Scribd
Upload
46 views3 pages

Worksheet 8.1 BiotechnologyandGMO

1. E. coli is a common host organism for recombinant DNA technology due to its rapid growth and well-understood genetics. 2. Many people with diabetes require treatment with human insulin to regulate their blood sugar levels. Producing human insulin through genetically modified E. coli could help meet the global demand for insulin in a cost-effective way. 3. The student proposes using recombinant DNA techniques to insert the human gene for insulin into E. coli so that the bacteria will then be able to produce and secrete human insulin during fermentation, providing an alternative way to manufacture the life-saving drug at large scale.

Uploaded by

Jevan Monte Racaza
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
46 views3 pages

Worksheet 8.1 BiotechnologyandGMO

1. E. coli is a common host organism for recombinant DNA technology due to its rapid growth and well-understood genetics. 2. Many people with diabetes require treatment with human insulin to regulate their blood sugar levels. Producing human insulin through genetically modified E. coli could help meet the global demand for insulin in a cost-effective way. 3. The student proposes using recombinant DNA techniques to insert the human gene for insulin into E. coli so that the bacteria will then be able to produce and secrete human insulin during fermentation, providing an alternative way to manufacture the life-saving drug at large scale.

Uploaded by

Jevan Monte Racaza
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
You are on page 1/ 3

Name : Angelo Racaza_________________________________________ Date: 05-24-

2021_________

Year and Section: 1st Year STS-D1___________Group No. _________ Score:

Professor/Instructor: Clyde Salanatin_______________________

ACTIVITY 21

A. Research on the following terms:

1. Chargaff’s rule
2. Restriction Enzyme
3. Sexual incompatibility barrier
4. Gene pole
5. Osteoarthritis
6. Aortic aneurysm
7. Duchenne muscular dystrophy
8. Huntington disease
9. Fragile X-syndrome
10.Breast cancer disposition gene BRCA 1 and BRCA 2
11.p53 gene
12.amalgamation
13.mitigation
14.DNA barcodes
15.transcriptomics

B. Identification of unknown gene

The researcher had isolated the human gene with the following nitrogenous base
sequence:

AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGT
GGGCTCAGGATTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCG

Using the Basic Local Alignment Search Tool (BLAST), determine the protein that
is coded by the nucleotide sequence.

Direction:

1. Open the website of BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi), and click the


“Nucleotide Blast” (pointed by the arrow).
2. Click the “blastn” (upper left arrow).
3. Enter the given nucleotide sequence in the box (pointed by the left arrow).
4. Scroll down and click "BLAST". Wait for a few seconds or minutes while the
software is analyzing your entry.
Answer the following:

a. Request ID (RID): ATF1A5T9016


b. Query ID: lcl|Query_40513
c. Molecule Type: dna
d. Query Length: 140
e. Description: None
f. Program: BLASTN
g. Name of the protein coded by the sequence- Insulin
h. List at least five organisms that possess that gene. Rhesus Monkey, Silvery
Gibbon, Western Gorilla, Sumatran Orangutan and Mandrill
i. What is the function of the protein? It regulates the amount of nutrients
circulating in your bloodstream. Although insulin is mostly implicated in blood
sugar management, it also affects fat and protein metabolism.
j. What happened to the person when a gene that codes for that protein mutates?
k. How that person’s disorder could be treated?

C. If you know how to do recombinant DNA technology, what organism you want to
modify, and why? You can use extra sheets to answer.

You might also like