Primer-BLAST Result
Primer-BLAST Result
NCBI Home
Sign in to NCBI
Skip to Main Content
Skip to Navigation
About NCBI Accesskeys
My NCBI
Sign in to NCBI
Register
Sign Out
https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 1/12
9/27/2020 Primer-Blast results
>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome
https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 2/12
9/27/2020 Primer-Blast results
Primer pair 2
Template Self Self 3'
Sequence (5'->3')
Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer GTCCTTCCCTCAGTCAGCAC Plus 20 3172 3191 60.04 60.00 3.00 1.00
Reverse primer GACTCCTTTGAGCACTGGCT Minus 20 3826 3807 59.96 55.00 3.00 3.00
Internal oligo Plus
Product length 655
Product Tm
Product Tm -
min(OLIGO Tm)
Exon junction
Total intron size
Products on intended targets
>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome
https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 3/12
9/27/2020 Primer-Blast results
Primer pair 3
Template Self Self 3'
Sequence (5'->3')
Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer CTGCACTGTTAGCGGGTACA Plus 20 2646 2665 60.04 55.00 4.00 3.00
Reverse primer ACACCATGAGGTGCTGACTG Minus 20 3201 3182 59.96 55.00 5.00 1.00
Internal oligo Plus
Product length 556
Product Tm
Product Tm -
min(OLIGO Tm)
Exon junction
Total intron size
Products on intended targets
>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome
https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 4/12
9/27/2020 Primer-Blast results
Primer pair 4
Template Self Self 3'
Sequence (5'->3') Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer CGGCCTTACTGTTTTGCCAC Plus 20 2590 2609 60.04 55.00 4.00 1.00
Reverse primer GTGCTGACTGAGGGAAGGAC Minus 20 3191 3172 60.04 60.00 3.00 1.00
Internal oligo Plus
Product length 602
Product Tm
Product Tm -
min(OLIGO Tm)
Exon junction
Total intron size
Products on intended targets
>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome
https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 5/12
9/27/2020 Primer-Blast results
Primer pair 5
Template Self Self 3'
Sequence (5'->3')
Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer GATGCTGTCCGTGATCCACA Plus 20 1742 1761 60.11 55.00 4.00 2.00
Reverse primer CCCGCCGAGGAGAATTAGTC Minus 20 2072 2053 59.97 60.00 4.00 3.00
Internal oligo Plus
Product length 331
Product Tm
Product Tm -
min(OLIGO Tm)
Exon junction
Total intron size
Products on intended targets
>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome
Primer pair 6
Template Self Self 3'
Sequence (5'->3') Length Start Stop Tm GC%
strand complementarity complementarity
https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 6/12
9/27/2020 Primer-Blast results
Forward primer TTGCCACCTTTGCTCACAGA Plus 20 2603 2622 60.11 50.00 4.00 2.00
Reverse primer CATGAGGTGCTGACTGAGGG Minus 20 3197 3178 60.11 60.00 4.00 0.00
Internal oligo Plus
Product length 595
Product Tm
Product Tm -
min(OLIGO Tm)
Exon junction
Total intron size
Products on intended targets
>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome
Primer pair 7
Template Self Self 3'
Sequence (5'->3') Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer CTGATGCTGTCCGTGATCCA Plus 20 1740 1759 59.82 55.00 4.00 2.00
Reverse primer GTGGCAAAACAGTAAGGCCG Minus 20 2609 2590 60.04 55.00 4.00 2.00
Internal oligo Plus
https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 7/12
9/27/2020 Primer-Blast results
>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome
Primer pair 8
Template Self Self 3'
Sequence (5'->3')
Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer CAAATCGCTCCAGGGCAAAC Plus 20 1247 1266 60.11 55.00 3.00 0.00
Reverse primer CTGTGGATCACGGACAGCAT Minus 20 1762 1743 60.11 55.00 4.00 2.00
Internal oligo Plus
Product length 516
Product Tm
Product Tm -
https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 8/12
9/27/2020 Primer-Blast results
min(OLIGO Tm)
Exon junction
Total intron size
Products on intended targets
>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome
Primer pair 9
Template Self Self 3'
Sequence (5'->3')
Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer CCTCAGTCAGCACCTCATGG Plus 20 3179 3198 60.11 60.00 4.00 2.00
Reverse primer ATGGCAGGAGCAGTTGTGAA Minus 20 3264 3245 59.89 50.00 3.00 1.00
Internal oligo Plus
Product length 86
Product Tm
Product Tm -
min(OLIGO Tm)
Exon junction
Total intron size
https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 9/12
9/27/2020 Primer-Blast results
>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome
product length = 86
Forward primer 1 CCTCAGTCAGCACCTCATGG 20
Template 24719 .................... 24738
Primer pair 10
Template Self Self 3'
Sequence (5'->3') Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer TTCAGGTTGGACAGCTGGTG Plus 20 787 806 60.18 55.00 6.00 3.00
Reverse primer CAGATGCAAATCTGGTGGCG Minus 20 1070 1051 59.90 55.00 6.00 2.00
Internal oligo Plus
Product length 284
Product Tm
Product Tm -
min(OLIGO Tm)
Exon junction
Total intron size
Products on intended targets
>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome
https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 10/12
9/27/2020 Primer-Blast results
If you want to allow any of the unintended targets, check the box(es) next to the ones you accept and try again to re-search for
specific primers Submit
[?]
BLAST is a registered trademark of the National Library of Medicine
USA.gov
https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 11/12
9/27/2020 Primer-Blast results
NCBI
National Center for Biotechnology Information, U.S. National Library of Medicine 8600 Rockville Pike, Bethesda MD, 20894 USA
Policies and Guidelines | Contact
https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 12/12