the states of the Markov chain, we estimate the probability of observing a table less or
equally likely than the observed sample configuration under the null hypothesis of panmixia.
For haplotypic data, the table is built using sample haplotype frequencies (Raymond and Rousset 1995).
For genotypic data with unknown gametic phase, the contingency table is built from sample genotype
frequencies (Goudet et al. 1996).
As it was done previously, an estimation of the error on the P-value is done by partitioning the total number of
steps into a given number of batches (see section 7.1.4.1).
Manual Arlequin ver 1.1 Appendix 76

8APPENDIX

8.1Overview of input file key words

Keywords Description Possible values

[Profile]
Title A title describing the present A string of alphanumeric characters within double
analysis quotes
NbSamples The number of different A positive integer larger than zero
samples listed in the data file
DataType The type of data to be analyzed STANDARD,
(only one type of data per DNA,
project file is allowed) RFLP,
MICROSAT,
FREQUENCY
GenotypicData Specifies if genotypic or 0 (haplotypic data),
gametic data is available 1 (genotypic data)
LocusSeparator The character used to separate WHITESPACE,
adjacent loci TAB,
NONE,
or any character other than "#", or the character
specifying missing data
Default: WHITESPACE
GameticPhase Specifies if the gametic phase is 0 (gametic phase not known),
known (for genotypic data 1 (known gametic phase)
only) Default: 1
RecessiveData Specifies whether recessive 0 (co-dominant data),
alleles are present at all loci (for 1 (recessive data)
genotypic data) Default: 0
RecessiveAllele Specifies the code for the Any string within quotation marks
recessive allele This string can be explicitly used in the input file to
indicate the occurrence of a recessive homozygote
at one or several loci.
Default: "null"
MissingData A character used to specify the "?" or any character within quotes, other than those
code for missing data previously used
Default: "?"
Frequency Specifies the format of ABS (absolute values),
haplotype frequencies REL (relative values: absolute values will be found
by multiplying the relative frequencies by the
sample sizes)
Default: ABS
Manual Arlequin ver 1.1 Appendix 77

CompDistMatrix Specifies if the distance matrix 0 (use any specified distance matrix),
has to be computed from the 1 (compute distance matrix from haplotypic
data information)
Default: 0
FrequencyThreshold The minimum frequency a A real number between 1e-2 and 1e-7.
haplotype has to reach for being Default: 1e-5
listed in any output file
EpsilonValue The EM algorithm A real number between 1e-7 and 1e-12.
convergence criterion. (For Default: 1e-7
advanced users only)

Keywords Description Possible values

[Data]
[[HaplotypeDefinition]] (facultative section)
HaplListName The name of a haplotype A string within quotation marks
definition list
HaplList The list of haplotypes listed A series of haplotype definitions given on separate
within braces ({...}) lines for each haplotype. Each haplotype is defined
by a haplotype label and a combination of alleles at
different loci. The Keyword EXTERN followed by
a string within quotation marks may be used to
specify that a given haplotype list is in a different
file

Keywords Description Possible values

[Data]
[[DistanceMatrix]] (facultative section)
MatrixName The name of the distance matrix A string within quotation marks
MatrixSize The size of the matrix A positive integer larger than zero (corresponding to
the number of haplotypes listed in the haplotype list)
LabelPosition Specifies whether haplotypes ROW (the haplotype labels will be entered
labels are entered by row or by consecutively on one or several lines, within the
column MatrixData segment, before the distance matrix
elements),
COLUMN (the haplotype labels will be entered as
the first column of each row of the distance matrix
itself )
MatrixData The matrix data itself listed The matrix data will be entered as a format-free
within braces ({...}) lower-diagonal matrix. The haplotype labels can be
either entered consecutively on one or several lines
(if LabelPosition=ROW), or entered at the first
column of each row (if labelPosition=COLUMN).
The special keyword EXTERN may be used
followed by a file name within quotation marks,
stating that the data must be read in an another file
Manual Arlequin ver 1.1 Appendix 78

Keywords Description Possible values

[Data]
[[Samples]]
SampleName The name of the sample. This A string within quotation marks
keyword is used to mark the
beginning of a sample definition
SampleSize Specifies the sample size An integer larger than zero.
For haplotypic data, it must specify the number
of gene copies in the sample.
For genotypic data, it must specify the number of
individuals in the sample.
SampleData The sample data listed within The keyword EXTERN may be used followed by
braces ({...}) a file name within quotation marks, stating that
the data must be read in a separate file. The
SampleData keyword ends a sample definition

Keywords Description Possible values

[Data]
[[Structure]] (facultative section)
StructureName The name of a given genetic A string of characters within quotation marks
structure to test
NbGroups The number of groups of An integer larger than zero
populations
IndividualLevel Specifies whether the level of 0 (the component of variance due to differences
genetic variability within between haplotypes within individuals will be
individuals has to be taken into ignored )
account (for genotypic data 1 (the component of variance due to differences
only) between haplotypes within individuals, and its
associated statistics will be computed)
Group The definition of a group of A series of strings within quotation marks all
samples, identified by their enclosed within braces, and, if desired, on separate
SampleName listed within lines
braces ({...})
Manual Arlequin ver 1.1 References 79

9REFERENCES

Abramovitz, M., and I. A. Stegun, 1970 Handbook of Mathematical Functions. Dover, New York.

Aris-Brosou, S., and L. Excoffier, 1996 The impact of population expansion and mutation rate heterogeneity on
DNA sequence polymorphism. Mol. Biol. Evol. 13: 494-504.

Cavalli-Sforza, L. L., and W. F. Bodmer, 1971 The Genetics of Human Populations. W.H. Freeman and Co., San
Francisco, CA.

Chakraborty, R. 1990 Mitochondrial DNA polymorphism reveals hidden heterogeneity within some Asian
populations. Am. J. Hum. Genet. 47:87-94.

Chakraborty, R., and K. M. Weiss, 1991 Genetic variation of the mitochondrial DNA genome in American
Indians is at mutation-drift equilibrium. Am. J. Hum. Genet. 86: 497-506.
Cockerham, C. C., 1969 Variance of gene frequencies. Evolution 23: 72-83.

Cockerham, C. C., 1973 Analysis of gene frequencies. Genetics 74: 679-700.

Dempster, A., N. Laird and D. Rubin, 1977 Maximum likelihood estimation from incomplete data via the EM
algorithm. J Roy Statist Soc 39: 1-38.

Efron, B. 1982 The Jacknife, the Bootstrap and other Resampling Plans. Regional Conference Series in Applied
Mathematics, Philadelphia:.

Ewens, W.J. 1972 The sampling theory of selectively neutral alleles. Theor. Popul. Biol. 3:87-112.

Ewens, W.J. 1977 Population genetics theory in relation to the neutralist-selectionist controversy. In: Advances
in human genetics, edited by Harris, H. and Hirschhorn, K.New York:Plenum Press,p. 67-134.

Excoffier, L., Smouse, P., and Quattro, J. 1992 Analysis of molecular variance inferred from metric distances
among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics 131:479-
491.

Excoffier, L. and M. Slatkin. 1995 Maximum-likelihood estimation of molecular haplotype frequencies in a

diploid population. Mol. Biol. Evol. 12:921-927

Excoffier, L., and M. Slatkin, 1998 Incorporating genotypes of relatives into a test of linkage disequilibrium.
Am. J. Hum. Genet. (January issue)

Goudet, J., M. Raymond, T. de Meeüs and F. Rousset, 1996 Testing differentiation in diploid populations.
Genetics 144: 1933-1940.

Guo, S. and Thompson, E. 1992 Performing the exact test of Hardy-Weinberg proportion for multiple alleles.
Biometrics 48:361-372.

Harpending, R. C., 1994 Signature of ancient population growth in a low-resolution mitochondrial DNA
mismatch distribution. Hum. Biol. 66: 591-600.
Manual Arlequin ver 1.1 References 80

Hudson, R. R., 1990 Gene genealogies and the coalescent proces, pp. 1-44 in Oxford Surveys in Evolutionary
Biology, edited by Futuyama, and J. D. Antonovics. Oxford University Press, New York.

Jukes, T. and Cantor, C. 1969 Evolution of protein molecules. In: Mammalian Protein Metabolism, edited by
Munro HN, New York:Academic press, p. 21-132.

Kimura, M. 1980 A simple method for estimating evolutionary rate of base substitution through comparative
studies of nucleotide sequences. J. Mol. Evol. 16:111-120.

Kumar, S., Tamura, K., and M. Nei. 1993 MEGA, Molecular Evolutionary Genetic Analysis ver 1.0.The
Pennsylvania State University, University Park, PA 16802.

Lange, K., 1997 Mathematical and Statistical Methods for Genetic Analysis. Springer, New York.
Levene H. (1949). On a matching problem arising in genetics. Annals of Mathematical Statistics 20, 91-94.

Lewontin, R. C. (1964) The interaction of selection and linkage. I. General considerations; heterotic models.
Genetics 49: 49-67.

Lewontin, R. C., and K. Kojima. (1960) The evolutionary dynamics of complex polymorphisms. Evolution 14:
450-472.

Long, J. C., 1986 The allelic correlation structure of Gainj and Kalam speaking people. I. The estimation and
interpretation of Wright’s F-statistics. Genetics 112: 629-647.

Michalakis, Y. and Excoffier, L. , 1996 A generic estimation of population subdivision using distances between
alleles with special reference to microsatellite loci. Genetics 142:1061-1064.

Nei, M., 1987 Molecular Evolutionary Genetics. Columbia University Press, New York, NY, USA.

Raymond M. and F. Rousset. 1994 GenePop. ver 3.0. Institut des Sciences de l'Evolution. Université de
Montpellier, France.

Raymond M. and F. Rousset. 1995 An exact tes for population differentiation. Evolution 49:1280-1283.

Reynolds, J., Weir, B.S., and Cockerham, C.C. 1983 Estimation for the coancestry coefficient: basis for a short-
term genetic distance. Genetics 105:767-779.

Rice, J.A. 1995 Mathematical Statistics and Data Analysis. 2nd ed. Duxburry Press: Belmont, CA

Rogers, A., 1995 Genetic evidence for a Pleistocene population explosion. Evolution 49: 608-615.

Rogers, A. R., and H. Harpending, 1992 Population growth makes waves in the distribution of pairwise genetic
differences. Mol. Biol. Evol. 9: 552-569.

Rousset, F., 1996 Equilibrium values of measures of population subdivision for stepwise mutation processes.
Genetics 142: 1357-1362.

Slatkin, M., 1991 Inbreeding coefficients and coalescence times. Genet. Res. Camb. 58: 167-175.

Slatkin, M. 1994a Linkage disequilibrium in growing and stable populations. Genetics 137:331-336.

Slatkin, M. 1994b An exact test for neutrality based on the Ewens sampling distribution. Genet. Res. 64(1):71-
74.
Manual Arlequin ver 1.1 References 81

Slatkin, M., 1995 A measure of population subdivision based on microsatellite allele frequencies. Genetics 139:
457-462.

Slatkin , M., 1996 A correction to the exact test based on the Ewens sampling distribution. Genet. Res. 68: 259-
260.

Slatkin, M. and Excoffier, L. 1996 Testing for linkage disequilibrium in genotypic data using the EM algorithm.
Heredity 76:377-383.

Stewart, F. M. 1977 Computer algorithm for obtaining a random set of allele frequencies for a locus in an
equilibrium population. Genetics 86:482-483.

Strobeck, K., 1987 Average number of nucleotide differences in a sample from a single subpopulation: A test for
population subdivision. Genetics 117: 149-153.

Tajima, F., 1983 Evolutionary relationship of DNA sequences in finite populations. Genetics 105: 437-460.

Tajima, F. 1989a. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism.
Genetics 123:585-595,.

Tajima, F. 1989b. The effect of change in population size on DNA polymorphism. Genetics 123:597-601,.

Tajima, F. 1993. Measurement of DNA polymorphism. In: Mechanisms of Molecular Evolution. Introduction to
Molecular Paleopopulation Biology, edited by Takahata, N. and Clark, A.G., Tokyo, Sunderland,
MA:Japan Scientific Societies Press, Sinauer Associates, Inc., p. 37-59.

Tajima, F. and Nei, M. 1984. Estimation of evolutionary distance between nucleotide sequences. Mol. Biol.
Evol. 1:269-285.

Tajima, F., 1996 The amount of DNA polymorphism maintained in a finite population when the neutral mutation
rate varies among sites. Genetics 143: 1457-1465.

Tamura, K., 1992 Estimation of the number of nucleotide substitutions when there are strong transition-
transversion and G+C content biases. Mol. Biol. Evol. 9: 678-687.

Tamura, K., and M. Nei, 1993 Estimation of the number of nucleotide substitutions in the control region of
mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10: 512-526.

Uzell, T., and K. W. Corbin, 1971 Fitting discrete probability distribution to evolutionary events. Science 172:
1089-1096.

Watterson, G., 1975 On the number of segregating sites in genetical models without recombination.
Theor.Popul.Biol. 7: 256-276.

Watterson, G. 1978. The homozygosity test of neutrality. Genetics 88:405-417

Watterson, G. A., 1986 The homozygosity test after a change in population size. genetics 112: 899-907.

Weir, B. S., 1996 Genetic Data Analysis II: Methods for Discrete Population Genetic Data. Sinauer Assoc., Inc.,
Sunderland, MA, USA.
 Manual Arlequin ver 1.1 References 82

Weir, B.S. and Cockerham, C.C. 1984 Estimating F-statistics for the analysis of population structure. Evolution
38:1358-1370.
Wright, S., 1951 The genetical structure of populations. Ann.Eugen. 15: 323-354.

Wright, S., 1965 The interpretation of population structure by F-statistics with special regard to systems of
mating. Evol 19: 395-420.

Zouros, E., 1979 Mutation rates, population sizes and amounts of electrophoretic variation of enzyme loci in
natural populations. Genetics 92: 623-646.

View publication stats