Namma Kalvi

www.nammakalvi.org

CHAPTER
PRINCIPLES OF INHERITANCE AND VARIATION
4
Points to Remember

 Genetics is a branch of biology that deals  Sex chromosomes may be similar

with the study of heredity and variations. (homomorphic) and dissimilar
 Gene is the unit of heredity and gene is (heteromorphic).
the inherited factor.  Homomorphic individuals - produce only
 Variation - is the degree of difference in one type of gametes (homogametic)
progeny from their parents.  Heteromorphic individuals - produce two
 All genes have two alternative forms types of gametes (heterogametic).
-Dominant and recessive alleles E.g : tall  Heterogametic Sex Determination - In
vs dwarf (T and t). this one sexes produces similar gametes
 Multiple alleles : When three or more and the other sex produces dissimilar
alleles of a gene that control a particular gametes.
trait occupy the same locus  Heterogametic Males -In this Males are
on the homologous chromosome of an heterogametic producing dissimilar gametes
organism, they are called multiple alleles Females are homogametic producing
 Multiple allelism: inheritance of multiple similar gametes.
alleles is called multiple allelism.  It is of two kinds XX-XO type and XX-XY
 Karl Landsteiner - discovered two kinds of type.
antigens called antigen ‘A’ and antigen ‘B’  XX-XO Type -This type is seen in bugs,
 Based on the presence or absence of these cockroaches and grasshoppers.
antigens blood groups are classified. They are  XX-XY type - This type seen in human
Type ‘A’, Type ‘B’, Type ‘O’ (universal beings and in Drosophila.
donor),Type ‘AB’ (universal recipient)  Heterogametic Females - type seen in
 IA and IB are dominant to IO, but co- insects, fishes, reptiles and birds
dominant to each other (IA=IB). Male produce a similar gametes
 The Rh factor or Rh antigen is found on the Female produce dissimilar gametes.
surface of RBC.  ZO-ZZ Type - is seen in moths, butterflies
 Fisher and Race hypothesis - Rh factor and domestic chickens.
involves three different pairs of alleles  ZW-ZZ type - This type seen in insects
located on three different loci (gypsy moth),fishes, reptiles and birds.
 This system is uses the ‘Cde’ nomenclature.  Sex determining Genes are located on two
 Wiener Hypothesis -He proposed eight sex chromosomes, called allosomes.
alleles (R1, R2, R0, Rz, r, r1, r11, ry).  In human 22 pairs of autosomes (44A)
 Dominant ‘R allele’ (R1, R2 ,R0 ,Rz) will produce + one pair of allosomes (XX or XY) =23
Rh+ positive phenotype pairs of chromosomes
 Double recessive genotypes (rr, rr1, rr11, rry)  In 1949, Barr and Bertram observed a
will give rise to Rh-negative phenotype. condensed body in the nerve cells of
 Rh incompatability has great impact on female cat which was absent in the male.
child birth.  This condensed body was called sex
 It is resultin Erythroblastosis foetalis chromatin later it was referred as Barr
body.
 Sex chromosomes determine the sex of
the individual.  Lyon’s hypothesis - Mary Lyon - Barr bodies
represented an inactive chromosome,
 Autosomes - chromosomes other than the
which in females becomes tightly coiled
sex chromosomes

SURYA 53
 www.nammakalvi.org
Chapter - 4 | Principles of inheritance and variation XII Std - Zoology ´ Unit II
into a heterochromatin, a condensed and  These disorders may be dominant or recessive
visible form of chromatin . and autosomal or sex linked.
 Haplodiploidy mechanism of sex  Thalassemia is an autosomal recessive
determination is common in hymenopteran disorder.
insects Eg. honeybees,  Types of Thalassemia ( based on chain
 In this, sex of the offspring is determined by affected)
the number of sets of chromosomes it  Alpha Thalassemia , Beta Thalassemia
receives.
 Phenylketonuria is an inborn error of
 Fertilized eggs develop into females Phenylalanine metabolism
(Queen or Worker)
 Causes : pair of autosomal recessive
 Unfertilized eggs develop into males genes.
(drones) by parthenogenesis.
 It is also caused due to mutation in the
 The inheritance of X or Y linked genes is called gene PAH located on chromosome 12
sex-linked inheritance.
 Albinism - It is an inborn error of
 Genes present on region of X or Y metabolism,
chromosomes are called sex linked genes.
 Caused by an autosomal recessive gene.
 X-linked gene inheritance are
 Huntington’s chorea is an autosomal
Red-green colour blindness or daltonism, dominant lethal gene in man.
Haemophilia, Duchenne’s muscular
 Symptoms : involuntary jerking of the
dystrophy
body and progressive degeneration of the
 Haemophilia is caused by a recessive nervous system, accompanied by gradual
X-linked gene. mental and physical deterioration.
 Colour blindness is Due to dominant X –  Chromosomal Abnormalities are caused
linked gene which is necessary for the by errors in the number or structure of
formation of cones chromosomes.
 The recessive form - incapable of producing  E.g - Down’s syndrome, Turner’s
cone cells. syndrome, Klinefelter’s syndrome,
 The are unable to distinguish red and Patau’s syndrome
green colour.  Several autosomal aneuploidies have been
 Y-linked genes for hypertrichosis (excessive reported in human being
development of hairs on pinna of the ear) are  Down’s syndrome (21-Trisomy),
transmitted directly from father to son
 Patau’s syndrome (13-Trisomy).
 Karyotyping is a technique through which a
 Down’s Syndrome/Trisomy – 21
complete set of chromosomes is separated
from a cell and the chromosomes are  Several sex chromosomal abnormalities
arranged in pairs. have been detected.
 Ideogram - diagrammatic representation of  Eg. Klinefelter’s syndrome and Turner’s
chromosomes. syndrome.
 Pedigree is a “family tree” which is drawn  Klinefelter’s Syndrome (XXY Males)
with standard genetic symbols, it show  Causes: presence of an additional copy of
the inheritance pathway the X chromosome resulting in a karyotype
 Pedigree analysis is the study of traits as of 47 / XXY.
they have appeared in a given family line  These Persons have 47 chromosomes
for several past generations. (44AA+XXY).
 Genetic Disorders Types : Mendelian  Turner’s Syndrome (XO Females)
disorders and chromosomal disorders.  Causes: loss of a X chromosome resulting
 Alteration or mutation in a single gene in a karyotype of 45,X.
causes Mendelian disorders.  Persons with this syndrome have 45
 Mendelian disorders are Thalassemia, chromosomes (44 autosomes and one X
albinism, phenylketonuria, sickle cell anaemia, chromosome) (44AA+XO)
Huntington’s chorea.

54 SURYA
XII Std - Zoology ´ Unit II Chapter - 4 | Principles of inheritance and variation
7. Which of the following is true about Rh factor
PART –A in the offspring of a parental combination Dd
X Dd (both Rh positive)?
TEXTUAL QUESTIONS (1 MARKS)
a) All will be Rh-positive
1. Haemophilia is more common in males b) Half will be Rh positive
because it is a c) About ¾ will be Rh negative
a) Recessive character carried by Y-chromosome d) About one fourth will be Rh negative Ans: d
b) Dominant character carried by Y-chromosome 8. What can be the blood group of offspring
c) Dominant trait carried by X-chromosome when both parents have AB blood group?
d) Recessive trait carried by X-chromosome a) AB only b) A, B and AB
Ans: d c) A, B, AB and O d) A and B only
Ans: b
2. ABO blood group in man is controlled by
a) Multiple alleles b) Lethal genes 9. If the child’s blood group is ‘O’ and fathers
blood group is ‘A’ and mother’s blood group is
c) Sex linked genes d) Y-linked genes ‘B’ the
Ans: a genotype of the parents will be
3. Three children of a family have blood groups a) IA IA and IB Io b) IA Io and IB Io
A, AB and B. What could be the genotypes of c) IA Io and IoIo d) IoIo and IB IB
their parents? Ans: b
a) IA IB and ii b) IA Io and IBIo 10. XO type of sex determination and XY type of
c) IBIB and IAIA d) IA IA and ii Ans: b sex determination are examples of

4. Which of the following is not correct? a) Male heterogamety

b) Female heterogamety
a) Three or more alleles of a trait in the population
are called multiple alleles. c) Male homogamety
b) A normal gene undergoes mutations to form d) Both b) and c) Ans: a
many alleles 11. In an accident there is great loss of blood and
c) Multiple alleles map at different loci of a there is no time to analyse the blood group
chromosome which blood can be safely transferred?
d) A diploid organism has only two alleles out of a) ‘O’ and Rh negative b) ‘O’ and Rh positive
many in the population c) ’B’ and Rh negative d) ‘AB’ and Rh positive
Ans: c Ans: a
5. Which of the following phenotypes in the 12. Father of a child is colourblind and mother is
progeny are possible from the parental carrier for colourblindness, the probability of
combination AxB? the child being colourblind is

a) A and B only b) A,B and AB only a) 25% b) 50% c) 100% d) 75%

Ans: b
c) AB only d) A,B,AB and O
Ans: d 13. A marriage between a colourblind man and a
normal woman produces
6. Which of the following phenotypes is not
a. All carrier daughters and normal sons
possible in the progeny of the parental
genotypic combination IAIO X IAIB? b. 50% carrier daughters, 50% normal daughters

a) AB b) O c) A d) B c. 50% colourblind sons, 50% normal sons

Ans: b d. All carrier offsprings Ans: a

SURYA 55
Chapter - 4 | Principles of inheritance and variation XII Std - Zoology ´ Unit II
14. Mangolism is a genetic disorder which 23. Co-dominant blood group is
is caused by the presence of an extra
a) A b) AB c) B d) O Ans: b
chromosome number
a) 20 b) 21 c) 4 d) 23 24. Which of the following is incorrect regarding
ZW-ZZ type of sex determination?
Ans: b
a. It occurs in birds and some reptiles
15. Klinefelters’ syndrome is characterized by a
karyotype of b. Females are homogametic and males are
heterogametic
a) XYY b) XO c) XXX d) XXY
Ans: d c. Male produce two types of gametes
d. It occurs in gypsy moth Ans: b
16. Females with Turners’ syndrome have
a) Small uterus PART – B,C AND D
b) Rudimentary ovaries
TEXTUAL QUESTIONS (2.3 AND 5 MARKS)
c) Underdeveloped breasts
d) All of these Ans: d 25. What is haplodiploidy?
17. Pataus’ syndrome is also referred to as • It is a sex determination mechanism
which is common in hymenopteran insects
a) 13 -Trisomy b) 18-Trisormy
E.g : honeybees, ants and wasps
c) 21-Trisormy d) None of these
Ans: a • In this, sex of the offspring is determined by
the number of sets of chromosomes it
18. Who is the founder of Modern Eugenics receives.
movement?
26.
Distinguish between heterogametic and
a) Mendel b) Darwin
homogametic sex determination systems.
c) Fransis Galton d) Karl pearson Ans: c
S. Heterogametic Homogametic sex
19. Improvement of human race by encouraging No. sex determination determination
the healthy persons to marry early and 1 In this type two In this type
produce large number of children is called types of gametes only one types
a) Positive eugenics b) Negative eugenics are produced of gamete is
produced
c) Positive euthenics d) Positive euphenics
Ans: a 2 Sex chromosomes Sex chromosomes
are dissimilar are similar
20. The _______deals with the control of several 3 These organisms These organisms
inherited human diseases especially inborn are called as are called as
errors of metabolism Heteromorphic Homomorphic
a) Euphenics b) Eugenics individuals individuals
c) Euthenics d) All of these Ans: a 27. What is Lyonisation?

21. “Universal Donor” and “Universal Recipients” • It is an condition Where there are two or
blood group are _____ and_______ more haploid sets of X- Linked genes
respectively in each cell all but one of the genes are
inactivated apparently at random and have
a) AB, O b) O, AB
no phenotypic expression.
c) A, B d) B, A Ans: b
• Lyonization is usual but it is not common in
22. ZW-ZZ system of sex determination occurs in all loci
a) Fishes b) Reptiles • Lyonization occurs in men with the Klinefelter
c) Birds d) All of these Ans: d (XXY) karyotype

56 SURYA
XII Std - Zoology ´ Unit II Chapter - 4 | Principles of inheritance and variation
28. What is criss-cross inheritance? 34. Explain the genetic basis of ABO blood
This type of inheritance of recessive sex linked
 grouping man.
character from father to daughter and • Blood group is determined by -three
then from the daughter to her sons is autosomal alleles located on chromosome
known as criss-cross inheritance or sex 9.
linked or X-linked inheritance.
• The gene controlling blood type are ‘L’
29. Why are sex linked recessive characters more (L-Landsteiner) or I (I - isoagglutination).
common in the male human beings?
• I gene occurs in three allelic forms, IA, IB
• Sex linked inherited traits are more common and IO.
in males than females
 IA denotes A antigen.
• This is because, males are hemizygous (has
only one X gene)  IB denotes B antigen
 IO denotes no antigen.
30. What are holandric genes?
• Y- linked or holandric genes – The genes • IA and IB are dominant to IO, but co-
present in the region of Y chromosome dominant to each other (IA=IB).
• The Y linked genes have no corresponding • Dominance hierarchy is - (IA=IB> IO).
allele in X chromosome. • A child receives one of three alleles from
• Y linked genes inherit along with Y chromosome each parent, and result in six possible
and phenotypically express only in the genotypes and four possible blood
male. groups (phenotypes).
31. Mention the symptoms of Phenylketonuria. • The genotypes : IA IA, IA IO - A group
• Symptoms of phenylketonuria include  IBIB, IB IO - B group
severe mental retardation, light  I I - AB Group
A B
pigmentation of skin and hair.
 IOIO - O Group
• Phenylpyruvic acid is excreted in the urine.
35. How is sex determined in human beings?
32. Mention the symptoms of Downs syndrome.
• Sex chromosomes determine the sex of
• Severe mental retardation,
the individual.
• Defective development of the central nervous
system, • Autosomes - chromosomes other than the
sex chromosomes
• Increased separation between the eyes,
• Sex chromosomes may be similar
• Flattened nose, (homomorphic) and dissimilar
• Ears are malformed, (heteromorphic).
• Mouth is constantly open and the tongue • Homomorphic individuals - produce only
protrudes one type of gametes (homogametic)
33. Differentiate Intersexes from Supersexes
The presence of both male and female

reproductive characteristics in one
individual is common both, but Supersex
is a natural condition while intersex is a
disorder.
Supersex individuals are able to

reproduce while intersex individuals are
usually not.
Supersexes are found among animals

and plants, but intersex individuals are
found among humans.

SURYA 57
 www.nammakalvi.org
Chapter - 4 | Principles of inheritance and variation XII Std - Zoology ´ Unit II
• Heteromorphic individuals - produce two  Females are homogametic with XX
types of gametes (heterogametic). chromosome,
• Females are homogametic with XX  Males are heterogametic with X and Y
chromosome, chromosome.
• Males are heterogametic with X and Y  Females produce only one kind of egg,
chromosome. each with one X chromosome,
• Females produce only one kind of egg,  Males produce two kinds of sperms (1.with
each with one X chromosome, X chromosome and 2. with Y chromosome.
• Males produce two kinds of sperms (1.with  Gender - depends on the type of fertilizing
X chromosome and 2. with Y chromosome. sperm
• Gender - depends on the type of fertilizing
sperm.
36. Explain male heterogamety.
• In this Males are heterogametic producing
dissimilar gametes.
• Females are homogametic producing
similar gametes.
• It is of two kinds XX-XO type and XX-XY
type.
37. Brief about female heterogamety.
XX-XO Type
Heterogametic Females
• In this type seen in insects, fishes, reptiles
and birds
• Male produce a similar gametes
• Female produce dissimilar gametes.
• Female sex - ‘X’ chromosome or one ‘X’ and
one ‘Y’ chromosome.
• Thus females are heterogametic and
produce two types of eggs.
• This type is seen in bugs, cockroaches and • In this ‘Z’ and ‘W’ are used here instead of X
gras shoppers. and Y respectively.
• Female - two X chromosomes - XX • Heterogametic females are of two types, ZO-
(homogametic) ZZ type and ZW-ZZ type.
• Males - only one X chromosome - XO ZO-ZZ Type
(heterogametic)
• Unpaired X chromosomes determines
the male sex.
• The males produce two types of sperms,
1.one half with X chromosome 2. other half
without X chromosome.
• The sex of the offspring depends upon
the sperm that fertilizes the egg.
XX-XY type (Lygaeus Type)
• This type is seen in moths, butterflies and
 This type seen in human beings and in domestic chickens.
Drosophila.
58 SURYA
XII Std - Zoology ´ Unit II Chapter - 4 | Principles of inheritance and variation
• Female have single ‘Z’ chromosome • Double recessive genotypes (rr, rr1, rr11, rry)
(heterogametic -ZO) will give rise to Rh-negative phenotype.
• Two kinds of eggs some organisms are 39. Explain the mode of sex determination in
with ‘Z’ chromosome and without ‘Z’ honeybees.
chromosome,
Haplodiploidy in Honeybees
• Male have two ‘Z’ chromosomes
• Haplodiploidy mechanism of sex
(homogametic - ZZ)
determination is common in hymenopteran
ZW-ZZ type insects
E.g : honeybees, ants and wasps
• In this, sex of the offspring is determined by
the number of sets of chromosomes it
receives.
• Fertilized eggs : develop into females
(Queen or Worker)
• Unfertilized eggs : develop into males
(drones) by parthenogenesis.
• This type seen in insects (gypsy moth),fishes,
reptiles and birds. • So males have half the number of
chromosomes (haploid), Females have
• Female has one ‘Z’ and one ‘W’ double the number
chromosome (ZW) which producing
two types of eggs, some carrying the Z (diploid), hence this system of sex determination
chromosomes and some carry the W is known as the name haplodiplody.
chromosome. • This method assists the evolution of
• The male sex has two ‘Z’ chromosomes sociality in which only one diploid female
(homogametic -ZZ) becomes a queen
and lays the eggs for the colony.
38. Give an account of genetic control of Rh
factor. • Kin Selection - All diploid females which
Fisher and Race hypothesis: developed from fertilized eggs help to raise
the queen’s
• Rh factor involves three different pairs of
alleles located on three different loci eggs and so contribute to the queen’s
reproductive success and indirectly to their
• This system is uses the ‘Cde’ nomenclature. own, a
• Three pairs of Rh alleles are Cc, Dd and Ee phenomenon known as Kin Selection.
• Genotypes will be one C or c, one D or d, • The queen constructs their social environment
one E or e from each chromosome. by releasing a hormone that suppresses
E.g : C
 DE/cde; CdE/cDe; cde/cde; CDe/CdE fertility of the workers.
etc.,
40. Discuss the genic balance mechanism of sex
• Atleast one dominant genotypes‘D’ allele determination with reference to Drosophila.
will produce Rh+ positive phenotype
• Double recessive genotype ‘dd’ will produce
Rh- negative phenotype.
Wiener Hypothesis :
• He proposed eight alleles (R1, R2, R0, Rz, r, r1,
r11, ry).
• Dominant ‘R allele’ (R1, R2 ,R0 ,Rz) will produce
XX-XY type (Lygaeus Type)
Rh+ positive phenotype

SURYA 59
Chapter - 4 | Principles of inheritance and variation XII Std - Zoology ´ Unit II
• This type seen in human beings and in only one X gene)
Drosophila. • X - linked and Y - linked genes (non
• Females are homogametic with XX homologus region) do not undergo
chromosome, pairing or crossing over during meiosis.
• Males are heterogametic with X and Y 43. What is extra chromosomal inheritance?
chromosome. Explain with an example.
• Females produce only one kind of egg, • Transmission of characters dependent on
each with one X chromosome, some factor which is not connected with the
• Males produce two kinds of sperms chromosomes
(1. with X chromosome and 2. with Y • It is also known as cytoplasmic inheritance
chromosome.)
• Example: Cytoplasmic inheritance of
• Gender - depends on the type of fertilizing chloroplasts and mitichondria.
sperm.
44. Comment on the methods of Eugenics
41. What are the applications of Karyotyping?
Classical eugenics
• It helps in gender identification.
• Advocacy for sexual abstinence
• It is used to detect the chromosomal
• Sex education in schools.
aberrations like deletion, duplication,
translocation, nondisjunction of chromosomes. • Promoting the use of contraception.
• It helps to identify chromosomal • Research for better contraceptives.
abnormalities like aneuploidy. • Voluntary sterilization.
• It is also used to predict the evolutionary • Abortion.
relationships between species.
Negative eugenics
• It is used to Genetic diseases can be
• Incentives for sterilization.
detected.
• Incentives for women on welfare to use
42.
Explain the inheritance of sex linked contraceptions.
characters in human being.
• Compulsory sterilization of the “mentally
• The inheritance of X or Y linked genes is called retarded” and criminals.
sex-linked inheritance.
Positive eugenics.
• Genes present on region of X or Y
chromosomes are called sex linked genes. • Financial incentives to have children.
• X linked genes - The genes present in the l • Taxation of the childless.
region of “X” chromosome. • Eugenic immigration
• The X–linked genes have no corresponding New eugenics
alleles in the Y chromosome. • Artificial insemination by donor.
• Y- linked or holandric genes – The genes • Egg donation.
present in the region of Y chromosome
• Pre implantation and prenatal diagnosis of
• The Y linked genes have no corresponding genetic disorders and pregnancy terminations
allele in X chromosome. of defective fetuses.
• Y linked genes inherit along with Y chromosome • Embryo selection.
and phenotypically express only in the • Genetic engineering.
male.
• Gene therapy
• Sex linked inherited traits are more common
in males than females • Cloning

• This is because, males are hemizygous (has

60 SURYA
XII Std - Zoology ´ Unit II Chapter - 4 | Principles of inheritance and variation
7. A child is blood group is ‘O’. His parents blood
PART-A group can not be:-
a) B & O b) A & O
ADDITIONAL QUESTIONS (1 MARK)
c) AB d) A & B Ans: c
1. If a genetic disease is transferred from a
phenotypically normal but carrier female to 8. If one parent has blood group A and the other
only some parent has blood group B. The off springs
of the male progeny, the disease is: have which blood group:-

a) Autosomal dominant a) AB only b) O only

b) Autosomal recessive c) B only d) A,B, AB, O Ans: d
c) Sex-linked dominant 9. A Child of O blood group, has B- blood father,
d) Sex-linked recessive Ans: d the genotype of father would be:-
2. Person having genotype IA, IB would show a) IOIO b) IBIB
the blood group as AB. This is because of: c) IAIB d) IBIO Ans: d
a) Pleiotropy
10. Sickle cell anaemia induces due to
b) Co-dominance
a) Change of Amino Acid in - Chain of Haemoglobin
c) Segregation
d) Incomplete dominance Ans: b b) Change of Amino Acid - Chain of Haemoglobin

3. ZZ / ZW type of sex determination is seen in:

c) Change of Amino Acid in both and chain of
haemoglobin
a) Platypus b) Snails
d) Change of Amino acid either or Chain of
c) Cockroach d) Birds Ans: d
haemoglobin
4. Mother and father of a person with ‘O’ Ans: b
blood group have ‘A’ and ‘B’blood group
respectively. 11. If mother has blood group B, father has A
group the offspring will be out:-
What would be the genotype of both
motherand father? a) A b) O
a) Mother is homozygous for ‘A’ blood group and c) AB d) Any of the above
father is heterozygousfor ‘B’ Ans: d
b) Mother is heterozygous for ‘A’ blood group and
12. A colour blind man marries a normal lady
father is homozygousfor ‘B’
whose father was colour blind. If it produces
c) Both mother and father are heterozygous for two sons & two daughters, how many of them
‘A’ and ‘B’ bloodgroup, respectively
would be suffer
d) Both mother and father are homozygous for ‘A’
and ‘B’ bloodgroup, respectively Ans: d a) Both sons
b) Both daughters
5. AB-Bloood group shows:-
a) Co-dominance c) One son & one daughter
b) Complete dominance d) Both sons & both daughters Ans: c
c) Mixed inheritance 13. A colourblind daughter is born when
d) Composite inheritance Ans: a a) Father is colourblind, mother is normal
6. ABO blood group is an example of b) Mother is colourblind, father is normal
a) Epistasis b) Multiple allelism c) Mother is carrier, father is normal
c) Pleotropism d) Complementary d) Mother is carrier, father is colourblind
genes
Ans: d
Ans: b

SURYA 61
 www.nammakalvi.org
Chapter - 4 | Principles of inheritance and variation XII Std - Zoology ´ Unit II
14. In which of the following the inheritance 21. Which of the following symbols are used for
takes place only by male:- representing sex chromosomes of birds:
a) Nuclear a) ZZ –ZW b) XX – XY
b) Cytoplasmic c) XO – XX d) ZZ – WW Ans: a
c) Co-dominance 22. In which of the following sex is determined
by female individual
d) Holandric inheritance Ans: d
a) Human b) Drosophila
15. Which of the following is not a sex linked
characters c) Birds d) Grasshopper Ans: c

a) Haemophilia b) Colour blindness 23. Male heterogamy found in case of

c) Hypertrichosis d) Baldness Ans: d a) XO type male in Grasshopper

b) XY type male in human
16. The condition in which only one allele of a
pair is present in a diploid organism is known c) ZW male in birds
as d) 1 and 2 both Ans: d
a) Homozygous 24. Which is a dominant trait:
b) Heterozygous a) Colour blindness b) Albinism
c) Hemizygous c) Haemophilia d) Rh factor Ans: d
d) Incomplete dominance Ans: c 25. Parents are carrier for albinism. What will be
17. Sex-linked disorders are generally the first three children:

a) Lethal b) Recessive a) Some normal, heterozygous & albino

c) Dominant d) Not inherited b) All normal

Ans: b c) All heterozygous, albino
18. If a colour blind woman marries with a normal d) No normal Ans: a
man. The offspring will be: 26. Which one of the following character in man
a) All is controlled by recessive gene:

b) All daughters normal and all son will be a) Colourblindness b) Woolly hair
colourblind c) Brachy-dactyly d) Curly hairs Ans: a
c) All normal 27. If a colourblind woman marries a normal
d) All daughters will be colourblind and all sons visioned man, their sons will be –
will be normal Ans: b a) All normal visined
19. How the sex of offspring determined in b) One – half colourblind and one – half normal
humans c) Three – forthscolourblind and one- fourth
a) Sex chromosome of mother normal
b) Size of ovum d) All colourblind Ans: d

c) Size of sperm 28. ABo blood groups in humans are controlled

by the gene I. It has three alleles – IA, IB and
d) Sex chromosome of father Ans: d I0. Since there are three different alleles, six
20. Which chromosome set is found in male grass different genotypes are possible. How many
hopper:- phenotypes can occur?

a) 2A+XY b) 2A + XO a) Four b) Two

c) 2A + YY d) 2A+XX Ans: b c) Three d) One Ans: a

62 SURYA
XII Std - Zoology ´ Unit II Chapter - 4 | Principles of inheritance and variation
These questions consists of two statements
each, printed as Assertion and Reason. PART-B
While answering these questions you are
required to choose any one of the following ADDITIONAL QUESTIONS (2 MARKS)
four response.
a) If both Assertion & Reason are True & the 1. Define Allels.
Reason is a correct explanation of the Assertion • Acording to Mendelian inheritance all genes
b) If both Assertion & Reason are True but Reason have two alternative forms, these
alternative form of a same gene is known as
is not a correct explanation of the Assertion.
alleles
c) If Assertion is True but the Reason is False.
• Dominant and recessive alleles e.g. tall vs
d) If both Assertion & Reason are false. dwarf (T and t).
29. Assertion : Inheritance is the basis of heredity 2. Define variation.
Reason : Inheritance is the process by which • Variation is the degree of difference in
characters are passed on from parent to progeny. progeny from their parents.
a) A b) B c) C d) D 3. Define multiple alleles and multiple allelism.
Ans: a
• When three or more alleles of a gene that
30. Assertion : Multiple alleles can be found only control a particular trait occupy the same
when population studies are made. locus on the homologous chromosome of an
Reason : Occasionally, a single gene product organism, they are called multiple alleles
may produce more than one effect • The inheritance of multiple alleles is called
a) A b) B c) C d) D Ans: b multiple allelism.
• Multiple allelism occurs in humans blood
31. Assertion : XO type, XY type & ZW type are groups.
the example of male heterogamety.
Reason : Male produces two types of sperms 4. Define the tem Eugenics, Euthenics,
Euphenics.
a) A b) B c) C d) D
• Eugenics is a measure to improve
Ans: d
the quality of human population by
32. Assertion : Sickle-cell anaemia is caused by encouraging or discouraging reproduction
the substitution of glumatic acid by valine at • Euthenics is a measure to improve the
the sixth position of the beta globin chain of environment in order to improve health, or
the haemoglobin molecule. well being of society
Reason : It is due to the single base substitution • Euphenics is a measure to improve the
at the sixth codon of the beta globin gene from individual or phenotype by biological
GUG to GAG method
a) A b) B c) C d) D Ans: c 5. Define Gene.
33. Assertion : Male is haploid and female is • Gene is the unit of heredity and gene is
diploid in honey bee. the inherited factor
Reason : Sex depends on paired and unpaired • Genetics is a branch of biology that deals
chromosomes in every organism with the study of heredity and variations.
a) A b) B c) C d) D Ans: c 6. List out the genes that control the blood
34. Assertion : Most of the X – linked disorders group.
can not be eliminated easily from nature and • IA IA, IA IO - A group
Our gene pool • IBIB, IB IO - B group
Reason : X –linked disorders are due to recessive • IA IB - AB Group
a) A b) B c) C d) D Ans: a • IOIO - O Group

SURYA 63
Chapter - 4 | Principles of inheritance and variation XII Std - Zoology ´ Unit II
7. Define secretor. 13. Compare the size of x and y chromosome.
• Individuals who possess A antigen and B • Y chromosome - 60 Mb in size with 60
antigen in saliva are called secretors. functional genes
• Secretors can be found in tears, saliva, • X chromosomes - 165 Mb in size with about
urine, semen, gastric juice and milk. 1,000 genes.
8. List out the enzyme produced by IA and IB, IO. 14. What is heterogametic sex determination?
• IA allele produces N-acetyl galactose • In this one sexes produces similar
transferase and can add N-acetyl gametes and the other sex produces
galactosamine (NAG)
dissimilar gametes.
• IB allele produces galactose transferase
that adds galactose. • The sex of the offspring is determined at
the time of fertilization
• IO/IO allele will not produce transferase
enzyme 15. What is Barr Body?

9. What is null allele? Why it is called so? • In 1949, Barr and Bertram observed a
condensed body in the nerve cells of
• IO/IO allele will not produce any transferase
female cat which was absent in the male.
enzyme therefore they are called “null”
allele moreover it cannot add NAG or • This condensed body was called sex
galactose. chromatin later it was referred as Barr
body.
10. Define Rh factor.
• The Rh factor or Rh antigen is found on the 16. “Genes contain the information that is
surface of RBC. required to express a particular trait.” Explain.
• Discovered by Karl Landsteiner and • After Mendel’s period, scientists discover that
Alexander Wiener in 1940 genes are present on chromosomes and
• From - blood of rhesus monkey, Macaca they were responsible for inheritance of
rhesusand later in human beings. characters.
• ‘Rh factor’ means “immunogenic Dantigen • Hence, it is said that genes contain the
of the Rh blood group system. information that is required to express a
particular trait.
• Person with D antigen are Rh D positive
(Rh+) 17. In our society a woman is often blamed for
• Person without D antigen are Rh D negative not bearing male child. Do you think it is
(Rh-)”. right? Justify.

11. Explain weiner hypothesis. • Based on sex determination in humans, Y

chromosome which is present in males comes
• He proposed eight alleles (R1, R2, R0, Rz, r, r1, from the father and not from the mother.
r11, ry).
• Females are homogametic with XX
• Dominant ‘R allele’ (R1, R2 ,R0 ,Rz) will produce
chromosome,
Rh+ positive phenotype
• Double recessive genotypes (rr, rr1, rr11, rry) • Males are heterogametic with X and Y
will give rise to Rh-negative phenotype. chromosome.
• Females produce only one kind of egg,
12. Explain the term HDN.
each with one X chromosome,
• Rh incompatability in mother and foetus blood
has great impact on child birth. • Males produce two kinds of sperms (1.with
X chromosome and 2. with Y chromosome.
• It Causes haemolysis of foetal RBCs result
in haemolytic jaundice and anaemia. • Gender - depends on the type of fertilizing
sperm so we should not blame women
• This condition is known as
Erythoblastosisfoetalis or Haemolytic
disease of the new born (HDN).

64 SURYA
XII Std - Zoology ´ Unit II Chapter - 4 | Principles of inheritance and variation
18. Can a child have blood group O if his parents chromosomes (ZW) and is heterogametic.
have blood group ‘A’ and‘B’. Explain.
22. Human population shown variations in blood
• A child from parents with blood group ‘A’ and groups. Explain the genetic basis for this
‘B’ can have child with O blood group. variation seen in the population.
• If genotype of one parent is IA IO and that of • ABO blood groups are controlled by gene I.
another parent is IB IO; then gametes from the
parents can have any one of the genotype, • The gene I has three alleles IA, IB and IO
i.e. IAIO or IBIO or IOIO • This phenomenon is known as multiple
• If fertilization happens between gametes with allelism.
IOIO, then the child’s genotype will be IOIO
and hence the child can have blood group PART-C
O.
19. What is Down’s syndrome? Give its symptoms ADDITIONAL QUESTIONS (3 MARKS)
and cause. 1. Write short notes on Rh factor.
• Down’s syndrome is a chromosomal • The Rh factor or Rh antigen is found on the
disorder. surface of RBC.
• Trisomic condition of chromosome - 21 • Discovered by Karl Landsteiner and
results in Down’s syndrome
Alexander Wiener in 1940
Symptoms :
• From - blood of rhesus monkey, Macaca
 Severe mental retardation, rhesus and later in human beings.
 Defective development of the central • ‘Rh factor’ means “immunogenic D antigen
nervous system, of the Rh blood group system.
 Increased separation between the eyes, • Person with D antigen are Rh D positive
 Flattened nose, (Rh+)
 Ears are malformed, • Person without D antigen are Rh D negative
 Mouth is constantly open and the tongue (Rh-)”.
protrudes. • Rhesus factor is dominant inherited trait.
20. Why is the frequency of red-green colour • Normally Anti D antibodies are absent in
blindness is many times higher in males than the plasma
that in the females? • If Rh negative person is exposed to Rh
• The genes that produce photo pigments are positive cells for the first time, anti D
present on X-chromosomes. antibodies are formed in the blood of that
• If some of the gene is missing or damaged, individual.
it can result in colourblindness. • If Rh positive person receives Rh negative
• Since males have only one X-chromosome, blood no effect is seen.
the chances of colour blindness is very 2. Explain fisher and race hypothesis.
high in males.
Fisher and Race hypothesis:
21. Identify the correct statement. • Rh factor involves three different pairs of
a) Female of many birds has a pair of alleles located on three different loci
dissimilar ZW chromosomes, while
the males possess a pair of similar ZZ
chromosomes.
b) Female of many birds has a pair of
similar ZZ chromosomes, while the
males possess a pair of dissimilar ZW
chromosomes.
• Statement (a) is correct.
• In birds, the male has two homomorphic sex
chromosomes (ZZ) and is homogametic,
and the female has two heteromorphic sex • This system is uses the ‘Cde’ nomenclature.
SURYA 65
 www.nammakalvi.org
Chapter - 4 | Principles of inheritance and variation XII Std - Zoology ´ Unit II
• Three pairs of Rh alleles are Cc, Dd and Ee • Small head with small eyes, cleft palate,
• Genotypes will be one C or c, one D or d, malformation of the brain and internal
one E or e from each chromosome. organs
E.g : CDE/cde; CdE/cDe; cde/cde; CDe/
CdE etc.,
• Atleast one dominant genotypes ‘D’ allele
will produce Rh+ positive phenotype
• Double recessive genotype ‘dd’ will produce
Rh- negative phenotype.
3. Compare genetic basis of the human ABO
blood grouping.

Antigens Antibodies
Blood group
Genotype present present in
phenotype
on RBC blood plasma
IAIA Type A A Anti -B
IAIo Type A A Anti -B
IBIB Type B B Anti -A
IBIo Type B B Anti -A 5. If a colour blind man Marry a normal visioned
Neither Anti woman. What would be probability of her
IAIB Type AB A and B -A sons and daughters to be colour blind?
nor Anti-B Explain with the help of a pedigree chart.
Neither Anti -A &
IoIo Type O F1 generation:
A nor B anti - B
4. Explain Autosomal anueploidy in human  They produce normal visioned male and
beings. female carriers.
• Several autosomal aneuploidies have been F2 generation :
reported in human being They produce
• Down’s syndrome (21-Trisomy),
1. Normal visioned carrier daughter,
• Patau’s syndrome (13-Trisomy).
2. Colourblind daughter
(i). Down’s Syndrome/Trisomy – 21
3. Normal visioned son
• Trisomic condition of chromosome - 21
results in Down’s syndrome. 4. Colourblind son

• Symptoms:severe mental retardation,  The marriage between a F1 normal visioned

defective development of the central carrier woman and a normal visioned
nervous system, increased separation male will produce
between the eyes, flattened nose, ears
1. One normal visioned female,
are malformed, mouth is constantly
open and the tongue protrudes. 2. One carrier female,
(ii). Patau’s Syndrome/Trisomy-13 3. One normal visioned male
• Trisomic condition of chromosome 13 4. One colour blind male.
results in Patau’s syndrome.  Colour blindness is inherited from the male
• Causes : Meiotic non disjunction. parent to his grandson through carrier
• Symptoms: multiple and severe body daughter.
malformations and deep mental  Colour blindness is an example of criss –
deficiency.
cross pattern of inheritance.

66 SURYA
XII Std - Zoology ´ Unit II Chapter - 4 | Principles of inheritance and variation
6. Describe the individuals having following 9. Differentiate between male and female
chromosomal abnormalities. a) XXY b) XO heterogamety.
a)
XXY - Klinefelter’s Syndrome (XXY Male heterogamety
Males) • The type of sex determination mechanism
 Causes: presence of an additional copy of shown in female XX with male XY is called
the X chromosome resulting in a karyotype male heterogamety because male produces
of 47 / XXY. two different types of gametes.
 These Persons have 47 chromosomes Example – Drosophila
(44AA+XXY). Female heterogamety
 They are usually sterile males, tall, obese, • The type of sex determination mechanism
with long limbs, high pitched voice, shown in female ZW with male ZZ is female
under developed genitalia and have weak heterogamety because female produces
breast (gynaecomastia) development. two different types of gametes.
b) Turner’s Syndrome (XO Females) Example - Birds
 Causes: loss of a X chromosome resulting 10. Why is haemophilia generally observed in
in a karyotype of 45,X. human males? Explain the conditions under
 Persons with this syndrome have 45 which a human female can be haemophilic.
chromosomes (44 autosomes and one X • Haemophilia is genetically due to the presence
chromosome) (44AA+XO) of a recessive sex linked gene ‘h’, carried
 They are sterile females. by X chromosome.
• It is generally observed in males as a single
 Symptoms : Low stature, webbed neck,
gene for the defect is able to express
under developed breast, rudimentary
itself as the Y chromosome is devoid of any
gonads lack of menstrual cycle during
corresponding allele (XhY).
puberty.
7. Explain the phenomena of co-dominance and PART-D
multiple allelism in human population?
• In the ABO system, there are four blood ADDITIONAL QUESTIONS (5 MARKS)
groups A, B, AB and O.
• ABO blood groups are controlled by gene I. 1. Explain the genetic basis of ABO – blood
groups in human population.
• The gene I has three alleles I , I and I this
A B o

phenomenon is known as multiple allelism. Multiple allele inheritance of ABO blood groups
• IA and IB are completely dominant over IO  Chemical nature of Blood differs individually.
• When IA and IB are present together they  Different incompatible blood groups are
both express themselves and produce mixed, agglutination (clumping) of RBC
blood group AB. occurs.
• This phenomenon is known as codominance.  This is due to the presence of different
antigens (surface antigens) on the membrane
8. Differentiate between dominance and co- of RBC
dominance.
 Karl Landsteiner - discovered two kinds of

Co-dominance antigens called antigen ‘A’ and antigen ‘B’
Dominance
(i) F1 is similar to the F1 is different from  Based on the presence or absence of these
dominant parent. either of the two antigens blood groups are classified. They are
parents. 1. Type ‘A’,
(ii) In F1 hybrid, the In F1 hybird, both
2. Type ‘B’,
dominant trait the alleles express
is completely themselves 3. Type ‘O’ (universal donor)
expressed. independently.

SURYA 67
Chapter - 4 | Principles of inheritance and variation XII Std - Zoology ´ Unit II
2. Type ‘AB’ (universal recipient) rare group was
discovered in 1902 by two of Landsteiner’s
students Von De Castelle and Sturli.
 Bernstein in 1925 discovered that the
inheritance of blood groups is determined
by multiple allelic series.
 Blood group is determined by -three
autosomal alleles located on chromosome
9. • This type of mechanism also seen in insects
 The gene controlling blood type are ‘L’ like gypsy moth,fishes, reptiles and birds.
(L-Landsteiner) or I (I - isoagglutination). • Female has one ‘Z’ and one ‘W’
 I gene occurs in three allelic forms, IA, IB chromosome (ZW) which producing
and IO. two types of eggs, some carrying the Z
IA denotes A antigen.
 chromosomes and some carry the W
chromosome.
IB denotes B antigen

• The male sex has two ‘Z’ chromosomes
IO denotes no antigen.
 (homogametic -ZZ)
 Individuals who possess these antigens in
4. Differentiate between ‘ZZ’ and ‘XY’ type of
saliva are called secretors.
sex-determination mechanisms.
 Each allele produces a transferase enzyme.
S. ZZ-sex XY-sex
 IA allele produces N-acetyl galactose No. determination determination
transferase and can add N-acetyl
1 This is This is
galactosamine (NAG)
chromosomal sex chromosomal sex
 IB allele produces galactose transferase determination determination
that adds galactose. where where male are
 IO/IO allele will not produce transferase females are heterogametic,
heterogametic i.e, they produce
enzyme therefore they are called “null”
i.e, they produce two types
allele moreover it cannot add NAG or
two type of of gametes
galactose. gametes, (ZW) (XY), while the
 IA and IB are dominant to IO, but co- while the females are
dominant to each other (IA=IB). male are homogametic
 Dominance hierarchy is - (IA=IB> IO). homogametic i.e,. they possess
i.e, they produce similar type of
 A child receives one of three alleles from similar type of gamete (XX).
each parent, and result in six possible gamete (ZZ).
genotypes and four possible blood
groups (phenotypes).
2 The females The females
 The genotypes : produce two produce one
o IA IA, IA IO - A group type of eggs (A + type of egg (X)
Z) and (A while the males
o IB IB, IB IO - B group + W), while the produce two
o IA IB - AB Group males produce types of sperms
only one type of (X) and (Y).
o I I
O O
- O Group sperm (A + Z).
3. Explain mechanism of sex-determination
mechanism in birds. 3 Eg : birds, fish, Eg : Humans and
• Mechanism of Sex-determination in some reptiles, Drosophila.
birds ZW-ZZ type etc

68 SURYA
XII Std - Zoology ´ Unit II Chapter - 4 | Principles of inheritance and variation
5. Write the types of sex-determination  Beta Thalassemia
mechanisms the following crosses show. Give • Alpha Thalassemia – due to Mutation or
an example of each type.
deletion of alpha gene alleles
a) Female XX with male XO • It is controlled by HBA1 and HBA2 gene
b) Female ZW with male ZZ. which is on chromosome 16.
 The type of sex determination mechanism • Beta Thalassemia – due to production of
shown in female XX with male XO is called beta globin chain is affected.
male heterogamety. In this case male are
• It is controlled by a single gene (HBB) on
heterogametic with half the male gametes
chromosome 11.
carrying X-chromosome while the other
half being devoid of it. • Thalassemia is also known as Cooley’s
anaemia.
 Example - Grasshopper
 The type of sex determination mechanism • In this disorder the alpha chain production
shown in female ZW with male ZZ is female is increased and damages the membranes
heterogamety because female produces two of RBC.
different types of gametes. 7. Write short notes on Haemophilia and its
 Example - Birds symtopms

6. What is mendlian disorder ? list out Mendelian • It is commonly known as bleeder’s disease.
disorders. Explain in detail about Thalassemia • This is more common in men than women.
Mendelian disorders
• First reported by John Cotto in 1803.
• Alteration or mutation in a single gene
• Haemophilia is caused by a recessive
causes Mendelian disorders.
X-linked gene.
• These disorders are transmitted to the
• This persons lacks a normal clotting
offsprings by Mendelian pattern of
substance (thromboplastin) in blood,
inheritance.
hence minor injuries cause continuous
• Mendelian disorders are Thalassemia, bleeding, leading to death.
albinism, phenylketonuria, sickle cell
anaemia, Huntington’s chorea, etc., • The females are carriers of the disease
and transmit the disease to 50% of their
• These disorders may be dominant or recessive sons even if the male parent is normal.
and autosomal or sex linked.
• Characteristic feature : criss - cross pattern
Thalassemia of inheritance.
• It is an autosomal recessive disorder.
8. Define pedigree analysis. State the
• Causes : gene mutation resulting in conclusions that can be drawn from pedigree
excessive destruction of RBC’s analysis.
• It is also due to the formation of abnormal • Pedigree analysis is the study of traits as
haemoglobin molecules. they have appeared in a given family line
• Haemoglobin is made up of four polypeptide for several past generations
chains (two alpha and two beta globin • Pedigree analysis is useful in following ways:
chains)
i) It is useful in finding the possibility of absence
• Thalassemia patients have defects in either
or presence of that trait in a particular
the alpha or beta globin chain
individual and his family members.
• Result in the less production of haemoglobin
ii) It is useful in detecting genetic defects like
molecules leads to anaemia.
haemophilia, colourblindness,phenylketonuria,
• Types of Thalassemia ( based on chain thalassemia, sickle cell anaemia,
affected)
iii) It helps to detect sex-linked characters
 Alpha Thalassemia and other linkages.

SURYA 69
 www.nammakalvi.org
Chapter - 4 | Principles of inheritance and variation XII Std - Zoology ´ Unit II
9. List out the difference between chromosomal (DOPA) into melanin pigment inside the
disorder and Mendelian disorder? melanocytes.
• In an albino, melanocytes are present in
S. Mendelian Chromosomal
No. Disorder Disorder normal numbers but they lack melanin
pigment.
i) This disorder is This disorder
mainly due to is caused due Tyro sin ase
3,4 dihydroxy phenylalanine (DOPA)  → Melanin
alteration or to absence
mutation in the or excess or • 3, 4 dihydroxy phenylalanine (DOPA) Melanin
single gene. abnormal Huntington’s chorea
arrangement
• It is an autosomal dominant lethal gene
of one or more
in man.
chromosomes.
ii) This follows This does not • Symptoms :involuntary jerking of the
Mendel’s follow Mendel’s body and progressive degeneration of the
principles of principles of nervous system, accompanied by gradual
inheritance. inheritance. mental and physical deterioration.
iii) This may be This is always • This patients die between the age of 35 and
recessive or dominant in 40.
dominant in nature.
11. Write short notes on Erythroblastosisfoetails.
nature.
iv) E.g : haemo- E.g : Turner’s Erythroblastosisfoetalis
philia, sickle-cell syndrome. • Rh incompatability has great impact on
anaemia. child birth.
10. Explain the causes, inheritance pattern and • Condition : Woman is Rh negative
symptoms of any two Mendelian genetic • Man is Rh positive,
disorders.
• Foetus Rh positive (inherited the factor
Colourblindness and thalassemia are from its father)
categorised as Mendelian disorders because
• Mother becomes sensitized by carrying Rh
of the following reasons:
positive foetus.
• Alteration or mutation in a single gene causes • Due to damage of blood vessels, during
Mendelian disorders. child birth, the mother’s immune system
• These disorders are transmitted to recognizes the
the offspringsby Mendelian pattern of Rh+ antigens and get activated.
inheritance.
• Then mother produces Rh antibodies.
• Mendelian disorders are Thalassemia,
• IgG antibodies cross placenta and enter
albinism, phenylketonuria, sickle cell anaemia,
the foetal circulation.
Huntington’s chorea, etc.,
• Before this time the child is delivered.
• These disorders may be dominant or
recessive and autosomal or sex linked. • Usually no effects in first child birth.
• In next pregnancy Rh positive children
1. Albinism carried by the same mother, IgG antibodies
• It is an inborn error of metabolism, cross placenta and enter into foetal blood
• Caused by an autosomal recessive gene. circulation.
• Melanin pigment is responsible for skin • Causes:haemolysis of foetal RBCs result in
colour. haemolytic jaundice and anaemia.
• Absence of melanin results albinism. • This condition is known as
Erythoblastosisfoetalis or Haemolytic
• A person with the recessive allele lacks the disease of the new born (HDN).
tyrosinase enzyme which is useful in
conversion of dihydroxyphenyl alanine • Prevention of Eryhroblastosisfoetalis

70 SURYA
XII Std - Zoology ´ Unit II Chapter - 4 | Principles of inheritance and variation
• Anti D antibodies should be administered • Patients : Homozygous recessive females
to the mother (28th and 34th week of (XcXc) Hemizygous recessive males (XcY)
gestation)
• The are unable to distinguish red and
• Anti D antibodies should be administered green colour.
to the mother soon after delivery.
Marriage between colour blind man and
12. Explain X-linked in heritance with an example. normal visioned woman
Inheritance of X - linked genes F1 generation:
• X-linked gene inheritance are Red- They produce normal visioned male and
green colour blindness or daltonism, female carriers.
Haemophilia Duchenne’s muscular F2generation :
dystrophy Haemophilia
They produce
• It is commonly known as bleeder’s disease.
 Normal visioned carrier daughter,
 Colourblind daughter
 Normal visioned son
 Colourblind son
The marriage between a) F1 normal visioned
carrier woman and a normal visioned male
will produce
• One normal visioned female,
• One carrier female,

• This is more common in men than women.

• First reported by John Cotto in 1803.
• Haemophilia is caused by a recessive
X-linked gene.
• This persons lacks a normal clotting
substance (thromboplastin) in blood,
hence minor injuries cause continuous
bleeding, leading to death.
• The females are carriers of the disease • One normal visioned male
and transmit the disease to 50% of their
• One colour blind male.
sons even if the male parent is normal.
 Colour blindness is inherited from the male
• Characteristic feature :criss - cross pattern
parent to his grandson through carrier
of inheritance.
daughter.
 Colour blindness
 Colour blindness is an example of criss –
• Due to dominant X – linked gene which cross pattern of inheritance.
is necessary for the formation of cones (
b) Marriage between normal visioned man
Colour sensitive cells)
and colour blind woman
• The recessive form - incapable of producing
F1 generation :
cone cells.
SURYA 71
Chapter - 4 | Principles of inheritance and variation XII Std - Zoology ´ Unit II
1. Colourblind sons in a karyotype of 45 XO
2. Normal visioned daughters. • Persons with this syndrome have 45
3. F1 carrier female + colourblind male chromosomes (44 autosomes and one X
chromosome) (44AA+XO)
 Result in the F2 generation:
• They are sterile females.
1. Normal visioned carried daughter
• Symptoms : Low stature, webbed neck,
2. Normal visioned son under developed breast, rudimentary
3. Colourblind son. gonads lack of menstrual cycle during
puberty.
13. Explain Allosomal abnormalities in human
beings. 14. Write short notes on phenylketonuria
Allosomal abnormalities in human beings  It is an inborn error of Phenylalanine
• Causes : Mitotic or meiotic non- metabolism
disjunction of sex chromosomes. Several  Causes : pair of autosomal recessive
sex chromosomal abnormalities have genes.
been detected.  It is also caused due to mutation in the
E.g : Klinefelter’s syndrome and Turner’s gene PAH (phenylalanine hydroxylase gene)
syndrome. located on chromosome 12
 Klinefelter’s Syndrome (XXY Males)  PAH gene synthesis hepatic enzyme
• Causes: presence of an additional copy of “phenylalanine hydroxylase”
the X chromosome resulting in a karyotype  This enzyme convert phenylalanine into
of 47 / XXY. tyrosine.
• These Persons have 47 chromosomes  In Affected individual phenylalanine gets
(44AA+XXY). converted to phenylpyruvic acid and
• They are usually sterile males, tall, obese, other derivatives.
with long limbs, high pitched voice,  Symptoms : severe mental retardation,
under developed genitalia and have weak light pigmentation of skin and hair.
breast (gynaecomastia) development.  Phenylpyruvic acid is excreted in the urine.
 Turner’s Syndrome (XO Females) Phenylalanine hydroxylase
Phenylalanine → Tyrosinase
• Causes:loss of a X chromosome resulting

72 SURYA
 CHAPTER
MOLECULAR GENETICS
5
POINTS TO REMEMBER

 Mendel’s theory explain the inheritance of base, a five carbon sugar(pentose) and a
character from one generation to the next. phosphate group.
 DNA directs the synthesis of proteins.  There are two types of nucleic acids (based
 Proteins determine-shapes of cell and rate on type of pentose sugar)
of chemical reactions.  DNA - contain Deoxyribose sugar.
 Genome is defined as Totality of gene  RNA - contain Ribose sugar.
 A gene is a basic physical and functional  DNA and RNA both have four bases (two
unit of heredity. purines and two pyrimidines)
 In 1909, Wilhelm Johannsen, coined the  Purines base are Adenine (A) and Guanine
term ‘gene’, (G) have double carbon–nitrogen ring
 ‘Gene’ is used to refer the factor for structures
inheritance.  Pyrimidines base are Thymine(T),
 Genes - defined as distinct particles that Cytosinec) and Uracil (U) have
follow Mendelian rules of inheritance, single ring structure
occupy a definite locus in the chromosome
 Thymine is unique for DNA, while Uracil is
and are responsible for the expression of
specific phenotypic character. unique for RNA.

 Several genes are located on the same  The phosphate functional group is derived
chromosome. from phosphoric acid(H3PO4).
 Genes are arranged in a single linear  Nucleoside =nitrogenous base + sugar
order like beads on a string. (at the 1-carbon of the sugar)
 In 1940, George Beadle and Edward  Nucleotide = Nucleoside +phosphate
Tatum conducted experiment inNeurospora group (attached to the 5’ carbon of the same
crassa (the red bread mould) and proposed sugar)
one gene -one enzyme hypothesis.  Base pair Rules - It was proposed by Erwin
 In 1944 Oswald Avery, Colin Macleod Chargaff
and Maclyn McCarty - repeated Griffith’s  Adenine pairs with Thymine(A=T) with
experiments in an ‘in vitro’
two hydrogen bonds and
 These experiments prove that DNA is the
 Guanine pairs with Cytosine(G ≡ C) with
genetic material and not proteins
three hydrogen bonds.
 Griffith, Avery and others, believed that
protein was the hereditary material, not  The ratios between Adenine with Thymine
DNA. and Guanine with Cytosine are constant and
equal.
 Eukaryotic chromosomes consist of equal
amounts of protein and DNA.  The term ‘RNA world’ was first used by
Walter Gilbert in 1986
 Alfred Hershey and Martha Chase (1952)
conducted experiments on bacteriophages  This hypothesies reveals that RNA as the
first genetic material on earth.
 They proved that DNA carries the hereditary
information from virus tobacteria.  Hershey and Chase clearly explained that
DNA acts as a genetic material.
 Nucleic acids are a long chain or polymer which
is made up of sequence of nucleotides.  But in Tobacco mosaic virus (TMV), bacterio
 Nucleotide consists of a nitrogenous phage, RNA acts as the genetic material.

SURYA 73
 www.nammakalvi.org
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
 Self Replication, Stability, Information contributed significantly to decipher the
storage, Variation through mutation: genetic code.
 Length of DNA double helix = Total  The genetic code is universal.
number of base pairs x distance between two  A non-overlapping codon means that the
consecutive base pairs same letter is not used for two different
 Chromatin consists of repeating units codons.
called nucleosomes.  For instance, the nucleotide sequence GUU
 2 molecules of the four histone proteins H2A, GUC represents only two codons.
H2B, H3 and H4 are organized to form a unit  Genetic code is comma less, which means
of eight molecules called histone octamere. that the message would be read directly from
 DNA Replication takes place during S phase one end to the other i.e., no punctuation
 During replication, each DNA molecule are needed between two codes.
gives rise to two DNA strands, identical to  Non-ambiguous code means that one codon
each other. will code for one aminoacid.
 In prokaryotes, replication process requires  The code is always read in a fixed direction
DNA polymerase I, II, and III. i.e. from 5’→3’ direction called polarity.
 DNA polymerase III is the main enzyme for  tRNA molecule of a cell acts as a vehicle that
DNA replication. picks up the amino acids scattered through
 DNA polymerase I & II are involved in DNA the cytoplasm and also reads specific codes
repair mechanism. of mRNA molecules. Hence it is called an
adapter molecule.
 Francis Crick proposed the Central dogma in
molecular biology.  Translation refers to the process of
polymerization of amino acids to form poly
 The process conversion of information peptide chain.
from DNA to RNA is termed transcription.
 This ribosome binding site is called the Shine
 DNA has three distinct regions namely, a – Dalgarno sequence or S-D sequence.
promoter, the structural gene and a
terminator.  Elongation is the second phase of
translation.
 In prokaryotes, have three are major types of
RNAs: mRNA, tRNA, and rRNA.  Termination is the third phase of
translation.
 All three RNAs are needed to synthesize a
protein.  Termination of protein synthesis occurs when
one of the three stop codons appears in
 The mRNA provides the template, the ‘A’ site of the ribosome.
 tRNA brings amino acids and reads the  Regulation of gene expression has been
genetic code, extensively studied in prokaryotes,
 rRNAs - act as catalytic factor for especially in E. coli.
translation.  Gene expression can be controlled or
 DNA is the genetic material that carries regulated at transcriptional or post
genetic information in a cell and from transcriptional or translational level.
generation to generation.  Each operon is a unit of gene expression
 There are 64 possible triplets, and 61 of and regulation and consists of one or more
them are used to represent amino acids. structural genes and an adjacent operator
gene that controls transcriptional activity of
 The remaining three triplet codons are
the structural gene.
termination signals for polypeptide chains.
 The metabolism of lactose in E.coli requires
 Marshall Nirenberg, Severo Ochoa
three enzymes permease, β-galactosidase
(enzyme polynucleotide phosphorylase
(β-gal) and transacetylase.
called Ochoa’s enzyme), Hargobind Khorana,
Francis Crick and many others have  Besides these, it has three structural genes
namely lac z,y and lac a.
74 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
 Human genome project was a mega project  The DNA finger printing technique was
and took 13 years to complete. first developed by Alec Jeffreys in 1985
 Through this all the genes (approximately  Each of us have the same chemical structure
30000) in human DNA has been identified. of DNA.
 Determine the sequence of the three billion  But there are millions of differences in the
chemical base pairs that make up the DNA sequence of base pairs.
human DNA.
 This makes the uniqueness among us so that
 The methodologies of the Human Genome each of us except identical twins
Project involved two major approaches.
 The DNA of a person and finger prints are
 1. ETSS – Expressed Sequence Tags and unique.
2. Sequence Annotation.  Application of DNA finger printing
 The fragments are sequenced using  Forensic analysis, Pedigree analysis,
automated DNA sequencers (developed by Conservation of wild life, Anthropological
Frederick Sanger). studies.
grow for two generations. DNA extracted
PART-A from these cells is ultracentrifuged in a
cesium chloride density gradient.
TEXTUAL QUESTIONS (1 MARK) What density distribution of DNA would you
expect in this experiment?
1. Hershey and Chase experiment with a) One high and one low density band.
bacteriophage showed that
b) One intermediate density band.
a) Protein gets into the bacterial cells
c) One high and one intermediate density band.
b) DNA is the genetic material
d) One low and one intermediate density band.
c) DNA contains radioactive sulphur Ans: d
d) Viruses undergo transformation Ans: b 6. What is the basis for the difference in the
2. DNA and RNA are similar with respect to synthesis of the leading and lagging strand of
DNA molecules?
a) Thymine as a nitrogen base
a) Origin of replication occurs only at the 5’ end
b) A single-stranded helix shape of the molecules.
c) Nucleotide containing sugars, nitrogen bases b) DNA ligase works only in the 3’ → 5’ direction.
and phosphates
c) DNA polymerase can join new nucleotides only
d) The same sequence of nucleotides for the to the 3’ end of the growing stand.
amino acid phenyl alanine
Ans: c d) Helicases and single-strand binding proteins
that work at the 5’ end.
3. mRNA molecule is produced by Ans: c
a) Replication b) Transcription 7. Which of the following is the correct sequence
of event with reference to the central dogma?
c) Duplication d) Translation
Ans: b a) Transcription, Translation, Replication

4. The total number of nitrogenous bases in b) Transcription, Replication, Translation

human genome is estimated to be about c) Duplication, Translation, Transcription
a) 3.5 million b) 35000 d) Replication, Transcription, Translation
c) 35 million d) 3.1 billion Ans: d
Ans: d 8. Which of the following statements about DNA
replication is not correct?
5. E. coli cell grown on 15N medium are a)
Unwinding of DNA molecule occurs as
transferred to 14N medium and allowed to hydrogen bonds break.

SURYA 75
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
b) Replication occurs as each base is paired with b) Repressor is unable to bind to the operator.
another exactly like it. c) Repressor is able to bind to the operator.
c) Process is known as semi conservative
d) Both (a) and (b) are correct.
replication because one old strand is conserved
in the new molecule. Ans: d

d) Complementary base pairs are held together PART-B, C AND D

with hydrogen bonds.
Ans: b
9. Which of the following statements is not true TEXTUAL QUESTIONS (2,3 AND 5 MARKS)
about DNA replication in eukaryotes?
15. Give reasons: Genetic code is ‘universal’.
a) Replication begins at a single origin of
replication.  The genetic code is universal.
b) Replication is bidirectional from the origins.  It means that in all living organism genetic
c) Replication occurs at about 1 million base code (triplet codon) direct the synthesis of
pairs per minute. same kind of protein from amino acids.
d) There are numerous different bacterial  Eg. In mRNA (UUU) codon codes for
chromosomes, with replication ocurring in phenylalanine in all cells of all organisms.
each at the same time.
Ans: d 16. Name the parts marked ‘A’ and ‘B’ in the given
transcription unit: A B 3’ 3’
10. The first codon to be deciphered was
__________ which codes for ________.
a) AAA, proline b) GGG, alanine
c) UUU, Phenylalanine d) TTT, arginine
Ans: c
11. Meselson and Stahl’s experiment proved
a) Transduction
b) Transformation
c) DNA is the genetic material Ans :
d) Semi-conservative nature of DNA replication A – Promoter
Ans: d B – Coding strand
12. Ribosomes are composed of two subunits; the 17. Mention any two ways in which single
smaller subunit of a ribosome has a binding nucleotide polymorphism (SNPs) identified
site for _________ and the larger subunit has in human genome can bring revolutionary
two binding sites for two __________. change in biological and medical science.
Ans: mRNA, tRNA
 A single-nucleotide polymorphism is a
13. An operon is a:
variation in a single nucleotide that
a) Protein that suppresses gene expression occurs at a specific position in
b) Protein that accelerates gene expression the genome, where each variation is present
c) Cluster of structural genes with related to some appreciable degree within a population
function  E.g. the C nucleotide may appear in most
d) Gene that switched other genes on or off individuals, but in a minority of individuals,
Ans: c the position is occupied by an A.
14. When lactose is present in the culture  This means that there is a SNP at this
medium: specific position, and the two possible
a) Transcription of lac y, lac z, lac a genes occurs. nucleotide variations – C or A – are said to
be alleles for this position

76 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
18. Differentiate - Leading stand and lagging 20. State any three goals of the human genome
strand project.

Leading Strand Lagging Strand  Identify all the genes (approximately

30000) in human DNA.
1. Its growth is
1. This strand  Determine the sequence of the three
discontinuous
grows billion chemical base pairs that makeup
This strand formed in
continuously the human DNA.
short segments called
without any gap
Okazaki fragments.  To store this information in data bases.
2. It does not
2. DNA-ligase is  Improve tools for data analysis.
require DNA
required for joining
ligase for its  Transfer related technologies to other
Okazaki fragments.
growth. sectors, such as industries.
3. The direction  Address the ethical, legal and social
3. The direction of
of growth of the issues (ELSI) that may arise from the project.
growth of the lagging
leading strand is
strand is 3′ à 5′ 21. In E.coli, three enzymes β- galactosidase,
5′ à 3′
4. Only a single 4. More number permease and transacetylase are produced
RNA primer is of RNA primer is in the presence of lactose. Explain why the
required. required enzymes are not synthesized in the absence
5. It is a rapid 5. it’s a slower of lactose.
process. process.  If lactose is absent or lacking, the
transcription of lac mRNA stops.
19. Differentiate - Template strand and coding
strand.  The metabolism of lactose in E.coli requires
three enzymes – permease, β-galactosidase
Template strand Coding strand
(β-gal) and transacetylase.
1. Template strand is 1. Coding strand is
directed in the 5’ directed in the 3’  The enzyme permease is needed for entry
to 3’ direction to 5’ direction of lactose into the cell,
2. Transcribed into 2. Not transcribed  β-galactosidase brings about hydrolysis
mRNA into mRNA of lactose to glucose and galactose,
3. Contains the 3. Contains the
 Transacetylase transfers acetyl group
complementary same nucleotide
from acetyl Co A to β-galactosidase.
nucleotide sequence to
sequence as the mRNA, except  If lactose is available as an energy source
mRNA thymine for the bacteria then lactose enters the cell as
4. Contains a result of permease enzyme.
4. Contains codons
anticondons  Lactose acts as an inducer and interacts
5. Contains the with the repressor to inactivate it.
5. Contains the
complementary
same nucleotide  This allows RNA polymerase to bind to
nucleotide
sequence as the the promotor site and transcribe the operon
sequence as the
tRNA to produce lac mRNA which enables formation
tRNA
6. Hydrogen 6. No hydrogen of all the required enzymes needed for lactose
bonds are bonds are metabolism.
formed between formed between
the template the coding strand
strand and the and synthesizing
synthesizing mRNA. mRNA
Ways to identify SNP
1. ETSS – Expressed Sequence Tags.
2. Sequence Annotation.
SURYA 77
 www.nammakalvi.org
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
22.
Distinguish between structural gene, 25. From their examination of the structure of
regulatory gene and operator gene. DNA, What did Watson and Crick infer about
the probable mechanism of DNA replication,
S. Structural Regulator Operator coding capability and mutation?
No. Genes Gene Gene  Watson and Crick explain the Semi –
1. This gene is It controls the It determines conservative mode of DNA replication
connected with f u n c t i o n i n g t h e  DNA Replication takes place during S phase
transcription of operator functioning
or formation gene. of structural  During replication, each DNA molecule
of mRNA for genes. gives rise to two DNA strands, identical to
synthesis each other and parent
Hypotheses of DNA replication.
2. It functions only Regulator gene Operator gene
when receives produces a functions only 1. Conservative replication,
complementary repressor or when it is 2. Dispersive replication,
n u c l e o t i d e s Apo repressor not blocked
and RNA for blocking by repressor. 3. Semi –conservativereplication.
polymerase. operator gene Semi- conservative replication.
3. M o d e r a t e l y Large gene. Smaller gene  Itwas proposed by Watson and Crick in
long gene 1953.
4. It functions It functions It function  This mechanism is based on the DNA
through the through the through the model.
f o r m a t i o n formation of presence or  Initially two polynucleotide strands of
of mRNA for an mRNA of absence of
DNA molecule unwind and start separating
s t r u c t u r a l repressor repressor.
at one end.
or enzymatic
polypeptide  During this process, covalent hydrogen
bonds are broken.
23. A low level of expression of lac operon occurs
at all the windows for treatment of various  The separated single strand then acts as
genetic disorders. Justify the statement. template for the synthesis of a new strand.
 A very low level of expression of lac  Later, each daughter double helix
operon has to be present in the cell all the carries one polynucleotide strand from
time, otherwise lactose cannot enter the the parent and other strand is newly
cells synthesised.
 Any error in replication leads to Mutation
24. Why the human genome project is called a
mega project? 26. Why tRNA is called an adapter molecule?
 Human genome project was considered to  The transfer RNA, (tRNA) molecule of acell
be a mega project because it had a specific acts as a vehicle that picks up the amino
goal to sequence every base pair present acids scattered through the cytoplasm
in the human genome. and also reads specific codes of mRNA
 It took around 13 years for its completion molecules.
and got accomplished in year 2003.  Hence tRNA is called an adapter molecule.
 It was a large scale project, which aimed  This term was postulated by Francis Crick.
at developing new technology and
generating new information in the field of
genomic studies.

78 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
27. What are the three structural differences 29. a) Identify the figure given below
between RNA and DNA?
b) Redraw the structure as a replicating fork
Comparison DNA RNA and label the parts
Deoxyribonucleic
Full Name Ribonucleic Acid
Acid
RNA only has
DNA consists of
one strand,
two strands,
but like DNA,
arranged in a
is made up of
double helix.
nucleotides. c)
Write the source of energy for this
These strands RNA strands replication and name the enzyme involved
are made up of are shorter in this process.
Structure
subunits called than DNA
d) Mention the differences in the synthesis of
nucleotides. strands.
protein, based on the polarity of the two
Each nucleotide RNA sometimes template strands.
contains a forms a Ans : a
phosphate, a secondary
5-carbon sugar double helix a) Given structure represents replicating fork.
molecule and structure, the two parental strands of DNA unwind at the
a nitrogenous but only start of replication.
base. intermittently. b)
RNA molecules
DNA is a much
Length  are shorter
longer than
than long DNA
RNA.
polymers.
RNA contains
The sugar in DNA
Sugar ribose sugar
is deoxyribose
molecules
RNA shares
Adenine (‘A’),
The bases in DNA
Guanine (‘G’)
are Adenine
and Cytosine
Bases (‘A’), Thymine
(‘C’) with DNA,
(‘T’), Guanine
but contains
(‘G’) and
Uracil (‘U’)
Cytosine (‘C’).
rather than Mechanism of replication showing a
Thymine. c) Deoxy nucleotide triphosphate
replication fork - provide energy
Adenine and Adenine and for replication
Thymine pair Uracil pair d) DNA-polymerase can polymerise
Base Pairs (A-T) (A-U) nucleotides only in 5’→3’ direction on
Cytosine and Cytosine and 3’→ 5’ strand because it adds them at the 3′
Guanine pair Guanine pair end.
(C-G) (C-G)
 Since the two strands of DNA run in
28. Name the anticodon required to recognize
the following codons:
antiparallel directions, the two templates
provide different ends for replication.
AAU, CGA,UAU,GCA.
Ans :  Replication over the two templates thus
Codon - Anti Codon proceeds in opposite directions.
AAU - UUA  One strand with polarity 3′→5′forms its
CGA - GCU complementary strand continuously
UAU - AUA because 3’ end of the latter is always open for
GCA - CGU elongation.

SURYA 79
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
 It is called leading strand.
 Replication is discontinuous on the other
template with polarity 5′→3′ because only
a short segment of DNA strand can be built in
5′→3′direction due to exposure of a small
stretch of template at one time
30. If the coding sequence in a transcription unit
is written as follows:
‘5’ TGCATGCATGCATGCATGCATGCATGC 3’ Write
down the sequence of mRNA.
Ans : mRNA -
‘5’ACGUACGUACGUACGUACGUACGUACG 3’
31. How is the two stage process of protein
synthesis advantageous?
 In eukaryote, Transcription take place in  Phages were allowed to infect bacteria
membrane bound nucleus containing the radioactive isotopes 35S
 Translation – take place in cytoplasm or 32P in the medium.
(outside of nucleus  The bacteriophage that grew in the presence
 This two stage of protein synthesis enable of 35S had labelled proteins
eukaryotes to regulate gene expression  Bacteriophages grown in the presence of
in much more complicated way, and also 32P had labelled DNA.
contributing to the richness of eukaryotic
form and functions.  They mixed the labelled phages with
unlabeled E. coli and allowed bacteriophages
32. Why did Hershey and Chase use radioactively to infect
labelled phosphorous and sulphur only?
Would they have got the same result if they  Before lysis of bacteria the bacterial cells
use radiolabelled carbon and nitrogen? were gently agitated to loosen particles.

Hershey and Chase experiment on T2  Findings :

bacteriophage  32P was found inbacterial cells
 Alfred Hershey and Martha Chase (1952)  35S was found in medium
conducted experiments on bacteriophages
 Phage progeny carry only 32P and not 35S.
 T2 - bacteriophages is a virus that infects
Results :
the bacterium Escherichia coli.
 Experiment - phages are added to  DNA only entered the bacterial cells and
bacteria  some material enters the not protein coat
bacteriumbacterium lyses and release  Hence its proved that DNA carries the
many progeny. hereditary informationfrom virus to bacteria.
 They wanted to check which part entered 33. Explain the formation of a nucleosome.
the bacteria (DNA or protein)
 Ineukaryotes,nucleus organization is much
 All nucleic acids contain phosphorus, more complex.
and contain sulphur(also amino acid -
 Chromatin consists of repeating units
cysteine and methionine).
called nucleosomes.
 Hershey and Chase designed an experiment
 2 molecules of the four histone proteins
 Radioactive isotopes of Sulphur (35S) H2A, H2B, H3 and H4 are organized to form
and phosphorus (32P) to keep separate a unit of eight molecules called histone
pathway of the viral protein and nucleic acids octamere.
during the infection process.
80 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
 The negatively charged DNA is wrapped  Hence DNA is a double stranded molecule, its
around the positively charged histone resisted changes
octamere to form a structure called  Some RNA molecules function as gene
nucleosome. regulators when it binding with DNA
 Nucleosome contains 200 bp of DNA helix.  In Some viruses RNA act as genetic
 DNA is coiled on the outside of material.
nucleosome.  Andrew Fire and Craig Mellow state that RNA
 Adjacent nucleosomes are connected by is an active ingredient in the chemistry of
linker DNA(H1) that is exposed to enzymes. life.
 TheDNA makes two complete turns around
the histone octameres and the two turns PART-A
are sealed off by an H1 molecule.
 Chromatin without H1 has a beads-on-a-
ADDITIONAL QUESTIONS (1 MARK)
string appearance in which DNA enters
and leaves the nucleosomes at random 1. Who proved DNA as a genetic material
places.
a) Griffith b) Bacteria
 Further folding is due to interaction between
H1 of one nucleosomes c) PPLO d) Hershey and Chase
Ans: d
34. It is established that RNA is the first genetic
material. Justify giving reasons. 2. Double helix model of DNA is proposed by
RNAworld a) Watson and Crick b) Schleiden Schwann
 A cell contains RNA which is ten times c) Singer and Nicholoson d) Kornberg and
more than DNA. Khurana
 Because RNA play a variety of roles in the Ans: a
cell. 3. Substance common in DNA molecules is made
 Fraenkel-Conratand Singer (1957) first up of
demonstrated that RNA is the genetic a) Hexose Sugar b) Histamine
material in TMV (Tobacco Mosaic Virus) c) Thymine d) Phosphate Groups
 They separated RNA from the protein of Ans: d
TMV viruses.
4. Nucleotide is
 In 1980’s (Molecular biologists - Leslie
Orgel, Francis Brick and Carl Woese) proposed a) Nitrogen base base, pentose sugar and
the ‘RNA world’ as the first stage in the phosphoric acid
evolution of life. b) Nitrogen, Hexose sugar and phosphoric acid
 RNA catalysed all molecules necessary for c) Nitrogen base, pentose sugar
survival and replication. d) Nitrogen base, trioses and phosphoric acid
 The term ‘RNA world’ first used by Walter Ans: a
Gilbert in 1986
5. DNA differs from RNA in
 This hypothesizes reveals that RNA as the
a) Only sugar
first genetic material on earth.
 RNA act as both genetic material and b) Nitrogen base only
catalyst. c) Nitrogen base and sugar
 The catalytic RNA is known as ribozyme. d) None Ans: c
 RNA being a catalyst was reactive and 6. DNA is not present in ____
hence unstable.
a) Mitochondria b) Chloroplast
 This lead to evolution with certain
modifications. c) Bacteriophage d) TMV Ans: d
SURYA 81
 www.nammakalvi.org
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
7. Prokaryotic genetic system contains: 15. The back bone of RNA is consists of which of
a) DNA & histones the following sugar?

b) RNA & histones a) Deoxyribose b) Ribose

c) Either DNA or histones c) Sucrose d) Maltose Ans: b

16. DNA is acidic due to ____
d) DNA but no histones Ans: d
a) Sugar b) Phosphoric acid
8. Which of the following is not a pyrimidine N2
base? c) Purine d) Pyrimidine Ans: b
a) Thymine b) cytosine 17. DNA polymerase is needed for ____

c) Guanine d) Uracil Ans: c a) Replication of DNA b) Synthesis of DNA

c) Elongation of DNA d) All of above
9. Number of H – bonds between guanine and
cytosine are ____ Ans: d
18. DNA Replication occurs at ____
a) One b) Two
a) Go & G-1 b) G2 – stages
c) Three d) Four Ans: c
c) S – Stage d) Mitotic Phase
10. What is the nature of the 2 strands of a DNA
duplex ? Ans: c
19. Method of DNA replication in which two
a) Identical & Complimentary strands of DNA separates and synthesize new
strands ?
b) Ant parallel & Complimentary
c) Dissimilar & non complimentary a) Dispersive b) Conservative

d) Anti parallel & non complimentary Ans: b c) Semiconservative d) Non conservative

Ans: c
11. Chargaff’s rule is given as 20. The direction of DNA replication is ____
a) Only about Puriness b) A+ G =T+C a) From 5’ end towards 3’ end
c) A+U=G+C d) A+T / G+C = Const. b) From 3’ end towards 5’ end
Ans: b
c) Amino terminus to carboxy terminus
12. Similarity in DNA and RNA is ____
d) Carboxy terminus to amino terminus
a) Both are polymer of nucleotides
Ans: a
b) Both have similar pyrimidine 21. Semiconservation replication of DNA was
c) Both have similar sugar given by ____
d) Both are genetic material Ans: a a) Watson and Crick

13. Bond between phosphate and sugar in a

b) Betason and Punnett
nucleotide is ____ c) Messelson and Stahi
a) H-Bond b) Covelent blood d) Avery, McCarty and Mactleod Ans: a
c) Phosphodiester bond d) Sulphide bond 22. Which of the following enzyme is used to join
Ans: b DNA fragments ?

14. Nucleoside is ____ a) Terminase b) Endonuclease

a) Polymer of nucleic acid c) Ligase d) DNA polymerase
b) Phosphoric acid + base Ans: c
23. The strand of DNA, which does not code for
c) Phosphoric acid + sugar + base anything is referred to as ____
d) Sugar + nitrogen base Ans: d a) Template strand b) Antisense strand
c)Coding strand d) Non coding strand
Ans: c
82 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
24. t- RNA attach to larger sub unit of ribosome 33. One – gene – one enzyme hypothesis was
with the help of which loop ? proposed by ____
a) DHU – loop b) T C loop a) Beadle and Tatum b) Jacob and Monod
c) Anticodon loop d) Minor loop Ans: b c) Lederberg d) Watson and Crick
25. Method by which information reaches from Ans: a
DNA to RNA is ____ 34. A gene containing multiple exons and at least
a) Transcription b) Translation one intron is termed as ____
c) Transformation d) Transduction a) Split gene b) Operator gene
Ans: a c) Synthetic gene d) Epistatic gene
26. DNA acts as a template for synthesis of ____ Ans: a
a) RNA b) DNA 35. What does “lac” refer to, in what we call the
c) Both a and b d) Protein Ans: c lac operon?
27. Genetic code was deciphered by chemically a) Lactose b) Lactase
synthesizing the trinucleotides by ____ c) Lac insect d) The number 1,00,000
a) Watson & Crick b) Beadle & Tatum Ans: a
c) Briggs & King d) M.W.Nirenberg 36. Functioning of structural genes is controlled
Ans: d by ____
28. Codons constitute genetic code because a) Operator b) Promoter
a) There was 64 types of amino acid c) Ligase d) Regulator gene
b) 64 types of t-RNA Ans: d
c) Genetic code is triplet 37. Regulation of lac operon by repressor is
referred to as ____
d) There are 64 enzymes Ans: c
29. Termination of chain growth in protein a) Positive regulation b) Nagative regulation
synthesis is brought about by______. c) Both (1) and (2) d) None
a) UUG, UGC, UCA b) UCG, GCG, ACC Ans: b
c) UAA, UAG, UGA d) UUG, UAG, UCG 38. The change of chromosomal parts between
Ans: c non homologous pairs of chromosome is ____
30. Genetic code determines the a) Crossing over b) Translocation
a) Structural pattern of an organism c) Inversion d) Transition
b) Sequence of amino acid in protein chain Ans: a
c) Variation in offsprings
39. Who supported Griffith effect by molecular
d) Constancy of morphological trait Ans: b explanation ?
31. A sequence of how many nucleotides in a) Hershay and chase
messager RNA makes a codon for an amino b) Watson, crick Ninenberg
acid?
(c) Avery, Mc Carty and Macleod
a) Three b) Four
d) Griffith and Avery Ans: c
c) One d) Two Ans: a
40. Synthesis of nucleic acids always takes place
32. Translation is the process in which ____ in
a) DNA is formed on DNA template a) 3’ – 5’direction b) 5’ – 3’ direction
b) RNA is formed on DNA Template c) Both ways d) in any direction
c) DNA is formed on RNA template Ans: b
d) Protein is formed from RNA Ans: d
SURYA 83
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
41. What is called Griffith effect ? c) Hexokinase and aldolase
a) DNA transcription d) Ligase and endo nuclease Ans: b
b) RNA translation 50. Okazaki fragments are Synthesized on
c) Bacterial transformation a) Leading strands of DNA only
d) Bacterial transduction Ans: c b) Lagging Strands of DNA only
42. Genetic information is carried by the long c) Leading and LaggingStrands
chain molecules which are made up of ____
d) Complementary DNA Strand Ans: b
a) Amino acids b) Nucleotides
51. Which of the following is used in DNA
c) Chromosomes d) Enzymes Ans: b multiplication?
43. By which bonds the purine & pyrimidine a) RNA polymerase b) DNA endonuclease
pairs of Complementary Strands of DNA held
together? ?
c) DNA exonuclease d) DNA Polymerase
Ans: d
a) H - bonds b) O - bonds
52. t - RNA attaches aminoacid at it’s
c) C - bonds d) N – bonds
Ans: a a) 3’ end b) 5’ end
44. The code AUG stands for ____ c) Anticodon d) Loop Ans: a
a) Glycine b) Methionine 53. DNA acts as a template for synthesis of ____
c) N-formyl methionine d) A lanine a) RNA b) Lipid
Ans: b
c) Both ‘a’ and ‘b’ d) Protein Ans: a
45. A Sequence of three Consecutiue bases in a
t- RNA molecule which Specifically binds to a 54. Antiparallel strand in DNA is due to
complementary Codon Sequence in m - RNA a) Disulphide linkage b) Hydorgen bond
is known as ____
c) Phosphodiester bond d) Ionic bond
a) Triplet Codon b) Non - Sense Codon Ans: - c
c) Anti Codon d) Termination Codon 55. Multiplication of DNA is called as ____
Ans: c
46. A Codon is made up of a) Translation b) Replication
a) Single nucleotide b) two nucleotides c) Transduction d) Transcription
Ans: b
c) three nucleotides d) Four nucleotides
Ans: c 56. Which is the smallest RNA ?
47. DNA replication requires a) r RNA b) m RNA
a) DNA polymerase only c) t - RNA d) nuclear RNA
b) DNA polymerase and ligase Ans: c
c) Ligase only 57. Genetic information are transfered from
nucleus to cytoplasm of cell through
d) RNA polymerase Ans: b
a) DNA b) RNA
48. The enzyme involved in transcription is ____
c) Lysosomes d) Anticodon Ans: b
a) RNA polymerase b) DNA polymerase I
58. The information from RNA to DNA are
c) DNA polymerase II d) DNA polymerase
transfered by which process?
Ans: a
49. Enzymes needed for formation of repliction a) Replication b) Transcription
fork is ____ c) Translation d) Reverse transcription
a) RNA polymerase and DNA polymerase I Ans: d
b) Helicase and gyrase
84 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
59. In a transcription unit promotor is said to be 65. Which is not the step of translation ?
located towards a) Initiation b) Replication
a) 3’ end of structural gene c) Elongation d) Termination
b) 5’ end of structural gene Ans: b
c) 5’ end of template strand 66. The enzyme amino acyl t-RNA-synthetase
d) 3’ end of template strand Ans: d facilitates
a) Joining two neighbouring amino acids on
60. Non - sense codons take part in
ribosomes
a) formation of unspecified aminoacids
b) Adoption of amino acids by a t-RNA molecule
b) Terminating gene controlled protein synthesis c) Insertion of amino acyl t-RNA into the ribosome
c) Releasing t-RNA from polynucleotide chain sites
d) Conversion of sense DNA in to non-sense one d) Transfer of amino acyl t-RNA from the
Ans: b ribosomal ‘A’ site to ‘P’ site Ans: b
61. Select the correct sequence of following in 67. State the anticodon of initiation codon of
DNA replication protein synthesis
a) Single stranded binding proteins - Helicase - a) UAC b) UUU c) CAU d) AUG
Topoisomerase - DNA polymerase Ans: a
b) Helicase - single stranded binding proteins 68. What does a gene consist of ?
-Topoisomerase - DNA polymerase a) Promoter
c) Helicase - DNA polymerase - Topoisomerase - b) Initiation site & termination site
Single stranded binding proteins
c) coding sequence
d) Helicase - Topoisomerase - DNA polymerase -
d) All the above Ans: d
Single stranded binding proteins Ans: b
69. Name the enzymes needed for lactose
62. Which of the following enzymes can detect
Catabolism in E.coli ?
and correct the wrong inserted base during
DNA replication? a) β - galactosidase, permease transacetylase
a) DNA polymerase-I b) Transacetalase b) β - galactosidasee Lactase, transacetylase
c) Primase d) Ligase Ans: a (c) β - galactosidase, lactase, permease
d) Lactase, permease, transacetylase Ans: a
63. Which one is a ribozyme ?
a) Helicase b) Catalytic RNA 70. What does operon contain ?

c) ligase d) Both (b) & (c) a) Regulator gene + promotor gene

Ans: b b) Operator gene + structural gene
64. Which of the following pairs is not correctly c) Regulator gene + promotor gene structural
matched ? gene
a) Recombinant DNA - DNA forming by union of d) Regulator gene + promotor gene + operator
gene + structural gene Ans: d
segments of DNA from different Sources
b) Purines - Nitrogenous bases Cytosine , thymine 71. Select correct match with respect to lac-
and Uracil operon model

c) ATP - The principal energy carrying compound a) Active represser + inducer =Inactive repressor
inthe cell b) Active repressor + corepressor =Inactive
repressor
k) r-RNA - RNA molecules found in ribosomes
Ans: b c) Inactive repressor + inducer =Active repressor
d) Inactive repressor + corepressor = Active
repressor Ans: a
SURYA 85
 www.nammakalvi.org
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
72. Which is not correct regarding the activity of 79. In Which of the following DNA not directly
helicase during DNA replication ? involved ?
a) Cuts hydrogen bonds a) Replication b) Transcription
b) Requires ATP c) Translation d) Transformation
Ans: c
c) separates DNA strands
80.
Transcription begins when one of the
d) Stabilizes single strands Ans: c following enzymes binds to promotor site.
73. Which of the following enzyme is not produced a) DNA polymerase b) RNA polymerase
by E. coli during lactose catabolism ?
c) helicase d) Gyrase Ans: b
a) β - galactosidase
81. In the genetic code dictionary how many
b) Thio glactoside translacetylase codons are used to code for all the 20 essential
c) Lactose dehydrogenase amino-acids?

d) Lactose permease Ans: c a) 20 b) 64 c) 61 d) 60

Ans: b
74. DNA replication in eukaryotes is ____
82. Which one of the following triplet codes, is
a) Unidirectional with many origin correctly matched with its specificity for an
b) Bidirectional with many origin aminoacid in protein synthesis or as ‘start’ or
‘stop’ codon ?
c) Unidirectional with single origin
a) UCG - start b) UUU – stop
d) Bidirectional with single origin Ans: b c) UGU - Leucine d) UAC – Tyrosine
75. Aminoacids lysine, serine and arginine are Ans: d
coded by how many codons ? 83. The following ratio is generally constant for a
a) 6, 4, and 3 respectively given species
b) 4, 2 and 2 respectively a) A + G / C + T b) T + C / G + A
c) 6 codons c) G + C / A + T d) A + C / T + G
Ans: c
d) 4 codons Ans: c
84.
During transcription if the nucleotide
76. Which of the following amino acid is coded by sequence of the DNA strand that is being
3 codons ? coded is ATACG then the nucleotide sequence
a) Serine b) Proline in the m RNA would be

c) Tryptophan d) Isoleucine Ans: d a) T A T G C b) T C T G G

c) U A U G C d) U A T G C Ans: c
77. Which of the following enzymes help in the
process of formation of phosphor di-ester 85. Which one of the following makes use of RNA
bond during reverse transcription ? template to synthesize DNA
a) DNA - dependant RNA polymerase a) DNA polymerase b) RNA polymerase
b) DNA dependant DNA polymerase c) Reverse transcriptase d) DNA dependant
RNA polymerase
c) RNA - dependant RNA polymerase Ans: c
d) RNA - dependant DNA polymerase Ans: d 86. Protein synthesis is an animal cell occurs
78. DNA replication in lagging strand of most of a) only on the ribosomes present in cytosol
the eukaryotic organisms is ____ b) only on ribosomes attached to the nuclear
a) conservative and continuous envelope and endoplasmic reticulum
b) semi conservative but discontinuous c) On ribosomes present in the nucleolus as well
as in cytoplasm
c) conservative and semi - discontinuous
d) on ribosomes present in cytoplasm as well as
d) semi conservative but continuous Ans: b in mitochondria Ans: d

86 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
87. Aminoacid Sequence in protein synthesis is 94. Intiation codon of protein synthesis (in
decided by the sequence of eukaryotes) is ____
a) r RNA b) t RNA a) GUA b) GCA
c) m RNA d) c DNA Ans: c c) CCA d) AUG Ans: d
88. Polysome is formed by ____ 95. Semiconservative DNA replication using 15 N
a) a ribosome with several subunits was demonstrated by
b) ribosomes attached to each other in a linear a) Meselson b) Taylor
arrangement c) Meselson and stahl d) Hershey and chase
c) several ribosomes attached to a single m RNA Ans: c
d) many ribosomes attached to a strand of
96. Termination of polypeptide chain is brought
endoplasmic reticulum
about by
Ans: c
a) UUG , UAG and UCG b) UAA , UAG and UGA
89. Semiconservative replication of DNA was first
demonstrated in c) UUG , UGC and UCA d) UCG , GCG and ACC
Ans: b
a) Escheirchia coli
b) streptococus pneumoniae 97. Correct sequence of code transfer during
polypeptide formation is ____
c) Salmonella typhimurium
a) DNA , mRNA , t RNA and amino acids
d) Drosophila melanogaster Ans: a
b) DNA , t RNA , r RNA and m RNA
90. Whose experiments cracked the DNA and
discovered unequivocally that a genetic code c) m RNA , t RNA , DNA and amino acids
is a “triplet” d) r RNA , DNA ,m RNA and t RNA Ans: a
a) Hershey and chase 98. Best method to determine paternity is ____
b) Morgan and sturtevant a) Protein analysis b) chromosome counting
c) Beadle and Tatum c) gene counting d) DNA finger printing
d) Nirenberg and Mathai Ans: d Ans: d
91. The lac opern consists of ____ 99. Nucleotide arrangement in DNA can be seen
by
a) four regulatory genes only
a) X - ray crystallography b) Electron microscope
b) One regulatory gene and three structural
genes c) Ultra centrifuge d) Light microscope
Ans: a
c) Two regulatory genes and three structural
genes 100.Pneumococcus experiment proved that
d) three regulatory genes and three structural a) Bacteria do not reproduce asexuallly
genes
b) Bacteria undergo binary fission
Ans: b
c) DNA is genetic material
92. Ribosomal RNA is actively synthesized by __
d) RNA may sometimes control a production of
a) Lysosomes b) nucleolus DNA and protein
c) nucleoplasm d) ribosomes Ans: c
Ans: b
101.A DNA nucletotide chain has A G C T T C G A
93. If one strand of DNA has the nitrogenous sequence The nucleotide sequence of other
base sequence as ATCTG, What would be the chain would be
complementary RNA strand Sequence a) T C G A A G C T b) G C T A A G C T
a) TTAGU b) UAGAC c) T A G C A T A T d) G A T C C T A G
c) AACTG d) ATCGU Ans: b Ans: a

SURYA 87
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
102.A functional unit in synthesis of protein is 110.Which step does not involve in DNA finger
a) Lysosome b) Peroxisome printing?

c) Polysome d) Dictyosome a) Southern blotting

Ans: c b) Gel electrophoresis
103.VNTR is employed for c) Restriction enzyme digestion
a) Protoplasmic culture d) Northern blotting Ans: d
b) DNA finger printing 111.Southern blotting is used for the identification
of
c) Regulation of plant growth hormones
a) DNA b) RNA
d) Enhancing photosynthesis in desert plant
Ans: b c) Protein d) All the above
Ans: a
104.Okazaki fragments are joined by enzyme
112.The approximate number of genes contained
a) DNA helix b) DNA ligase
in the genome of Kalpana Chawla was
c) DNA polymerase II d) RNA polymerase II
a) 40,000 b) 30,000
Ans: b
c) 80,000 d) 1,00,000 Ans: b
105.Heat killed pathogenic cells and live non
pathogenic cells are mixed and injected into 113.Which of the following is not associated with
Mice the result would be HGP ?
a) Mice develop disease and die a) Bioinformatics
b) Mice die without developing disease b) Cloning vectors BAC & YAC
c) Mice remain healthy c) Automated DNA sequencers
d) 50% mice develop discease and die d) VNTR Ans: d
Ans: a
114.Which step is not correct in DNA finger
106.Genetic mutations occur in printing ?
a) DNA b) RNA a) Isolation of DNA
c) Protein d) RNA & protein both b) Digestion of DNA by DNA ligase enzyme
Ans: a c) Separation of DNA by electrophoresis
107.The locus of mutation is d) Hybridisation using labelled VNTR probe
a) Gene b) Chromosome Ans: b
c) Centromere d) Nucleus 115.Both deoxyribose and ribose belong to a class
Ans: a of sugars called as ____

108.Which of the following causes mutation a) trioses b) hexoses

c) pentoses d) polysaccharides
a) Crossing-over b) Nacl Ans: c
c) Colchicine d) UV rays
116.The net electric charge on DNA and histones
Ans: d
is ____
109.The minimum requirement for mutation is a) both positive
a) Change of triplet codon b) both negative
b) Change in single nucleotide c) negative and positive, respectively
c) Change in whole DNA d) zero Ans: c
d) Change in single strand of DNA
Ans: b

88 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
117.The promoter site and the terminator site for These questions consists of two statements each,
transcription are located at printed as Assertion and Reason. While answering
a) 3’ (downstream) end and 5’ (upstream) end, these questions you are required to choose any
respectively of the transcription unit one of the following four response.
b) 5’ (upstream) end and 3’ (downstream) end, a) If both Assertion & Reason are True &
respectively of the transcription unit the Reason is a correct explanation of the
Assertion.
c) the 5’ (upstream) end
b) If both Assertion & Reason are True but Reason
d) the 3’ (downstream) end is not a correct explanation of the Assertion.
Ans: b
c) If Assertion is True but the Reason is False.
118.One of the following is true with respect to
AUG d) If both Assertion & Reason are false.

a) It codes for methionine only 124.Assertion : Lac operon is an inducible system

b) It is also an initiation codon Reason : Transcription occurs in the presence
of lactose
c) It codes for methionine in both prokaryotes
and eukaryotes a) A b) B c) C d) D
d) All of the above Ans: a
Ans: d 125.Assertion : Operon concept was given by
119.The first genetic material could be Hershey and chase

a) protein b) carbohydrates Reason : Separation of DNA fragments are

done by centrifugation technique
c) DNA d) RNA
Ans: d a) A b) B c) C d) D
Ans: d
120.Discontinuous synthesis of DNA occurs in one
strand, because 126.Assertion : DNA is cut into Sections by using
restriction endonucleases
a) DNA molecule being synthesised is very long
b) DNA dependent DNA polymearse catalyses Reason : Ligase is used to join DNA nucleotides
polymerisation only in one direction (5’ → 3’) a) A b) B c) C d) D
c) It is a more efficient process Ans: b
d) DNA ligase has to have a role Ans: b 127. Assertion : Helicase is called unwindase
121.Control of gene expression takes place at the Reason : DNA helix uncoils and splits into
level of single strands by breaking of hydrogen bonds
a) DNA-replication b) Transcription between complementary bases

c) Translation d) None of the above a) A b) B c) C d) D

Ans: b Ans: a

122.In some viruses, DNA is synthesised by using 128.Assertion : Formation of Lagging strand is
RNA as template. Such a DNA is called as ____ slow

a) A-DNA b) B-DNA Reason : Formation of lagging strand begins

bit later than that of leading strand
c) c DNA d) r DNA Ans: c
a) A b) B c) C d) D
123.The amino acid attaches to the tRNA at it’s
Ans: a
a) 5’ - end b) 3’ – end
c) Anti codon site d) DHU loop
Ans: b

SURYA 89
 www.nammakalvi.org
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
129.Assertion : Mutations effect protein structure 137.Assertion : In DNA fingerprinting, after
and functions hybridization with VNTR probe, the
Reason : Only one changed codon may be autoradiogram gives many bands of different
missense when it changes insertion of one sizes
aminoacid Reason : It differs from individual to individual
a) A b) B c) C d) D in a population except fraternal twins.
Ans: a a) A b) B c) C d) D
130.Assertion : Catching criminals could become
easier and quicker using DNA fingerprints
Ans: c

Reason : The process begins with blood or PART-B

cell sample from which DNA is extracted
a) A b) B c) C d) D ADDITIONAL QUESTIONS (2 MARKS)
Ans: b
131.Assertion :Mutation results in changes in the 1. How is the information in DNA used for an
genotype and the phenotype of an organism organism ?
Reason : Mutation is a phenomenon, which  Based on the information on DNA synthesis
results in alternation of DNA sequences: of proteins will take place.
a) A b) B c) C d) D  Proteins determine the shapes of cell and
Ans: a rate of chemical reactions.
132.Assertion :Normally the genetic code is 2. Define genome
degenerate.  Genome is the totality of gene
Reason : One amino acid is coded by more
than one codon.  It is the hereditary nature of living organism
a) A b) B c) C d) D  It consists of a long sequence of nucleic
Ans: a acids that carry information.
 Genome carry hereditary information of
133.Assertion: There occur 64 codons in dictionary
of genetic code an organism.
 Genome divided into nucleic acid molecules.
Reason : Genetic code is quadraplete.
3. Define gene
a) A b) B c) C d) D
Ans: c  A gene is a basic physical and functional
unit of heredity.
134.Assertion :Replication and transcription
 Genes is defined as distinct particles that
occur in the nucleus but translation occurs in
the cytoplasm. follow Mendelian rules of inheritance,
occupy a definite locusin the chromosome
Reason : Transcription and translation are and are responsible for the expression of
unidirectional specific phenotypic character.
a) A b) B c) C d) D 4. List out the Properties of Gene
Ans: b
I. Several genes are located on the same
135.Assertion : Base pairing between purine chromosome.
and pyrimidines allows uniforms distance
II. The genes are arranged in a single linear
between two strands of the helix
order like beads on a string.
Reason : Number of hydrogen bonds between III.Locus - Each gene occupies a specific
pairing bases are constant. position called locus.
a) A b) B c) C d) D IV. Alleles - Genes may exist in several
Ans: b alternate forms called alleles.
136.Assertion :DNA is a chemically and structurally
more stable. V. Mutations - genes may undergo
mutations (sudden change in positions
Reason : DNA have no catalytic properties. and composition
a) A b) B c) C d) D VI. Genes are capable of self-duplication
Ans: a producing their own copies.
90 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
5. List out the contributions of scientist in 10. Classify nitrogen base.
research related to genetic material of an  The bases in the genetic materials are
organism
nitrogen containing molecules
 In1848,Wilhelm Hofmeister, observed that
 DNA and RNA both have four bases (two
nuclei organize themselves into small,
purines and two pyrimidines)
rod like bodies during mitosis called
chromosomes.  Purines base are Adenine and Guanine
(G) have double carbon–nitrogen ring
 In 1869, Friedrich Miescher, isolated a
structures
substance from the cell nuclei and called
it as nuclein.  Pyrimidines base are Thymine(T),
Cytosinec) and Uracil (U) have
 Altman renamed nucleic acid as DNA.
single ring structure
 By 1920 - it became clear that chromosomes
 Thymine is unique for DNA, while Uracil is
are made up of proteins and DNA.
unique for RNA.
 Griffith's experiment proved that DNA is the
genetic material. 11. Differentiate Nucleoside and nucleotide
6. Why One gene-one enzyme hypothesis  Nucleoside =nitrogenous base + sugar
modified into one gene-one polypeptide (at the 1-carbon of the sugar)
hypothesis  Nucleotide = Nucleoside +phosphate
 Enzyme may be composed of more than group (attached to the 5’ carbon of the same
one polypeptide chain and a gene can code sugar
for only one polypeptide chain. 12. How will you calculate the size of DNA
 Hence One gene-one enzyme hypothesis molecule
modified into one gene-one polypeptide  The distance between base pairs of the
hypothesis. DNA is 0.34nm (0.34×10-9m)
7. State one gene-one polypeptide hypothesis.
 Length of DNA double helix = Total
 One gene-one polypeptide hypothesis states number of base pairs x distance between
that one gene controls the production of two consecutive base pairs
only one polypeptide chain of an enzyme Eg. 6.6 × 10-9 × 0.34 ×10-9 m/bp), which is
molecule approximately 2.2 m for mammalian nucleus
8. List out the functions of DNase, RNase,  If the length of E. coli DNA is 1.36 mm, the
Protease number of base pairs in E. coli is 4 ×106m
 DNase - an enzyme which destroys DNA (1.36 × 103)
 RNase - an enzyme which destroys RNA 13. Define genophore
Proteases-an enzyme which destroys protein)  DNA of prokaryotes is almost circular and
lacks chromatin organization, hence it
9. Explain the chemical nature of nucleic acid
termed as genophore.
and how they are classified ?
 Nucleic acids are a long chain or polymer 14. Define histone octamere
which is made up of sequence of  2 molecules of the four histone proteins
nucleotides. H2A, H2B, H3 and H4 are organized to form
a unit of eight molecules called histone
 Nucleotide consists of a nitrogenous base,
octamere.
a five carbon sugar(pentose) and a
phosphate group. 15. What are the two types of chromatin ?
 There are two types of nucleic acids (based on Chromatins are two types they are
type of pentose sugar 1. Loosely packed chromatin are referred as
1. DNA - contain Deoxyribose sugar. euchromatin - transcriptionally active
2. RNA -contain Ribose sugar. 2. Tightly packed chromatin are called

SURYA 91
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
as heterochromatin transcriptionally which has replaced the traditional sequencing
inactive. methods.
16. Explain the term exon and intron 23.
Distinguish between heterochromatin
and euchromatin. Which of the two is
 In eukaryotes, the monocistronic structural transcriptionally active?
genes have interrupted coding sequences
known as exons (expressed sequences) and Heterochromatin Euchromatin
non- coding sequences called introns i) They are darkly
(intervening sequences). i) Euchromatin
staining and
is not readily
17. Define the term splicing, tailing . are scattered or
stainable and is
accumulated near the
 Splicing - The introns are removed by a dispersed.
nuclear envelope.
process called splicing. ii) These are
ii) These are
 Tailing-hnRNA undergoes additional transcriptionally
transcriptionally less
processing called as capping and tailing. active.
active or inactive
18. Define genetic code.
 Genetic code is the sequence relationship 24. What is the cause of discontinuous synthesis
different ways through alternate splicing of DNA on one of the parental strands of
patterns, a mechanism known to play an DNA? What happens to these short stretches
important role in generating both protein of synthesised DNA?
and functional diversity in animals.  DNA polymerase catalyses polymerization
19. What is Translation ? in only one direction, i.e. 5’ – 3’.
 Translation refers to the process of  Due to this, replication is continuous on one
strand (3’ – 5’), while it is discontinuous
polymerization of amino acids to form
on another strand (5’ – 3’).
poly peptide chain.
 The fragments which is discontinuous is
 The decoding process is carried out by later joined by DNA ligase.
ribosomes that bind mRNA and charged
tRNA molecules. 25. Name a few enzymes involved in DNA
replication other than DNA polymerase and
 The mRNA is translated starting at the 5’ end.
ligase. Name its functions.
20. Define operon .  Primase- It adds RNA primers to template
 Extra cellular or intracellular metabolites strands.
triggerinitiation or inhibition of gene  RNAse - Removes the RNA primer.
expression.
 Exonuclease- Initiate cleaving of
 The clusters of gene with related functions nucleotides one at a time.
are called operons.
26. Name any three viruses which have RNA as
21. Why Human Genome Projectcalled as mega the genetic material.
project ? 1. Ebola virus 2. Tobacco Mosaic Virus
 It was a mega project and took 13 years to 3. SARS 4. HIV Virus
complete.
27. Why is DNA considered a better genetic
 The human genome is about 25 times material?
larger than the genome of any organism
sequenced to date and is the first vertebrate  DNA is chemically less reactive and
genome to be completed. structurally more stable as its nucleotides
are not exposed except when they are to
 Human genome is said to have approximately express their effect.
3×109 bp.
 DNA is capable of undergoing slow
22. Define Shotgun sequencing mutations.
 The latest method of sequencing even longer  It has power of repairing.
fragmentsis by a method called Shotgun  Hence DNA is a better material for the
sequencing using supercomputers, storage of genetic information.
92 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
28. State the dual role of deoxyribonucleoside 33. What is aminoacylation?.
triphosphates during DNA replication.  Aminoacylation or charging of the tRNA is
 Deoxyribonucleoside triphosphates (or the process during which the amino-acyl-
phosphorylated nucleotides) i.e., deATP, adenylateenzyme complex reacts with
deCTP, deGTP and deTTP serve dual tRNAspecific for the amino acid to form
purpose during DNA replication. aminoacyl-tRNA complex.
 They act as substrates for the replication 34. How is the translation of mRNA terminated?
process as well as provide energy for the Explain.
polymerisation of nucleotides.  Polypeptide chain synthesis is terminated when
29. Compare the roles of the enzymes DNA a nonsense codon of mRNA reaches the
polymerase and DNA ligase in the replication. A-site of ribosome during protein synthesis.
 There are three nonsense codons-UAA, UAG
DNA polymerase DNA ligase and UGA.
The discontinuously  These codons do not specify any amino
DNA polymerase
synthesised fragments acid.
catalyse the
are joined by the
elongation of a new  So, translation is stopped.
enzyme DNA ligase
30. State the difference between the structural 35. Differentiate between the following: Inducer
genes in a transcription unit of prokaryotes and repressor in lac operon.
and eukaryotes.  Inducer is a chemical, which come and
contact with the repressor, and change it into
S. Structural gene Structural gene non-DNA binding state so as to free the
No in prokaryotes in eukaryotes operator gene.
Consists of Consists of both
 Repressor is a regulator protein meant
1. functional coding exons and introns.
for blocking the operator gene so that the
sequences.
structural genes are unable to form
Information is split
Information is mRNAs.
due to presence of
2. continuous as only
introns in between 36. How does DNA polymorphism arise in a
exons are present.
exons. population?
Splicing occur to  DNA polymorphism in a population arise due
Splicing does
3. make functional to mutations.
not take place.
mRNA.
37. Write the full form of VNTR. How is VNTR
31. State the functions of the following in different from ‘Probe’?
aprokaryote: a) tRNA b) rRNA
 VNTR stands for Variable Number of
a) tRNA helps in transferring amino acids to Tandem Repeats.
ribosome for synthesis of polypeptide chain.
 VNTRs are short nucleotide repeats in
b) tRNA acts as an adapter molecule. DNA that are specific to each individual and
c) rRNAplays structural and catalytic role vary in number from person to person.
during translation.  DNA probes, are radioactive, have repeated
base sequence complementary to VNTRs .
32. Differentiate between exons and introns.
Introns Exons 38. Explain the significance of satellite DNA in
DNA fingerprinting technique
i) Regions of a gene
Regions of a gene  Satellite DNA are very specific in each
which do not
which become part individual, vary in number from person to
form part of
of mRNA person and are inherited.
mRNA.
ii) Removed during  These sequences show high degree of
Code for the
the processing of polymorphism.
different proteins.
mRNA

SURYA 93
 www.nammakalvi.org
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
 Each individual inherits the satellite DNA 4. These two strands are complementary to
from, his/her parents which are used as each other
genetic markers in DNA fingerprinting. If the sequence on one strand is known we
39. Genetic code is specific and nearly universal. can predict sequence of other strand.
Justify.
2. List out the enzymes used in DNA replication
 Genetic code is specific as one codon
codes for only one amino acid and it is  In prokaryotes, replication process requires
nearly universal as the same codon would DNA polymerase I, II, and III.
code for same amino acid from bacteria to  DNA polymerase III is the main enzyme for
human. DNA replication.
 Hence it is universal and specific  DNA polymerase I & II are involved in DNA
40. What are the Contributions of Watson and repair mechanism.
Crick?  Eukaryotes have five types of DNA
 A simple model of DNA was available because polymerases
of them.  Errors replication are corrected by nucleases
 DNA replication could be easily understood. enzymes.
 The model brought revolution in  Deoxy nucleotide triphosphate provides
understanding of biology at a molecular energy for polymerization reaction.
level.  DNA helicase, Unwind the DNA strand
41. What is Central dogma ? Who proposed it?  Gap in the strands are joined by DNA ligase
 Central dogma was proposed by Crick.  At the point of origin of repliction, the
helicases and topoisomerases (DNA
 It refers to the flow of information from DNA to
gyrase) unwind and pull apart the
mRNA (transcription) and then decoding
strands, forming a Y-Shaped structure called
the information present in mRNA in the
the replication fork.
formation of polypeptide chain or protein
(translation). 3. Explain Wobble Hypothesis
 It is a hypothesis proposed by Crick (1966)
42. How do histones acquire positive charge?
which states that tRNA anticodon has the
 Histones are rich in basic amino acids ability to wobble at its 5’ end by pairing
lysine and arginine, hence they are with even non-complementary base of mRNA
positively charged. codon.
 According to this hypothesis, in codon-
PART-C anticodon pairing the third base may not
be complementary.
ADDITIONAL QUESTIONS (3 MARKS)  The third base of the codon is called wobble
base and this position is called wobble
1. State Base pair Rules
position.
 It was proposed by Erwin Chargaff
 The actual base pairing occurs at first two
1. Adenine pairs with Thymine (A=T) with positions only.
two hydrogen bonds and
Guanine pairs with Cytosine (G ≡ C) with
three hydrogen bonds.
2. The ratios between Adenine with Thymine
and Guanine with Cytosine are constant and
equal.
3. The base pairing confers a unique
property to the polynucleotide chain.
94 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
 The importance of Wobbling hypothesis is that to use this information for profit or for
it reduces the number of tRNAs required political power.
for polypeptide synthesis and it overcomes
 Insurance companies may refuse to insure
the effect of code degeneracy.
people at ‘genetic risk’ and this would save
 In the above example though the codon and the companies the expense of uture medical
the anti codon do not match perfectly, bills incurred by ‘less than perfect’ people.
yet the required amino acid is brought
 Another fear is that attempts are being
perfectly.
made to “breed out” certain genes of
 This enables the economy of tRNA, GUU, GUC, people from the human population in order to
GUA and GUG code for the aminoacid- create a ‘perfectrace’.
Valine.
7. List out the Application of DNA finger printing
4. Write short notes on Structure of the operon:
 Forensic analysis - It can be used in the
 Operon is a unit of gene expression and
identification of a person involved in
regulation and consists of one or more
criminal activities, for settling paternity
structural genes and an adjacent operator
or maternity disputes, and in determining
gene.
relationships for immigration purposes.
 Operator gene that controls transcriptional
 Pedigree analysis – inheritance pattern of
activity of the structural gene
genes through generations and for detecting
1. The structural gene codes for proteins, inherited diseases.
rRNA and tRNA required by the cell.
 Conservation of wild life – protection of
2. Promoters are the signal sequences in DNA endangered species, by maintaining DNA
that initiate RNA synthesis. records for identification of tissues of the dead
3. RNA polymerase binds to the promoter endangered organisms.
prior to the initiation of transcription.  Anthropological studies–It is useful in
4. The operators are present between the determining the origin and migration
promoters and structural genes. of human populations and genetic
diversities.
5. The repressor protein binds to the
operator region of the operon. 8. Define transformation in Griffith’s experiment.
5. List out the aims of Human GenomeProject Discuss how it helps in the identification of
DNA as the genetic material.
 The main goals of Human Genome Project are
as follows  During the course of Griffith’s experiment,
bacteria changed its physical form.
1. Identify all the genes(approximately
30000) in humanDNA.  This was termed as transformation.
2. Determine the sequence of the three  In this experiment, the DNA of the S strain
billion chemical base pairs that makeup bacteria survived after heating.
the humanDNA.  When a mice was injected with mixture of
3. To store this information in databases. killed S strain and R strain, the mice died
of pneumonia.
4. Improve tools for dataanalysis.
 This showed that DNA had the capability
5. Transfer related technologies to other sectors,
of surviving adverse circumstances and
such as industries.
manifesting itself on return of favourable
6. Address the ethical, legal and social conditions.
issues(ELSI) that may arise from the project.
 Stability and survival are key factor for a
6. What are the Applications and future material to be classified as genetic material.
challenges of HGP  Thus, transformation in Griffith’s experiment
 Once genetic sequence becomes easier to helped in identification of DNA as genetic
determine, some people may attempt material.
SURYA 95
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
9. Discuss the significance of heavy isotope
of nitrogen in the Meselson and Stahl’s PART-D
experiment.
 The heavy isotope of nitrogen was used in ADDITIONAL QUESTIONS (5 MARKS)
Meselson and Stahl’s experiment for various
reasons. 1. List out Properties of A molecule that can act
 The heavy DNA molecule (containing 15N) as a genetic material:
could be easily distinguished from the (a) Self Replication:
normal DNA by centrifugation in a Cesium  It should be able to replicate.
chloride (CsCl) density gradient.
 According to the base pair rule and
 It could be easily separated from lighter complementarity, both nucleic acids (DNA
nitrogen (14N) on the basis of density. and RNA) have the ability
 Use of lighter and heavier nitrogen made to duplications. Proteins will not replicate.
the task of identifying transfer of DNAs
(b) Stability:
through subsequent generation quite
easier.  It should be stable structurally and
chemically.
10. Retroviruses do not follow central Dogma.
Comment.  The genetic material should be stable
through out the life.
 Francis and Crick proposed the central dogma
in molecular biology.  Stability of genetic material was clearly
explained by Griffith’s experiments.
 According to this, genetic information flows
 Heat did not destroy some of the properties
from DNA --> RNA --> Protein.
of genetic material.
 In retroviruses, genetic information flows in
 RNA is catalytic and reactive.
reverse direction, i.e. Protein --> RNA -->
DNA.  Hence,DNA is chemically more stable than
RNA.
 Hence, it is said that retroviruses do not
follow central dogma.  Presence of thymine in DNA provide
additional stability to DNA.
 The process followed by retroviruses is also
called reverse transcription because of the (c) Information storage:
opposite sequence of the process involved.  It should be able to express itself
11. Do you think that the alternate splicing of  RNA can directly code for protein synthesis
exons may enable a structural gene to code and can easily express the characters.
for several
 DNA depends on RNA for synthesis of
isoproteins from one and the same gene? If proteins.
yes, how? If not, why so?  DNA and RNA can act as a genetic
 In humans about 95% of multi-exonic material, but DNA stores the genetic
genes are alternatively spliced. information and RNA transfers the genetic
information.
 Alternative splicing helps in generating
many proteins from one and the same gene. (d) Variation through mutation:
 In this process, a particular exon may be  It should be able to mutate.
excluded from or included in a specific  Both DNA and RNA able to mutate.
RNA.
 RNA being unstable, mutates at a faster rate
 Splicing which results in a single gene coding
 Thus RNA viruses have shorter life span
for multiple proteins is called alternative
can mutate and evolve faster.
splicing.
2. Explain different types of DNAReplication

96 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
 DNA Replication takes place during S phase  The ‘light’ culture was grown in a medium
 During replication, each DNA molecule in which the nitrogen source contained light
gives rise to two DNA strands, identical isotope 14N
to each other and parent Hypotheses of DNA  Findings : DNA in the heavy culture contained
replication. only 15N and in the light culture only
 Conservative replication, 14N.
 Dispersive replication,  Then heavy DNA is distinguished from light
DNA (15N from 14N) by Cesium Chloride
 semi-conservativereplication. (CsCl) density gradient centrifugation
a. Conservative replication, technique.
 In this original double helix serves as a  Heavy and light DNA extracted from cells and
template. separate bands (hybrid DNA).
 The original strand is preserved unbroken and  The heavy culture (15N) was then transferred
an entirely new double stranded molecule into a medium that had only NH4Cl, and
is synthesized. took samples at various time intervals (20
b. Dispersive replication, minutes duration).
 In this original molecule is broken into  After the first replication, they extracted DNA
fragments and each fragment serves and subjected it to density gradient
as a template for the synthesis of centrifugation.
complementary fragments.  The DNA settled into a band that was
 Finally two new molecules are formed intermediate in position between the
which consist of both old and new fragments. previously determined heavy and light
bands.
c. Semi- conservative replication.
 After the second replication (40 minutes
 It was proposed by Watson and Crick in duration), they again extracted DNA samples,
1953. and this time found the DNA settling into two
 This mechanism is based on the DNA model. bands, one at the light band position and one
at intermediate position.
 Initially two polynucleotide strands of DNA
molecule unwind and start separating at  These results confirm Watson and Crick’s
one end. semi conservative replication hypothesis.
 During this process, covalent hydrogen 4. Explain the mechanism of replication.
bonds are broken.  Replication begins at the initiation site
 The separated single strand then acts as called the site of ‘origin of replication’ (ori).
template for the synthesis of a new strand.  In prokaryotes, there is only one origin of
replication,
 Later, each daughter double helix carries
one polynucleotide strand from the parent  Eukaryotes have several origins of
and other strand is newly synthesised. replication (replicons).

3. Explain the process of DNA replication with a

 Replication occurs at replication fork.
help of an Experiment.  DNA helicase, Unwind the DNA strand
 The mode of DNA replication was determined  In one strand (with 3' 5'polarity) the
in 1958 by Meselson and Stahl. replication is continuous and it is known as
 They distinguish different types of replications the leading strand.
method.  In other strand (with 5’ 3' polarity)
 They grew two cultures of E.coli in replication is discontinuous, known as the
separate media. lagging strand.
 The ‘heavy’ culture was grown in a  Gap in the strands are joined by DNAligase.
medium in which the nitrogen source(NH4Cl)  Discontinuous strands are called as Okazaki
with heavy isotope 15N fragments
SURYA 97
 www.nammakalvi.org
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
 Complementary strands are connected by  For transcription, DNA’s double helix drawn
covalent bond and DNA polymerase. apart temporarily, and RNA is synthesized
 Formation of new strand requires a RNA by RNA polymerase.
primer for initiation.  RNA polymerase binds to DNA at the start
of a gene and opens the double helix.
 RNA primer removed gap from 5’ end in
the newly synthesized DNA strand.  Finally, RNA molecule is synthesized.
 Enzymes used :DNA polymerase.  The nucleotide sequence in the RNA is
complementary to the DNA.
 Finally, all the gaps are sealed by
DNAligase.  Both the strands of DNA are not copied
during transcription for two reasons.
 At the point of origin of repliction, the
helicases and topoisomerases (DNA  If both the strands act as a template, they
gyrase) unwind and pull apart would code for RNA with different
sequences.
the strands, forming a Y-Shaped structure
called the replication fork.  This will result in formation of different
amino acid sequences.
 Each region has two replication forks.
 This would result in one segment of DNA
 The two strands are always antiparallel coding for two different proteins, hence
orientation. complicate the genetic information transfer
 DNA polymerase eznymes catalyse the mechanism.
addition of a nucleotide to the new strands  If two RNA molecules were produced
in the 5’ 3’ direction, (it add nucleotides to simultaneously, double stranded RNA
the 3’ carbon position) would be formed.
5. Explain Transcription process in detail.  This would prevent RNA from being
translated into proteins.
 Francis Crick proposed the Central
dogma in molecular biology which states that 6. Explain various regions of DNA
 The process conversion of information  DNA has three distinct regions namely, a
from DNA to RNA is termed transcription. promoter, the structural gene and a
terminator.
 This process takes place in presence RNA
polymerase. The promoter :
 In some retroviruses, RNA act as the genetic  It is located towards the 5’ end.
material(e.g, HIV).  It is a DNA sequence act as a binding site
 RNA synthesizes DNA by reverse transcription, for RNA polymerase.
then transcribed into mRNA by transcription  The presence of promoter defines the
and then into proteins by translation. template and coding strands.
 For a cell to operate, its genes must be The terminator region :
expressed.
 It is located towards the 3’ end causes the
 This means that the gene products, whether RNA polymerase to stop transcribing.
proteins or RNA molecules must be
made.  In eukaryotes the promoter has AT rich
regions called TATA box (Goldberg
 The RNA that carries genetic information
-Hogness box)
is known as messenger RNA(mRNA).
 In prokaryotes this region is called Pribnow
box.
 Apart from promoter, eukaryotes also
require an enhancer.
 DNA dependent RNA polymerase catalyses
the polymerization in only one direction,

98 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
the strand that has the polarity 3’ 5’ acts as 4. A non-overlapping codon means that the
a template, and is called the template strand. same letter is not used for two different
 The other strand which has the polarity 5’ codons.
3’ has a sequence same as RNA and is For instance, the nucleotide sequence GUU,
displaced during transcription. This strand is GUC represents only two codons.
called coding strand. 5. It is comma less, which means that the
 The structural gene may be monocistronic message would be read directly from
(eukaryotes) or polycistronic one end to the other i.e., no punctuation
(prokaryotes). are needed between twocodes.
 In eukaryotes, each mRNA carries only a 6. A degenerate code means that more than
single gene and encodes information one triplet codon could code for a specific
for only a single protein and is called amino acid.
monocistronic mRNA. For example, codons GUU, GUC, GUA and GUG
 In prokaryotes, clusters of related genes, code forvaline.
known as operon, are transcribed together 7. Non-ambiguous code means that one
to give a single mRNA and hence are codon will code for one aminoacid.
polycistronic.
8. The code is always read in a fixed direction
 Bacterial RNA polymerase consists of two
major components -core enzyme + sigma i.e. from 5’→3’ direction called polarity.
subunit. 9. AUG has dual functions. It acts as a
 The core enzyme (β1, β, and a) is responsible initiator codon and also codes for the amino
for RNA synthesis acidmethionine.
 Sigma subunit is responsible for recognition 10.UAA, UAG (tyrosine) and UGA (tryptophan)
of the promoter. codons are designated as termination
(stop) codons and also are known as “non-
 RNA polymerase opensup the DNA to form sense” codons.
the transcription bubble.
8. Draw and explain the structure of tRNA.
 The core enzyme moves ahead,  The two dimensional clover leaf model of
manufacturing RNA leaving the sigma tRNA was proposed by Robert Holley.
subunit
 Terminator sequence that forms a hair pin
structure in the RNA.
 The sub-class of terminators require a
recognition protein, known as rho (ρ), to
function.
7. List out the salient features of genetic code
1. The genetic codon is a triplet code (61
codons code for amino acidsand 3
codons do not code for any amino acid
and function as stop codon(Termination).
2. The genetic code is universal.
E.g. the mRNA (UUU)codon codes for
phenylalanine in all cells of all organisms.
3. Some exceptions are reported in
prokaryotic, mitochondrial and chloroplast
genomes. However similarities are more
common than differences.

SURYA 99
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
 In actual structure, the tRNA is a compact  β-galactosidase hydrolysis of lactose
molecule which looks like an inverted L. into glucose and galactose,
 tRNA has three arms namely DHU arm,  transacetylase à transfers acetyl group
middle arm and TΨC arm. from acetyl Co A to β-galactosidase.
 These arms have loops such as amino  The lac operon consists of one regulator gene
acyl binding loop, anti codon loop and (‘i’ gene refers to inhibitor) promoter
ribosomal binding loop attheir ends. sites(p), and operator site (o).
 In addition it also shows asmall lump called  Besides these, it has three structural genes
variable loop or extra arm. namely lac z,y and lac a.
 The aminoacid is attached to one end  The lac ‘z’ gene codes for β-galactosidase,
(aminoacid acceptor end) and the other end
consists of three anti codon nucleotides.  Lac ‘y’ gene codes for permease
 The anti codon pairs with a codon in mRNA Lac a’ gene codes for transacetylase.

ensuring that the correct amino acid is  In lac operon, a polycistronic structural gene
incorporated into the growing polypeptide is regulated by a common promoter and
chain. regulatory gene.
 Four different regions of double-stranded RNA  When the cell is using its normal energy source
are formed during the folding process. as glucose, the ‘i’ gene transcribes a repressor
 Modified bases are especially common in mRNA and after its translation, a repressor
tRNA. protein is produced.
 Wobbling between anticodon and codon  It binds to the operator region of the operon
allows some tRNA molecules to read more and prevents translation, as a result,
thanonecodon. β-galactosidase is not produced.
 The process of addition of amino acid to  When lactose is available as an energy
tRNA is known as amino acylation or source for the bacteria then lactose enters
charging and the resultant product is called the cell as a result of permease enzyme.
aminoacyl- tRNA (charged tRNA).
 Lactose acts as an inducer and interacts
 Without aminoacylation tRNA is known as with the repressor to inactivate it.
uncharged tRNA
 The repressor protein binds to the operator
 This aminoacylation is catalyzed by an enzyme of the operon and prevents RNA
aminoacyl –tRNA synthetase. polymerase from transcribing the operon.
 20 different aminoacyl – tRNA synthetases are
 In the presence of inducer, such as lactose or
known.
allolactose, the repressor is inactivated
 The power to recognize codon on the by interaction with the inducer.
mRNA lies in th tRNA and not in the attached
 This allows RNA polymerase to bind to the
amino acid molecule.
promotor site and transcribe the operon to
 The tRNA charged with amino acid serves produce lac mRNA which enables formation
as an adapter molecule to decode the of all the required enzymes needed for
information on mRNA. lactose metabolism.
 There are no tRNAs for stop codons.  Jacob and Monod proposed the classical
9. Explain in detail about Lac operon model. model of Lacoperon to explain gene expression
 The metabolism of lactose in E.coli requires  lac operon by the repressor is an example
three enzymes permease, β-galactosidase of negative control of transcription
(β-gal) and transacetylase. initiation.
 Permease à help In entry of lactose into the  Lac operon is also under the control of
cell positive regulation as well.
100 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
10. List out the Salient features ofHuman Genome  The DNA of a person and finger prints are
Project: unique.
1. Human genome contains 3 billion  Thereare 23 pairs of human chromosomes
nucleotide bases, the DNA sequences that with 1.5 million pairs of genes.
encode proteins make up only about 5% of  It is a well known fact that genes are
the genome. segments of DNA which differ in thes
2. An average gene consists of 3000 bases, the equence of their nucleotides.
largest known human gene being dystrophin  Not all segments of DNA code for proteins,
with 2.4 million bases. some DNA segments have a regulatory
3. The function of 50% of the genome is function, while others are intervening
derived from transposable elements such sequences (introns) and still others are
as LINE and ALUsequence. repeated DNA sequences.
4. Genes are distributed over 24  In DNA fingerprinting, short repetitive
chromosomes. Chromosome 19 has the nucleotide sequences are specific for a
highest gene density. Chromosome 13 person.
and Y chromosome have lowest gene  These nucleotide sequences are called as
densities. Variable number tandem repeats (VNTR).
5. The chromosomal organization of human  The VNTRs of two persons generally
genes shows diversity. show variations and are useful as genetic
6. There may be 35000-40000 genes in the markers.
genome and almost 99.9 nucleotide bases  DNA finger printing involves identifying
are exactly the same in all people. differences in some specific regions in
7. Functions for over 50 percent of the DNA sequence called repetitive DNA, because
discovered genes are unknown. in these sequences, a small stretch of DNA is
repeated many times.
8. Less than 2 percent of the genome codes
for proteins.  These sequences do not code for any
proteins, but theyform a large portion of
9. Repeated sequences make up very large
human genome.
portion of the human genome. Repetitive
sequences have no direct coding functions  These sequences show high degree of
but they shed light on chromosome structure, polymorphism and form the basis of DNA
dynamics and evolution (genetic diversity). fingerprinting.
10.Chromosome 1 has 2968 genes whereas 12. How are the following formed and involved in
chromosome ’Y’ has 231genes. DNA packaging?
11.Identification of ‘SNIPS’ is helpful in (i)
Histone octamer (ii) Nucleosome (iii)
finding chromosomal locations for disease Chromatin
associated sequences and tracing human (i) Histone octamer :
history.
 Histones are positively charged proteins,
11. Write short notes on DNA finger printing rich in basic amino acid residues lysines
technique and arginines.
 This technique was first developed by Alec  These amino acids carry positive charges
Jeffreys in 1985 on their side chains.
 Each of us have the same chemical  There are five types of histone proteins : H1,
structure of DNA. H2A, H2B, H3 and H4.
 But there are millions of differences in the  Four of them (H2A, H2B, H3 and H4) are
DNA sequence of base pairs. organised inpairs to from a unit of eight
 This makes the uniqueness among us molecules called histone octamer.
so that each of us except identical twins is  Negatively charged DNA wraps around this
different from each other genetically. octamer to form nucleosome.
SURYA 101
 www.nammakalvi.org
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
(ii) Nucleosome : 14. Explain the process of transcription in
prokaryotes.
 It is the compaction unit.
 The positively charged ends of histone  Mechanism of transcription in prokaryotes:
octamer attract the negatively charged In prokaryotes, transcription occurs in
strands of DNA. contact with cytoplasm as their DNA lies in
the cytoplasm.
 The DNA is thus wrapped around the
positively charged histone octamer to a) Activation of ribonucleotides –
form a structure called nucleosome.  The four types of ribonucleotides are
 Around 200 bp of DNA is wrapped around adenosine monophosphate (AMP),
the body or histone octamer for 134 turns. guanosine monophosphate (GMP),
uridine monophosphate (UMP) and
 DNA connecting two adjacent nucleosomes cytidine monophosphate (CMP).
is called linker DNA which bears H1 histone
protein. Nucleosome and linker DNA together  They occur freely in the nucleoplasm.
constitute chromatosome.  Prior to transcription the nucleotides are
 Nucleosome chain gives a bead on string activated through phosphorylation.
appearance.  Enzyme phosphorylase is required along
Chromatin : with energy.

 The nucleosomal organization has  The activated or phosphorylated ribonucleo tides

approximately 10 nm thickness, which further are adenosine triphosphate (ATP), guanosine
gets condensed and coiled to produce a triphosphate (GTP), uridine triphosphate (UTP)
solenoid (having 6 nucleosomes per turn) of and cytidine triphosphate (CTP).
30 nm diameter. b)
Binding of RNA polymerase to DNA
 This solenoid structure further undergoes duplex
coiling to produce a chromatin fibre of  On a signal from the cytoplasm, DNA
30-80 nm thickness. segment becomeready to transcribe.
13. Mention the contributions of the following  The RNA polymerase enzyme binds to a
scientists: specific site, called promoter, in the DNA
double helix.
(i) Maurice Wilkins and Rosalind Franklin (ii)
Erwin Chargath  Prokaryotes have only one RNA
polymerase that synthesise all types of RNA.
(i) Maurice Wilkins and Rosalind Franklin (1953)
carried out X-ray diffraction studies to  The promoter also determines which DNA
study the structure of DNA molecule. strand is to be transcribed.
 Waston and Crick (1953) worked out the first  Thus, a promotor region has RNA
correct double helix model from the X-ray polymerase recognition site and RNA
photographs of Wilkins and Franklin. polymerase binding site.
(ii) Erwin Chargaff (1950) proposed Chargaff’s c) Base pairing
rules (or base pair rules)about DNA.  Ribonucleoside triphosphates present in the
 Adenine pairs with Thymine (A = T) with surrounding medium come to lie opposite
two hydrogen bonds and Guanine pairs the nitrogen bases of the DNA template
with Cytosine (G ≡ C) with three hydrogen (anti-sense strand).
bonds.  They form complementary pairs; U opposite
 The ratios between Adenine with Thymine A, A opposite T, C opposite G and G
and Guanine with Cytosine are constant and opposite C.
equal.  A pyrophosphate is released from each
 The base pairing confers a unique property ribonucleoside triphosphate to produce
to the polynucleotide chain. ribonucleotide.

102 SURYA
XII Std - Zoology ´ Unit II Chapter-5 | Molecular genetics
d) Formation of RNA chain  It should be able to incorporate slow
 With the help of RNA polymerase the adjacent changes (mutation) which are required for
ribonucleotides held over DNA template join to evolution.
form RNA chain.  It should be able to express itself in the
 A single RNA polymerase recognise form of Mendelian characters.
promoter and initiation region is Biochemistry of DNA and RNA:
prokaryotes.  Both DNA and RNA show complementarity
 As the RNA chain formation initiates, the of base pairs and hence are capable of
sigma (s) factor of the RNA polymerase replication.
separates.  As shown by Griffith’s experiment, DNA
 RNA polymerase (core enzyme) moves along is more stable than RNA because it
the DNA template causing elongation of RNA could survive even heat-killing during the
chain at the rate of some 30 nucleotides per experiment.
second.  2'-OH group is present in RNA. This
 RNA synthesis stops as soon as polymerase makes RNA labile and degradable; which
reaches the terminator region. is not the case with DNA.
 Rho factor (r) has ATP-ase activity and  Both RNA and DNA can carry on mutations.
also possesses 4-8 adenine ribonucleotides. But DNA being more stable is better suited
 Separation of RNA chain – With the help of rho for long term storage of mutations.
factor, the fully formed RNA chain is now  Hence, DNA was preferred as the genetic
released. material during the course of evolution.
 One gene forms several molecules of RNA, 16. Discuss the process of translation in detail.
which are released from the DNA template
 The process of polymerization of amino
one after the other on completion.
acid to form a polypeptide is called
 The released RNA is called primary translation.
transcript.
 Thus, the biological process through
(f) Duplex formation which protein is synthesized is called
 As the RNA chain is released, the transcribed translation.
region of the DNA molecule gets hydrogen  Translation happens in following main
bonded to the sense strand and the two steps:
are spirally coiled to assume the original
Initiation:
doublehelical form.
 Ribosome assembles around the target mRNA
 The protective protein coat is added again to
and we know that ribosome is the site of
the DNA duplex.
protein synthesis.
15. During the course of evolution why DNA was  The first tRNA gets attached at the start
chosen over RNA as genetic material? Give codon.
reasons by first discussing the desired criteria
in a molecule that can act as genetic material  A codon is a triplet of amino acids.
and in the light of biochemical differences Elongation:
between DNA and RNA.
 The tRNA transfers an amino acid to the
Following are the desired criteria in a molecule tRNA corresponding to the next codon.
that can act as genetic material:
 This phase involves addition of subsequent
 It should have the capability of replication. amino acids to form a long chain.
 It should chemically and structurally  This step forms the bulk of the protein
stable. synthesis.

SURYA 103
Chapter-5 | Molecular genetics XII Std - Zoology ´ Unit II
Translocation:  Cytosine and thymine are pyrimidines.
 The ribosome then moves to the next  According to Chargath’s Rule, purines and
mRNA codon and continues the process. pyrimidine
 This creates an amino acid chain.  base pairs are in equal amount, therefore
Termination:  Total nucleotides = 2000
 When a stop codon is reached, the ribosome [A + G + C + T] = 2000
releases the polypeptide. [A] = [T] and [G] = [C]
17. Define an operon. Giving an example, explain Guanine = 600
an Inducible operon.
Therefore, A + 600 + 600 + T = 2000
 A functioning unit of genomic DNA containing
A + T + 1200 = 2000
a cluster of genes under the control of a
single promoter is called operon. A + T = 2000– 1200
 An operon is generally transcribed into 2T = 800(A=T
polycistronic mRNA. T = 800/2= 400
 A single mRNA which codes for more than  Therefore, total pyrimidine,
one protein is called polycistronic mRNA.
C + T = [600 + 400] = 1000
 An operon is made up of 3 basic DNA
components: 20. Difference between Prokaryotic Transcription
Eukaryotic Transcription
Promoter:
 A nucleotide sequence that enables a gene to Prokaryotic Eukaryotic
be transcribed is called promoter. Transcription Transcription
It occurs in cytoplasm It occurs inside the
 It is recognized by RNA polymerase, which nucleus
then initiates transcription.
There is no specific Major part of
Operator: period for its transcription occurs
 A segment of DNA to which a repressor occurrence in G1 and G2 phases
binds is called operator. It is coupled to Transcription and
translation translation are
Structural genes: spacially separated
 The genes that are co-regulated by the Products of Products of
operon are called structural genes. T r a n s c r i p t i o n transcription come
Inducible Operon: become effective out of the nucleus
for functioning in
 When the operon is regulated by an inducer, it cytoplasm
is called inducible operon. There is only one There are three
 An inducer can switch on or off the operon. RNA polymerase. types of RNA
polymerases.
 E.g. Lac operon
mRNA is generally mRNA is generally
18. A DNA segment has a total of 2,000 polycistronic monocistronic
nucleotides, out of which 600 are Guanine Splicing is generally Splicing is required
containing nucleotides. not required for removing
How many pyrimidine bases this segment intervening sequences
possesse

104 SURYA
 CHAPTER
EVOLUTION
6
POINTS TO REMEMBER
 The term evolution is used to describe homologous structures that brings about
heritable changes in one or more divergent evolution.
characteristics of a population of species
 Organisms having different structural patterns
from one generation to the other.
but similar function are termed as analogous
 According Theory of special creation, life structures.
was created by “God”.
 Structures that are of no use to the possessor,
 According to the theory of spontaneous and are not necessary for their existence are
generation or Abiogenesis, living called vestigial orgAns:
organisms originated from non-living
 Eg. Human appendix, coccyx, wisdom teeth,
materials
ear muscles, body hair, mammae in male,
 Big bang theory explains the origin of nictitating membrane
universe as a singular huge explosion in  The organisms which possess the characters
physical terms. of two different groups (transitional stage)
 According to the theory of biogenesis, life are called connecting links.
arose from pre-existing life.  Sudden appearance of vestigial organs in
 According to the theory of chemical highly evolved organisms is called atavistic
evolution, primitive organisms in the orgAns:
primordial environment of the earth  E.g. presence of tail in a human baby
evolved spontaneously from inorganic
 Embryology deals with the study of the
substances and physical forces
development of individual from the egg to
 The Paleozoic era is characterized by the adult stage.
abundance of fossils of marine  Jean Baptiste de Lamarck, postulate
invertebrates. the theory of evolution in his famous book
 Mesozoic era (dominance of reptiles) called ‘Philosophie Zoologique’ in the year 1809.
the Golden age of reptiles.  The two principles of Lamarckian theory are:
 Cenozoic era (Age of mammals) is 1. The theory of use and disuse
subdivided into two periods namely Tertiary
and Quaternary. 2. The theory of inheritance of acquired
characters
 Urey and Miller (1953), paved way for
understanding the possible synthesis  Lamarck’s “Theory of Acquired characters”
of organic compounds that led to the was disproved by August Weismann
appearance of living organisms.  Charles Darwin explained the theory of
 Paleontology is the study of prehistoric life evolution in his book ‘The Origin of Species
through fossils. by Natural Selection’.

 Fossilization is the process by which plant  Darwin’s theory was based on

and animal remains are preserved in  Over production (or) prodigality of
sedimentary rocks. They fall under three production,Struggle for existence,
main categories. Universal occurrence of variations
 Actual remains, Petrifaction, Natural  Hugo de Vries put forth the Mutation theory.
moulds and casts
 Mutations are sudden random changes
 Structures which are similar in origin but that occur in an organism that is not
perform different functions are called heritable.

SURYA 105
 www.nammakalvi.org
Chapter - 6 | Evolution XII Std - Zoology ´ Unit II
 Mutations or discontinuous variation are
transmitted to other generations. PART-A
 Sewell Wright, Fisher, Mayer, Huxley,
Dobzhansky, Simpson and Haeckel TEXTUAL QUESTIONS (1 MARK)
explained Natural Selection in the light of
Post-Darwinian discoveries. 1. The first life on earth originated
 Five basic factors involved in the process of a) in air b) on land
organic evolution.
c) in water d) on mountain
 1. Gene mutation or Chromosomal
Ans: c
mutation, Genetic recombination, Natural
selection, Reproductive isolation, 2. Who published the book “Origin of species by
Natural Selection” in1859?
 The evolutionary process which produces new
species diverged from a single ancestral form a) Charles Darwin b) Lamarck
becomes adapted to newly invaded habitats c) Weismann d) Hugo de Vries
is called adaptive radiation.
Ans: a
 There are mainly three types of natural
selection 3. Which of the following was the contribution
of Hugo de Vries?
 Stabilising Selection (centipetal selection),
Directional Selection, Disruptive Selection a) Theory of mutation
(centrifugal selection): b) Theory of natural Selection
 Movement of genes through gametes or c) Theory of inheritance of acquired characters
movement of individuals in (immigration)
d) Germplasm theory Ans: a
and out (emigration) of a population is
referred to as gene flow. 4. The wings of birds and butterflies is an
 Genetic drift is a mechanism of evolution example of
in which allele frequencies of a population a) Adaptive radiation
change over generation due to chance
b) convergent evolution
(sampling error).
c) divergent evolution
 Hominid evolution occurred in Asia and
Africa. d) variation Ans: b
 Dryopithecus and Ramapithecus were 5. The phenomenon of“ Industrial Melanism”
hairy and walked like gorillas and chimpanzees. demonstrates
 Australopithecus lived in East African a) Natural selection
grasslands about 5 mya and was called the b) induced mutation
Australian ape man.
c) reproductive isolation
 Homo erectus the first human like being was
around 1.7 mya and was much closer to d) geographical isolation Ans: a
human in looks. 6. Darwin’s finches are an excellent example of
 Neanderthal human was found in Neander a) connecting links b) seasonal migration
Valley, Germany with a brain size of 1400 cc
c) adaptive radiation d) parasitism Ans: c
 Cro-Magnon was one of the most talked
forms of modern human found from the rocks 7. Who proposed the Germplasm theory?
of Cro-Magnon, France and is considered as a) Darwin b) August Weismann
the ancestor of modern EuropeAns:
c) Lamarck d) Alfred Wallace
 Homo sapiens arose in Africa some 25,000 Ans: b
years ago and moved to other continents

106 SURYA
XII Std - Zoology ´ Unit II Chapter - 6 | Evolution
8. The age of fossils can be determined by 3. Natural moulds and casts
a) electron microscope b) weighing the fossils i) Actual remains –
c) carbon dating d) analysis of bones • This is the most common method of
Ans: c fossilization.
9. Fossils are generally found in • Hard parts such as bones, teeth or shells
are preserved as such in the earth’s
a) igneous rocks b) meta morphic rocks
atmosphere.
c) volcanic rocks d) sedimentary rocks
• If Marine animals die their parts are covered
Ans: d
with sediments and are protected.
10. Evolutionary history of an organism is called • They get preserved as such as they are
a) ancestry b) ontogeny preserved in vast ocean, the salinity in them
c) phylogeny d) paleontology prevents decay.
Ans: c • The sediments become hardened to form
definite layers or strata.
11. The golden age of reptiles was
• Eg. Woolly Mammoth fossils were
a) Mesozoic era b) Cenozoic era
preserved in the frozen coast of Siberia
c) Paleozoic era d) Proterozoic era
• Several human beings and animals ancient
Ans: a
city of Pompeii were preserved intact by
12. Which period was called “Age of fishes”? volcanic ash
a)Permian b) Triassic ii) Petrifaction
c) Devonian d) Ordovician Ans: c • When animals die the original portion of
their body may be replaced by minerals
13. Modern man belongs to which period?
and the original substance being lost
a) Quaternary b) Cretaceous through disintegration.
c) Silurian d) Cambrian Ans: a • This method of fossilization is called
14. The Neanderthal man had the brain capacity petrifaction.
of • Minerals involved - iron pyrites, silica,
a) 650–800cc b) 1200cc calcium carbonate and bicarbonates of calcium
and magnesium.
c) 900cc d) 1400cc Ans: d
iii) Natural moulds and casts
PART-B, C AND D • Even after disintegration, the body of an
animal might leave indelible impression
on the soft mud which later becomes hardened
TEXTUAL QUESTIONS (2,3 AND 5 MARKS) into stones.
15. List out the major gases seems to be found in • Such impressions are called moulds.
the primitive earth. • The cavities of the moulds may get filled
• Primitive earth contain ammonia, methane, up by hard minerals and get fossilized,
hydrogen and water vapour. which are called casts.
• Due to split up water molecules by UV rays
hydrogen and oxygen also present.
16. Explain the three major categories in which
fossilization occur?
Fossilization occur in three ways they are
1. Actual remains
2. Petrifaction
SURYA 107
Chapter - 6 | Evolution XII Std - Zoology ´ Unit II
17. Differentiate between divergent evolution p = 0.3, q = 0.7 then,
and convergent evolution with one example
p2 = (0.3)2 = 0.09 = 9 % AA
foreach.
2pq = 2(0.3) (0.7) = 0.42 = 42 % Aa
Convergent q2 = (0.7)2=0.49 = 49 % aa
Divergent Evolution
evolution
i. Development i. Development of • Hence the beetle population appears to be in
of different similar adaptive Hardy- Weinberg equilibrium.
functional functional • The major factors which disturb Hardy-
structures from a structures in Weinberg equilibrium are
common ancestral unrelated groups of
form. organisms. 1. Gene migration or gene flow
ii. Homologous ii. Analogous organs 2. Mutation
organs show show convergent 3. Genetic drift
divergent evolution. evolution.
Eg. Darwin’s Eg. Australian 4. Recombination
finches, Marsupials and 5. Natural selection
Australian placental mammals,
Marsupials, various aquatic 19. Explain how mutations, natural selection
locomotion in vertebrates and and genetic drift affect Hardy Weinberg
mammals. wings of insect, equilibrium.
bird and bat.  Allele frequencies in a population may change
due to four fundamental forces of evolution
18. How does Hardy-Weinberg’s expression
such as natural selection, genetic drift,
(p2+2pq+q2=1) explain that genetic
equilibrium is maintained in a population? mutation and gene flow.
List any four factors that can disturb the  If these events are not possible the
genetic equilibrium. population will not be in Hardy –
• If a population is in a state of Hardy Weinberg Weinberg equilibrium
equilibrium, the frequencies of alleles 20. How did Darwin explain fitness of organisms?
and genotypes or sets of alleles in
 Fitness is the state of being suitably
that population will remain same over
adapted to an environment.
generations.
 Darwin proved that fittest organisms can
• Suppose we have a large population of beetles,
survive and leave more progenies than
and appear in two colours dark grey (black)
the unfit ones through natural selection.
and light grey, and their colour is determined
by ‘A’ gene.  Because they will survive more and hence
are selected by nature.
• ‘AA’ and ‘Aa’ beetles are dark grey
21. Mention the main objections to
• ‘aa’ beetles are light grey.
Darwinism.
• In a population let’s say that ‘A’ allele has
objections against Darwinism are
frequency (p) of 0.3 and ‘a’ allele has a
frequency (q) of 0.7. 1. Darwin failed to explain the mechanism of
variation.
• Then p+q=1.
2. Darwinism explains the survival of the fittest
• If a population is in Hardy Weinberg
but not the arrival of the fittest.
equilibrium, the genotype frequency can be
estimated by Hardy Weinberg equation. 3. He focused on small changing variations
that are mostly non-heritable.
(p + q)2= p2 + 2pq + q2
4. He did not distinguish between somatic
p2 = frequency of AA
and germinal variations.
2pq= frequency of Aa
5. He could not explain the occurrence of
q2= frequency of aa

108 SURYA
XII Std - Zoology ´ Unit II Chapter - 6 | Evolution
vestigial organs, over specialization of recognized species differing in body size,
some organs beak shape and feeding behavior.
Eg. large tusks in mammoths, oversized antlers in • Changes in the size and form of the beak
Irish deer, etc., have enabled different species to utilize
different food resources such as insects,
22. Taking the example of Peppered moth,
seeds, nectar from cactus flowers and blood
explain the action of natural selection. What
from iguanas, all driven by Natural selection.
do you call the above phenomenon?
• Genetic variation in the ALX1 gene in the
• Phenomenon - industrial melanism
DNA of Darwin finches is associated with
• Peppered moth – Bistonbetularia were variation in the beak shape.
available in two colours, white and black.
• Mild mutation in the ALX1 gene leads to
• Before industrialization peppered moth both phenotypic change in the shape of the beak
white and black coloured were common in of the Darwin finches.
England.
Eg.,Australian marsupials :
• Pre-industrialization witnessed white coloured
• A number of marsupials, each different
background of the wall of the buildings hence
from the other evolved from an ancestral
the white coloured moths escaped from
stock, but all within the Australian island
their predators.
continent.
• Post industrialization, the tree trunks
became dark due to smoke and dust let 24. Who disproved Lamarck’s Theory of acquired
out from the industries. characters? How?

• The black moths masked on the dark  August Weismann disproved Lamarck’s
bark of the trees and the white moths were “Theory of Acquired characters”
easily identified by their predators.  He conducted experiments on mice for
• Hence the dark coloured moth population twenty generations by cutting their tails
was selected and their number increased and breeding them.
when compared to the white moths.  All mice born were with tail.
• Nature offered positive selection pressure  Weismann proved that change in the
to the black coloured moths. somatoplasm will not be transferred
• The above proof shows that in a population, to the next generation but changes in the
organisms that can adapt will survive germplasm will be inherited.
and produce more progenies resulting 25. How does Mutation theory of De Vries differ
in increase in population through natural from Lamarck and Darwin’s view in the origin
selection. of new species.
23. Darwin’s finches and Australian marsupials  According to de Vries, sudden and large
are suitable examples of adaptive radiation – variations were responsible for the
Justify the statement. origin of new species whereas Lamarck and
• The process of evolution of different Darwin believed in gradual accumulation
species in a given geographical area of all variations
starting from a point and literally radiating to  According to Hugo de Vries, mutations are
other areas of geography (habitats) is called sudden and heritable variations which
adaptive radiation causes evolution, hence called it saltation
E.g., Darwin’s finches. (single step large mutations).
• Common ancestor of Darwin’s finches  While Darwin’s theory of natural selection states
arrived on the Galapagos about 2 million that speciation is due to accumulation
years ago. of small, directional, and heritable
variations, and is a gradual process.
• Darwin’s finches have evolved into 14

SURYA 109
 www.nammakalvi.org
Chapter - 6 | Evolution XII Std - Zoology ´ Unit II
26. Explain stabilizing, directional and disruptive 27. Rearrange the descent in human evolution
selection with examples. Austrolopithecus → Homo erectus →
There are mainly three types of natural selection Homosapiens→Ramapithecus→Homo habilis.
1. Stabilising Selection (centipetal Answer : Ramapithecus → Homo habilis →
selection): Homo erectus → Homo sapiens
• This type of selection operates in a stable 28. Differentiate between the eating habit
environment. and brain size of Australopithecus and
• The organisms with average phenotypes Ramapithecus.
survive whereas the extreme individuals
Australopithecus Ramapithecus
from both the ends are eliminated.
Eating It mainly ate fruit, It ate hard
• There is no speciation but the phenotypic pattern vege tables, nuts and
stability is maintained within the population small lizards, seeds
and tubers.
over generation.
Brain size 350 – 450 cc Relatively
E.g., measurements of sparrows that survived large brain
the storm clustered around the mean, and
29. How does Neanderthal man differ from the
the sparrows that failed to survive the storm
modern man in appearance?
clustered around the extremes of the variation
2. Directional Selection: Neanderthal Modern human
• The environment which undergoes gradual Neanderthals are an Humans refer to the
change is subjected to directional extinct species of primate species
selection human. of to which modern
• This type of selection removes the humans belong
individuals from one end towards the Named as Homo Named as Homo
other end of phenotypic distribution. Neanderthalensis sapiens
E.g., size differences between male and Evolved about Evolved about
400,000 to 40,000 200,000 years ago in
female sparrows.
years ago in Europe Africa
• Both male and female look alike externally and Southwestern to
but differ in body weight. central Asia
• Females show directional selection in relation Skull comprised a Skull is thin-walled,
to body weight. large middle part of dome shape, with a
the face, A huge flat, and near vertical
3. Disruptive Selection (centrifugal nose and angled forehead
selection) : check bone
• When homogenous environment changes Brain was larger in Have special features
into heterogenous environment this type comparison to body in their skull to
of selection is operational overcome the large
size of the brain
• The organisms of both the extreme phenotypes
are selected whereas individuals with Average height - Average height -
average phenotype are eliminated. Males : 5 ft 5 Males : 5 ft 71/2
Females was 5 ft 1 Females was 5 ft 2
• This is a rare form of selection but leads
to formation of two or more different 30. Mention any three similarities found common
species. in Neanderthal man and Homosapiens.

• It is also called adaptive radiation. • Neanderthal man and Homo sapiens are
belongs to the genus –Homo
• E.g., Darwin’s finches-beak size in relation to
seed size inhabiting Galapagos islands. • Both are primates
• Both Neanderthal man and Homo sapiens have
a similar size brain

110 SURYA
XII Std - Zoology ´ Unit II Chapter - 6 | Evolution
31. According to Darwin, the organic evolution is 6. Which of the following provides most evident
due to proof of evolution?
a) Intra specific competition a) Fossils b) Morphology
b) Inter specific competition c) Embryo d) Vestigial organs
c) Competition within closely related species Ans: a

d) Reduced feeding efficiency in one species due 7. What was the basic principle of Lamarckism
to the presence of interfering species. a) Inheritance of acquired characters
32. A population will not exist in Hardly- Weiberg b) Survival of the fittest
equilibrium if c) Natural selection
a) Individuals mate selectively d) Acquired characters Ans: c
b) There are no mutations
8. Book ‘PhilosophieZoologique’ published in
c) There is no migration the year 1809 was written by
d) The population is large a) Darwin b) Lanmark
c) De Vries d) Mendel Ans: b
PART-A
9. Who published the book “Orgin of species by
Natural Selection” in 1859
ADDITIONAL QUESTIONS (1 MARK)
a) lanmarck b) Darwin
1. The mammal like early reptiles which gave c) Wallace d) Oparin Ans: b
rise to mammals, are evolved in
10. Neo-Darwinism believes that new species
a) Silurian b) Mississippian develop through
c) Devonian d) Permian Ans: d a) Mutations
2. Dinosaurs originated: b) Hybridization
a) After evolution of mammals c) Mutations with natural selection
b) With mammals d) None of the above Ans: c
c) Much before mammals 11. Which one is linked to evolution?
d) Before mammals and they formed them a) Extinction b) Competition
Ans: b
c) Variation d) Reproduction
3. Archaeopteryx is a connecting link because Ans: c
a) It possessed characters of reptiles and aves 12. Ancestor of man who first time showed
b) It has characters of reptiles and mammals bipedal movement
c) It was a reptile not a bird a) Cro-magnon b) Australopithecus
d) It had characters of non chordates and c) Java apeman d) Peking man
chrodates Ans: a Ans: b
4. Analogous organs are 13. Cranial capacity of Neanderthal man was
a) Similar in origin b) Similar in structure a) 900 cc b) 1075 cc
c) Non functional d) Similar in function c) 1450 cc d) 1400 cc Ans: d
Ans: d
14. Coloured rock paintings were first done by
5. Evolutionary history of an organism is known a) Cro-magnon man b) Java ape man
as
c) Peking man d) Neanderthal man
a) Phylogeny b) Ancestry Ans: a
c) Palaeontology d) Ontogeny Ans: a
SURYA 111
Chapter - 6 | Evolution XII Std - Zoology ´ Unit II
15. Primitive atmosphere was made up of the 23. Most modern hypothesis regarding origin of
mixture of life was given by
a) Oxygen, ammonia, methane, water a) Wallace b) Hugo de Vries
b) Hydrogen, ammonia, methane, oxygen c) Oparin d) Charles Darwin
c) Hydrogen, steam, methane, ammonia Ans: c

d) Oxygen, methane, water, nickle Ans: c 24. Which is vestigial organ in man

16. What is most important for origin of life a) Pinna b) Pinna muscles

a) Carbon b) Oxygen c) Lleum d) Teeth Ans: b

c) Water d) Nitrogen Ans: c 25. Miller and Urey performed an experiment to

prove the origin of life. They took gases NH3
17. Oxygen in atmosphere has been formed by and H2 along with
a) Evaporation of water a) N2 and H2O b) H2O and CH4
b) Photosynthesis of blue green algae c) CH4 and N2 d) CO2and NH3 Ans: b
c) metabolism of microorganisms 26. Peripatus is connecting link between
d) decaying organisms Ans: b a) Mollusca and Arthropoda
18. Oparin’s theory is based on b) Flat worms and annelid
a) Artificial synthesis c) Annelida and Arthropoda
b) Spontaneous generation d) Reptilia and Mammalia Ans: c
c) God’s well 27. Which of the following set has homologous
d) All Ans: a organs
19. Which biologist gave most logical biochemical a) Hands of man, monkey and kangaroo and
theory of origin of life trunk of elephant
a) Urey b) Oparin b) Wings of insects, birds and bats
c) Stanley Miller d) Haeckel Ans: b c) Hind limbs of grasshopper, horse and bat
20. Who did an experiment to prove that ‘The d) bones such as humerus, radius, ulna, carpals,
organic compounds were the basis of life’? metacarpals and phalanges Ans: d
a) Darwin 28. Who was the first to explain recapitulation
theory
b) Stanely Miller and Harold C.Urey
a) Weismann b) Haeckel
c) Melvin
c) Darwin d) Malthus Ans: b
d) Fox Ans: b
29. Which of the following sets do not have
21. First life on earth was
homologous organs
a)Cyanobacteria
a) Wings of mosquito and butterfly
b) similar to the Monera
b) Wings of butterfly and bat
c) Autotrophs
c) Mouth parts of cockroach and butter fly
d) Photoautotrophs Ans: b
d) None of them Ans: b
22. Abiogenesis is the
30. Golden age of Dinosaurs was during
a) Origin of life from non-living material
a) Cenozoic era b) Palaeozic era
b) Origin of life from living organism
c) Archeozoic era d) Mesaozoic era
c) Origin of viruses and microbes Ans: d
d) none Ans: a

112 SURYA
XII Std - Zoology ´ Unit II Chapter - 6 | Evolution
31. Evolution of birds and mammals occurred in 39. Convergent evolution of two species is
a) Eocene and Oligocene periods associated with

b) Silurian and Devonian periods a) Analogous organs

c) Carboniferous and Permian periods b) Recent common ancestor

d) Cretaceous and Triassic periods Ans: d c) Homologous organs

d) Different habitat Ans: a
32. The Mesozoic era of earth is called the
a) Golden Age of amphibians 40. Darwin’s finches are an example of

b) Golden age Age of armoured fishes a) Divergent evolution

c) Golden Age of primitive man b) Adaptive radiation

d) Golden age of reptiles Ans: d c) Allopatric speciation

d) All of these Ans: d
33. An era “age of birds and mammals”
a) Mesozoic b) Palaeozoic 41. Name of the scientist who gave Mutation
Theory
c) Cenozoic d) Cretaceous Ans: c
a) Wallace b) Malthus
34. Origin of life took place in which of the c) Dawin d) De Vries Ans: d
following era
a) Mesozoic b) Palaeozoic 42. The ultimate source of variation is

c) Precambrian d) Proterozoic Ans: c a) Mutation b) Sexual reproduction

c) natural selection d) Hormonal action
35. A connecting link between reptiles and birds
is Ans: a
a) Archaeopteryx b) Platypus 43. Who is related with modern synthetic theory
c) Java Ape man d) Whale Ans: a of evolution:
a) Dobzhansky b) Haldane
36. Evolution of heart from one to two, three and
four chambered proves c) Mayr d) De Vries Ans: a
a) Biogenetic law of Haeckel 44. Inheritance of acquired characters comes
b) Lamarckism from

c) Hardy Weinberg’s law a) Lamarckism b) Darwinism

d) Neo Darwinism Ans: a c) Ne- Lemarckism d) Neo-Darwinism

Ans: a
37. Potato and sweet potato
45. Struggle for existence and survival of the
a) Have edible parts which are homologous fittest theories were given by
organs
a) Wallace b) Darwn
b) Have edible which are analogous organs
c) Lanmarck d) None of these
c) Have been introduced in India from the same Ans : b
place
46. Which fossil man had cranial capacity almost
d) they are two species of the same genus equal to modern man
Ans: b
a) Australopithecus b) Java ape man
38. Fossils are
c) Neanderthal man d) Peking man Ans: c
a) Animals living in burrows
47. Homo habilis refers to
b) Remnants of extinct animals and plants
a) Wandering species b) Ancient man
c) Floating organisms
c) Modern man d) Tool-maker Ans: d
d) Fast runners Ans: b
SURYA 113
 www.nammakalvi.org
Chapter - 6 | Evolution XII Std - Zoology ´ Unit II
48. Which of the following ancestor of man was 55. By studying analogous structures we look for
fond of painting and weapons making ______.
a) Neanderthal man b) Cromagnon man a. similarities in appearance and function but
c) Java man d) Peking man Ans: b different in structure.
b. similarities in appearance but differences in
49. Hugo Devries worked on
functions.
a) Oenotheralamarckiana b) Lathrusodoratus
c. Similarities in organ structure.
c) Pisumsativum d) Arachis hypogeal
d. Similarities in cell make up.
Ans: a
Ans: a
50. (p+q) = p +2pq+q =1 represents an equation
2 2 2
56. The scientist who cut off the tails of mice of
used in
successive generations to prove Lamarck’s
a) Population genetics theory was wrong was _____.
b) Menedelian genetics a) Weismann b) Haeckel
c) Biometrics c) Darwin d) Wallace Ans: a
d) Molecular genetics Ans: a 57. Human being belongs to the species of_____.
51. Fossils are generally found in a) Homo erectus b) Homo habillis
a) Sedimentary rocks b) Igneous rocks c) Homo sapiens d) Hominidae Ans: c
c) Metamorphic rocks d) Any type of rock 58. Evidences of evolutionary relationships is
Ans: a found in ______.
52. The first human being like prehistoric man a) atmosphere b) fossils
was
c) ocean beds d) rocks Ans: b
a) Homo sapiens b) Homo erectus
59. The pre-cell which is gradually transformed
c) Homo habilis d) Neanderthal man into living cells ______.
Ans: c
a) prokaryotes b) coacervates
53. What is sequence in the evolution of c) eobionts d) chemoautotrophs
mammals?
Ans: b
a) Fish-amphibian-bird-mammals
60. The first organism to be found on a bare rock
b) Insect – fish –bird – mammals is a (an) ______.
c) Fish – amphibian – reptile- mammals a) moss b) alga
d) Fish – amphibian – reptile – bird – mammals c) lichen d) fern Ans: c
Ans: c
61. The era called ‘age of prokaryotic microbes’ is
54. The difference between Homo sapiens and ______.
the Homo erectus was ____. .
a. a) archaezoic b) precambrian
a. Homo sapiens originated in Africa while Homo
c) phaenerozoic d) proterizoic Ans: b
erectus was in Asia
b. Homo erectus were much smaller in size than 62. The first photoautotroph organisms were
homo sapiens. ______.

c. Homo erectus stayed in Africa while Homo a. a) bryophytes b) algae

sapiens did not. c) cyanobacteria d) bacteria Ans: d
d. The size of their brain of Homo eructus was
smaller to homo sapiens
Ans: d

114 SURYA
XII Std - Zoology ´ Unit II Chapter - 6 | Evolution
63. Who performed this famous experiment to 71. The Jurassic period belongs to the ............
prove origin of life ? era
a) Oparin and Haldane a. a) proterozoic b) archezoic
b) Spallanzani and Pasteur c) mesozoic d) cenozoic Ans: c
c) Urey and Miller 72. Potato and sweet potato ______.
d) Fox and Pasteur Ans: c a. have edible parts which are homologous
64. Coacervates are organs
a) colloidal droplets b. have edible part which are analogous organs
b) contain nucleoprotein c. have been introduced in India from the same
c) a) and b) place
d) protobiont Ans: c d. None of the above Ans: b

65. According to abiogenesis life originate from 73. Which one is not a vestigial organ in man ?
______. a) Wisdom teeth
a) non-living matter b) Muscles of external ear-pinna
b) pre-exiting life c) Fossa ovalis
c) chemicals d) Ileum Ans: d
d) extra-terrestrial matter Ans: a
74. The tracking of evolutionary history of
66. Mesozoic era is associated with mass organisms is ______.
extinction of ______. a. a) ontogeny b) phylogeny
a) flowering plants b) trilobites c) analogy d) homology Ans: b
c) Dodo d) dinosaurs Ans: d
75. An old view about evolution states that the
67. Vermiform appendix in man, nictitating organisms were created by a super organism
membrane and wisdom teeth are ______. in the same condition as they exist now. This
a) homologous organs b) analogous organs theory is called ______.

b. c) vestigial organs d) none of the above a) theory of special creation

Ans: c b) theory of natural selection
68. Which one of the following terms would most c) Lamarck’s theory of evolution
correctly describe the relationship between d) theory of spontaneous generation Ans: a
the flight organs of animals like locust, bat,
swallow, and flying fish ? 76. Industrial melanism is an example of
a) Atavism b) Analogous a) natural selection b) mutation
c) Homologous d) Vestigeal Ans: b c) adaptive convergence d) gene flow Ans:a
69. Appearance of facial hair in some people is an 77. Who was the first civilized man ?
example of a) Cro-magnon man b) Neanderthal man
a) Vestigial organ b) analogous organs
c) Java ape man d) Peking man Ans: a
c) atavistic organ d) all above Ans: c
78. Closest primate to man is ______.
70. These are some examples of vestigial
a) gorilla b) rhesus monkey
structures in man
c) orangutan d) lemur Ans: a
a) wisdom tooth vermiform appendix, hair
b) wisdom tooth, vermiform appendix, coccyx
c) wisdom tooth, head, nails
d) none of these Ans: b

SURYA 115
Chapter - 6 | Evolution XII Std - Zoology ´ Unit II
79. Match the features from the columns C) If Assertion is True but the Reason is
False.
Column – I Column – II
D) If both Assertion & Reason are false.
a) Ape like primate 1. Homo erectus
b) Ancestor of modern 2. Australopithecus 84. Assertion : Fossils are always remains of hard
apes parts of life-forms found only in rocks
c) Connecting link 3. Dryopithecus Reason : Rocks are formed due to sediments
between ape and man
d) First to use fire 4. Propliopethecus a) A b) B c) C d) D Ans: d

A B C D 85. Assertion :According to Lamarck, evolution of

life forms had occurred but driven by use and
a) 3 4 2 1 disuse of orgAns:
b) 4 3 2 1 Reason : Use and disuse of organ leads to
c) 3 4 1 2 change at genetic level
d) 4 2 1 3 Ans: b a) A b) B c) C d) D Ans: c
80. The first human like being was 86. Assertion : Big – Bang theory talks of a singular
a) neanderthal man b) Homo erectus huge explosion unimaginable in physical
terms to explain the origin of universe.
c) cro-magnon man d) Australopithecus
Ans: b Reason : Due to big-bang origin of life tooks
place.
81. Human evolution actually started in ______.
a) A b) B c) C d) D Ans: c
a) asia b) Africa
87. Assertion : Analogous structures are a result
c) Central Asia d) a) and b) Ans: d
of convergent evolution.
82. Which of the following is correct match Reason : Different structures evolving for the
regarding cranial capacity and location of same function and hence having similarity.
respective fossil.
a) A b) B c) C d) D Ans: a
a) Australopithecus – east Africa (350- 450 CC)
b) Homo erectus – 1400 cc 88. Assertion : Analogous organs show common
ancestory.
c) Neanderthal – Africa (500–600 CC)
Reason : Analogous organ show evolution
d) Homo sapiens – 650 -800 cc Ans: a
a) A b) B c) C d) D Ans: d
83. Which one of the following ancestors of man
first time showed bipedal movement ? 89. The theory of spontaneous generation stated
that:
a) Australopithecus b) Cro-magnon
a) life arose from living forms only.
c) Java apeman d) Peking man
Ans: a b) life can arise from both living and non-living.
These questions consits of two statements c) life can arise from non-living things only.
each, printed as Assertion and Reason. d) life arises spontaneously, neither from living
While answering these questions you are nor from the non-living. Ans: c
required to choose any one of the following
90. ______is a byproduct of human exploitation
four response.
of forests, oceans and fisheries or the use of
A) If both Assertion & Reason are True & pesticides, herbicides or drugs
the Reason is a correct explanation of
a) reverse evolution b) artificial selection
the Assertion
c) mutation d) natural selection
B) If both Assertion & Reason are True but
Ans: b
Reason is not a correct explanation of
the Assertion.

116 SURYA
XII Std - Zoology ´ Unit II Chapter - 6 | Evolution
91. Palaentological evidences for evolution refer 98. Which of the following is an example for link
to the: species?
a) development of embryo a) Peripatus b) Dodo bird
b) homologous organs c) Sea weed d) Chimpanzee Ans: a
c) fossils 99. Match the scientists listed under column ‘A’
d) analogous orgAns: Ans: c with ideas listed undercolumn ‘B’.

92. The bones of forelimbs of whale, bat, cheetah Column A Column B

and man are similar in structure, because: (i) Darwin M. abiogenesis
a) one organism has given rise to another (ii) Oparin N. use and disuse of organs
b) they share a common ancestor (iii) Lamarck O. continental drift theory
c) they perform the same function (iv) Wagner P. evolution by natural selection
d) they have biochemical similarities Ans: b a) (i) M; (ii) P; (iii) N; (iv) O
b) (i) P; (ii) M; (iii) N; (iv) O
93. Analogous organs arise due to:
c) (i) N; (ii) P; (iii) O; (iv) M
a) divergent evolution
d) (i) P; (ii) O; (iii) N; (iv) M Ans: b
b) artificial selection
100.Variations during mutations of meiotic
c) genetic drift
recombinations are:
d) convergent evolution Ans: d
a) random and directionless
94. Evolution of life shows that life forms had a b) random and directional
trend of moving from:
c) random and small
a) land to water
d) random, small and directional Ans: a
b) dryland to wet land
c) fresh water to sea water PART-B
d) water to land Ans: d
95. Fossils are generally found in: ADDITIONAL QUESTIONS (2 MARKS)

a) Sedimentary rocks b) Igneous rocks 1. Define Evolution.

c) Metamorphic rocks d) Any type of rock • Evolution is describe heritable changesin
Ans: a characteristics of a population of species
from one generation to the other.
96. Which type of selection is industrial melanism
observed in moth, Bistonbitularia: • Types of evolution - chemical, organic and
social or cultural evolution
a) Stabilising b) Directional
c) Disruptive d) Artificial Ans: b 2. What is Abiogenesis ?
• This one of the theory of origin of living
97. The most accepted line of descent in human
organism on earth
evolution is:
• According to this theory living organisms
a) Australopithecus → Ramapithecus → Homo
originated from non-living materials and
sapiens → Homohabilis
occurred through evolution over millions of
b) Homo erectus → Homo habilis → Homo years.
sapiens
3. Did aquatic life forms get fossilised? If, yes
c) Ramapithecus → Homo habilis → Homo where do we come across such fossils?
erectus → Homo sapiens
• Many aquatic life forms too got fossilized.
d) Australopithecus → Ramapithecus → Homo
erectus → Homohabilis → Homo sapiens. • Many such fossils have been found from oil
Ans: c wells.

SURYA 117
 www.nammakalvi.org
Chapter - 6 | Evolution XII Std - Zoology ´ Unit II
Many others have been found from 10. Define the term protobionts.
sedimentary rocks because many water bodies  Abiotically produced molecules can
got filled up by sedimentation spontaneously self assemble into
4. What is coacervates ? droplets that enclose a watery solution
and maintain a chemical environment
• Coacervates are large colloidal particles that
different from their surroundings.
precipitate out in aqueous medium
 Scientists call these spheres as ‘protobionts’.
• They are the first pre-cells which gradually
transformed into living cells. 11. What are the two types of cell that are formed
in Biological evolution?
5. Explain Biogenesis theory.
Cell type 1 :
• This one of the theory of origin of living
 One form of the earliest cell contained clumps
organism on earth
of nucleoproteins embedded in the cell
• According to the Theory of biogenesis, substance.
life arose from pre-existing life.
 Such cells were similar to the Monera.
• The term biogenesis also refers to the
 They are considered as ancestral to the
biochemical process of production of
modern bacteria and blue green algae.
living organisms.
Cell type 2 :
6. Explain chemical evolution theory.
 The other form of earliest cells contained
• According to the theory of chemical nucleoprotein clumps that condensed
evolution, primitive organisms in the into a central mass surrounded by a thin
primordial environment of the earth evolved membrane.
spontaneously from inorganic substances
and physical forces such as lightning, UV 12. How prokaryotes and Eukaryotes are evolved?
radiations, volcanic activities, etc.,  The atmospheric oxygen combined with
methane and ammonia to form CO2 and
7. Why Mesozoic era known as Golden age of
free nitrogen.
Reptiles?
 The presence of the free O2 brought about
In Mesozoic era known as Golden age of

the evolution of aerobic respiration
Reptiles because reptiles are more dominated
which could yield large amounts of energy by
at this era
oxidation of food stuffs.
8. Difference between Relative dating of
 Thus Prokaryotes and Eukaryotes
Absolute dating.
evolved.
 Relative dating - is used to determine a 13. Define fossilization.
fossil by comparing it to similar rocks and
fossils of known age.  Fossilization is the process by which plant
and animal remains are preserved in
 Absolute dating is used to determine the sedimentary rocks.
precise age of a fossil by using radiometric
dating to measure the decay of isotopes 14. What is petrifaction?

9. Write the significance of Cenozoic era?  When animals die the original portion of
their body may be replaced molecule
 Cenozoic era is also Age of mammals for molecule by minerals and the original
 This era is subdivided into two periods namely substance being lost through disintegration.
Tertiary and Quaternary.  This type of fossilization is called petrifaction.
 Tertiary period is characterized by abundant
15. Define moulds, cast.
mammalian fauna.
 Moulds - after disintegration, the body of an
 Quaternary period characterized by decline animal might leave indelible impression
of mammals and beginning of human on the soft mud which later becomes
social life. hardened into stones.

118 SURYA
XII Std - Zoology ´ Unit II Chapter - 6 | Evolution
 Such impressions are called moulds. 22. Define molecular evolution.
 Cast - The cavities of the moulds may get  Molecular evolution is the process of
filled up by hard minerals and get change in the sequence composition of
fossilized, to form a casts. molecules such as DNA, RNA and proteins
16. What is Divergent evolution? across generations.
 It’s a type of evolution in which structurally 23. What is molecular clock?
similar organs are produced but they perform  A slight change that occurs over time in
different functions these conserved molecules (DNA, RNA and
 They also called homologous structures protein) are often called molecular clocks.
E.g. Thorn of Bougainvillea and the  Molecules that have been used to study
tendrils of Curcurbita and Pisumsativum evolution are cytochrome c (respiratory
represent homology. pathway) and rRNA (protein synthesis).
17. What are Analogous structure? 24. What is the findings of August Weismann?
 Organisms having different structural  August Weismann found out that change in
patterns but similar function are termed
the somatoplasm will not be transferred
as analogous structures.
to the next generation but changes in the
E.g. wings of birds and insects are different germplasm will be inherited.
structurally but perform the same function.
25. Classify struggle denoted by Darwin.
18. What are vestigial organs?
 Darwin denoted struggle for existence in three
 Organ which in not useful or not necessary ways –
for their existence are called vestigial
orgAns: 1. Intra specific struggle (between the same
species) for food, space and mate
 Vestigial organs may be considered as
leftovers of structures 2. Inter specific struggle (between different
 They were well developed and functional species) for food and space.
in the ancestors, but disappeared in course 3. Struggle with the environment to
of evolution due to their non- utilization. cope with the climatic variations, flood,
E.g. Human appendix,mammae in male. earthquakes, drought, etc.,
19. Define connecting link. Give an example. 26. What is mutation theory?
 The organisms which possess the characters  Hugo de Vries proposed Mutation theory.
of two different groups (transitional stage)  According to de Vries, sudden and large
are called connecting links. variations were responsible for the
E.g. Peripatus (connecting link between origin of new species
Annelida and Arthropoda), 27. What is Adaptive Radiation?
 Archeopteryx (connecting link between
 The evolutionary process which produces
Reptiles and Aves).
new species diverged from a single
20. What is Atavistic organs? ancestral form becomes adapted to newly
 Sudden appearance of vestigial organs in invaded habitats is called adaptive radiation.
highly evolved organisms is called atavistic E.g Darwin’s finches and Australian marsupials
orgAns:
28. Define gene flow.
E.g. presence of tail in a human baby is an
atavistic organ.  Movement of genes through gametes or
movement of individuals in (immigration
21. Define embryology, and out (emigration of a population is
 Embryology is a branch of science which deals referred to as gene flow.
about the study of the development of  Gene flow can be a strong agent of
individual from the egg to the adult stage. evolution.
SURYA 119
Chapter - 6 | Evolution XII Std - Zoology ´ Unit II
29. How do we compute the age of a fossil? b) Theory of spontaneous generation
• Age of a fossil is computed by using carbon  This theory based on Abiogenesis,
dating.
 It means living organisms originated from
• Relative presenceof 14C (radioactive carbon) non-living materials and occurred through
is calculated to compute the age of a fossil.
evolution over millions of years.
30. What is the most important pre-condition for  Thomas Huxley coined the term abiogenesis.
adaptive radiation?
• Common ancestry is the most important c) Big bang theory
pre-condition for adaptive radiation.  According theory origin of universe as a
singular huge explosion in physical terms.
31. What is founder effect?
• When a new species evolves by a small  Initially earthconsist of ammonia, methane,
number of individuals from a larger hydrogen and water vapour.
population; the loss of genetic variation in the  UV rays from the sun split up water
new species is called the founder effect or molecules into hydrogen and oxygen.
founder principle
 Whentemperature cooled and thewater
32. Are the wing of a bird and the forelimb of a vapour condensed to form rain.
horse homologous or analogous?
 Ammonia and methane in the atmosphere
 Wing of bird and the forelimb of horse are
combined with oxygen to form carbon-
homologous organs
dioxide and other gases.
 Because both have same fundamental
structures but have different functions 2. Write short notes on vestigial organ.
 i.e., for flying in bird and in horse for  Organ which in not useful or not necessary
running. for their existence are called vestigial
orgAns:
33. Convergent evolution leads to analogous
structures. Give an example.  Vestigial organs may be considered as
• Convergent evolution is development of leftovers of structures
similar functional structure in different  They were well developed and functional
organisms. in the ancestors, but disappeared in course
• This will resulting in analogous organs in of evolution due to their non- utilization.
unrelated organisms, which have similar  Vestigial organs may be considered as leftover
functions but different developmental patterns. structures which were well developed
• E.g., the wings of bee, bird and bat. and functional in the ancestors, but
disappeared in course of evolution due to
PART-C their non- utilization.
 E.g. Human appendix is the remnant of
caecum which is functional in the digestive
ADDITIONAL QUESTIONS (3 MARKS) tract of herbivorous animals like rabbit.
1. Explain any two theory which explain  Cellulose digestion takes place in the
evolution of organism. caecum of these animals.
a) Theory of special creation  Due to change in the diet containing less
 It states that life was created by “God”. cellulose, caecum in human became
functionless and is reduced to a vermiform
 According to Hinduis - Lord Brahma created appendix, which is vestigial.
the Earth.
 Other vestigial organs - coccyx, wisdom
 Christianity, Islam and most religions believe teeth, ear muscles, body hair, mammae in
that God created the universe, the plants male, nictitating membrane of the eye, etc.,
and the animals.

120 SURYA
XII Std - Zoology ´ Unit II Chapter - 6 | Evolution
3. List out the features of mutation theory. 5. Write short notes on Urey and miller
 According to de Vries, sudden and large experiments.
variations were responsible for the Urey and Miller’s experiment :
origin of new species whereas Lamarck and  They paved way for understanding the
Darwin believed in gradual accumulation possible synthesis of organic compounds
of all variations that led to the appearance of living organisms.
 According to Hugo de Vries, mutations are  In their experiment, a mixture of gases
sudden and heritable variations which was allowed to circulate over electric
causes evolution, hence called it saltation discharge from an tungsten electrode.
(single step large mutations).
 A small flask was kept boiling and the steam
 While Darwin’s theory of natural selection states emanating from it was made to mix with
that speciation is due to accumulation the mixture of gases (ammonia, methane
of small, directional, and heritable and hydrogen) in the large chamber that
variations, and is a gradual process. was connected to the boiling water.
Salient features of Mutation Theory  The steam condensed to form water
1. Mutations or discontinuous variation are which ran down the ‘U’ tube.
transmitted to other generations.  Experiment was conducted continuously for a
2. In naturally breeding populations, mutations week and the liquid was analysed.
occur from time to time.  Glycine, alanine, beta alanine and
3. There are no intermediate forms, as they aspartic acid were identified.
are fully fledged.  Thus Miller’s experiments had an understanding
4. They are strictly subjected to natural as to the possibility of abiogenetic synthesis
selection. of large amount of variety of organic
compounds in nature from a mixture of
4. List the two main propositions of Oparin and
sample gases in which the only source of
Haldane.
carbon was methane.
 Oparin proposed that the organic
compounds could have undergone a 6. Identify the following pairs as homologous
series of reactions leading to more complex and analogous organs:
molecules. a. Sweet potato and potato
 He proposed that the molecules formed b. Eye of octopus and eye of mammals
colloidal aggregates or ‘coacervates’ in c. Thorns of Bougainvillea and tendrils of
an aqueous environment. The coacervates Cucurbita.
were able to absorb and assimilate organic
compounds from the environment. d. Forelimbs of bat and whale.

 “Haldane” proposed that the primordial e. Flippers of Penguins and Dolphins.

sea served as a vast chemical laboratory Answer :
powered by solar energy. Homologous organs :
 The atmosphere was oxygen free and the 1. Thorns of Bougainvillea and tendrils of
combination of CO2, NH3 and UV radiations Cucurbita,
gave rise to organic compounds.
2. Forelimbs of bat and whale.
 The sea became a ‘hot’ dilute soup containing
large populations of organic monomers Analogous organs:
and polymers. 1. Sweet potato and potato
 They imagined that groups of monomers 2. Eye of Octopus and eye of mammals.
and polymers acquired lipid membranes and 3. Flippers of Penguins and Dolphins.
further developed into the first living cell.

SURYA 121
 www.nammakalvi.org
Chapter - 6 | Evolution XII Std - Zoology ´ Unit II
7. Explain Darwinian theory of evolution and (including beneficial ones) and fixation of
add the factor responsible for it other alleles.
 Charles Darwin explained the theory of  Genetic drift can have major effects, when
evolution in his book ‘The Origin of Species the population is reduced in size by
by Natural Selection’. natural disaster due to bottle neck effect or
 During his journey around the Earth, he made when a small group of population splits from
extensive observations of plants and animals. the main population to form a new colony due
to founder’s effect.
 He noted a huge variety and remarkable
similarities among organisms and their 10. Name the ancestors of a man based on the
adaptive features to cope up to their features given below :
environment. a. Human like, meat-eater with 900 cc brain,
 He proved that fittest organisms can lived around 1.7 mya
survive and leave more progenies than b. More human with brain size 1400 cc, lived in
the unfit ones through natural selection. neander valley, used hides and buried their
8. How does Darwin’s theory of natural selection dead.
explain the appearance of new forms of life c. Human like, vegetarian, bipedal locomotion
on earth? with brain capacity between 650 cc and 800
• The theory of natural selection is based on the cc.
following factors : d. Man like primate, that existed about 14 mya.
1. Over production (or prodigality of Answer :
production
a Homo erectus,
2. Struggle for existence
b Homo sapines neanderthalensis,
3. Universal occurrence of variations
c Homo habilis,
4. Origin of species by Natural Selection
d Ramapithecus
9. Explain the term gene flow and genetic drift?
11. Mention any three characteristics of
a) Gene flow Neanderthal man that lived in near East and
 Movement of genes through gametes or Central Asia.
movement of individuals in (immigration) and • Characteristics of Neanderthal man:
out (emigration) a) Their brain size of 1400 cc
of a population is referred to as gene flow. b) They lived between 34,000 - 1,00,000
 Organisms and gametes that enter the years ago.
population may have new alleles or may c) They used animal hides to protect their
bring in existing alleles but in different bodies, knew the use of fire and buried
proportions than those already in the their dead.
population.
d) They did not practice agriculture and
 Gene flow can be a strong agent of evolution. animal domestication.
b) Genetic drift / Sewall Wright Effect
12. State and explain any three factors affecting
 Genetic drift is a mechanism of evolution in allele frequency in populations.
which allele frequencies of a population
• Following are the three out of five factors
change over generation due to chance
which affect allele frequency in populations:
(sampling error).
a) Genetic Drift:
 Genetic drift occurs in all population sizes,
but its effects are strong in a small population.  Genetic drift is a mechanism of evolution in
which allele frequencies of a population
 It may result in a loss of some alleles

122 SURYA
XII Std - Zoology ´ Unit II Chapter - 6 | Evolution
change over generation due to chance
(sampling error). PART-D
 Genetic drift occurs in all population sizes,
but its effects are strong in a small population. ADDITIONAL QUESTIONS (5 MARKS)
 It may result in a loss of some alleles
1. Explain the process of biological evolution.
(including beneficial ones) and fixation of
other alleles.  Abiotically produced molecules can
spontaneously self assemble into
b) Genetic Recombination:
droplets that enclose a watery solution and
 Production of offspring with traits which maintain a chemical environment.
differ from parents is called genetic
 Scientists call these spheres as ‘protobionts’.
recombination.
 Some of the proteins inside the liposomes
c) Natural Selection:
acquired the properties of enzymes
 It occurs when one allele (or combination resulting in fast multiplication of molecules.
of alleles of differences makes an
 Subsequently number of genes united to
organism more or less fit to survive and
form ‘proto viruses’ somewhat similar to
reproduce in a given environment.
present day viruses.
 E.g. one gene’s allele frequencies might be
Cell type 1 :
modified by both gene flow and genetic
drift, for another gene, mutation may produce  One form of the earliest cell contained clumps
a new allele, that is favoured by natural of nucleoproteins embedded in the cell
selection. substance.

13. Write the significance of Paleozoic era  Such cells were similar to the Monera.

 The Paleozoic era is characterized by abundance  They are considered as ancestral to the
of fossils of marine invertebrates. modern bacteria and blue green algae.

 Towards the later half, other vertebrates Cell type 2 :

(marine and terrestrial) except birds and  The other form of earliest cells contained
mammals appeared. nucleoprotein clumps that condensed
Paleozoic era are into a central mass surrounded by a thin
membrane.
1. Cambrian - Age of invertebrates),
 This membrane separated nucleoproteins
2. Ordovician - fresh water fishes, Ostracoderms, from the cell substances.
various types of Molluscs
 Such cells were referred to as Protista.
3. Silurian - origin of fishes
 These may be summarized as parasitism,
4. Devonian - Age of fishes, many types of saprophytism, predator or animalism
fishes such as lung fishes, lobe finned fishes and chemosynthesis or photosynthesis.
and ray finned fishes
 When the number of photosynthetic organisms
5. Mississippian - earliest amphibians, increased it result in increase in the free O2
Echinoderms
CH4+2O2 à CO2 +2H2O
6. Pennsylvanian - earliest reptiles
4NH3+3O2 à 2N2+6H2O
7. Permian - mammal like reptiles.
 The atmospheric oxygen combined with
methane and ammonia to form CO2 and free
nitrogen.
 The presence of the free O2 brought about
the evolution of aerobic respiration
which could yield large amounts of energy by
oxidation of food stuffs.
SURYA 123
Chapter - 6 | Evolution XII Std - Zoology ´ Unit II
 Thus Prokaryotes and Eukaryotes E.g. Neck in giraffe (use theory) absence of
evolved. limbs in snakes (disuse theory)
2. List out and explain the basic factor involved 2) The theory of inheritance of acquired
in the process of organic evolution. characters
 Sewell Wright, Fisher, Mayer, Huxley,  Characters that are developed during the
Dobzhansky, Simpson and Haeckel life time of an organism are called acquired
explained Natural Selection in the light of characters and these are then inherited.
Post-Darwinian discoveries. The main objection to Lamarckism
1. Gene mutation  August Weismann disproved Lamarck’s
“Theory of Acquired characters”
 It refers to the changes in the structure of
the gene.  He conducted experiments on mice for
twenty generations by cutting their tails
 It is also called gene/ point mutation. and breeding them.
 It alters the phenotype of an organism and  All mice born were with tail.
produces variations in their offspring.
 Weismann proved that change in the
2. Chromosomal mutation somatoplasm will not be transferred
 It refers to the changes in the structure of to the next generation but changes in the
chromosomes due to deletion, addition, germplasm will be inherited.
duplication, inversion or translocation. Neo-Lamarckism
 This too alters the phenotype of an organism  The followers of Lamarck like Cope, Osborn,
and produces variations in their offspring. Packard and Spencer tried to explain Lamarck’s
theory on a more scientific basis are known as
3. Genetic recombination
Neo- Lamarckists
 It is due to crossing over of genes during
 They considered that adaptations are
meiosis.
universal.
 This brings about genetic variations in the  Organisms acquire new structures due
individuals of the same species and leads to to their adaptations to the changed
heritable variations. environmental conditions.
4. Natural selection
4. Write short notes on Darwin’s theory.
 It does not produce any genetic variations
 Charles Darwin explained the theory of
but once such variations occur it favours evolution in his book ‘The Origin of Species
some genetic changes while rejecting by Natural Selection’.
others (driving force of evolution).
 Darwin’s theory was based on several facts,
5. Reproductive isolation observations and influences. They are:
 It helps in preventing interbreeding 1. Over production (or prodigality of
between related organisms. production
3. Explain Lamarck’s theory of evolution.  All living organisms increase their
population in larger number.
 Jean Baptiste de Lamarck, postulate
the theory of evolution in his famous book  E.g. Salmon fish produces about 28 million
‘Philosophie Zoologique’ eggs during breeding season and if all
of them hatch, the seas would be filled with
 The two principles of Lamarckian theory are: salmon in few generations.
1) The theory of use and disuse  Elephant, can produce six young ones in
 Organs that are used often will increase its life time can produce
in size and those that are not used will 2. Struggle for existence
degenerate.
 Organisms struggle for food, space and
mate.

124 SURYA
XII Std - Zoology ´ Unit II Chapter - 6 | Evolution
 Darwin denoted struggle for existence in three  Their modified concepts collectively called as
ways – Neo Darwinism
 Intra specific struggle (between the same  This theory emphasizes the change in the
species) for food, space and mate frequency of genes in population arises due
 Inter specific struggle (between different to mutation, variation, isolation and
species) for food and space. Natural selection.
 Struggle with the environment to 6. Write short notes on Human evolution.
cope with the climatic variations, flood, Origin and Evolution of Man
earthquakes, drought, etc.,
 Hominid evolution occurred in Asia and
3. Universal occurrence of variations Africa.
 No two individuals are alike.  Hominids proved that human beings are
 There are variations even in identical superior to other animals and efficient in
twins. making tools and culture.
 Variations found in an organism help them  Prehistoric man like Ramapithecus and
to overcome struggle and such variations Sivapithecus lived some 14 mya and were
are passed on to the next generation. derived from ape like Dryopithecus.
Origin of species by Natural Selection  Dryopithecus and Ramapithecus were hairy
 According to Darwin, nature is the most and walked like gorillas and chimpanzees.
powerful selective force. Australopithecus
 He compared origin of species by natural  They are lived in East African grasslands
selection to a small isolated group. about 5 mya and also known as Australian
 Darwin believed that the struggle for ape man.
existence resulted in the survival of the  Height - 1.5 meters, bipedal locomotion,
fittest. omnivorous, semi erect.
5. List out the objections to Darwinism and add  They are lived in caves.
notes on Neo Darwinism  Low forehead, brow ridges over the eyes,
objections against Darwinism are protruding face, low brain capacity - 350
– 450 cc.
1. Darwin failed to explain the mechanism of
variation.  Human like dentition, lumbar curve in the
vertebral column were his distinguishing
2. Darwinism explains the survival of the fittest features.
but not the arrival of the fittest.
Homo habilis
3. He focused on small changing variations
that are mostly non-heritable.  They lived about 2 mya.
4. He did not distinguish between somatic  Their brain capacity : 650 – 800cc,
and germinal variations.  They are vegetarian.
5. He could not explain the occurrence of  They had bipedal locomotion and used
vestigial organs, over specialization of tools made of chipped stones.
some organs
Homo erectus
Eg. large tusks in mammoths, oversized antlers in
 They were the first human like being was
Irish deer, etc.,
around 1.7 mya
Neo Darwinism
 They were closer to human in looks, skull
 New facts and discoveries about evolution was flatter and thicker than the modern
have led to modifications of Darwinism man
and is supported by Wallace, Heinrich,
 Brain capacity - 900 cc.
Haeckel, Weismann and Mendel.
 They were meat eaters.
 Homo ergaster and Homo erectus were the
SURYA 125
 www.nammakalvi.org
Chapter - 6 | Evolution XII Std - Zoology ´ Unit II
first to leave Africa.  They started cultivating crops and
 Their brain size of 1400 cc domesticating animals.
 They lived between 34,000 - 1,00,000 7. What are the assumption of Hardy Weinberg
years ago. 1. No mutation
 They used animal hides to protect their No new alleles are generated by mutation
bodies, knew the use of fire and buried nor the genes get duplicated or deleted.
their dead.
2. Random mating
 They did not practice agriculture and
animal domestication. Every organism gets a chance to mate and the
mating is random with each other with no
Cro-Magnon preferences for a particular genotype.
 They are considered as the ancestor of 3. No gene flow
modern EuropeAns:
Neither individuals nor their gametes enter
 They were not only adapted to various (immigration or exit (emigration) the
environmental conditions, but were also population.
known for their cave paintings, figures on
floors and walls. 4. Very large population size

Homo sapiens or modern human The population should be infinite in size.

 They arose in Africa some 25,000 years 5. No natural selection

ago All alleles are fit to survive and reproduce.
 They moved to other continents and If any one of these assumptions were not
developed into distinct races. met, the population will not be in Hardy-
 They had a brain capacity of 1300 – 1600 Weinberg equilibrium.
cc.
8. Provide a comparison table for Mesozoic era and Cenozoic era its important events

YEARS IN
ERA

PERIOD EPOCH FAUNA FLORA

MILLION

Recent Angiosperms
1 Age of Mammals
(Holocene) Monocotyledons
Quaternary
6 Pleistocene Age of Human beings
Cenozoic

15 Pliocene Human evolution

10 Miocene
Age of
20 Oligocene Angiosperms - Dicotyledons
Tertiary
Eocene Mammals and birds
100
Paleocene
Sphenopsides,
Ginkgos, Gnetales,
125 Cretaceous
Mesozoic

(Dicotyledons)
(Golden age of Reptiles) Herbaceous
Rise of Dinosaurs lycopods, Ferns,
150 Jurassic
Conifers, Cycads
180 Triassic

126 SURYA
XII Std - Zoology ´ Unit II Chapter - 6 | Evolution
9. Compare Precambrian era and Paleozoic era its important events

YEARS IN
ERA

PERIOD EPOCH FAUNA FLORA

MILLION
Arborescent
205 Permian Mammal like reptiles
lycopods
Earliest Amphibians and Seed ferns and
230 Pennsylvanian
abundant Echinoderms Bryophytes
Carboniferous
Paleozoic

255 Mississippian Earliest reptiles

315 Devonian Age of fishes Progymnosperms
Earliest fishes and land
350 Silurian Zosterophyllum
invertebrates
Dominance of Appearance of
430 Ordovician
invertebrates first land plants
510 Cambrian Fossil invertebrates Origin of algae
Upper Multicellular organisms
Precambrian

Appearance of
Middle
3000 eukaryotes
Planktons
Lower
prokaryotes

www.nammakalvi.org SURYA 127