3rd Sec Final Revision 1
3rd Sec Final Revision 1
a. UAA b. AUG
c. UGA d. UAG
……………………………………………………………………………………………………………………………………………
……………………………………………………………………………………………………………………………………………
……………………………………………………………………………………………………………………………………………
……………………………………………………………………………………………………………………………………………
3.For the synthesis of a protein composed of 150 amino acids , the number
of nucleotides on mRNA should be………….at least
a. 50 b. 150
c. 300 d. 450
……………………………………………………………………………………………………………………………………………
……………………………………………………………………………………………………………………………………………
……………………………………………………………………………………………………………………………………………
……………………………………………………………………………………………………………………………………………
4.With the help of the following diagram that
represents a part of DNA molecule . put the
suitable number infront of each of the
following:
a. Deoxyribose sugar ( )
b. A weak hydrogen bond ( )
c. The phosphate group ( )
d. The nitrogenous base ( )
………………………………………………………………………………………………………………………………
………………………………………………………………………………………………………………………………
………………………………………………………………………………………………………………………………
………………………………………………………………………………………………………………………………
3..TACCCCTTTTACTCCTTTGGGCACGCGATT…5
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
11.If there was a protein composed of 300 amino acids , therefore the
number of turns of DNA molecule that will be transcribed to form this
protein is approximately…………turns
a. 15 b. 45
c. 45 d. 90
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
12.if the number of nucleotides on a segment of DNA strand from which
the mRNA is transcribed equals (X) , so the number of amino acids that
forms the produced polypeptide equals…………
a. X b. X-1
c. 3X-3 d. X-3/3
………………………………………………………………………………………………………………………………………
………………………………………………………………………………………………………………………………………
……………………………………………………………………………….………………………………………
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
18.If the sequence of nucleotides in one strand of DNA segment runs , as
follows:
5… C – T – G – A – A – T – T – C – A – G…3
(a) Write this sequence and the complementary sequence of
nucleotides of the other strand for the same segment of DNA
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
(b) If you have a restriction enzymes and its recognition site is
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
(c) Write the nucleotides sequence in the resulted segments from
the action of this restriction enzyme on the two strands of DNA
segment
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
Mention :
24.All corn plants contain the ZmLA1 gene. Some corn plants contain a
certain mutation in the ZmLA1 gene. The graph below shows the
amount of ZmLA1 RNA produced in plants with the normal gene and
in plants with the mutated gene.
gene?
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
25.Methylation is a process that can add
methyl (CH3) groups to DNA. A gene containing methylated
nucleotides often cannot be transcribed. As a result, proteins will not
be produced. Which of the following cellular processes is most directly
affected by DNA methylation?
(c) replication
(d) respiration
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
26.The table below contains statements which may be TRUE or FALSE
concerning DNA replication and mRNA synthesis in eukaryotic cell.
Which line in the table is correct?
CTCACACCGTAGCAAATTTAG
During translation of mRNA made from the above sequence, how many of
the tRNA anticodons will have at least one uracil base?
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
28.Analysis of a molecule of DNA found it to contain 200 adenine bases,
20% of the total number of bases in the strand. How many phosphate
groups did it contain?
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
29.A piece of DNA was analysed and 15% of its nucleotides were
adenine. What percentage would be uracil?
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
30.The graph shows how temperature changes during repeated cycles of a
polymerase chain reaction (PCR). If there were 500 molecules of DNA at the
start, predict how many copies there will be after 20 minutes.
(a) 3000
(b) 8000
(c) 2500
(d) 2000
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………
31. DNA from a mother, child and four men (A, B, C and D) in a paternity suit
was analysed. The DNA was amplified using PCR and separated. From the
results shown in the diagram, identify the likely father of the child.
…………………………………………………………………………………………………………………………………
…………………………………………………………………………………………………………………………………
………………………………………………………………………………………….………………………………………