Fish and Shellfish Immunology 93 (2019) 449–462

Contents lists available at ScienceDirect

Fish and Shellfish Immunology

journal homepage: www.elsevier.com/locate/fsi

Full length article

Molecular, transcriptional and functional delineation of Galectin-8 from T

black rockfish (Sebastes schlegelii) and its potential immunological role
Rajamanthrilage Kasun Madusankaa, Thanthrige Thiunuwan Priyathilakaa, N.D. Jansona,b,
T.D.W. Kasthuriarachchia, Sumi Junga, M.D. Neranjan Tharukaa,b, Jehee Leea,b,*
a
Department of Marine Life Sciences & Fish Vaccine Research Center, Jeju National University, Jeju Self-Governing Province, 63243, Republic of Korea
b
Marine Science Institute, Jeju National University, Jeju Self-Governing Province, 63333, Republic of Korea

ARTICLE INFO ABSTRACT

Keywords: Galectins are β-galactoside-binding lectins, which are involved in pattern recognition, cell adhesion, and sti-
Agglutination mulation of the host innate immune responses against microbial pathogens. In spite of several functional studies
Carbohydrate binding domain on different galectins isolated from vertebrates and invertebrates, this is the first report to present functional
Galectin-8 studies for galectin-8 from the marine teleost tissues. In the present study, we characterized galectin-8 homolog
Immunity
from black rockfish (Sebastes schlegelii), in molecular and functional aspects. Rockfish galectin-8 (SsGal8) was
Rockfish
found to consist of a 969 bp long open reading frame (ORF), encoding a protein of 322 amino acids and the
predicted molecular weight was 35.82 kDa. In silico analysis of SsGal8 revealed the presence of two carbohydrate
binding domains (CRDs), at both N and C-termini and a linker peptide of 40 amino acids, in between the two
domains. As expected, the phylogenetic tree categorized SsGal8 as a tandem-repeat galectin, and ultimately
positioned it in the sub-clade of fish galectin-8. rSsGal8 was able to strongly agglutinate fish erythrocytes and the
inhibition of agglutination was successfully exhibited by lactose and D-galactose. Bacterial agglutination assay
resulted in agglutination of both Gram (+) and Gram (−) bacteria, including Escherichia coli, Vibrio harveyi,
Vibrio parahaemolyticus, Streptococcus parauberis, Lactococcus garvieae, Streptococcus iniae and Vibrio tapetis. The
tissue distribution analysis based on qPCR assays, revealed a ubiquitous tissue expression of SsGal8 for the
examined rockfish tissues, with the most pronounced expression in blood, followed by brain, intestine, head
kidney and kidney. Furthermore, the mRNA transcription level of SsGal8 was significantly up-regulated in
spleen, liver and head kidney, upon immune challenges with Streptococcus iniae, LPS and poly I:C, in a time
dependent manner. Taken together, these findings strongly suggest the contribution of SsGal8 in regulating
innate immune responses to protect the rockfish from bacterial infections.

1. Introduction molecular patterns (DAMPs) [3] that are originated from damaged
cells.
The innate immune system, as the first line of defense mechanism, Among the lectins, galectins are a family of proteins comprising 17
instigates the acquired immunity to resist and eradicate invading pa- members, with a characteristic binding specificity towards β -galacto-
thogens in higher vertebrates [1]. These immune responses are initiated side moieties of cellular glycoconjugates [4]. Depending on the domain
by the recognition of conserved molecular patterns named as pathogen architecture and diversity, galectins are primarily categorized in to
associated molecular patterns (PAMPs), such as bacterial DNA, viral three main sub-types: proto-type, chimera-type, and tandem-repeated
dsDNA, fungal β-1, 3-glucan, and bacterial cell wall lipopolysaccharides galectins [5]. Primarily, both proto-type and chimera-type consist of a
and peptidoglycans [1]. The receptors specialized for the recognition of single Carbohydrate binding domain (CRD), though the chimera-type
PAMPs are termed as pattern recognition receptors (PRRs) [2]. PRRs has an additionally extended non-lectin N-terminal stretch, rich in
can bind PAMPs and trigger host immune protective mechanisms proline, glycine, and tyrosine repeat units, bound to the CRD [6]. Proto-
against the microbial invaders. Studies have proven that PRRs are also type and chimera-type galectins form dimers and multimers respec-
responsible for sensing molecules known as damage associated tively, whereas tandem-repeat galectins deliver functions in their

*
Corresponding author. Marine Molecular Genetics Lab, Department of Marine Life Sciences, College of Ocean Science, Jeju National University, 66 Jejudaehakno,
Ara-Dong, Jeju, 690-756, Republic of Korea.
E-mail address: [email protected] (J. Lee).

https://doi.org/10.1016/j.fsi.2019.07.072
Received 14 March 2019; Received in revised form 18 July 2019; Accepted 24 July 2019
Available online 25 July 2019
1050-4648/ © 2019 Elsevier Ltd. All rights reserved.
R.K. Madusanka, et al. Fish and Shellfish Immunology 93 (2019) 449–462

monomeric form [7,8]. In addition, the tandem-repeated type consists 2.2. SsGal8 sequence identification and characterization
of two CRDs, covalently linked to each other by a linker peptide se-
quence [9]. Usually, galectins lack a signal peptide sequence, by which The cDNA contig, corresponding to SsGal8, was identified from the
proteins are secreted out of the cells [6]. Galectins mediate many im- rockfish transcriptome database using the Basic Local Alignment Search
mune functions by regulating the migration of neutrophils and mono- Tool (BLAST) [26] algorithm (https://blast.ncbi.nlm.nih.gov/Blast.cgi).
cytes, pathogen recognition and attachment to the host cell, T and B cell In order to confirm the presence of correct nucleotide sequence, a TA
survival and TCR signaling [10]. Furthermore, galectins can regulate cloning was performed. Thereafter, the ORF finder online tool (https://
cytokine functions and mediate their expression, secretion, and sig- www.ncbi.nlm.nih.gov/orffinder/) was used to determine the open
naling [11]. reading frame (ORF) and the putative amino acid sequence. The pro-
Galectin-8 is a member of tandem repeat galectins bearing a strong teins homologous to SsGal8 were obtained from BLAST search, and the
modulatory activity in innate and adaptive immunity. The N-terminal pairwise sequence alignment and multiple sequence alignment was
CRD exerts higher binding affinity to α-2,3-sialylated glycans compared conducted using EMBOSS Needle (https://www.ebi.ac.uk/Tools/psa/
to the C-terminal CRD, which possesses a different carbohydrate spe- emboss_needle/) and ClustalW multiple sequence alignment tools
cificity [12]. Galectin-8 mediates many cellular functions including cell (BioEdit) respectively. Functional domains and motifs of SsGal8 were
adhesion, and cell growth [13], and acts as a regulator of inflammation predicted by means of several databases and online tools such as, Ex-
[14]. Several functional studies have proven the agglutination potency PASy PROSITE (http://prosite.expasy.org/), Motif Scan (http://myhits.
of galectins, highlighting their involvement in glycan recognition, as- isb-sib.ch/cgi-bin/motif_scan), and SMART (http://smart.embl-
sociated with immunological functions. For example, recombinant ga- heidelberg.de/). Furthermore, important physical and chemical para-
lectin-1, -2, -9 have shown successful bacterial agglutinations in ex- meters, such as molecular weight and isoelectric point, were de-
perimental assays [14–16]. Although, several fish galectins have been termined using the ExPASy ProtParam tool (http://web.expasy.org/
identified and well characterized molecularly, and even functionally, protparam). Phylogenetic relationships were assessed using the MEGA
the attention drawn by galectin-8 remains fairly less. So far, among the (version 6.0) software, by applying the Neighbor-Joining (NJ) method
limited number of reports published on characterization of tandem- at 5000 bootstrap replications. The Swiss Model online tool was used to
repeat galectins from fish, galectin-9 from Labeo rohita [17], galectin-8 predict the protein tertiary structures, and protein structures were
from Oreochromis niloticus [18], and recently galectin-4 from Scoph- modeled by PyMOL version 1.3. The genomic organization with exon-
thalmus maximus [19] have been studied with less or no functional intron structures were constructed using the Gene Mapper tool (version
studies. Galectin-8 expression was up-regulated in Oreochromis niloticus 2.5), comparing the genomic DNA and respective cDNA sequences.
upon S. agalactiae challenge [18].
Rockfish (Sebastes schlegelii) is one of the major teleost, largely 2.3. Experimental fish and tissue collection
farmed as a comestible maricultural species, with a vast distribution in
Asia Pacific region around China, Japan and Korea [20]. Evidently, For this study, healthy rockfish having an average body weight of
only the production of flounder fish can exceed the annual tonnage of 200 ± 20 g were selected. The rockfish were provided by the Marine
black rockfish. The main reason for extensive cultivation of Sebastes Science Institute of Jeju National University, Jeju Self Governing
schlegelii as a food source, is its high growth and survival rate, tolerance Province, Republic of Korea. First, acclimatization was performed for a
of low temperatures [21], and its attractive taste over other farmed fish, week in 400 L of aerated and filtered seawater at 22 ± 1 °C, with
and the ability to polyculture along with flounder fish [22]. Never- regular inspection, and the fish were fed with a commercial feed diet
theless, the black rockfish pisciculture is highly impacted by various throughout the acclimatization period, except the last two days prior to
pathogenic disease outbreaks, such as streptococcosis [22], vibriosis tissue collection. Thereafter, five fish were sacrificed for tissue collec-
[23] and lymphocystis [24]. Fittingly, studying about the rockfish im- tion; blood samples (~1 mL) were drawn from the caudal veins using
mune related genes and methods of controlling the pathogens, is sterile syringes, pre-coated with 0.2% heparin (USB, USA), followed by
paramount to obtaining a satisfactory yield. In the present study, ga- immediate centrifugation at 3000×g at 4 °C for 10 min, to harvest the
lectin-8 homolog of Sebastes schlegelii was identified, and its molecular blood cells. Subsequently, several tissue samples including spleen, liver,
and functional properties were investigated. Additionally, the tissue head kidney, kidney, heart, skin, muscle, gills, intestines, ovary, testis,
specific distribution of SsGal8 in rockfish naïve tissues, and the ex- stomach and brain were collected; snap frozen and stored at −80 °C.
pression modulation under immune stimulation, was investigated.
Therefore, the present study will be important in understanding the 2.4. Immune challenge experiment
biological functions of SsGal8, in terms of rockfish immune protection.
The temporal responses of SsGal8, upon immune stimulations were
2. Methodology ascertained by subjecting the healthy fish to a time-course analysis over
a 72 h time period. First, the fish were grouped into three tanks (35
2.1. cDNA library construction individuals in each) and intraperitoneally injected with 200 μL of bac-
terial endotoxin LPS (1.25 μg/μL), poly I:C (1.5 μg/μL, Sigma, St. Louis,
Black rockfish transcriptomic database was constructed by using the USA), which represents viral dsRNA, and live form of the Gram-positive
Roche 454 Genome Sequencer FLX (GS-FLX™) [25]. Briefly, total RNA bacterial strain, S. iniae (1 × 105 CFU/μL). All the immune stimulants
was extracted from blood, head kidney, liver, spleen, intestine, and gill were prepared as stock solutions in 1 x PBS (phosphate-buffered saline).
tissues from three fish challenged with immune stimulants, including A volume of 200 μL of PBS was injected as the control. Thereafter, the
Streptococcus iniae (S. iniae) (107 CFU/fish), Edwardsiella tarda (E. liver, spleen, and head kidney samples were collected from five fish at
tatrda) (107 CFU/fish), lipopolysaccharide (LPS; 1.5 mg/fish) and 0, 3, 6, 12, 24, 48, and 72 h post injection. Samples were snap-frozen
polyinosinic:polycytidylic acid (poly I:C; 1.5 mg/fish). The extracted and stored at −80 °C until further use. All the immune challenges were
RNA was cleaned up using the RNeasy Mini Kit (Qiagen, USA). The analyzed as mean ± SD from triplicates.
quality and quantity of the extracted RNA were analyzed by Agilent
2100 Bioanalyzer (Agilent Technologies, Canada), at an RNA integrity 2.5. RNA extraction and cDNA synthesis
number (RIN) of 7.1, to evaluate the integrity of the extracted RNA.
Thereafter, a black rockfish cDNA library was constructed using frag- Total RNA was extracted from the collected tissue samples (~40 mg
mented RNA samples, with an average size of 1147 bp (Macrogen, each, from 5 fish) using QIAzol® (Qiagen, USA), as per the vender's
Korea). instructions. The RNA samples, isolated from the black rockfish

450
R.K. Madusanka, et al. Fish and Shellfish Immunology 93 (2019) 449–462

(challenged and healthy, respectively), were purified using the RNeasy 4 °C overnight. Thereafter, the recombinant plasmids were transformed
Mini Kit (Qiagen, USA). The purity of RNA was confirmed by 1.5% into Escherichia coli (E. coli) DH5α competent cells and grown on a
agarose gel electrophoresis and the concentration was determined using Luria-Bertani plate (LB) at 37 °C for overnight. Sequencing was per-
the μDrop™ Plate (Thermo Scientific, USA), through the absorbance formed after purifying the recombinant plasmids from a single colony
measured at 260 nm. PrimeScript™ first-strand cDNA synthesis kit (Macrogen, Korea). After the confirmation of the correct sequence and
(TaKaRa, Japan) was used to synthesize first strand cDNA from the the orientation of SsGal8 in to pMAL-c5X expression vector, the re-
purified RNA, (2.5 μg) in a volume of 20 μL reaction mixture and sub- combinant plasmids were transformed into E. coli BL21 (DE3) cells and
sequently, was diluted 40-fold in nuclease-free water and stored at 15 mL of a seed culture was prepared by inoculating E. coli BL21 cells
−20 °C to be used for quantitative real time PCR (qPCR). containing recombinant plasmids. A volume of 5 mL from a seed culture
was added into a 500 mL LB broth, supplemented with 2% glucose and
2.6. SsGal8 expression analysis by qPCR 100 μg/mL ampicillin, and grown at 37 °C. When OD600 of ⁓0.4 was
achieved, the broth was further incubated at 18 °C until the OD600
In order to monitor the transcriptional modulation of the SsGal8 reached 0.5. Thereafter, IPTG (0.5 mM) was added for protein induction
upon immune challenge, as previously mentioned in section 2.4, qPCR and was incubated in a shaking incubator at 18 °C for 20 h. The cells
was performed using Thermal Cycler Dice™ Real Time System (TaKaRa, were harvested by centrifugation (at 10000 g for 10 min), and the re-
Japan). All the primers for qPCR (Table 1) were designed using IDT's sulting cell pellet was used for protein purification using maltose affi-
Primer Quest online tool (https://sg.idtdna.com/Primerquest/Home/ nity chromatography, following the pMAL-c5X purification protocol
Index), as per the minimum information for publication of quantitative (New England BioLabs Inc., USA). Protein concentration was measured
real-time PCR experiments, MIQE guidelines [27]. The reaction mixture by the Bradford method [29] and protein size was confirmed by sodium
(10 μL total volume) for qPCR, was prepared by adding 3 μL of diluted dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (Fig. 6).
cDNA template, 0.4 μL of gene specific, forward and reverse primers
(having initial concentration of 10 μM), 5 μL 2 × TaKaRa Ex Taq™ SYBR 2.8. Hemagglutination assay for rSsGal8
premix, and 1.2 μL of PCR grade dH2O. The reactions were carried out
using the following protocol: one cycle at 95 °C for 30 s, followed by 45 The hemagglutination assay was performed on fish erythrocytes
cycles at 95 °C for 5 s, 58 °C for 10 s, and 72 °C for 20 s, and one final provided by the Marine Science Institute of Jeju National University,
cycle at 95 °C for 15 s, 60 °C for 30 s, and 95 °C for 15 s. The Livak Jeju Self Governing Province, Republic of Korea by following a slightly
2−ΔΔCT method was followed in order to evaluate the relative mRNA modified protocol [30]. In brief, blood samples were collected in 0.5%
expression levels of SsGal8 [28], using the internal control gene, pre-heparinized microcentrifuge tubes, and immediately centrifuged at
rockfish elongation factor-1- α (SsEF1A, GenBank accession- 80×g for 5–10 min, at 4 °C. Thereafter, the erythrocytes were pre-wa-
KF430623). The spatial expression levels of SsGal8, in each tissue, were shed 4 times with sterile 1 × PBS, and the cell number was adjusted to
calculated by considering the tissue with the lowest expression level as 1 × 105 in sterile 1xPBS using a hemocytometer. Thereafter, the
the normalizing constant. Relative expression levels of SsGal8, were rSsGal8 was serially diluted two-fold in 1 × PBS, and mixed with equal
determined by representing the SsGal8 mRNA expression, relative to volumes (25 μL) of erythrocyte suspension in 96-well plates, and in-
the SsEF1A expression, and was expressed as mean ± standard devia- cubated at 25 °C for 45 min. Two-fold serially diluted recombinant
tion (SD). During immune responsive temporal expression analysis, the maltose binding protein (rMBP) in 1 × PBS, 1 × PBS alone, and in-
fold differences in gene expression were calculated relative to the basal activated rSsGal8 were used as the negative controls. The hemaggluti-
expression level at 0 h post injection, followed by normalization to the nation activity was visually observed under a light microscope (Leica
corresponding values obtained for the PBS-injected fish. These trials DMIL LED, Germany) for a detectable agglutination, compared to the
were performed in triplicates. The significance in difference in mRNA negative controls.
expression between experimental and control (0 h) was calculated using
the two-tailed un-paired t-test (P < 0.05). 2.9. Sugar specificity assay

2.7. Cloning, overexpression and purification of recombinant SsGal8 The sugar specificity assay was performed based on the inhibition of
(rSsGal8) the hemagglutination. Seven potential inhibitory carbohydrates and
carbohydrate derivatives, such as D-glucose, sucrose, D-galactose, D-
The rSsGal8 fusion protein was overexpressed by isopropyl-β-D-1- mannose, maltose, α-lactose and glucosamine were assayed in this
thiogalactopyranoside (IPTG) and purified using maltose affinity study. In brief, equal volumes (25 μL) of the erythrocyte suspension and
chromatography. The ORF of SsGal8 was amplified by PCR, using 200 μg/mL rSsGal8 or rMBP, were mixed in a 96 well plate. After in-
cloning primers (Table 1) with restriction recognition sites for EcoRI cubating at 25 °C for 30 min, the serially diluted sugar solutions (final
and EcoRV. The pMAL-c5X (New England BioLabs Inc. USA) vectors concentration ranging from 3.125 to 400 mM) were added. The assay
and the PCR amplified products of SsGal8, were restriction digested was performed in triplicates and after 1-h incubation at room tem-
with EcoRI and EcoRV (TaKaRa, Japan), followed by ligation using a perature, the hemagglutination inhibition was observed under a light
Mighty Mix DNA Ligation Kit (Takara, Japan), for 30 min at 16 °C, and microscope.

Table 1
Primers used in the study.
Name Purpose Sequence (5′–3′)

SsGal8-qF qPCR of SsGal8 GCCAGTGTGACCAAACAGGAACAA

SsGal8-qR qPCR of SsGal8 CACTCGCAGGTTCACACCGAAAT
SsGal8-F Amplification of the SsGal8 coding region GAGAGAgatatcATGAAAGTCAAGGACATGACATTCAAGGAGG
SsGal8-R Amplification of the SsGal8 coding region GAGAGAgaattcCTACTTGATCTTGATGCCGACGATCCTG
SsEF1A-F qPCR internal control AACCTGACCACTGAGGTGAAGTCTG
SsEF1A-R qPCR internal control TCCTTGACGGACACGTTCTTGATGTT
TA-F TA cloning of SsGal8 CTTCACGCCGCGGCTCTTC
TA-R TA cloning of SsGal8 AACCTGAACACAGTGAGCGATGCT

451
R.K. Madusanka, et al. Fish and Shellfish Immunology 93 (2019) 449–462

Table 2
Amino acid homology analysis of SsGal8 with identity and similarity to other known orthologs.
Organism Common name Accession number Amino acids Identity (%) Similarity (%)

Oplegnathus fasciatus Rock bream ANN46245 313 82 87.6

Seriola dumerili Allied Kingfish XP_022626072 314 77 84.2
Amphiprion ocellaris Ocellaris clownfish XP_023152887 313 76.1 86.6
Lates calcarifer Barramundi XP_018544257 314 72.7 82.3
Oreochromis niloticus Nile tilapia XP_020473523 321 71.8 83.5
Maylandia zebra Zebra mbuna XP_023189103 318 69.9 82.3
Larimichthys crocea Large yellow croaker KKF10354 301 69.1 80.7
Salmo salar Atlantic salmon NP_001133778 296 64.3 78.6
Hippocampus comes Tiger tail seahorse XP_019751803 323 57.2 73.1
Homo sapiens Human AAF19370 317 51.5 68.6
Canis lupus familiaris Dog NP_001271415 316 51.2 68.9
Xenopus tropicalis Western clawed frog NP_001135558 315 51.2 70.5
Gallus gallus Chicken XP_007111816 315 50.9 71.7
Rattus norvegicus Brown rat NP_446314 316 49.7 67.1
Alligator sinensis Chinese alligator XP_025069314 316 49.2 70.2
Bos taurus Bovine NP_001039419 357 46.7 64.7
Drosophila obscura Fruit fly XP_022222443 403 19.2 39.5

Fig. 1. (A)The predicted tertiary structure of

SsGal8 indicating the critical amino acids
required for sugar binding. This model was
generated by PyMOL version 1.3 based on
human galectin-8 as the template, suggested by
the SWISS-MODEL online program. N and C-
terminal carbohydrate binding domains are in-
dicated in green and blue respectively. N and C-
termini and linker sequence are labeled. Amino
acids important for sugar binding are indicated
in sticks with the respective color and labeled.
(B) Surface properties of SsGal8 highlighting
the N and C- terminal carbohydrate binding
pockets. The putative N and C-terminal carbo-
hydrate binding pockets are labeled and colored
in purple. N-terminal CRD, C-terminal CRD and
hinge region are colored in green, blue and red
respectively. (For interpretation of the refer-
ences to color in this figure legend, the reader is
referred to the Web version of this article.)

2.10. Bacterial agglutination assay the cell number was adjusted to ~105 CFU/mL in TBS. Thirty μL from
each bacterial suspension was mixed with the same volume of two-fold
To investigate the bacterial agglutination of rSsGal8, nine bacterial serially diluted rSsGla8 (final concentration ranging from 3.125 to
strains were used. Bacteria were cultured in their respective growth 400 μg/mL) in a 96 well plate and incubated at 25 °C. Heat inactivated
media and incubated at 25/37 °C, until the mid-log phase of growth. rSsGal8, rMBP in TBS and TBS alone were used as the negative controls.
Each culture was harvested by centrifugation (at 1500×g for 30 min), After 45–60 min, each well was assessed for bacterial agglutination,
followed by 3 washing steps in TBS (TBS; 50 mM Tris-HCl, 150 mM under a light microscope.
NaCl, pH 7.5). Each bacterial strain was then resuspended in TBS and

452
R.K. Madusanka, et al. Fish and Shellfish Immunology 93 (2019) 449–462

Fig. 2. Multiple sequence alignment of SsGal8 with its vertebrate orthologs, generated by ClustalW method. The N-terminal and C- terminal CRDs are
represented by blue and green color arrow headed lines, respectively. Identical amino acid residues are shaded in black and similar residues are shaded in grey. The
amino acid residues involved in sugar binding are boxed in red. The conserved Gln45, which recognizes the 3′-sulfated or sialylated glucans is indicated by a yellow
box. Amino acids that face the carbohydrate ligands are indicated by asterisks. The Hinge sequences of each ortholog are boxed in orange color. Conserved cysteine
residues are shaded in purple color. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

3. Results (1377AATAAA1382) and, as suggested by SignalP-4.1 prediction results,

the deduced protein lacked a signal peptide sequence. Expasy Prosite
3.1. Characterization of SsGal8 domain analysis revealed the presence of two N and C– terminal CRD at
the amino acid positions of 17–150 (134 aa) and 191–322 (132 aa)
Black rockfish transcriptome database was searched using the NCBI- respectively (Fig. 2, Supplementary Fig. 1). Two distinct CRDs were
BLASTX tool. A nucleotide sequence of 1390 bp was identified connected by a linker (hinge) region of 40 amino acids. Conserved
(GenBank accession- MK616586), containing an ORF of 969 bp motifs identified within the N-terminal CRD consisted of critical amino
(Supplementary Fig. 1), while the putative amino acid sequence was acids H63, N65, R67 and W84, E86, I89. In the C-terminal CRD, conserved
found to be 322 amino acids. The predicted molecular weight of the motifs were identified as H233, N235, R237 and W253, E256, R258, that
putative protein was 35.82 kDa, with a theoretical iso-electric point of enable binding with glycans (Supplementary Fig. 1). The linker pep-
7.69. Using insilico analysis, this protein was further classified as stable, tides in between two CRDs were easily identified and labeled in the
based on its instability index (34.72) and aliphatic index 93.11. The multiple sequence alignment (Fig. 2). However, high conservation was
sequence consisted of a polyadenylation signal sequence not observed in the hinge regions. The predicted 3D structure of SsGal8

453
R.K. Madusanka, et al. Fish and Shellfish Immunology 93 (2019) 449–462

Fig. 3. Phylogenetic reconstruction of SsGal8 along with its vertebrate and invertebrate counterparts, prepared by using Neighbor-joining method in
MEGA version 5.2.2. The corresponding bootstrap values are shown adjacent to the respective branches. NCBI -GenBank accession numbers for identification of
each ortholog are provided within parenthesis, adjacent to the name of each species.

comprised of two anti-parallel β-sheet bundles, resembling the N- and human galectin-8, at identity and similarity of 51.5% and 68.6% re-
C-terminal CRDs. The linker peptide was observed as a simple coiled spectively.
structure, joining the two CRDs. Further, the major amino acids that
facilitate carbohydrate binding, were localized in the concave sites of
the β-sheets, forming the respective carbohydrate binding pockets at 3.3. Evolutionary relationships of SsGal8
the far ends of the protein (Fig. 1 A and B).
In order to evaluate the evolutionary relationship of SsGal8 with
other vertebrate and invertebrate similitudes, a phylogenetic tree was
3.2. Homology analysis of SsGal8 with other galectin-8 similitudes constructed using the neighbor-joining method (bootstrap- 5000).
Primarily, proto-type, chimera-type and tandem-repeat galectins were
The multiple sequence alignment results revealed that the amino independently clustered into three sub-groups. Galectin-8 was clustered
acids (especially the aforementioned amino acid residues) were con- with tandem-repeat galectins, such as galectin-4 and 9. As expected,
served along the other examined homologs including reptiles, amphi- within the galectin-8 clade, all the fish galectin-8 were clustered in-
bians, birds, and mammals (Fig. 2). However, a notable sequence dependently in a separate clade, apart from other vertebrate galectin-8
compatibility was observed with the teleostean galectin-8 counterparts, homologs, reflecting their intimacy along the evolutionary pathway.
and particularly highest identity (82%) and similarity (87.6%) was Although, SsGal8 was harbored within the fish galectin-8 homologs, it
exhibited by rock bream (Oplegnathus fasciatus) galectin-8 (Table 2). showed a relatively distant relationship to the other fish counterparts
The most compatible non-teleostean counterpart was identified as (Fig. 3).

454
R.K. Madusanka, et al. Fish and Shellfish Immunology 93 (2019) 449–462

Fig. 4. The genomic structure prediction and comparison of SsGal8 with its known vertebrate orthologs. Boxes and lines indicate the exons and introns
respectively. The coding regions are in black boxes and the UTRs within the exons are denoted as striped boxes. Respective sequence lengths of the exons and introns
are given above and below each region respectively. (a) Sebastes schlegelii, (b) Oreochromis niloticus (XM_003446634.3), (c) Salvelinus alpinus (XM_023999602.1), (d)
Amphiprion ocellaris, (XM_023297119.1), (e) Xenopus tropicalis (ENSXETT00000019750.2), (f) Gallus gallus (ENSGALT00000006738.5), (g) Mus musculus
(ENSMUST00000099821.9), (h) Homo sapiens (ENST00000526634.5).

3.4. Genome structure organization of SsGal8 3.6. Transcriptional modulation of SsGal8 gene expression under immune
challenge
All the exon and intron splicing margins were predicted using the
GT-AG rule [31]. The genome architecture of SsGal8 consisted of 9 The mRNA transcriptional modulation of SsGal8 in liver, spleen and
exons, interrupted by 8 introns. Other fish similitudes were also found head kidney, in response to the immune stimulation mounted by S.
to have similar exon intron combinations, except that they differed in iniae, LPS and poly I:C, are shown in Fig. 7. SsGal8 expression in liver/
sequence lengths from SsGal8. Broadly, all the homologs compared spleen and head kidney remained unchanged on immune stimulation,
here, including fish, amphibian, reptile, aves, and mammals, showed a until 12 h and 24 h post injection (p.i.), respectively. However, once
general splicing pattern, producing approximately similar sizes in their SsGal8 expression in the various tissues had peaked at the respective
respective coding regions. The major amino acids for sugar binding time points, it was again found to decrease gradually. In the liver tis-
were arranged in the third and the eighth exons. The start and stop sues, expression of SsGal8 was found to peak in response to S. iniae and
codons of SsGal8 were in the first and the ninth exons, respectively LPS stimuli, at 48 h p.i. and 24 h p.i. respectively, compared to the 0 h
(Fig. 4). expression level. The poly I:C injection could notably upregulate SsGal8
expression from 12 h p.i., and peaked at 24 h p.i. (Fig. 6A). However,
SsGal8 expression in response to poly I:C stimulation seemed higher
3.5. Tissue-specific mRNA expression of SsGal8 than in response to S. iniae or LPS. In the spleen tissues, all three im-
mune stimulants could significantly enhance the SsGal8 expression le-
Basal expression levels of SsGal8 in different tissue types of naïve vels. The highest mRNA expression of SsGal8, in response to S. iniae
rockfish were analyzed by qPCR. The most prominent basal expression, infection was observed at 24 h p.i., and both poly I:C and LPS could
with the highest fold difference, was observed in blood, followed by trigger its expression up to their respective peak levels at 12 h p.i.
brain, intestine, head kidney, spleen and kidney (Fig. 5). (Fig. 6B). In the head kidney, a significant elevation in SsGal8 mRNA
transcript load was detected at 24 and 48 h, after S. iniae challenge.
However, LPS and poly I:C challenges exhibited weak or un-detectable
modulation of SsGal8 transcription, throughout the experiment

455
R.K. Madusanka, et al. Fish and Shellfish Immunology 93 (2019) 449–462

Fig. 5. Tissue dependent mRNA expression of SsGal8 in healthy rockfish. The tissue distribution analysis of SsGal8 was conducted using qPCR and the fold
expression change was calculated based on the expression of elongation factor-1 α gene. Data are given as mean values ± SD (n = 3).

(Fig. 6C). 3.9. Bacterial agglutination assay

Bacterial agglutination was carried out for nine Gram (+) and (−)
3.7. Overexpression and purification of rSsGal8 bacterial strains, including the marine fish pathogens. Most of the as-
sayed bacteria substantiated the ability of rSsGal8 in bacterial re-
The recombinant fusion protein (rSsGal8) was purified by using cognition with a strong agglutination. Both Gram (+) and (−) bacteria
maltose affinity chromatography, and an eluted protein sample was run including, Escherichia coli, Vibrio harveyi, Vibrio parahaemolyticus,
on SDS-PAGE, along with MBP and the samples collected at major Streptococcus parauberis, Lactococcus garvieae, Streptococcus iniae and
purification steps. The SDS-PAGE results revealed that, E. coli (BL21) Vibrio tapetis showed agglutination with the rSsGal8 concentration
system expressed more rSsGal8, compared to the uninduced control. range used; however, no detectable agglutination was observed for TBS,
The observed protein size (approximately 78.32 kDa), was found to be rMBP or inactivated rSsGal8 treated negative controls. The minimum
consistent with the predicted molecular weight, where MBP and concentrations that were required for agglutination of each bacteria are
rSsGal8 accounted for 42.5 kDa and 35.82 kDa, respectively (Fig. 7). given in Table 3, and light microscopic views of the bacterial aggluti-
nation are shown in Fig. 9.

3.8. Hemagglutination assay and sugar binding assay

4. Discussion
The hemagglutination assay was performed for the fish erythrocytes
Galectins play a vital role in enhancing the fish innate immunity by
with two-fold serially diluted rSsGal8 concentrations. rSsGal8 showed
recognizing microbes and regulating the host immune responses ac-
complete agglutination of erythrocytes at the minimum concentration
cordingly [10]. So far, the immunomodulatory effects of galectin-8,
of 100 μg/mL, in a concentration dependent manner (Fig. 8). Negative
from teleost, have not been sufficiently included in scientific discus-
controls (PBS, rMBP, inactivated rSsGal8) did not show visible agglu-
sions. In this study, we sought to demonstrate the immunological re-
tination, compared to the rSsGal8 treated erythrocytes. Lactose and D-
levance of galectin-8 isolated from black rockfish in terms of molecular,
galactose inhibited hemagglutination in a concentration dependent
transcriptomic, and for the first time, functional aspects in fish. Based
manner, while other examined sugars were unable to produce a de-
on the domain analysis, it was found that SsGal8 comprises two func-
tectable agglutination, even at a maximum concentration of 400 μg/mL
tional domains, localized at the two ends of the protein sequence. Two
(Table 4). The extent of inhibition shown by lactose was comparably
CRDs of SsGal8 are held together by a 40 amino acid long hinge se-
stronger than that shown by D-galactose.
quence, identified as a linker peptide. This irregular coiled structure is
an essential moiety for prevention against the proteolysis, and proper

456
R.K. Madusanka, et al. Fish and Shellfish Immunology 93 (2019) 449–462

Fig. 6. Transcriptional modulation of SsGal8 in (A) liver (B) spleen and (C)
head kidney tissues after in vivo challenge with S. iniae, LPS, poly I: C.
Total mRNA was extracted from tissues from five fish and pooled together for
cDNA synthesis. The mRNA expression levels were determined by qPCR assay,
run in triplicates. The relative expression levels were obtained by Livak method
using SsEF1A as an internal control gene. Fold changes of SsGal8 expression was
calculated after normalizing to the PBS injected negative control. Data are given
as mean value ± SD (n = 3). Asterisk (*) above the bars denotes the sig-
nificant difference at P < 0.05 which was calculated by students' t-test.

Fig. 7. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-

PAGE) analysis of overexpressed and affinity purified rSsGal8 protein
along with samples collected at its different purification levels. Lane 1-
Molecular weight marker, Lane 2- Uninduced sample, Lane 3- Lysate, Lane 4-
Supernatant, Lane 5- Pellet, 6- Purified recombinant fusion protein, Lane 7-
Maltose binding protein (MBP) sample.

functionality of the galectins [32]. Although no sequence homolog was

identified among the linker peptides, the varying number of amino
acids in this region gives rise to variable protein sizes (Fig. 2). Using
galectin-8 mRNA studies, scientists have shown the prevalence of six
different isoforms, three of which are tandemly repeated forms, with
varying hinge lengths [33]. The N-terminal CRD was found to have two
critical sequence motifs, H–N-R and W-E-I, whereas the C-terminal
domain consisted of typical H–N-R and W-E-R signature motifs (Fig. 2,
Supplementary Fig. 1), which are responsible for glycan specificities.
Due to the discrepancy in the amino acid types between N-terminal W-
E-I (Ile89) and the C-terminal W-E-R (R258) motifs, we speculate that
each domain must have unique glycan specificities, different from each
other. The involvement of SsGal8 N- terminal amino acids, congruent
with R43, H63, R76, W84, E87, have been scientifically proven to form
hydrogen bonds with several saccharides [18]. Not only the afore-
mentioned amino acids, but also many other amino acids in the binding
pocket, should function together for delivering a broader spectrum of
carbohydrate recognition (Fig. 2) [34]. Furthermore, the arginine (R)
residue in the W-E-R motif (in the C-terminal) is pivotal for carbohy-
drate binding, especially for binding to the glucose moiety in lactose
[35]. The Gln45 residue plays a major role in galecin-8, by recognizing
and binding to 3′-sulfated or sialylated glycan moieties [36]. Therefore,
the conservation of Gln45 in all the aligned homologs (Fig. 2) reveals a
relationship between galectin-8 avidity for glycans containing 3′-sul-
fated or sialylated moieties, and its biological functions. Sialic acid is
found on the bacterial outer surface as sialylated LPS or capsules con-
taining sialic acid, which serve to evade the host immune system
[37,38]. In this context sialylated glycan specificity makes galectin-8 a
successful candidate for bacterial recognition and binding. In addition,
SsGal8 was found to have 5 cysteine residues, two of which (C76 and

457
R.K. Madusanka, et al. Fish and Shellfish Immunology 93 (2019) 449–462

Fig. 8. Agglutination of fish erythrocytes by

rSsGal8 at the minimum concertation of 200 μg/
mL. Fish erythrocytes were isolated and the con-
centration was adjusted to 1 × 105 cells/mL in sterile
phosphate-buffered saline (PBS). Agglutination of
erythrocytes, on treatment with two-fold serially di-
luted (400–12.5 μg/mL) rSsGal8, was visually as-
sessed under a light microscope. For the negative
controls, erythrocytes were treated with sterile PBS
or recombinant maltose binding protein (rMBP) or
inactivated rSsGal8.

Table 3 The genome organization of SsGal8 appears to be very similar to

Bacterial agglutination assay; minimum rSsGal8 concentration needed to ag- other teleosts, in terms of the number of exons (nine exons) in the ORF
glutinate the bacteria. and the exon sizes. However, when compared with the vertebrate
Bacteria Gram Minimum rSsGal8 concentration for homologs, such as amphibians, reptiles, aves, and mammals, SsGal8
(+)/(−) agglutination (μg/mL) shows a tendency for possible evolutionary divergence, with the pre-
sence of total 10 exons, resulting in extended N-terminal sequences
Escherichia coli - 100
(Fig. 4). Therefore, with the addition of an extra anterior exon to the
Vibrio harveyi - 3.125
Vibrio parahaemolyticus - 25 gene, galectin-8 has undergone evolutionary change with the move-
Streptococcus parauberis + 6.25 ment of life, from aquatic to terrestrial habitat. In addition, exon 2, 6
Lactococcus garvieae + 50 and 7 in SsGal8, and the corresponding exons of aligned vertebrates, are
Streptococcus iniae + 25
identical in size and therefore, evolutionarily conserved. Interestingly,
Vibrio tapetis - 12.5
Tenacibaculum maritimum - -
consistent with SsGal8, all the aligned genomic structures contained
Micrococcus luteus + - their coding regions in the 9 exons. Collectively, SsGal8 exhibits a closer
genome structure to that of the teleosts, which shows a relatively si-
milar pattern to other vertebrates, including mammalian galectin-8
Table 4 gene.
Sugar specificity assay; minimum sugar concentration required to inhibit ery- SsGal8 exhibits a wide range of tissue-specific expression patterns,
throcyte agglutination. being most abundantly expressed in the blood, followed by brain and
Sugar/sugar derivative type Minimum hemagglutination inhibitory intestine (Fig. 6). Blood is a dynamic and circulatory tissue, with an
concentration (mM) ample amount of immune related cell types, including T-lymphocytes,
neutrophils and natural killer cells [43,44]. However, the bactericidal
Lactose 25
D-Galactose 100
properties of peripheral neutrophils, that are stimulated by galectin-8
D-Mannose - through the production of superoxides, have been demonstrated in
Fructose - human galectin-8 [45]. Superoxide is a major component that exerts
Sucrose - bactericidal effects; therefore, the higher expression of SsGal8 in blood
Maltose -
tissue strongly suggests its possible role in killing bacteria and elim-
Glucosamine -
inating harmful pathogens, by inducing the production of superoxides
to establish host immune protection. After blood, the second most
C278) are totally conserved within all the aligned homologs, indicating abundant expression of SsGal8 was noted in the brain tissues; microglial
the involvement of intra and inter molecular di-sulphide bond forma- cells in the brain are actively involved in quick response to injury, as
tion for the structural stability and function of the protein. well as pathogenic infections. Microglial cells can produce pro-in-
Although galectins do not contain a typical signal peptide, they tend flammatory mediators, with the help of their Toll-like receptors (TLRs)
to exhibit both intracellular and extracellular functions. It is believed to respond to the TLR ligands in systemic infections, and activate the
that oligomerization [39] and intracellular vesicular transportation are immune signaling pathways [46]. Previous literature also provides sa-
such mechanisms to facilitate this non-conventional ER/Golgi in- tisfactory evidence for a wide range of organ and tissue distribution of
dependent secretion process [14,40]. Further, caspase-1 behaves as a tandem-repeat galectins in fish [18,47]. More remarkably, fish galectins
regulatory factor for galectin secretion into the extracellular milieu were not found to be abundantly expressed in the classical immune
[41]. More research work is yet required in order to have a thorough tissues, such as spleen, kidney, liver and head kidney, but instead
understanding of galectin-8 secretion. showed high expression in a range of other tissues. For examples, ga-
Based on the domain analysis and the split pattern of the phyloge- lectin-2, -4 and -9 showed the highest expression in the fish intestine
netic tree (Fig. 4), SsGal8 was categorized as a tandem-repeat galectin, [17,19,48], and teleost galectin-1 and -3 were prominently expressed in
which contains two carbohydrate recognition domains, similar to that heart and brain, respectively [49,50]. The reason for the predominant
reported in galectin-4, -6, -9 and -12 [9]. In fact, the existence of the expression of most of the galectins in the mucosal tissues, such as in-
tandem-repeat protein structure is a compelling factor for galectin-8 testine, might be due to their vital roles in mucosal immunity against
mediated T-cell proliferation [42]. The leading amino acids that deliver invading pathogens, since those tissues act as the major portals of pa-
the sugar binding properties to the two CRDs are confined to the third thogen entry. Likewise, in this study, the intestine showed a higher
and the eighth exons; therefore, the two sugar binding pockets of SsGal8 galectin-8 expression, after blood and brain, compared to the major
might be formed by the respective exons. Particularly, multiple se- immune tissues, emphasizing the involvement of galectin-8 in rockfish
quence alignment and sequence analysis suggest the conservation of the mucosal immunity. Additionally, predominant expression levels of
aforesaid glycan specific motifs in the galectin-8 homologs (Fig. 2). The human galectin-8 were observed in tumor tissues, with correlation to
highly homologous SsGal8 functional domains possess the typical ga- various types of cancers and is a possible diagnostic marker for cancer
lectin-8 12-β-stranded fold [40] 3D structure, which in-turn creates the therapy [51–53]. Moreover, robust upregulation of the galectin-8 in
carbohydrate binding pocket [10], recertifying the high structural human and rat inflamed corneas, was reported with pathological lym-
conservation among the galectins (Fig. 1). phangiogenesis [54].

458
R.K. Madusanka, et al. Fish and Shellfish Immunology 93 (2019) 449–462

Fig. 9. Bacterial agglutination by rSsGal8. Each bacterial strain was cultured at its optimum growth conditions and harvested at mid-logarithmic phase. Bacterial
cells were washed twice in Tris-buffered saline (TBS), concertation was adjusted to 1 × 105 CFU/mL in TBS, and mixed with two-fold serially diluted (400–3.125 μg/
mL) rSsGal8. Bacterial agglutination was visually assessed under a light microscope. For the negative controls, each bacterial strain was treated with sterile PBS,
rMBP, or inactivated rSsGal8.

The immune challenge results revealed a correlation between be explained by the fact that the inner organs need more time to mount
SsGal8 and the innate immune responses. Following challenge by im- an immune response, as they are not exposed to the immune stimulants
mune stimulants, the mRNA expression of SsGal8 in liver/spleen and immediately. The liver, spleen and head kidney were selected for the
head kidney, was upregulated approximately after 12 h and 24 h, re- immune challenge because they are among the major immune organs in
spectively (Fig. 7). The comparatively longer time taken to respond can the teleost's innate immune system [55]. Moreover, in our study, spleen

459
R.K. Madusanka, et al. Fish and Shellfish Immunology 93 (2019) 449–462

and head kidney showed relatively higher tissue distribution of SsGal8 (−) bacteria in a concentration dependent manner. The agglutination
in naïve tissues, corroborating the findings of previous reports in the of bacteria is a mechanism in the host system for trapping pathogenic
literature, that have shown evidence for the up regulation of fish ga- invaders in the extracellular matrix, by preventing the entry of patho-
lectins in those tissues, upon immune challenges [17,47,49]. In the liver gens in to the host cells, followed by subsequent destruction and
and spleen, poly I:C could trigger higher expression of SsGal8 than LPS elimination by the host defense mechanisms. Trapped pathogens on the
or S. iniae, consistent with prominent galectin-9 (tandem-repeat) ex- extracellular surfaces are forcefully eliminated by macrophages through
pression in Larimichthys crocea [16] after poly I:C injection, suggesting opsonization and phagocytosis [73]. One of the major reasons for
the occurrence of viral inflammatory reactions. The synthetic viral bacterial agglutination is the ability of galectins to recognize LPS,
analog, poly I:C, binds with the viral receptors and triggers the virus which acts as a PAMP on the Gram (−) bacterial cell wall [16]. Ga-
activated signaling pathways, in a manner similar to that observed lectins isolated from Clarias batrachus [71] and Channa striatus [15],
during the viral infections [56,57]. Moreover, the increased expression were able to show agglutination only for Gram (−) bacteria. None-
of galectin-8 subsequently plays a key role in mounting T-cell popula- theless, consistent with our results, galectins derived from rock bream
tion, as a response to microbial attack [42]. LPS is a strong stimulator of (Oplegnathus fasciatus) showed strong agglutination of both Gram (−)
innate immunity, resembling the major component of Gram (−) bac- and (+) bacteria [27,60]. Indeed, the ability of SsGal8 to agglutinate
terial outer surface membrane [58]. Indeed, the augmentation of mRNA both Gram (+) and (−) bacteria encourages us to suggest its utility in
level by the injection of LPS and live bacteria S. iniae, straightforwardly recognizing a wide range of bacteria and its crucial role in the immune
display the immune functions of SsGal8 against bacteria. In accordance response.
with our results, tandem-repeat galectin-9 was upregulated in the
spleen and liver of Labeo rohita [17] upon A. hydrophila challenge, and 5. Conclusion
Rhodeus uyekii [47] showed galectin-9 upregulation after the LPS
challenge. In contrast, S. iniae was able to boost rockfish galectin-8 In the present study, we report the molecular, transcriptional and
transcription in the head kidney, while poly I:C caused a slight up- functional assay-based analysis of rockfish galectin-8. Molecular char-
regulation, and LPS remained ineffective. This might be due to the se- acterization revealed the presence of two distinct carbohydrate binding
lective stimulation of galectin-8 expression in the head kidney by the domains, fused by a short linker peptide. Both, genome organization
Gram-positive live pathogen, S. iniae, rather than responding to syn- and multiple sequence alignment, were indicative of the SsGal8 simi-
thetic bacterial and viral mimicking substances. However, more ad- larity to other galectin-8 homologs. qPCR based studies revealed en-
vanced studies are required to clarify the specificity of S. iniae in ga- hanced SsGal8 mRNA levels in immune tissues, upon immune chal-
lectin-8 expression in the head kidney tissues. In addition, galectin-8 lenge, and the most dominant basal expression among naïve tissues,
can perform immunomodulatory activation and pathogen elimination was observed in the blood. Rockfish galectin-8 actively participated in
via the mechanism called autophagy [59]. Autophagy is a cellular agglutination of fish erythrocytes as well as both Gram (−) and (+)
mechanism by which the cells disassemble and recycle cellular com- bacteria. Overall, it is obvious that SsGal8 is an indispensable compo-
ponents, misfolded proteins, and dysfunctional organelles, as well as nent of the rockfish antibacterial defense, and its immune system.
removing intracellular pathogens [60,61]. One of the immune reg-
ulatory functions of galectin-8 have been documented against Salmo- Acknowledgements
nella proliferation [59]. Galectin-8 can act as a danger receptor and
bind β-galactoside sugars on the damaged vacuoles, containing Salmo- This research was a part of the project titled ‘Fish Vaccine Research
nella, and thereby mediate the recruitment of autophagy receptor Center’, funded by the Ministry of Oceans and Fisheries, Korea and
NDP52 (nuclear dot protein 52) to direct bacterial autophagy [59]. supported by Basic Science Research Program through the National
Further, galectin-8 can stimulate the host immune responses in an an- Research Foundation of Korea funded by the Ministry of Education
tigen dependent manner or by inducing the T-cell proliferation [42]. (2019R1A6A1A03033553).
Galectin up-regulation, after an immune challenge is associated with
the enormous immune functions regulated by them. As soon as patho- Appendix A. Supplementary data
gens enter the body, the organisms are first recognized and cellular
immune related pathways are activated. As a response to pathogenic Supplementary data to this article can be found online at https://
attack, galectins can direct the pathogens toward phagocytic clearance doi.org/10.1016/j.fsi.2019.07.072.
[62]. Further, elevating the number of galectin transcripts, enables
microbial recognition and the triggering of downstream immune re- References
sponses, like cytokine production [63], proliferation of activated T-cells
[64], leukocyte recruitment [65] and complement activation [66]. [1] B. Magnadóttir, Innate immunity of fish (overview), Fish Shellfish Immunol. 20
Agglutination is a functional method used to assess the galectin (2006) 137–151, https://doi.org/10.1016/j.fsi.2004.09.006.
[2] G.R. Vasta, Galectins as pattern recognition receptors: structure, function, and
activity. Glycosylated proteins on the cell surface or the extracellular evolution, Adv. Exp. Med. Biol. 2012, pp. 21–36, , https://doi.org/10.1007/978-1-
matrix, give rise to classical galectin mediated agglutination [67]. 4614-0106-3_2.
Therefore, our observation of hemagglutination indicates the SsGal8 [3] S.-Y. Seong, P. Matzinger, Hydrophobicity: an ancient damage-associated molecular
pattern that initiates innate immune responses, Nat. Rev. Immunol. 4 (2004)
affinity for glycans. In galectin-8 sugar specificity assays, inhibition of 469–478, https://doi.org/10.1038/nri1372.
hemagglutination by lactose and galactose, has been demonstrated in [4] J. Hirabayashi, T. Hashidate, K. ichi Kasai, Glyco-catch method: a lectin affinity
the previous studies [68–70]. The rSsGal8 was able to effectively ag- technique for glycoproteomics, J. Biomol. Tech. 13 (2002) 205–218 http://www.
ncbi.nlm.nih.gov/pubmed/19498986 , Accessed date: 22 January 2019.
glutinate fish erythrocytes, and successfully inhibit hemagglutination
[5] J. Hirabayashi, K.I. Kasai, The family of metazoan metal-independent β-galactoside-
by lactose and galactose (Table 4), illustrating the ability of glycan binding lectins: structure, function and molecular evolution, Glycobiology 3 (1993)
recognition and reversible binding property. Importantly, affinity of 297–304, https://doi.org/10.1093/glycob/3.4.297.
[6] S.H. Barondes, D.N.W. Cooper, M.A. Gitt, H. Leffler, Galectins. Structure and
lectins for galactose [71] and lactose [72] appear to be related to an-
function of a large family of animal lectins, J. Biol. Chem. 269 (1994)
timicrobial activities. In this study, we attempted to validate the bac- 20807–20810, https://doi.org/10.1016/j.celrep.2015.02.012.
terial agglutination capacity of SsGal8 against various Gram (+) and [7] C. Boscher, J.W. Dennis, I.R. Nabi, Glycosylation, galectins and cellular signaling,
(−) bacterial strains, including several known fish pathogens. Previous Curr. Opin. Cell Biol. 23 (2011) 383–392, https://doi.org/10.1016/j.ceb.2011.05.
001.
studies have shown the agglutination of V. alginolyticus and A. hydro- [8] N. Ahmad, H.-J. Gabius, S. André, H. Kaltner, S. Sabesan, R. Roy, B. Liu,
phila by tandem-repeat galectin-9, in teleosts in a calcium dependent F. Macaluso, C.F. Brewer, Galectin-3 precipitates as a pentamer with synthetic
manner [16]. The rSsGal8 was able to agglutinate both Gram (+) and multivalent carbohydrates and forms heterogeneous cross-linked complexes, J. Biol.

460
R.K. Madusanka, et al. Fish and Shellfish Immunology 93 (2019) 449–462

Chem. 279 (2004) 10841–10847, https://doi.org/10.1074/jbc.M312834200. nematode parasite Toxascaris leonina galectin, J. Biol. Chem. 291 (2016)
[9] G.A. Rabinovich, Integrating structure and function of tandem-repeat galectins, 25326–25338, https://doi.org/10.1074/jbc.M116.743773.
Front. Biosci. S4 (2012) 305, https://doi.org/10.2741/s305. [33] N. Bidon, F. Brichory, P. Bourguet, J.-P. Le Pennec, L. Dazord, Galectin-8: a complex
[10] S. Thiemann, L.G. Baum, Galectins and immune responses—just how do they do sub-family of galectins (Review), Int. J. Mol. Med. 8 (2001) 245–250, https://doi.
those things they do? Annu. Rev. Immunol. 34 (2016) 243–264, https://doi.org/10. org/10.3892/ijmm.8.3.245.
1146/annurev-immunol-041015-055402. [34] H. Yoshida, S. Yamashita, M. Teraoka, A. Itoh, S. Nakakita, N. Nishi, S. Kamitori, X-
[11] M. Gordon-Alonso, A.M. Bruger, P. van der Bruggen, Extracellular galectins as ray structure of a protease-resistant mutant form of human galectin-8 with two
controllers of cytokines in hematological cancer, Blood 132 (2018) 484–491, carbohydrate recognition domains, FEBS J. 279 (2012) 3937–3951, https://doi.
https://doi.org/10.1182/blood-2018-04-846014. org/10.1111/j.1742-4658.2012.08753.x.
[12] E. Pardo, C. Cárcamo, R. Uribe-San Martín, E. Ciampi, F. Segovia-Miranda, [35] Y.R. Hadari, K. Paz, R. Dekel, T. Mestrovic, D. Accili, Y. Zick, Galectin-8. A new rat
C. Curkovic-Peña, F. Montecino, C. Holmes, J.E. Tichauer, E. Acuña, F. Osorio- lectin, related to galectin-4, J. Biol. Chem. 270 (1995) 3447–3453, https://doi.org/
Barrios, M. Castro, P. Cortes, C. Oyanadel, D.M. Valenzuela, R. Pacheco, R. Naves, 10.1074/JBC.270.7.3447.
A. Soza, A. González, Galectin-8 as an immunosuppressor in experimental auto- [36] H. Ideo, A. Seko, I. Ishizuka, K. Yamashita, The N-terminal carbohydrate recogni-
immune encephalomyelitis and a target of human early prognostic antibodies in tion domain of galectin-8 recognizes specific glycosphingolipids with high affinity,
multiple sclerosis, PLoS One 12 (2017) e0177472, , https://doi.org/10.1371/ Glycobiology 13 (2003) 713–723, https://doi.org/10.1093/glycob/cwg094.
journal.pone.0177472. [37] M.M. Estabrook, N.C. Christopher, J. McLeod Grifliss, C.J. Baker, R.E. Mandrell,
[13] Y. Zick, M. Eisenstein, R.A. Goren, Y.R. Hadari, Y. Levy, D. Ronen, Role of galectin-8 Sialylation and human neutrophil killing of group C Neisseria meningitidis, J. Infect.
as a modulator of cell adhesion and cell growth, Glycoconj. J. 19 (2002) 517–526, Dis. 166 (1992) 1079–1088, https://doi.org/10.1093/infdis/166.5.1079.
https://doi.org/10.1023/B:GLYC.0000014081.55445.af. [38] J.J. Kim, D. Zhou, R.E. Mandrell, J.M. Griffiss, Effect of exogenous sialylation of the
[14] F.-T. Liu, Galectins: a new family of regulators of inflammation, Clin. Immunol. 97 lipooligosaccharide of Neisseria gonorrhoeae on opsonophagocytosis, Infect.
(2000) 79–88, https://doi.org/10.1006/clim.2000.4912. Immun. 60 (1992) 4439–4442.
[15] A. Arasu, V. Kumaresan, A. Sathyamoorthi, M.K. Chaurasia, P. Bhatt, A.J. Gnanam, [39] J.P. Steringer, S. Bleicken, H. Andreas, S. Zacherl, M. Laussmann, K. Temmerman,
R. Palanisamy, K. Marimuthu, M. Pasupuleti, J. Arockiaraj, Molecular character- F.X. Contreras, T.A.M. Bharat, J. Lechner, H.-M. Müller, J.A.G. Briggs, A.J. García-
ization of a novel proto-type antimicrobial protein galectin-1 from striped murrel, Sáez, W. Nickel, Phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2)-dependent oli-
Microbiol. Res. 169 (2014) 824–834, https://doi.org/10.1016/j.micres.2014.03. gomerization of fibroblast growth factor 2 (FGF2) triggers the formation of a lipidic
005. membrane pore implicated in unconventional secretion, J. Biol. Chem. 287 (2012)
[16] D.L. Zhang, C.H. Lv, D. hui Yu, Z.Y. Wang, Characterization and functional analysis 27659–27669, https://doi.org/10.1074/jbc.M112.381939.
of a tandem-repeat galectin-9 in large yellow croaker Larimichthys crocea, Fish [40] R.C. Hughes, Secretion of the galectin family of mammalian carbohydrate-binding
Shellfish Immunol. 52 (2016) 167–178, https://doi.org/10.1016/j.fsi.2016.03.032. proteins, Biochim. Biophys. Acta Gen. Subj. 1473 (1999) 172–185, https://doi.org/
[17] Z. Mushtaq, R. Krishnan, K.P. Prasad, M.K. Bedekar, A.P. Kumar, Molecular cloning, 10.1016/S0304-4165(99)00177-4.
characterization and expression profiling of galectin-9 gene from Labeo rohita [41] M. Keller, A. Rüegg, S. Werner, H.-D. Beer, Active caspase-1 is a regulator of un-
(Hamilton, 1822), Fish Shellfish Immunol. 76 (2018) 287–292, https://doi.org/10. conventional protein secretion, Cell 132 (2008) 818–831, https://doi.org/10.1016/
1016/j.fsi.2018.02.037. j.cell.2007.12.040.
[18] S. Unajak, N. Pholmanee, N. Songtawee, K. Srikulnath, P. Srisapoome, [42] V. Cattaneo, M.V. Tribulatti, O. Campetella, Galectin-8 tandem-repeat structure is
A. Kiataramkul, H. Kondo, I. Hirono, N. Areechon, Molecular characterization of essential for T-cell proliferation but not for co-stimulation, Biochem. J. 434 (2011)
Galectin-8 from Nile tilapia (Oreochromis niloticus Linn.) and its response to bacterial 153–160, https://doi.org/10.1042/BJ20101691.
infection, Mol. Immunol. 68 (2015) 585–596, https://doi.org/10.1016/j.molimm. [43] H. Arase, N. Arase, T. Saito, Fas-mediated cytotoxicity by freshly isolated natural
2015.09.012. killer cells, J. Exp. Med. 181 (1995) 1235–1238.
[19] J. Chen, L. Zhang, N. Yang, M. Tian, Q. Fu, F. Tan, C. Li, Expression profiling and [44] T. Suda, T. Okazaki, Y. Naito, T. Yokota, N. Arai, S. Ozaki, K. Nakao, S. Nagata,
microbial ligand binding analysis of galectin-4 in turbot (Scophthalmus maximus L.), Expression of the Fas ligand in cells of T cell lineage, J. Immunol. 154 (1995)
Fish Shellfish Immunol. 84 (2019) 673–679, https://doi.org/10.1016/j.fsi.2018.10. 3806–3813.
050. [45] N. Nishi, H. Shoji, M. Seki, A. Itoh, H. Miyanaka, K. Yuube, M. Hirashima,
[20] Y. Zhang, Q. Xu, J. Alós, H. Liu, Q. Xu, H. Yang, Short-term fidelity, habitat use and T. Nakamura, Galectin-8 modulates neutrophil function via interaction with in-
vertical movement behavior of the black rockfish Sebastes schlegelii as determined tegrin M, Glycobiology 13 (2003) 755–763, https://doi.org/10.1093/glycob/
by acoustic telemetry, PLoS One 10 (2015) e0134381, , https://doi.org/10.1371/ cwg102.
journal.pone.0134381. [46] S. Rivest, Regulation of innate immune responses in the brain, Nat. Rev. Immunol. 9
[21] S.-M. Lee, I.G. Jeon, J.Y. Lee, Effects of digestible protein and lipid levels in prac- (2009) 429–439, https://doi.org/10.1038/nri2565.
tical diets on growth, protein utilization and body composition of juvenile rockfish [47] H.J. Kong, W.-J. Kim, H.S. Kim, Y.J. Lee, C.H. Kim, B.-H. Nam, Y.-O. Kim, D.-
(Sebastes schlegeli), Aquaculture 211 (2002) 227–239, https://doi.org/10.1016/ G. Kim, S.-J. Lee, S.-G. Lim, B.-S. Kim, Molecular characterization of a tandem-
S0044-8486(01)00880-8. repeat galectin-9 (RuGlec9) from Korean rose bitterling (Rhodeus uyekii), Fish
[22] S.H. Kang, G.W. Shin, Y.S. Shin, P.K. J, Y. rim Kim, H. hee Yang, E. young Lee, Shellfish Immunol. 32 (2012) 939–944, https://doi.org/10.1016/j.fsi.2012.02.003.
E. goo Lee, N. eung Huh, O.M. Ju, T. sung Jung, Experimental evaluation of pa- [48] W.S. Thulasitha, N. Umasuthan, Q. Wan, B.-H. Nam, T.-W. Kang, J. Lee, A proto-
thogenicity of Lactococcus garvieae in black rockfish (Sebastes schlegeli), J. Vet. Sci. type galectin-2 from rock bream (Oplegnathus fasciatus): molecular, genomic, and
5 (2004) 387–390 doi:200412387 [pii]. expression analysis, and recognition of microbial pathogens by recombinant pro-
[23] H.-J. Han, D.-Y. Kim, W.-S. Kim, C.-S. Kim, S.-J. Jung, M.-J. Oh, D.-H. Kim, Atypical tein, Dev. Comp. Immunol. 71 (2017) 70–81, https://doi.org/10.1016/j.dci.2017.
Aeromonas salmonicida infection in the black rockfish, Sebastes schlegeli Hilgendorf, 01.023.
in Korea, J. Fish Dis. 34 (2011) 47–55, https://doi.org/10.1111/j.1365-2761.2010. [49] W.S. Thulasitha, N. Umasuthan, I. Whang, B.-H. Nam, J. Lee, Antimicrobial re-
01217.x. sponse of galectin-1 from rock bream Oplegnathus fasciatus: molecular, transcrip-
[24] S.-I. Kitamura, S.-J. Jung, W.-S. Kim, T. Nishizawa, M. Yoshimizu, M.-J. Oh, A new tional, and biological characterization, Fish Shellfish Immunol. 50 (2016) 66–78,
genotype of lymphocystivirus, LCDV-RF, from lymphocystis diseased rockfish, Arch. https://doi.org/10.1016/j.fsi.2016.01.010.
Virol. 151 (2006) 607–615, https://doi.org/10.1007/s00705-005-0661-3. [50] M. Tian, N. Yang, L. Zhang, Q. Fu, F. Tan, C. Li, Expression profiling and functional
[25] M. Droege, B. Hill, The Genome Sequencer FLXTM System—longer reads, more characterization of galectin-3 of turbot (Scophthalmus maximus L.) in host mucosal
applications, straight forward bioinformatics and more complete data sets, J. immunity, Fish Shellfish Immunol. 84 (2019) 333–340, https://doi.org/10.1016/j.
Biotechnol. 136 (2008) 3–10, https://doi.org/10.1016/j.jbiotec.2008.03.021. fsi.2018.10.009.
[26] D.W. Mount, Using the basic local alignment search tool (BLAST), Cold Spring Harb. [51] N. Bidon-Wagner, J.-P. Le Pennec, Human galectin-8 isoforms and cancer,
Protoc. 2007 (2007), https://doi.org/10.1101/pdb.top17 pdb.top.17. Glycoconj. J. 19 (2002) 557–563, https://doi.org/10.1023/B:GLYC.0000014086.
[27] S.A. Bustin, V. Benes, J.A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller, 38343.98.
T. Nolan, M.W. Pfaffl, G.L. Shipley, J. Vandesompele, C.T. Wittwer, The MIQE [52] M.M. Fernández, F. Ferragut, V.M. Cárdenas Delgado, C. Bracalente, A.I. Bravo,
guidelines: minimum information for publication of quantitative real-time PCR A.J. Cagnoni, M. Nuñez, L.G. Morosi, H.R. Quinta, M.V. Espelt, M.F. Troncoso,
experiments, Clin. Chem. 55 (2009) 611–622, https://doi.org/10.1373/clinchem. C. Wolfenstein-Todel, K.V. Mariño, E.L. Malchiodi, G.A. Rabinovich, M.T. Elola,
2008.112797. Glycosylation-dependent binding of galectin-8 to activated leukocyte cell adhesion
[28] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real- molecule (ALCAM/CD166) promotes its surface segregation on breast cancer cells,
time quantitative PCR and the 2−ΔΔCT method, Methods 25 (2001) 402–408, Biochim. Biophys. Acta Gen. Subj. 1860 (2016) 2255–2268, https://doi.org/10.
https://doi.org/10.1006/meth.2001.1262. 1016/j.bbagen.2016.04.019.
[29] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram [53] A. Danguy, S. Rorive, C. Decaestecker, Y. Bronckart, H. Kaltner, Y.R. Hadari,
quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. R. Goren, Y. Zich, M. Petein, I. Salmon, H.J. Gabius, R. Kiss, Immunohistochemical
72 (1976) 248–254, https://doi.org/10.1016/0003-2697(76)90527-3. profile of galectin-8 expression in benign and malignant tumours of epithelial,
[30] C. Li, X. Wei, L. Xu, X. Li, Recombinant galectins of male and female Haemonchus mesenchymatous and adipous origins, and of the nervous system, Histol.
contortus do not hemagglutinate erythrocytes of their natural host, Vet. Parasitol. Histopathol. 16 (2001) 861–868, https://doi.org/10.1111/j.1728-4457.2001.
144 (2007) 299–303, https://doi.org/10.1016/j.vetpar.2006.10.015. 00001.x.
[31] S. Kitamura-Abe, H. Itoh, T. Washio, A. Tsutsumi, M. Tomita, Characterization of [54] W.-S. Chen, Z. Cao, S. Sugaya, M.J. Lopez, V.G. Sendra, N. Laver, H. Leffler,
the splice sites in GT-AG and GC-AG introns in higher eukaryotes using full-length U.J. Nilsson, J. Fu, J. Song, L. Xia, P. Hamrah, N. Panjwani, Pathological lym-
cDNAs, J. Bioinform. Comput. Biol. 2 (2004) 309–331, https://doi.org/10.1142/ phangiogenesis is modulated by galectin-8-dependent crosstalk between podo-
S0219720004000570. planin and integrin-associated VEGFR-3, Nat. Commun. 7 (2016) 11302, https://
[32] E.Y. Hwang, M.S. Jeong, S.K. Park, S.C. Ha, H.S. Yu, S.B. Jang, Structural basis for doi.org/10.1038/ncomms11302.
carbohydrate recognition and anti-inflammatory modulation by gastrointestinal [55] L. Tort, J.C. Balasch, S. Mackenzie, Fish Immune System a Crossorads Tort, 22

461
R.K. Madusanka, et al. Fish and Shellfish Immunology 93 (2019) 449–462

(2003), pp. 277–286 2003. leukocyte recruitment in a murine model of lung infection by Streptococcus pneu-
[56] K. Li, Z. Chen, N. Kato, M. Gale, S.M. Lemon, Distinct poly(I-C) and virus-activated moniae, J. Immunol. 180 (2008) 2466–2473, https://doi.org/10.4049/jimmunol.
signaling pathways leading to interferon-β production in hepatocytes, J. Biol. 180.4.2466.
Chem. 280 (2005) 16739–16747, https://doi.org/10.1074/jbc.M414139200. [66] O. Avni, Z. Pur, E. Yefenof, M. Baniyash, Complement receptor 3 of macrophages is
[57] Z. Zhou, B. Zhang, L. Sun, Poly(I:C) induces antiviral immune responses in Japanese associated with galectin-1-like protein, J. Immunol. 160 (1998) 6151–6158.
flounder (Paralichthys olivaceus) that require TLR3 and MDA5 and is negatively [67] R.C. Hughes, Galectins as modulators of cell adhesion, Biochimie 83 (2001)
regulated by Myd88, PLoS One 9 (2014) e112918, , https://doi.org/10.1371/ 667–676, https://doi.org/10.1016/S0300-9084(01)01289-5.
journal.pone.0112918. [68] K. Karakostis, C. Costa, F. Zito, V. Matranga, Heterologous expression of newly
[58] C. Alexander, E.T. Rietschel, Bacterial lipopolysaccharides and innate immunity, J. identified galectin-8 from sea urchin embryos produces recombinant protein with
Endotoxin Res. 7 (2001) 167–202, https://doi.org/10.1179/ lactose binding specificity and anti-adhesive activity, Sci. Rep. 5 (2015) 17665,
096805101101532675. https://doi.org/10.1038/srep17665.
[59] T.L.M. Thurston, M.P. Wandel, N. von Muhlinen, Á. Foeglein, F. Randow, Galectin 8 [69] A.-K. Ludwig, M. Michalak, N. Shilova, S. André, H. Kaltner, N. V Bovin, J. Kopitz,
targets damaged vesicles for autophagy to defend cells against bacterial invasion, H.-J. Gabius, Studying the structural significance of galectin design by playing a
Nature 482 (2012) 414–418, https://doi.org/10.1038/nature10744. modular puzzle: homodimer generation from human tandem-repeat-type (hetero-
[60] D. Glick, S. Barth, K.F. Macleod, Autophagy: cellular and molecular mechanisms, J. dimeric) galectin-8 by domain shuffling, Molecules 22 (2017), https://doi.org/10.
Pathol. 221 (2010) 3–12, https://doi.org/10.1002/path.2697. 3390/molecules22091572.
[61] J.E. Casanova, Bacterial autophagy: offense and defense at the host-pathogen in- [70] H. Ideo, T. Matsuzaka, T. Nonaka, A. Seko, K. Yamashita, Galectin-8-N-domain
terface, Cell. Mol. Gastroenterol. Hepatol. 4 (2017) 237–243, https://doi.org/10. recognition mechanism for sialylated and sulfated glycans, J. Biol. Chem. 286
1016/j.jcmgh.2017.05.002. (2011) 11346–11355, https://doi.org/10.1074/jbc.M110.195925.
[62] H. Sano, D.K. Hsu, J.R. Apgar, L. Yu, B.B. Sharma, I. Kuwabara, S. Izui, F.-T. Liu, [71] S. Dutta, B. Sinha, B. Bhattacharya, B. Chatterjee, S. Mazumder, Characterization of
Critical role of galectin-3 in phagocytosis by macrophages, J. Clin. Investig. 112 a galactose binding serum lectin from the Indian catfish, Clarias batrachus: possible
(2003) 389–397, https://doi.org/10.1172/JCI17592. involvement of fish lectins in differential recognition of pathogens, Comp. Biochem.
[63] J. van der Leij, A. van den Berg, G. Harms, H. Eschbach, H. Vos, P. Zwiers, R. van Physiol. C Toxicol. Pharmacol. 141 (2005) 76–84, https://doi.org/10.1016/j.cca.
Weeghel, H. Groen, S. Poppema, L. Visser, Strongly enhanced IL-10 production 2005.05.009.
using stable galectin-1 homodimers, Mol. Immunol. 44 (2007) 506–513, https:// [72] A.S. Riera, A. Daud, A. Gallo, S. Genta, M. Aybar, S. Sánchez, Antibacterial activity
doi.org/10.1016/j.molimm.2006.02.011. of lactose-binding lectins from Bufo arenarum skin, Biocell 27 (2003) 37–46 http://
[64] H.G. Joo, P.S. Goedegebuure, N. Sadanaga, M. Nagoshi, W. von Bernstorff, www.scielo.org.ar/scielo.php?script=sci_arttext&pid=S0327-
T.J. Eberlein, Expression and function of galectin-3, a beta-galactoside-binding 95452003000100005 , Accessed date: 22 January 2019.
protein in activated T lymphocytes, J. Leukoc. Biol. 69 (2001) 555–564, https:// [73] M. van Lookeren Campagne, C. Wiesmann, E.J. Brown, Macrophage complement
doi.org/10.1189/JLB.69.4.555. receptors and pathogen clearance, Cell Microbiol. 9 (2007) 2095–2102, https://doi.
[65] J. Nieminen, C. St-Pierre, P. Bhaumik, F. Poirier, S. Sato, Role of galectin-3 in org/10.1111/j.1462-5822.2007.00981.x.

462