LESSON 1: GENETICS Pyrimidines are Cytosine (C), Thymine (T, in DNA only) and Uracil

(U, found only in RNA)

1.1 PEDIGREE ANALYSIS 5. Specific base pairings occur in DNA. A pairs with T; G pairs with
C
GENETICS is a branch of Biology concerned with the study of 6. DNA is double stranded while RNA is single stranded with Uracil
genes, genetic variation, and heredity in an organism. instead of Thymine.
GREGOR JOHANN MENDEL (1822-1884) 7. Main Functions:
 Known as the Father of Genetics DNA: repository of genetic information; sequence of bases
 Formulated Mendel’s Law of Inheritance by carrying encodes the blueprint for life processes
out experiment with garden peas. RNA: information in the form of base sequence is
Mendel studies seven characteristics in the garden peas transformed (transcribed) into mRNA, tRNA and rRNA.
1. Flower color (Purple or White) DNA is the template copied into RNA by base pairing. G
2. Flower position (Axial or Terminal) with C; A with U.
3. Seed color (Yellow or Green) Protein: functional products of genes; executes cellular
4. Seed Shape (Round or Wrinkled) functions
5. Pod Shape (Inflated or Constricted) Sample pairing:
6. Pod Color (Green or Yellow) 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
7. Stem length (Tall or Dwarf) 3’ TACGTATCTAATCCTATAGGGTCTATC 5’
YY – Homozygous Dominant
yy – Homozygous Recessive
1.5 RECOMBINANT DNA
Yy – Heterozygous
MENDEL’S LAW OF INHERITANCE
The central dogma of molecular biology is an explanation of
1. Law of Segregation
the flow of genetic information within a biological system. It is
Allele from each gene segregate from each other so
often stated as "DNA makes RNA and RNA makes protein
that each gamete carries one per gene
DNA (gene) RNA (transcript) Protein (trait)
2. Law of Independent Assortment
Gene for different features segregate independently  Different organisms have different traits based on their
and do not impact each other. genes (DNA sequences).
3. Law of Dominance For example, frogs have antimicrobial peptides on their
Dominant alleles mask/cover the recessive alleles skin. Some jellyfish have proteins that allow them to glow
PUNNETT SQUARE is a square diagram that is used to in the dark. Mutations in hemoglobin genes lead to anemia.
predict the genotypes of a particular cross or breeding  Based on the central dogma, if transcription and translation
experiment. of genes lead to some traits, then the insertion of certain
Genotype: Genetic make up genes in a given organism may provide it with new traits.
Phenotype: Physical appearance This is the basis for the development of genetically
PEDIGREE ANALYSIS is a diagram showing the ancestral modified organisms (GMOs).
relationships and transmission of genetic traits over several POLYMERASE CHAIN REACTION (PCR) is a method widely
generations in the family. used in molecular biology to make many copies of a
PROBAND is a person serving as the starting point for genetic specific DNA segment.
study of a family.
LESSON 2: EVOLUTION AND ORIGIN OF BIODIVERSITY
1.2 SEX LINKAGE AND RECOMBINATION
2.1 HISTORY OF LIFE ON EARTH
SEX-LINKED TRAITS- The gene(pair) that determines a The Geological Time Scale (GTS)
character is located on the sex chromosomes  FOUR ERAS - Precambrian; Paleozoic; Mesozoic;
X-LINKED TRAIT- The sex-linked trait is where the Cenozoic
gene or allele for the trait is found on the X  PERIODS UNDER THE PALEOZOIC ERA -
chromosome Cambrian, Ordovician, Silurian, Devonian, Carboniferous,
Y-LINKED TRAIT- A sex-linked trait where the gene Permian
or allele for the trait is found on the Y chromosome  PERIODS UNDER THE MESOZOIC ERA - Triassic,
Examples: Color blindness, Hemophilia, Fabry disease, Hunter Jurassic, Cretaceous
syndrome  PERIODS UNDER THE CENOZOIC ERA - Tertiary
SEX-INFLUENCE TRAIT is trait controlled by a pair of alleles and Quaternary
found on autosomal chromosomes but its phenotypic CAMBRIAN EXPLOSION is the belief that there was a sudden,
expression is influenced by the presence of certain hormones apparent explosion of diversity in life forms about 545 million years
(estrogen, progesterone, testosterone) ago.
Examples: Baldness, rheumatoid arthritis
SEX-LIMITED TRAITS is a trait in a diploid organism whose FOSSIL is any preserved remains, impression, or trace of any
expression is limited to just one biological sex. once-living thing from a past geological age.
Example: Functional mammary gland Examples include bones, shells,  exoskeletons, stone imprints
of animals or microbes, objects preserved in amber,
1.3 MODIFICATION TO MENDEL’S CLASSIC RATIO hair,  petrified wood, oil, coal, and DNA  remnants. 

CO-DOMINANCE: When two contrasting alleles are present in the THE SIX WAYS OF FOSSILIZATION
same locus or trait (heterozygote genotype), then the phenotype 1. Unaltered preservation - Small organism or part trapped in
expressed is a “blend” of the two extreme phenotypes. The two genes amber, hardened plant sap
interact and the offspring shows the effects of both alleles. 2. Permineralization/ Petrification - The organic contents of bone
INCOMPLETE DOMINANCE - When two contrasting alleles are and wood are replaced with
present in the same locus or trait (heterozygote genotype), then both silica, calcite or pyrite, forming a rock-like fossil
alleles are expressed in the same phenotype 3. Replacement - hard parts are dissolved and replaced by other
MULTIPLE ALLELES - When there are more than two types of minerals, like calcite, silica,
alleles for a given locus or trait, this will result in more than two pyrite, or iron
kinds of phenotypes that may be expressed for that trait. 4. Carbonization or Coalification - The other elements are removed
and only the carbon
1.4 CENTRAL DOGMA OF MOLECULAR BIOLOGY remained
5. Recrystalization - Hard parts are converted to more stable
1. The building blocks of any nucleic acid are the nucleotides. minerals or small crystals turn into
2. A nucleotide is composed of a phosphate group (with negative larger crystals
charges), a sugar portion and an N-base. 6. Authigenic preservation - Molds and casts are formed after most
3. The sugar in DNA is deoxyribose while the sugar in RNA is of the organism have been
ribose. destroyed or dissolved
4. DNA and RNA are polynucleotides. N-bases are either purines or
pyrimidines. Purine bases are Adenine (A) and Guanine (G).
METHODS USED TO CREATE FOSSILS HOMOLOGOUS STRUCTURES are structures with the
A. Imprint same set of bones that presumably evolved from a common
B. B. 3-D Object (Cast) ancestor.
ANALOGOUS STRUCTURES are structures that perform
2.2 MECHANISMS THAT PRODUCE CHANGE IN the same function but have very different embryological
POPULATIONS development or set of structures like bones.
VESTIGIAL STRUCTURES are structures or attributes that
HARDY-WEINBERG PRINCIPLE states that allele and have lost most of its ancestral function in more recent
genotype frequencies in a population will remain constant from species.
generation to generation in the absence of other evolutionary  Evidence from embryology
influences.  Evidence from molecular biology
 Evidence from Biogeography
GENETIC MECHANISMS
A. MUTATION is the permanent alteration of LESSON 3: SYSTEMATICS BASED ON EVOLUTIONARY
the nucleotide sequence of the genome of RELATONSHIPS
an organism, virus, or extrachromosomal DNA or Lines of evidence to infer evolutionary relationships:
other genetic elements. 1. Fossil evidence
B. SELECTION is the process by which certain traits 2. Homologies- Similar characters due to relatedness are known as
become more prevalent in a species than other traits. homologies. Homologies can be revealed by comparing the
C. GENE FLOW OR MIGRATION is the transfer of anatomies of different living things, looking at cellular similarities
genetic variation from one population to another. and differences, studying embryological development, and studying
D. GENETIC DRIFT is the change in the frequency of an vestigial structures within individual
existing gene variant (allele) in a population due to organisms.
random sampling of organisms. 3. Biogeography- the geographic distribution of species in time and
space as influenced by many
2.3 EVOLUTION AND ORIGIN OF BIODIVERSITY factors, including Continental Drift and log distance dispersal.
4. Molecular clocks help track evolutionary time- The base sequences
SPECIES are groups of interbreeding natural populations that are of some regions of DNA
reproductively isolated from other such groups. change at a rate consistent enough to allow dating of episodes in past
evolution.
REPRODUCTIVE ISOLATING MECHANISMS

A. Pre-zygotic isolation mechanisms prevent fertilization and zygote

formation.
 geographic or ecological or habitat isolation – potential
mates occupy different areas or habitats thus, they never
come in contact
 temporal or seasonal isolation – different groups may not
be reproductively mature at the same season, or month or
year
 behavioral isolation – patterns of courtship are different
 mechanical isolation – differences in reproductive organs
prevent successful interbreeding
 gametic isolation – incompatibilities between egg and
sperm prevent fertilization

B. Post-zygotic isolation mechanisms allow fertilization but

nonviable or weak or sterile hybrids TAXONOMY is the science of defining and naming groups of
are formed. biological organisms on the basis of shared characteristics.
 hybrid inviability – fertilized egg fails to develop past the CARL LINNAEUS  considered as Father of Taxonomy and
early embryonic stages formalized binomial nomenclature
 hybrid sterility – hybrids are sterile because gonads BINOMIAL NOMENCLATURE is a formal system of
develop abnormally or there is abnormal segregation of naming species of living things by giving each a name
chromosomes during meiosis composed of two parts, both of which use Latin grammatical
 hybrid breakdown - F1 hybrids are normal, vigorous and forms, although they can be based on words from other
viable, but F2 contains many weak or sterile individuals languages.

2.4 DEVELOPMENT OF EVOLUTIONARY THOUGHT Hierarchy of Biological Classification

Carolus Linnaeus – order in the diversity of life; hierarchy of

taxonomic categories
Thomas Malthus – ‘Essay on the Principle of Population’
Georges Cuvier – fossils, paleontology and the theory of
Catastrophism
James Hutton – theory of Gradualism
Charles Lyell – principles of geology
Jean-Baptiste Lamarck- proponent of theory of evolutionary
change
 Principle of use and disuse
 Inheritance of acquired characteristics
Charles Darwin published his theory of evolution with
compelling evidence in his 1859 book On the Origin of Species

A DICHOTOMOUS KEY is a tool that helps identify unknown

2.5 EVIDENCES OF EVOLUTION
organisms to some taxonomic level (e.g., species, genus, family, etc.).
The key is constructed in such a way that a series of choices is made
EVIDENCES OF EVOLUTION
that leads the user to the correct identity of a sample organism.
 Evidence from Fossils "Dichotomous" means, "divided into two
 Evidence from Structures
parts." Therefore, a dichotomous key always offer two choices for
each step, each of which describes key characteristics of a particular
organism or group of organisms.

CLADISTICS studies relationships between taxa using shared

derived characters. The basic assumption behind cladistics is that
members of a group share a common recent ancestor and are thus
more "closely related" to one another than they are to other groups of
organisms. Related groups of organisms are recognized because they
share a set of derived characters. These derived characters were
inherited from a recent ancestor.

A cladogram is a diagram used in cladistics to show relations

among organisms.
A phylogeny (or a tree of life) is a theory about how organisms
are related to one another through evolutionary time