Modulators of Thermogenesis
Modulators of Thermogenesis
thermogenesis
Glucocorticoids, diet and novel research models
Ineke H. N. Luijten
Abstract
The activation and recruitment of brown adipose tissue (BAT) thermogenesis has been put forward as a promising strategy
to reduce the disease burden of obesity and obesity-related diseases. Heat production by BAT can be attributed to the tissue-
specific mitochondrial uncoupling protein 1 (UCP1). Upon activation, UCP1 uncouples substrate oxidation from ATP
production, thereby dissipating energy solely as heat and thus facilitating the ‘wasting’ of energy. To date, cold exposure is
the strongest known BAT activator. However, to harness the energy wasting potential of BAT as a weight-reducing agent,
the search for alternative factors that alter the activation or recruitment state of BAT is ongoing. The goal of this thesis is
to obtain a better understanding of compounds and processes that modulate UCP1-dependent thermogenesis.
We investigate glucocorticoids for their potential to alter the UCP1-dependent thermogenic capacity of mice. We provide
the novel insight that glucocorticoid supplementation reduces total BAT UCP1 protein levels, but only in mice housed at
thermoneutrality. This reduction occurs at the transcriptional level by direct binding of the liganded glucocorticoid receptor
to Ucp1regulatory regions. We also demonstrate that the glucocorticoid-induced reduction in BAT thermogenesis does not
contribute to the development of glucocorticoid-induced obesity.
Further, we show that high-fat diet- and cafeteria diet-feeding induces the activation and recruitment of BAT UCP1
protein in the obesity-resistant 129S mouse strain. We demonstrate the importance of this diet-induced modulation of BAT
thermogenic capacity by reporting an increased metabolic efficiency in UCP1-ablated mice compared to wild-type mice.
We finally present two novel models that can be used for the identification of novel modulators of BAT thermogenesis,
namely a brown adipocyte clonal cell line derived from adult human BAT, and a UCP1-luciferase reporter mouse which
facilitates real-time tracking of endogenous Ucp1expression. Using these models, we identify the genes Mtus1and Kcnk3,
and the compound WWL113, as novel modulators of UCP1-dependent thermogenesis.
Keywords: brown adipose tissue: UCP1: glucocorticoids: diet-induced thermogenesis: obesity: physiology.
Stockholm 2019
http://urn.kb.se/resolve?urn=urn:nbn:se:su:diva-163376
ISBN 978-91-7797-580-9
ISBN 978-91-7797-581-6
Ineke H. N. Luijten
©Ineke H. N. Luijten, Stockholm University 2019
Cover image by Ineke Luijten. Microscopy images of Phoenix cells transfected with a MSCV-GFP vector,
differentiated WT1 cells stained with Oil Red O, and brown adipose tissues isolated from wild-type or DAdKO
mice stained with hematoxylin & eosin.
3
3.8.1 Extrapolating rodent data to humans 71
3.8.2 Human studies 71
Sammanfattning på svenska 77
Nederlandse samenvatting 79
Acknowledgements 81
References 85
4
ABBREVIATIONS
(gene name)-KO (gene name) - knock-out
18
FDG-PET 18F-fluoro-2-deoxy-D-glucose positron emission tomography
ACTH Adrenocorticotropic hormone
ATF-2 Activating transcription factor-2
ATP Adenosine triphosphate
ATGL Adipose triglyceride lipase
(𝛽3)AR (beta-3) Adrenergic receptor
(I)BAT (Interscapular) Brown adipose tissue
BMI Body-mass index
BMP Bone morphogenetic protein
BSA Bovine serum albumin
C/EBP CCAAT-enhancer-binding protein
cAMP Cyclic adenosine monophosphate
CREB cAMP-response element binding-protein
CRH Corticotropin-releasing hormone
DEX Dexamethasone
DNP 2,4-Dinitrophenol
FFA Free fatty acid
FGF Fibroblast growth factor
GDP Guanosine diphosphate
GR Glucocorticoid receptor
GRE Glucocorticoid response element
HPA-axis Hypothalamus-pituitary-adrenal-axis
HSD1/2 11β-hydroxysteroid dehydrogenase 1 and 2
HSL Hormone-sensitive lipase
MR Mineralocorticoid receptor
NE Norepinephrine
OCR Oxygen consumption rate
P38 MAPK p38 Mitogen-activated protein kinase
PGC-1α PPARγ coactivator-1α
PKA Protein kinase A
POMC Pro-opiomelanocortin
PPAR(γ) Peroxisome proliferator-activated receptor (γ)
UCP1 Uncoupling protein 1
(Ing)(Is)WAT (Inguinal)(Interscapular) White adipose tissue
5
6
INTRODUCTION TO UCP1-
DEPENDENT THERMOGENESIS
7
environmental temperatures. In humans and rodents, environmental temperature is
sensed by a group of temperature sensitive ion-channels of the TRP (transient receptor
potential channel) superfamily present on peripheral nerve endings (Zhang, 2015).
Temperature can be sensed through these receptors both at the skin and the spinal cord.
The signals from these receptors are integrated in distinct brain areas and ultimately
signal to the hypothalamus where a perceived cold environment will lead to excitation
of sympathetic nerves signaling to BAT (Morrison, 2016). In sympathetic peripheral
neurons, catecholamines (among which is norepinephrine, NE) are produced from L-
tyrosine, the rate-limiting step being catalyzed by tyrosine hydroxylase. BAT is richly
innervated by fibers of the sympathetic nervous system, and brown adipocytes express
α1 , α2 , β1 , β2 and β3 adrenergic receptors (AR’s), of which the β3 -adrenergic
receptor (β3AR) is the most significant for thermogenesis in rodents (Bartness et al.,
2010). Thus, when NE is released from sympathetic nerves upon cold exposure, it binds
to β3ARs on the surface of brown adipocytes and sets off an intracellular signaling
cascade (Cannon and Nedergaard, 2004)(overview in Fig. 1).
β3ARs belong to the G protein-coupled receptor class of membrane proteins,
which means that they undergo a conformational change upon ligand binding which
ultimately leads to dissociation of a G-protein subunit (in BAT of the Gαs subtype). The
Gs protein successively activates adenylyl cyclase, an enzyme that catalyzes the
conversion of ATP into cAMP and PPi, leading to an intracellular accumulation of
cAMP (Paper II). cAMP functions as a crucial second messenger in brown adipocytes.
Intracellular cAMP concentrations are determined by the rate of synthesis by adenylyl
cyclase on the one hand and the rate of degradation by phosphodiesterases on the other
hand (Coudray et al., 1999). cAMP activates protein kinase A (PKA) by binding to its
regulatory subunits, releasing and thus activating the catalytic subunits. PKA
phosphorylates a series of target proteins, among which are cAMP-response element
binding-protein (CREB), p38 mitogen-activated protein kinase (p38 MAPK), hormone-
sensitive lipase (HSL) and perilipin (Cao et al., 2004; Thonberg et al., 2002). Both PKA
and perilipin have been shown to also successively regulate adipose triglyceride lipase
(ATGL) activity (Pagnon et al., 2012; Wang et al., 2011). P38 MAPK successively
continues the signaling cascade by phosphorylating activating transcription factor-2
(ATF-2) and peroxisome proliferator-activated receptor γ (PPAR γ ) coactivator-1 α
(PGC-1α) (Cao et al., 2004). The collective effects of activation of these downstream
targets are activation and recruitment of BAT, through a release of free fatty acids
(FFAs) from lipid droplets (ATGL, HSL and perilipin), an increase in mitochondrial
biogenesis (PGC-1α) and activation of Ucp1 transcription at the proximal promoter and
distal enhancer regions in the 5’ non-coding region of the Ucp1 gene (CREB, ATF-2)
(Villarroya et al., 2017)(overview in Fig. 1).
Complementary to the adrenergic signaling system, BAT thermogenesis can also
be activated by natriuretic peptides secreted by the heart (Shi and Collins, 2017). De
8
novo recruitment of UCP1 is also facilitated by transcription factors such as C/EBPs
(CCAAT-enhancer-binding protein) and PPARs, which regulate Ucp1 gene
transcription (Sears et al., 1996; Yubero et al., 1994).
The intracellular release of FFAs upon adrenergic stimulation of BAT is
generally accepted to activate heat production. In the inactivated, ‘resting’, state, purine
nucleotides (e.g. GDP, ATP) are bound to UCP1 and fully prevent protons from leaking
through the inner mitochondrial membrane (Shabalina et al., 2010). Through a yet
unknown mechanism, FFAs (probably) activate UCP1 and thereby induce the
uncoupling of substrate oxidation from ATP synthesis, leading to heat production
(Bouillaud et al., 2016). Thus, adrenergic signaling in BAT both activates the UCP1 that
is already present in the mitochondria through increasing the release of FFAs from
brown adipocyte lipid droplets, and initiates additional transcription of Ucp1 through
activation of transcription (co-) factors CREB, ATF-2 and PGC-1α. Additionally, FFAs
serve another vital purpose in BAT thermogenesis, namely being used as substrates for
oxidation, continuously ensuring the generation of sufficient protons for maintenance of
the proton gradient across the inner mitochondrial membrane, thus continuously fueling
thermogenesis.
9
droplets and several medium-sized mitochondria (Cinti, 2012; Keipert and Jastroch,
2014)(Fig. 1). The mitochondria in brite adipocytes contain UCP1, and this UCP1 is
functionally thermogenic (Shabalina et al., 2013). How exactly white adipocytes ‘turn
into’ brite adipocytes upon stimulation has not been deciphered yet. Upon cold
exposure, brite adipocytes may be derived either from existing mature adipocytes in a
process named transdifferentiation (Barbatelli et al., 2010; Lee et al., 2015; Rosenwald
et al., 2013), or from de novo differentiation of preadipocytes into brite adipocytes
(Wang et al., 2013). Alternatively, brite adipocytes may always be characteristically
brite, but are masked by their white appearance in the absence of an adrenergic stimulus.
Another difference between brown and brite adipocytes may be their molecular
origin. It has been postulated that at least some brite adipocytes are derived from
different embryonic precursors than brown adipocytes, which are thought to be derived
mainly from a Myf5-positive lineage; the same lineage from which skeletal muscle
develops (Seale et al., 2008; Timmons et al., 2007). However, more recent research
suggests that brown, white and brite adipocytes can all develop from several lineages
and thus have multiple developmental origins in themselves (Long et al., 2014; Sanchez-
Gurmaches and Guertin, 2014).
10
can be detected in a high percentage of the adult population (Lee et al., 2011; van
Marken Lichtenbelt et al., 2009; Virtanen et al., 2009). The re-discovery of BAT in adult
humans initiated a renaissance in BAT research.
In earlier studies, the burning of substrate in BAT in the absence of ATP
production has been shown to facilitate metabolic inefficiency in mice, meaning that
less of the total amount of ingested energy is stored in the body. In small adult mammals,
cold-activated BAT can receive up to 34 % of cardiac output, and may contribute for 40
% to metabolic rate (Foster, 1984; Rothwell and Stock, 1979). We show that merely
housing mice in mild cold (21 °C) doubles their resting energy expenditure over that
measured at thermoneutrality (30 °C) (Paper I) (Fig. 2). Cold-activated BAT also
significantly increases energy expenditure in humans. The increase may vary from 0-14
% of resting metabolic rate during prolonged cold exposure to up to 30 % of resting
metabolic rate in situations of acute cold exposure (van Marken Lichtenbelt and
Schrauwen, 2011). BAT thermogenesis may also be activated by the consumption of
specific (high-fat) diets, thereby mediating facultative diet-induced thermogenesis (von
Essen et al., 2017; Feldmann et al., 2009; Rowland et al., 2016; Paper V) (Fig. 1). Thus,
diet-activated BAT may burn off excess ingested calories and prevent mice or humans
from gaining as much weight as they otherwise would. Indeed, inverse relationships
between the activity of BAT and BMI, body fat content and visceral fat accumulation
in humans have been shown (Saito, 2013; but see Paper V). In addition, cold-activated
BAT contributes to the clearance of glucose and FFAs from the blood (Bartelt et al.,
2011; Labbé et al., 2015). Thus, cold- or diet-activated BAT is currently widely believed
to contribute to a healthier phenotype in both mice and men.
Upon cold exposure, the browning of WAT has also been proposed to contribute
to energy expenditure and weight loss in mice additionally to the activation of BAT
(Guerra et al., 1998). However, the precise contribution of recruited brite fat to energy
expenditure is still under debate (Chapter 2).
The significant energy-burning thermogenic capacity of BAT has been put forward by
many as a novel target for pharmacological interventions aimed at reducing the
prevalence of obesity (BMI ≥ 30) and obesity-related diseases such as diabetes (fasting
blood glucose ≥ 7 mmol/l). In 2016, 13 % of the adult population worldwide was obese
and in 2014, 8.5 % of the adult population worldwide suffered from diabetes (WHO,
2018). As these percentages are still increasing, the need for novel therapeutic
interventions grows larger every day. The pharmacological activation of UCP1-
dependent thermogenesis in BAT may be (part of) the answer to the growing obesity
epidemic. In addition, the activation of brite adipose tissue may possibly fulfill the same
purpose, but due to brite fat’s questionable contribution to energy expenditure, the
importance and necessity of studying the tissue as a potential therapeutic target to lower
obesity also remains unclear (Chapter 2).
11
Nevertheless, if we want to explore the possibility of reducing obesity by means
of UCP1 activation and recruitment, it is vital that the research community identifies
compounds that modulate UCP1-dependent thermogenesis in BAT and that thereby
modulate energy expenditure. The aim of this thesis is therefore to provide further
insights into modulators of UCP1-dependent thermogenesis.
In the next chapter, I first discuss ways in which the modulation of UCP1-
dependent thermogenesis can be adequately measured in mice as a model for humans
(Chapter 2). In Chapter 2, I also discuss the consumption of specific diets as a modulator
of BAT thermogenesis, and novel research models that may find future use as tools to
identify novel modulators of UCP1-dependent thermogenesis. Successively, I discuss
glucocorticoids as potential modulators of UCP1-dependent thermogenesis (Chapter 3).
Finally, I provide an overview of the main conclusions of this thesis and of areas
regarding the modulation of UCP1-dependent thermogenesis that require further
research.
Fig. 1. (page 13) Schematic overview of UCP1-dependent thermogenesis. (A) Brown adipocytes
(mainly located in the interscapular region) and brite adipocytes (mainly located in the inguinal region)
are activated upon cold exposure or the consumption of a high-fat diet. (B) Brite adipocytes (left)
contain large lipid droplets and few mitochondria, brown adipocytes (right) contain multilocular small
lipid droplets and many mitochondria. (C) UCP1 is recruited and activated through the adrenergic
signaling pathway: norepinephrine (NE) binds to the β3-adrenergic receptor (β3AR). The Gs protein
dissociates and activates adenylyl cyclase (AC): an enzyme that converts ATP into cAMP (+PPi).
cAMP may converted into AMP by phosphodiesterases (PDE), or may activate protein kinase A
(PKA). PKA upregulates the transcription of Uncoupling protein-1 (UCP1) through phosphorylation
of several transcription factors (see Chapter 1.1 for details). PKA also phosphorylates lipases such as
hormone-sensitive lipase (HSL). Through the action of lipases, free fatty acids (FFA) are released from
lipid droplets and activate the UCP1 present in the inner mitochondrial membrane. UCP1 creates a leak
for protons to circumvent the ATP synthase, thereby producing heat. (D) When activated, brown and
brite adipose tissue contribute to energy expenditure (EE) and to the lowering of plasma FFA and
glucose levels.
12
13
MEASURING THE MODULATION
OF UCP1-DEPENDENT
THERMOGENESIS
Research into BAT thermogenesis has experienced a profound revival ever since it has
been hypothesized that BAT’s large energy burning capacity may be harnessed to
combat obesity in humans. Currently, many research groups work to identify novel
modulators of UCP1-dependent thermogenesis. Due to this overwhelming interest in
BAT, the research field has also experienced the invention of new techniques that can
be used to examine BAT physiology and to discover novel modulators of BAT
thermogenesis. Although these techniques have provided us with many new insights and
several potential novel modulators, there are pitfalls in the study of the modulation of
UCP1-dependent thermogenesis that must be avoided in order to obtain meaningful
results. Here, I discuss the main pitfalls and highlight two novel research models in the
BAT field.
14
Energy expenditure (W)
LCT
0.8 L
Slo inea
pe r inc
= i rea
ns
0.6 ula se
tio Fig. 2. The energy cost of living below
n
thermoneutrality. The thermoneutral zone
Extra EE
at 21 °C
0.4 (TMZ) of mice is around 30-33 °C. Below
the lowest ambient temperature (Ta) of the
TMZ, i.e. the lower critical temperature
0.2 (LCT), energy expenditure (EE) increases
TMZ
linearly in relation to Ta to defend body
temperature. The slope of the increase in
0.0 EE is a measure for insulation. Adjusted
10 20 30 40 from Paper I based on Cannon and
Ta (°C) Nedergaard, 2011.
shivering thermogenesis to defend their body temperature. The energy mice have to
expend to produce a sufficient amount of heat to compensate for heat loss to the
environment increases linearly with decreasing temperatures (Fig. 2). The amount of
energy that has to be expended extra per extra degree of difference between
environmental and internal temperature is determined by a mouse’s insulation (tail vein
vasocontraction, erection of fur etc.). Thus, the slope of the curve in Fig. 2 changes
depending on insulation, e.g. when an animal loses fur, it loses more heat to the
environment and will have to expend more energy to counteract any progressive
decrease in environmental temperature. Accordingly, this will be visible in the curve as
a steeper slope.
For naked humans, the thermoneutral zone is around 25-30 °C. However, as
humans generally walk around clothed, we consider a thermoneutral ‘room temperature’
to be around 21 °C. Humans can to a certain extent alter the temperature of the
environment they are in, and accordingly they will set indoor thermostats to 21 °C, so
they can spend most of their lives comfortably within the thermoneutral zone. This
means that in most animal facilities around the world, experiments on mice are
conducted at 21 °C. As can be concluded from what is mentioned above, this is about
10 °C below the thermoneutral zone of mice. Thus, the majority of rodent studies into
metabolism, physiology and also UCP1-dependent thermogenesis, have been executed
on mice that expend double the amount of energy above their basal metabolic rate (Fig.
2, Paper I) to defend their body temperature, and therefore also eat significantly more
than they would if they were housed at thermoneutrality (Paper I). As shown in Paper
I of this thesis, housing mice below their thermoneutral zone can have significant
impacts on research outcomes. The effects of modulators (such as glucocorticoids) of
UCP1-dependent thermogenesis in mice may be masked when experiments are
conducted at 21 °C, as they are overridden by the need for heat production when animals
have to defend their body temperature. In addition, modulators or genetic alterations
15
that alter a mouse’s insulation (e.g. fur) may be falsely concluded to affect BAT
thermogenesis, while the change in BAT thermogenesis is merely a secondary effect
needed to compensate for the change in insulation (e.g. Westerberg et al., 2004). Thus,
in order to find any real, and for humans relevant, modulators of UCP1-dependent
thermogenesis, it is vital to conduct studies aiming to identify these modulators at
thermoneutral temperatures.
Another example highlighting the influence that environmental temperature can have
on experimental outcomes in the study of UCP1-dependent thermogenesis, is the
initially erroneous conclusions that were drawn concerning the effects of BAT UCP1
ablation on mouse physiology. Initially, it was believed that UCP1 ablation in itself
would induce obesity because it would block any possibility for cold- or diet-induced
thermogenic energy expenditure (Fig. 1). However, this was shown not to be the case in
animals housed at 23 °C (Enerbäck et al., 1997). As researchers later noted, this
unexpected result was due to the fact that the energy expenditure needed to defend body
temperature is not solely derived from BAT-derived non-shivering thermogenesis, as
animals can also shiver to defend their body temperature. When animals are exposed to
cold for prolonged periods of time, the increase in their metabolic rate remains constant,
but the proportion of this increase that is mediated by non-shivering thermogenesis,
rather than shivering thermogenesis, gradually increases (Sellers et al., 1954). Thus,
UCP1-ablated animals can still constantly shiver to maintain their body temperature and
thereby expend the energy that prevents them from becoming obese (Golozoubova et
al., 2001).
However, when UCP1 knock-out (UCP1-KO) animals are housed at
thermoneutrality, the ‘real’ effects of UCP1 ablation become visible. For example, when
obesity-prone C57Bl/6 mice are housed at 30 °C and are fed a chow diet, UCP1 ablation
in itself induces weight gain (Feldmann et al., 2009). When these animals receive a high-
fat diet (more comparable to a standard, Western, human diet), it becomes evident that
the consumption of this diet modulates BAT activity, as C57Bl/6J UCP1-KO mice
become more obese on this diet than wild-type mice (Fig. 3). Thus, high-fat diet
consumption increases BAT UCP1-dependent thermogenic capacity and thereby
prevents C57Bl/6J mice from becoming quite as obese as would be expected based on
their energy intake (Fig. 3). This phenomenon is termed UCP1-mediated facultative
diet-induced thermogenesis.
The mediation of UCP1-dependent thermogenesis by high-fat diet-feeding is
even visible in the obesity-resistant 129S mouse strain (Paper V). Indeed, wild-type
mice from this strain show an increase in total BAT UCP1 protein levels when they are
fed a high-fat diet (Fig. 3). In the absence of UCP1, 129S mice fed a high-fat diet store
more of what they eat, visible as an increase in metabolic efficiency, WAT mass and a
tendency to an increased body weight gain (Paper V) (Fig. 3). These effects of UCP1
16
ablation all indicate the contribution of the modulation of UCP1 levels by high-fat diet
feeding to diet-induced thermogenesis in 129S mice (Fig. 3). Thus, UCP1-mediated
facultative diet-induced thermogenesis also prevents obesity-resistant mice from getting
as fat as they ‘should’ based on caloric intake, which shows the potential of the
modulation of UCP1-dependent thermogenesis as a means of counteracting the
development of obesity.
17
2.2 STUDYING THE MODULATION OF UCP1-DEPENDENT
THERMOGENESIS IN BRITE ADIPOSE TISSUE
In rodents, the modulation of UCP1-dependent thermogenesis, which may result in a
successive modulation of energy expenditure, may not solely occur in BAT, but possibly
also in UCP1-expressing brite fat. Thus, next to activation and recruitment of ‘classical’
brown fat, activation and recruitment of brite fat may also be a contributor to weight
loss. For this reason, the identification of compounds that modulate the ‘britening’ of
WAT (i.e. the UCP1-dependent thermogenic capacity of the tissue) in mice has been
deemed increasingly important. However, the human relevance of research into murine
brite fat for weight-loss purposes remains questionable, for reasons discussed below.
First, the comparability of brown fat and brite fat between mice and humans is an
unresolved issue. As mentioned in Chapter 1.2, murine BAT and brite fat may originate
from distinct developmental lineages. From this observation, the question arose whether
it is relevant to compare human BAT to ‘classical’ murine BAT, since the human tissue
might be more comparable to murine brite fat. Indeed, in isolated human neck fat,
researchers have found cells that look like classical murine brown fat, but also an
abundance of ‘paucilocular’ cells (cells with several medium-sized lipid droplets) that
contain UCP1, thus phenotypically resembling murine brite fat rather than murine BAT
(Zingaretti et al., 2009) (Fig. 4). This similarity between murine brite fat and human
BAT would mean it might actually be more meaningful for human purposes to study the
modulation of UCP1-dependent thermogenesis in murine brite fat rather than murine
BAT.
Several efforts have been made to resolve this issue, with conflicting results
(Jespersen et al., 2013; Sharp et al., 2012; Wu et al., 2012). One difficulty that arose
with these previous analyses, has been the large cellular heterogeneity within BAT and
WAT depots (mature adipocytes, preadipocytes, endothelial cells, immune cells). We
have tried to tackle this issue by comparing clonally-derived murine and human
adipocyte cell lines with each other (Paper III). Since murine brown and brite
adipocytes have distinct gene expression patterns, it is possible to determine which one
of these cell types has a transcriptome that is more comparable to the human BAT
transcriptome. For this purpose, we have isolated the stromal vascular fraction of human
neck fat (see Jespersen et al., 2013), immortalized it using SV40-T protein, and derived
three adipogenic clones from it (Paper III, but see Chapter 2.3). Upon comparison of
these human BAT-derived clonal cell line with murine BAT and WAT-derived clonal
cell lines through unbiased genome-wide expression analyses, we provide evidence that
clonally derived differentiated human adipocytes have a molecular signature that
resembles differentiated murine brite adipocytes rather than differentiated murine brown
adipocytes (Paper III).
18
Although the above-mentioned conclusion seems to provide clear evidence that
for human purposes, it would be more fruitful to focus our efforts on studying the
modulation of UCP1-dependent thermogenesis in murine brite fat rather than in BAT,
several side notes have to be made to the research shown in Paper III. First, a clear
downside of comparing clonally derived cells to one another is that in the end we are
really comparing the transcriptomes of only three human brown adipocytes with the
transcriptomes of only three mouse beige adipocytes and three mouse brown adipocytes.
As mentioned, adipose tissue depots are very heterogenous. The nature of human brown
fat has been shown to be dependent on the physical depth of the depot in the body, with
deeper depots probably more closely resembling classical BAT (Cypess et al., 2013;
Lidell et al., 2013; Nedergaard and Cannon, 2013a). Thus, the comparison of the few
human and murine adipocytes presented in Paper III may be too limited to draw far
reaching conclusion about the nature of human BAT.
Second, we again run into the issue of environmental temperature. The initial
observations that human BAT seemed phenotypically to resemble murine brite fat rather
than classical BAT were based on comparisons between tissues taken from mice housed
at 21 °C (mild cold exposure), but from humans that spend most of their lives at
thermoneutrality (Fig. 4). This is problematic, as it means that the adipose depots
compared are in a very different ‘recruitment’ and ‘activation’ stage. We show in
unpublished research coordinated by Natasa Petrovic that BAT from ‘humanized mice’
(housed at 30 °C and fed a high-fat diet for 7-8 months) is phenotypically remarkably
similar to human BAT (de Jong et al.). Thus, when analyzed under comparable
environmental conditions, human BAT and mouse BAT physiology may be directly
compared. In our published study (Paper III), adipocyte precursors were isolated from
mice housed at mild cold exposure and humans living at thermoneutrality (Jespersen et
al., 2013; Wu et al., 2012). Even though the cells were differentiated in vitro, we show
that differences in the transcriptomes between human brown and white adipocytes may
already occur at the preadipocyte level (Paper III). Thus, even the comparison of
precursor cells isolated from animals housed at different environmental temperatures
may be false in the sense that these precursor cells already resemble an adipose tissue
that is either thermogenically recruited or not. It may therefore be more interesting to
compare the transcriptome of BAT/WAT from ‘humanized’ thermoneutral mice with
that of BAT/WAT from thermoneutral humans (Fig. 4). Indeed, although BAT of
humanized mice phenotypically more closely resembles WAT, Petrovic’s research
shows that BAT of humanized mice does retain the molecular signature associated with
BAT of mice housed at 21 °C, and can thus still be characterized as ‘real BAT’ (Cheng
et al., 2018; de Jong et al.; Perdikari et al., 2018). Furthermore, comparative
transcriptomics show a remarkable similarity between the transcriptomes of humanized
mouse BAT and human BAT (de Jong et al.). These findings mean that human BAT is
phenotypically and molecularly comparable to murine BAT studied under humanized
19
conditions. Thus, as long as the modulation of UCP1-dependent thermogenesis in
murine classical BAT is studied in the correct way, it is more useful as a model for the
modulation of UCP1-dependent thermogenesis in human BAT than the study of murine
brite fat (Fig. 4).
Fig. 4. The comparison between murine brite adipose tissue and human BAT. (A) In mice housed
at 21 °C, brite adipose tissue contains multilocular lipid droplets and low amounts of UCP1 protein,
and is thus phenotypically comparable to BAT of humans housed at thermoneutrality (C). (B) In mice
housed at thermoneutrality, lipid droplets in brite adipose tissue increase in size and the tissue does not
contain detectable amounts of UCP1 protein. Thus, when studied under similar conditions, human BAT
and murine brite fat are not comparable.
Apart from the question as to whether human BAT is more comparable to murine BAT
or brite fat, it may be so that the modulation of UCP1-dependent thermogenesis in
murine brite fat is in any case irrelevant for human weight loss purposes, as the
contribution of activated brite fat to total energy expenditure is questionable (Keipert
and Jastroch, 2014). This questionability arises from the observation that even though
the expression of Ucp1 mRNA is induced ~ 100-fold in the inguinal WAT (ingWAT)
and only ~ 3-fold in the interscapular BAT (IBAT) of mice moved from 30 °C to 4 °C,
the absolute Ucp1 mRNA levels at 4 °C are still 5- to 10-fold higher in IBAT compared
to ingWAT (de Jong et al., 2015; Kalinovich et al., 2017; Nedergaard and Cannon,
2013b). This indicates that in the end, total – physiologically relevant – UCP1 levels in
brite adipose tissue may be much lower than total UCP1 levels in BAT (Fig. 4). Indeed,
as shown in Paper I of this thesis, we were unable to detect any relevant UCP1 protein
20
levels in the ingWAT of C57Bl/6J mice housed at 30 °C (thermoneutrality) or 21 °C
(mild cold exposure). These findings indicate that only quite severe cold exposure
induces a more robust browning of WAT, and that this browning makes up only a small
proportion of total thermogenic capacity. In summary, the contribution of brite fat to
total UCP1-dependent thermogenic capacity appears to be minimal when mice are
studied under circumstances that are physiologically relevant for humans.
First, as mentioned in Chapter 2.2, we have developed novel clonal cell lines derived
from the isolated stromal vascular fractions of human neck fat (Jespersen et al., 2013;
Paper III). Although we aimed to immortalize the human BAT stromal vascular
fractions by retroviral transduction with the SV40-T protein, the adipogenic clonal cell
lines unfortunately stopped growing after multiple passages and thus appear to be not
fully immortalized. We hypothesize that this may be due to reported difficulties with
SV40 T-mediated immortalization of human cells (Bryan and Reddel, 1994; Sack and
Obie, 1981; Shay and Wright, 1989). Nevertheless, early passages of the clonal cell lines
can be differentiated in vitro upon treatment with an adipogenic cocktail (Paper III).
When differentiated, the clones express Ucp1 mRNA and protein in an adrenergically-
inducible way, accumulate lipids and have an increased mitochondria-derived oxygen
consumption rate (OCR) upon stimulation with cAMP (Paper III). It has to be noted
that the mitochondria-derived OCR as reported in Paper III was determined by
subtracting the non-mitochondrial respiration (after rotenone / antimycin-A addition)
from the total respiration (FCCP) and is therefore only a measurement of the number of
mitochondria in the cell and not of UCP1 activity. As is shown in Paper I and research
21
published previously by our lab (Fischer et al., 2017), UCP1-mediated OCR can be
measured in intact adipocytes only after addition of an adrenergic stimulus, or in isolated
mitochondria after addition of GDP.
The potential of using early passages of these clonal cell lines to unravel the
functioning of human BAT is underlined by the identification of Mtus1 (mitochondrial
tumor suppressor 1) and Kcnk3 (potassium two pore domain channel subfamily K
member 3) in these cells as potential novel human BAT marker genes (Paper III). As a
side note, although the search for marker genes specific to murine/human BAT/brite fat
has intensified over the years, only very few proposed markers actually seem helpful in
reliably determining adipose tissue identity under a range of conditions (Zic1 being the
most promising one) (de Jong et al., 2015). Although we show that the expression of
both Mtus1 and Kcnk3 is increased in human BAT isolated from the neck region
compared to human WAT isolated from the same individuals, and the expression of
these genes is induced by cold exposure in human BAT, it is evident that these
phenomena do not happen unanimously in all subjects (Paper III). Thus, the usefulness
of these genes as human BAT-specific markers remains unclear.
Nevertheless, we show that Ucp1 mRNA levels, as well as UCP1 protein levels
per µg protein, are decreased in cultured adipocytes lacking either Mtus1 or Kcnk3, thus
providing an indication that these two proteins may be novel modulators of UCP1-
dependent thermogenesis (Paper III).
22
luciferase signal, such as light absorption by fur and the varying thickness of the WAT
tissue overlying the BAT tissue e.g. when mice age or become obese (Birnbacher et al.,
2018). In addition, changes in body composition may alter the tissue distribution pattern
of the injected luciferin substrate. Thus, using the Thermomouse to screen compounds
for their capacity to modulate UCP-dependent thermogenesis may only be meaningful
if proper controls for these factors are in place.
23
GLUCOCORTICOIDS AS
MODULATORS OF UCP1-
DEPENDENT THERMOGENESIS
24
transcription factors have been found to suppress BAT thermogenesis, among them the
retinoblastoma proteins (Harms and Seale, 2013).
Other proposed endogenous negative modulators of UCP1-dependent
thermogenesis are the glucocorticoids. Glucocorticoids belong to the group of steroid
hormones and are a vital part of human and animal physiology as modulators of
inflammation and glucose homeostasis, primarily during the stress response (see
Chapter 3.2). However, it is becoming more and more clear that glucocorticoids also
play an important role in energy homeostasis and adipose tissue physiology. This can
be inferred from reports describing rearrangements of fat tissues and a concomitant
development of symptoms of the metabolic syndrome in patients suffering from diseases
involving either elevated circulating levels of glucocorticoids (i.e. hypercortisolism) or
reduced circulating levels of glucocorticoids (i.e. hypocortisolism) (Pasieka and
Rafacho, 2016; Rockall et al., 2003).
Hypercortisolism can be due to an endogenous overproduction of glucocorticoids
or exogenous administration of glucocorticoids as anti-inflammatory medication
(Sharma et al., 2015). In patients with hypercortisolism (i.e. Cushing’s Syndrome), a
profound accumulation of fat in central regions and wasting of fat in peripheral regions
occurs. This puts patients at risk for developing insulin resistance and other symptoms
of the metabolic syndrome (Pasieka and Rafacho, 2016). Cushing’s patients may also
develop a ‘buffalo hump’: an accumulation of fat in the neck and the upper part of the
back. On the other hand, in the case of endogenous hypocortisolism (i.e. Addison’s
disease), patients experience weight loss and thereby fat wasting.
More recent experimental research has reported direct effects of glucocorticoids
on WAT physiology on a cellular and molecular level. Glucocorticoid signaling in WAT
promotes adipogenesis and adipose tissue expansion in both mice and humans (Infante
et al., 2017; John et al., 2016; Kargi and Iacobellis, 2014; Lee et al., 2014; Peckett et al.,
2011). Conversely, blocking glucocorticoid signaling in mice generally reverses these
effects. Thus, from these and the above-mentioned observations, it can be concluded
that glucocorticoids are important regulators of adipose tissue homeostasis.
The observed importance of glucocorticoid signaling for WAT functioning has led
researchers to propose that glucocorticoids may also modulate BAT functioning. Indeed,
BAT has been shown to be a glucocorticoid target organ (Feldman, 1978). Similar to
the effects of glucocorticoids on WAT, glucocorticoids may induce lipid accumulation
in BAT, which may or may not reflect an impaired UCP1-dependent thermogenic
capacity. If glucocorticoids indeed suppress BAT thermogenesis, this may decrease
cold- or diet-induced thermogenic energy expenditure and has therefore been proposed
to contribute to the development of glucocorticoid-induced obesity in mice and men
(Mousovich-Neto et al., 2019). Thus, unraveling the effects of glucocorticoids on BAT
may take us one step closer to determining the cause of glucocorticoid-induced obesity,
25
which may possibly help to alleviate symptoms of Cushing’s Syndrome and to
ultimately counteract obesity by inducing UCP1-dependent thermogenesis.
26
adrenocorticotropic hormone (ACTH), which is released into the bloodstream (Chapter
3.3). ACTH travels to the adrenal cortex, where it stimulates the production and release
of glucocorticoids in a process termed steroidogenesis (Chapter 3.4). Glucocorticoids
released from the adrenal gland travel through the bloodstream bound to corticosteroid-
binding globulin (also known as transcortin) to target organs (Chapter 3.5). When free
glucocorticoids reach target organs, they generally move through cell membranes
without the aid of a transporter, due to their lipophilic nature. Inside target cells,
glucocorticoids may be converted from their active forms (cortisol / corticosterone) into
their inactive forms (cortisone / 11-dehydrocorticosterone) or vice versa by the 11β-
hydroxysteroid dehydrogenases (Chapter 3.6). Once converted into their active forms,
glucocorticoids generally exert effects by binding to the cytoplasmic glucocorticoid
receptor (GR) (Chapter 3.7). Upon ligand-binding, the GR translocates to the nucleus
where it functions as a transcription factor, thus regulating the expression of target genes
and thereby finally affecting mouse and human physiology (Chapter 3.7).
Almost every event in glucocorticoid signaling as described here has been
investigated for its potential to modulate UCP1-dependent thermogenesis, and will be
discussed further below in the chapters indicated above.
27
Fig. 5. Schematic overview of glucocorticoid synthesis. Enzyme abbreviations: P450scc: cholesterol side-
chain cleavage enzyme, CYP17A1: 17𝛼-hydroxylase, 3bHSD: 3b-hydroxysteroid dehydrogenase, CYP21a2:
21𝛼-hydroxylase, CYP11b1: 11b-hydroxylase, 11bHSD1/2: 11b-hydroxysteroid dehydrogenase type 1/2.
28
3.3 THE REGULATION OF GLUCOCORTICOID RELEASE:
THE HYPOTHALAMUS AND THE PITUITARY
In stressful situations, the release of energy from the body’s glycogen and fat stores is
vital for survival. As mentioned above, glucocorticoids play an important role in
regulating the supply of energy both during stress as well as post-stress, and are therefore
often referred to as the ‘stress hormones’. Due to the vital nature of the role of
glucocorticoids as stress hormones, it follows that circulating levels of glucocorticoids
have to be tightly regulated. The regulation of glucocorticoid production and secretion
is under central control of the HPA-axis, and will be further discussed here.
The hypothalamus is the main regulator of the production and release of
glucocorticoids by the adrenal gland. In its paraventricular nucleus, sensory information
concerning the internal state of the body or information concerning peripheral stimuli
(sound, visual) is integrated. When the central nervous system signals the presence of a
cognitive (e.g a perceived threatening situation) or physical (e.g. thirst, hunger, pain)
stressor to the hypothalamus, the hypothalamus secretes CRH at an area known as the
median eminence (Fig. 6).
CRH is not only released by the hypothalamus as a response to stressors, but also
in a circadian manner during specific times of the day (Fig. 6). The hypothalamus
harbors an area named the suprachiasmatic nucleus, where clock cells reside that are
under regulation of nerve cells, that in their turn are stimulated by daylight. Via this
mechanism, the environmental day-and-night-cycle affects the expression of CLOCK
genes in the clock cells of the suprachiasmatic nucleus. The circadian information from
the suprachiasmatic nucleus is also integrated in the paraventricular nucleus of the
hypothalamus, and may thereby lead to the release of CRH. The circadian manner in
which CRH – and thereby glucocorticoids – is released is well-defined in humans and
mice. In humans, the lowest circulating glucocorticoid levels (i.e. the nadir) can be
measured around 11 PM, after which glucocorticoid levels gradually rise during sleep
until they peak at the beginning of the light phase, around 8 AM. During the rest of the
day, glucocorticoid levels slowly decrease until the nadir is reached again around
midnight. As mice are nocturnal, their circadian pattern of circulating glucocorticoid
levels is precisely inversed, i.e. the nadir is around 10 AM, when the mice go to sleep,
and the peak is around 8 PM, when the mice wake up (Fig. 6). Because the GR is
expressed in virtually every cell in the body (Chapter 3.7), and the expression of several
CLOCK genes in peripheral tissues is regulated by the GR, glucocorticoids function as
important second messengers that connect the central circadian clock with the peripheral
circadian clock, thus aiding the synchronization of whole-body daily rhythms
(Balsalobre et al., 2000; So et al., 2009).
As a side note, the fact that glucocorticoids play a central role in circadian
homeostasis causes difficulties in optimizing glucocorticoid medication. Current ways
of exogenous glucocorticoid administration, e.g. in the form of pills, do not simulate the
29
circadian rhythm of endogenous glucocorticoid release (Venneri et al., 2018).
Consequently, patients receiving this type of medication to combat hypocortisolism
often still suffer from poor quality of life. Additionally, mimicking the circadian pattern
of endogenous glucocorticoid release has also proven to be an obstacle in rodent studies
aiming to unravel the effects of glucocorticoids. Indeed, the continuous administration
of glucocorticoids via injections, micro-osmotic pumps or implantation of slow release
pellets does not succeed in maintaining the endogenous circadian pattern of
glucocorticoid secretion seen in mice (Herrmann et al., 2009). The administration of
glucocorticoids through the drinking water has been proposed because it is inexpensive,
non-invasive and may more closely mimic endogenous circadian glucocorticoid release
patterns, because mice will have high circulating glucocorticoid levels during the dark
period, when they drink (Gasparini et al., 2016). However, as we show in Paper I,
glucocorticoid levels are still profoundly elevated at the beginning of the light period
(7:30AM, when the mice go to sleep) in rodents receiving glucocorticoids via the
drinking water, which is not compatible with endogenous circadian glucocorticoid
release patterns. It thus cannot be excluded that the metabolic effects we report in mice
treated with glucocorticoids via the drinking water are not solely due to the
glucocorticoid treatment, but also to a disturbed circadian rhythm of the hormone
(Paper I).
30
6). This means that circulating glucocorticoids in themselves rapidly (within minutes)
inhibit the release of more glucocorticoids by binding to the GR in the paraventricular
nucleus (but not the suprachiasmatic nucleus) of the hypothalamus. Hereby, the release
of CRH from the hypothalamus is inhibited, which in its turn lowers the release of
ACTH from the pituitary (Fig. 6). In the pituitary, glucocorticoids also suppress the
transcription of POMC (Tremblay et al., 1988), thus regulating the availability of the
ACTH precursor. The negative feedback mechanisms in the hypothalamus and pituitary
may be mediated through both genomic and non-genomic GR signaling (Chapter 3.7).
Finally, the peripheral clearance of glucocorticoids also contributes to making sure
circulating glucocorticoid levels return to baseline post-stress.
31
The proposed upregulation of UCP1-dependent thermogenesis in response to
ACTH treatment may indicate that in physiological situations, ACTH mediates the acute
effects of stress on BAT. Upon exposure to a stressor, circulating glucocorticoid levels
rise after 20 min, while circulating ACTH levels rise much more rapidly. Thus, ACTH
may initially enhance BAT activity, after which this enhancement is suppressed by the
rise in glucocorticoids. Indeed, several reports indicate that corticosterone suppresses
the ATCH-induced increase in UCP1 mRNA and protein levels in vivo and in vitro (van
den Beukel et al., 2014; York and Al-Baker, 1984), although this remains controversial
(Schnabl et al., 2019). However, it has to be kept in mind that the reported experimental
concentrations of supplemented ACTH are profoundly supra-physiological. In mice,
circulating ACTH levels are ~3 pg/ml at 8AM (e.g. Füchsl et al., 2013). Upon exposure
to a stressor, these levels can rise to 500 pg/ml, or 1 ng/ml in extreme cases (van den
Beukel et al., 2014; Füchsl et al., 2013). In the above-mentioned experiments, ACTH is
supplemented at concentrations ranging from ~5 ng/ml to ~50 ng/ml (van den Beukel
et al., 2014; Biswas, 2017; Iwen et al., 2008; Rothwell and Stock, 1985; Schnabl et al.,
2019), which is thus at least 5x above maximal physiological concentrations. As the
effects of ACTH on BAT are dose-dependent (van den Beukel et al., 2014; Schnabl et
al., 2019) and only occur at these supraphysiological doses, it is unlikely that the
proposed activation of UCP1-dependent thermogenesis by ACTH is physiologically
relevant (Fig. 6).
Moreover, even if the finding that ACTH activates BAT would be
physiologically relevant, it seems unlikely to affect experimental outcomes when
glucocorticoids are administrated exogenously. This is because exogenous
glucocorticoid administration immediately suppresses HPA-axis activity, and thereby
ACTH secretion from the pituitary, through the same negative feedback loop whereby
endogenously released glucocorticoids suppress HPA-axis activity (Fig. 6). Thus, there
is no rise in circulating ACTH levels upon exogenous glucocorticoid administration.
Therefore, it is unlikely that any reported modulations of BAT by exogenous
glucocorticoids as discussed below (and see Paper I) are altered by acute rises in ACTH
levels. This does not take away the fact that the effects of exogenously administrated
glucocorticoids on BAT may be different from what would be seen in physiological
stress-situations, when there is a measurable peak in circulating ACTH levels.
32
Fig. 6. The effects of ACTH on BAT. Upon the perception of a stressor or in response to
the circadian clock, the hypothalamus secretes corticotropin-releasing hormone (CRH) at the
median eminence. CRH stimulates the pituitary to release adrenocorticotropic hormone
(ACTH) into the bloodstream. At physiological concentrations, ACTH stimulates the
production and secretion of glucocorticoids (GC) by the adrenal cortex, but does not in itself
affect BAT functioning. Through a negative feedback mechanism, GC prevent the release
of CRH by the hypothalamus, thereby lowering circulating levels of ACTH. When
exogenously supplemented at supraphysiological concentrations (> 1 ng/ml), ACTH
activates and recruits UCP1 in BAT.
33
3.4 GLUCOCORTICOID SYNTHESIS:
THE ADRENAL GLAND
After being released into the vascular system by the pituitary, ACTH travels through the
blood to the adrenal cortex (Fig. 6). The half-life of ACTH in the blood is around 10
min, thus ensuring a rapid ACTH turnover and thereby usually preventing the
occurrence of prolonged hypercortisolism. Upon arrival at the adrenal gland, ACTH
binds to surface ACTH receptors, i.e. the melanocortin 2 receptor, on cells of the adrenal
cortex. The melanocortin 2 receptor is a G protein-coupled receptor that changes
conformation upon ligand binding, after which the 𝛼 -subunit of the G-protein
dissociates and stimulates the production of cAMP by adenylate cyclase. Through a
PKA signaling pathway, ACTH regulates multiple steps in the synthesis of steroid
hormones, also named steroidogenesis.
Steroidogenesis is primarily located to the cortex of the adrenal glands. The
adrenal cortex consists of three functionally distinct layers; the outer zona glomerulosa,
the middle zona fasciculata and the inner zona reticularis (Fig. 7). Each cortical layer
expresses a specific set of enzymes, thus regulating specific steps in steroidogenesis.
This results in the production of mineralocorticoids in the zona glomerulosa (through
specific expression of aldosterone synthase), glucocorticoids in the zona fasciculata and
androgens (e.g. DHEA) in the zona reticularis (Fig. 7). Although differences occur
between mice and men in zona reticularis development and presence (mice adrenals
rather contain a transient X-zone) (Holmes and Dickson, 1971), the glucocorticoid-
producing zona fasciculata is comparable between the two species.
34
In addition to the circadian clock in the hypothalamus that ensures a circadian
production and secretion of ACTH, the adrenal gland also contains a circadian clock.
CLOCK genes in the adrenal gland are rhythmically expressed under control of the
central nervous system, and control the transcription of genes that are important for
steroidogenesis (Oster et al., 2006). Through this mechanism, the circadian clock in the
adrenal gland determines the times of the day during which the zona fasciculata is most
responsive to the induction of steroidogenesis by ACTH.
35
In Chapters 3.4.1 and 3.4.2, I discuss the information we have gained concerning the
modulation of UCP1-dependent thermogenesis by glucocorticoids from studies
concerning the adrenal gland. First, I discuss how removal of the adrenal glands affects
BAT functioning (Chapter 3.4.1), and second, I discuss how overproduction of
glucocorticoids due to adrenal tumors (adrenal Cushing’s) affects BAT functioning
(Chapter 3.4.2).
36
which can be restored by adrenalectomy, thus indicating that the reduction may be
mediated by glucocorticoids (Himms-Hagen and Desautels, 1978; Holt and York, 1984,
1982; Holt et al., 1983; Marchington et al., 1983). This hypothesis was later confirmed
by the fact that successive administration of corticosterone to adrenalectomized mice
reduces GDP-binding to BAT mitochondria, as well as BAT Ucp1 mRNA levels, anew
(Arvaniti et al., 1998; Holt et al., 1983; Shargill et al., 1989; Tokuyama and Himms-
Hagen, 1987). It has to be noted that more recent findings indicate that there is no
decrease in total BAT UCP1 protein levels in ob/ob mice (Fischer et al., 2016). It
therefore remains to be determined whether adrenalectomy induces a ‘true’ increase in
total BAT UCP1 protein levels in these mice, or whether this effect disappears when the
correct measurements and calculations are applied (Chapter 2). Nevertheless,
adrenalectomy does reverse morphological abnormalities seen in adipocytes of both
ob/ob mice and fa/fa rats, i.e. larger lipid droplets and an enlargement of the
mitochondria that also contain fewer cristae (Hogan and Himms-Hagen, 1980; Holt et
al., 1983).
Taken together, these data indicate that in mice, the complete removal of the production
of glucocorticoids by adrenalectomy has profound effects on BAT physiology, i.e. a
37
reduction in lipid droplet size, an increase in GDP-binding to BAT mitochondria and a
possible increase in BAT UCP1 protein per µg protein (Fig. 8). These effects thus
indicate that when glucocorticoids are present, they may suppress UCP1-mediated
thermogenesis. Moreover, the discussed studies provide indications that the effects of
glucocorticoids on BAT functioning may be mediated indirectly through alterations in
the sympathetic output to the tissue (Fig. 8).
Although variations in lipid droplet size in BAT are often used as indicators of
an altered thermogenic capacity of the tissue, this may not necessarily be the case. For
example, we show in Paper I that mice treated with glucocorticoids at 21 °C experience
a profound lipid accumulation in their BAT compared to veh-treated mice, in the
absence of changes in total BAT UCP1 protein levels or UCP1-dependent thermogenic
capacity between the groups. In addition, lipid accumulation in BAT is similar in mice
housed at 30 °C, while total BAT UCP1 levels in these mice are a ~100-fold lower than
in mice housed at 21 °C. Thus, the decrease in lipid content in BAT upon adrenalectomy
does not a necessarily indicate an increase in thermogenic capacity of the tissue (Fig. 8).
From the above-mentioned studies on adrenalectomized rodents, it is also
questionable to draw the conclusion that glucocorticoids lower BAT UCP1 levels (Fig.
8). Most of these studies are performed on animals housed below thermoneutrality, and
report only BAT Ucp1 mRNA levels or UCP1 protein / µg BAT protein. Because these
experimental conditions and calculations can provide a skewed image of the results
(Chapter 2, Paper I), it is difficult to draw a definite conclusion from them.
Finally, there is the hypothesis that glucocorticoids may lower sympathetic
output to BAT and thereby suppress UCP1-dependent thermogenesis. As we show that
the capacity of BAT to respond to adrenergic stimulation is unaltered by glucocorticoid
treatment (Paper I), this may mean that glucocorticoids somehow reduce the firing of
sympathetic nerves or reduce the production or release of NE from sympathetic nerve
endings. A reduction in sympathetic outflow to BAT may explain the effects of
glucocorticoids on lipid accumulation in the tissue, as we report an increased lipid
accumulation in BAT in vivo in mice but not in vitro in differentiated adipocytes upon
glucocorticoid treatment (Paper I, Paper II). However, given the fact that we find that
Ucp1 expression is downregulated in vitro by glucocorticoids even in cases when the
intracellular adrenergic signalling pathway is upregulated, the effects of glucocorticoids
on Ucp1 expression seem to be regulated transcriptionally in a cell-autonomous manner
rather than through alterations in adrenergic output to BAT (Paper II) (Fig. 8).
38
Fig. 8. The effects of alterations in adrenal gland functioning on BAT. (A) In adrenalectomized (ADX)
mice housed at ~21 °C, lipid droplets in BAT are decreased in size and BAT UCP1 protein per µg protein
is possibly increased. The output of the sympathetic nervous system (SNS) to BAT may be increased. (B)
Prkar1a-flox x Cyp11b2-Cre mice (DAdKO) housed at 21 °C develop adrenal, glucocorticoid (GC)-
producing tumors and consequently become obese. Lipid droplets in BAT are increased in size and BAT
Ucp1 mRNA levels are decreased.
39
medication (more information on humans with adrenal Cushing’s and BAT in Chapter
3.8).
Mammals other than humans can also develop adrenal Cushing’s, most notably
dogs and hamsters. However, adrenal Cushing’s is not reported for wild-type mice, and
thus the possibilities of using the mouse as a model organism to study the effects of
adrenal Cushing’s on UCP1-dependent thermogenesis seem limited. Luckily, novel
gene editing technologies have resulted in the development of genetically modified mice
that develop glucocorticoid-producing adrenal tumours. For example, knocking out a
regulatory subunit of PKA specifically in the adrenal cortex by crossing Prkar1a-lox
(protein kinase cAMP-dependent type I regulatory subunit alpha) with Akr1b7-Cre
(aldo-keto reductase family 1, member B7) mice, leads to mice developing Cushing’s
due to the development of glucocorticoid-producing adrenal tumours (Sahut-Barnola et
al., 2010). Prkar1a-lox x Akr1b7-cre mice develop frank Cushing’s syndrome between
5-10 months of age, including symptoms such as a doubling of circulating plasma
corticosterone levels and fat accumulation in the interscapular region (Sahut-Barnola et
al., 2010). Whether the interscapular fat represents ‘whitened’ BAT remains to be
determined, as BAT function has so far not been investigated in this mouse model.
A more novel mouse model for Cushing’s Syndrome has been developed by
crossing Prkar1a-lox with Cyp11b2-cre (cytochrome P450 family 11 subfamily B
member 2, aldosterone synthase) mice (here termed DAdKO mice) (Dumontet et al.,
2018) (Fig. 8). In these mice, adrenal tumours develop only in the definitive, adult,
adrenal cortex, not in the fetal adrenal cortex (Dumontet et al., 2018 versus Sahut-
Barnola et al., 2010). Analysis of the DAdKO mice in collaboration with the lab of
Antoine Martinez (GReD, Université Clermont Auvergne, CNRS, INSERM, Clermont-
Ferrand, France), reveals that their plasma corticosterone concentrations are doubled,
probably due to an upregulation of steroidogenic gene expression in the adrenal cortex,
and their body weight is significantly increased compared to wild-type mice (Figs. 8, 9;
Dumontet et al., 2018). The increased body weight in DAdKO mice is due to an increase
in total adipose tissue weight, as interscapular BAT and WAT, and inguinal and gonadal
WAT are all increased in size, and there is a simultaneous decrease in lean mass (Fig.
9; Dumontet et al., 2018). Similar to our observations in mice with exogenous
hypercortisolism (Paper I), individual adipocyte size is increased in all adipose tissues
in DAdKO mice with endogenous hypercortisolism (Fig. 10). Ucp1 mRNA levels are
significantly decreased in the IBAT of DAdKO mice (Figs. 8, 11). Small amounts of
Ucp1 transcripts are found in isWAT (interscapular WAT) and ingWAT, but these
remain unaffected by hypercortisolism (Fig. 11). The expression of the adipogenic
Fabp4 and Pparg genes is upregulated in all adipose tissues of DAdKO mice, except
IBAT (Fig. 11).
40
Plasma corticosterone
10 0.10 0.4
30 0.6
0.10
20 0.4
5 0.05 0.2
10 0.2 0.05
0 0 0.00 0.0 0.0 0.00
D WT
D WT
D WT
D WT
KO
KO
KO
KO
D WT
KO
D WT
KO
Ad
Ad
Ad
Ad
Ad
Ad
Fig. 9. Endogenous hypercortisolism induces adipose tissue growth. Characteristics of 7-month
old female wild-type (WT: As+/+ x Prkar1afl/fl; As+/Cre x Prkar1a+/+; As+/Cre x Prkar1a+/fl) and
DAdKO mice (As+/Cre x Prkar1afl/fl). IBAT = interscapular BAT, isWAT = interscapular WAT,
ingWAT = inguinal WAT, gWAT = gonadal WAT. Data are represented as mean ± SEM, WT n =
13, DAdKO n = 3. ** P < 0.01, *** P < 0.001, Student’s t-test.
WT DAdKO
% of total adipocytes
60 ingWAT
*** WT
DAdKO
IBAT
40 ***
20 ***
*** * ** **
0
> 7.5
0-0.5
0.5-1
1-1.5
1.5-2
2-2.5
2.5-3
3-3.5
3.5-4
4.4-5
4.5-5
5-5.5
5.5-6
6-6.5
6.5-7
7-7.5
ingWAT
100 gWAT WT
80 *** DAdKO
60
gWAT
40
20 ** *
0
0-1
1-2
2-3
3-4
4-5
5-6
6-7
7-8
8-9
9-10
10-11
11-12
> 12
41
From these data, we conclude that glucocorticoids may reduce BAT Ucp1 levels in mice
experiencing endogenous hypercortisolism (Fig. 8). Although this conclusion seems to
agree with the one drawn in Paper I, it does remain to be determined to what extent
Cushing’s syndrome develops and affects BAT when DAdKO mice are housed at
thermoneutrality. Furthermore, whole-body thermogenic capacity has not yet been
determined in these mice. Finally, even if it will be found that UCP1-dependent
thermogenesis is reduced in mice suffering from ‘Cushing’s’, the human implication of
this might be minimal. As we show in Paper I, glucocorticoid-induced obesity develops
independently of UCP1 levels in mice (and possibly in humans), and thus, reversing any
reduction in UCP1-dependent thermogenesis may have no effects in patients suffering
from obesity caused Cushing’s Syndrome.
Ppargc1a/18s
0.0004
IBAT
Cidea/18s
Adrb3/18s
0.015 0.00015
Nr3c1/18s
Ucp1/18s
Dio2/18s
0.04 0.0003 0.00010 0.0010 0.00015
0.0006 0.015 ** 0.010 0.00010 0.07
0.0004 0.010 ** 0.02
0.0002 ** 0.00005 0.0005 * 0.00010
0.0002 0.005 0.005 0.0001 0.00005 0.00005
0.0000 0.000 0.000 0.00 0.0000 0.00000 0.00000 0.0000 0.00000
KO
KO
KO
D WT
D WT
D WT
KO
D WT
KO
KO
KO
D WT
D WT
KO
KO
T
T
T
W
W
W
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
D
D
D
0.0004 0.00004
isWAT
Pparg/18s
Adrb3/18s
18S 2^-CT
Cidea/18s
0.0006
Nr3c1/18s
Ucp1/18s
Dio2/18s
KO
KO
D WT
D WT
D WT
KO
KO
KO
D WT
D WT
KO
KO
T
T
W
W
W
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
D
D
*
Ppargc1a/18s
0.00020
Fabp4/18s
18S 2^-CT
0.00015
Adrb3/18s
0.00006
Ucp1/18s
0.000006
Nr3c1/18s
Dio2/18s
D WT
KO
D WT
KO
KO
D WT
D WT
KO
KO
KO
KO
D WT
KO
T
T
W
W
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
D
0.0004
Pparg/18s
0.0008
gWAT
0.00020
Fabp4/18s
18S 2^-CT
0.000006
Cidea/18s
Adrb3/18s
0.00003 0.00015
Ucp1/18s
Nr3c1/18s
*
Dio2/18s
D WT
KO
KO
KO
D WT
KO
KO
KO
D WT
D WT
KO
KO
T
T
W
W
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Fig. 11. Gene expression in IBAT, isWAT, ingWAT and gWAT of WT and DAdKO mice. Abbreviations and
genotypes as in Fig 9. 18S (reference gene), uncoupling protein 1 (Ucp1), cell death-inducing DFFA-like effector
A (Cidea), fatty acid-binding protein 4 (Fabp4), peroxisome proliferator activated receptor gamma (Pparg), pparg
co-activator 1 alpha (Ppargc1a), iodothyronine deiodinase 2 (Dio2), adrenergic receptor beta 3 (Adrb3),
glucocorticoid receptor (Nr3c1). Data are represented as mean ± SEM, WT n = 8, DAdKO n = 3. * P < 0.05, ** P
< 0.01, *** P < 0.001, Student’s t-test.
42
3.5 GLUCOCORTICOID TRANSPORT:
TRANSCORTIN
After glucocorticoids are produced and released by the adrenal cortex, they travel
through the blood stream to target organs. Due to the low water solubility of
glucocorticoids, they cannot travel through the vascular system by themselves, but have
to be bound to a transport protein in order to remain in solution. The main transport
protein that glucocorticoids are bound to in the vascular system is termed corticosteroid-
binding globulin, also known as transcortin.
Transcortin is an alpha-globulin produced and secreted by the liver, and has a
high affinity for binding glucocorticoids. Consequently, when the adrenal secretion of
glucocorticoids is low, up to 95-99 % of circulating glucocorticoids can be bound to
transcortin. Because glucocorticoids can only diffuse into target tissues when they are
un-bound (Mendel, 1989), it is vital that under stressful conditions, there are
mechanisms in place that ensure that a sufficient amount of circulating free
glucocorticoids is available to exert effects on target tissues. For this reason, there are
several ways in which the amount of free glucocorticoids in the circulation can be
increased in response to a stressor. First, circulating transcortin can become saturated
with glucocorticoids. This means that, when circulating glucocorticoid levels are high,
more free glucocorticoids will be available for diffusion into target tissues. Second,
glucocorticoids themselves inhibit the synthesis of transcortin in the liver (Verhoog et
al., 2014). Thus, when circulating glucocorticoid levels are high, circulating transcortin
levels are low, and vice versa. Third, the binding affinity of transcortin for
glucocorticoids is variable. More specifically, the dissociation constant (Kd) with which
transcortin binds glucocorticoids increases in response to an increased body temperature
or a lower glycosylation state of transcortin (Chan et al., 2013). This means that in these
situations, glucocorticoids are bound less tightly to transcortin and thus, more
glucocorticoids will be available for diffusion into target tissues. Through these
processes, the bioavailability of glucocorticoids is adequately regulated, so that
glucocorticoids can only exert effects on target tissues when needed.
In addition to being bound to transcortin, a small percentage of circulating
glucocorticoids is bound to albumin. Albumin has a higher capacity but lower affinity
for binding glucocorticoids than transcortin and consequently, glucocorticoids bound to
albumin become more rapidly available to target tissues (Breuner and Orchinik, 2002).
43
The regulation of the transport and bioavailability of glucocorticoids by transcortin is
increasingly recognized as an important requirement for proper glucocorticoid
signaling. Indeed, alterations in the functioning of transcortin may affect the metabolic
outcomes of glucocorticoid signaling. Through genetic studies, a link between mutations
in the transcortin gene and adiposity or susceptibility to diabetes has been found
(Moisan, 2010). In addition, experimental studies report that disturbances in circulating
transcortin levels may directly affect adipose tissue physiology. One of these
disturbances may be the complete absence of transcortin, as is the case in the transcortin-
KO mouse (Petersen et al., 2006). Although free plasma corticosterone levels are
increased 10-fold in transcortin-KO mice, the physiological consequences of this
increase on adipose tissue physiology are not necessarily comparable to the effects seen
in mice experiencing endogenous or exogenous hypercortisolism (Petersen et al., 2006).
For example, transcortin-KO mice do not gain extra weight when fed a high-fat diet,
and accumulate less subcutaneous WAT than their wild-type counterparts (Gulfo et al.,
2016) (contrary to Paper I). Although researchers have proposed that this might be due
to a desensitization of the mice to high levels of free corticosterone (Gulfo et al., 2016),
this has not been experimentally confirmed.
Because research into the link between transcortin and adipose tissue physiology
is rather recent and still emerging, firm conclusions on the topic have not yet been
reached. Moreover, no results have been reported concerning the relevance of
transcortin for BAT functioning. Because the reported effects of the ablation of
transcortin on WAT appear inconsistent and do not necessarily corresponded to
previously reported effects of hypercortisolism on WAT, the effects of transcortin on
BAT may also be surprising and worthy of further investigation. Thus, the link between
transcortin and BAT may be an exciting new area of research and may provide us with
further information on the modulation of UCP1-dependent thermogenesis by
glucocorticoids.
44
bioactive forms of glucocorticoids into their inactive forms and vice versa. The enzymes
catalyzing these reactions are termed the 11β-hydroxysteroid dehydrogenases.
There are two main 11 β -hydroxysteroid dehydrogenases, coded for by the
Hsd11b1 and Hsd11b2 genes. 11β-hydroxysteroid dehydrogenase type 1 (HSD1) is an
NADPH-dependent reductase that is responsible for the conversion of inactive cortisone
(11-dehydrocorticosterone in mice) to active cortisol (corticosterone in mice) (Fig. 5).
11 β -hydroxysteroid dehydrogenase type 2 (HSD2) is an NAD-dependent
dehydrogenase that inactivates cortisol (/corticosterone) in the reverse reaction (Fig. 5).
The synthetic glucocorticoid DEX is not converted by the HSD enzymes, but the
synthetic prednisolone is converted into prednisone and vice versa (Fig. 5).
The HSD1 and HSD2 enzymes are differentially expressed across tissues.
Whereas HSD1 is widely expressed in key metabolic tissues such as the liver, muscle
and adipose tissues, HSD2 is expressed predominantly in the kidneys, colon and salivary
gland, i.e. tissues that rely heavily on mineralocorticoid receptor action. This specific
tissue distribution of the HSDs may have evolved because of the fact that
glucocorticoids can also bind to the mineralocorticoid receptor (MR). The MR can bind
both aldosterone and glucocorticoids with high affinity (Gomez-Sanchez and Gomez-
Sanchez, 2014). Because circulating concentrations of glucocorticoids are ~100 x higher
than circulating concentrations of aldosterone, the MR, when present, is virtually always
occupied by glucocorticoids (Funder, 2005; Gomez-Sanchez and Gomez-Sanchez,
2014). To ensure that epithelial tissues are only regulated by mineralocorticoids and not
glucocorticoids, HSD2 inactivates around 90 % of intracellular glucocorticoids (Funder,
2005). Thus, HSD2 is able to protect the mineralocorticoid receptor in sodium-
transporting epithelia from glucocorticoid-binding, and thereby confers aldosterone
specificity.
HSD1 is expressed in BAT of mice housed both at 21 °C and 30 °C, as we show
in tissues isolated from 14-week-old mice (Fig. 12; average Ct value ~23). Very low
HSD2 mRNA levels have been found in subcutaneous WAT of rodents, but so far, these
have not been shown to be physiologically relevant (Milagro et al., 2007). Low levels
of HSD2 mRNA have also been found in WAT and BAT of humans, but again it remains
unclear whether these levels are sufficient to affect BAT glucocorticoid concentrations
in vivo (Ramage et al., 2016).
The presence of the HSD enzymes means that the dose of active glucocorticoids
available to exert effects on target tissues is not solely determined by the amount of
glucocorticoids in the circulation, but also by the conversion of these glucocorticoids
into their bioactive forms in a local tissue- (or even cell-) specific manner.
45
21°C
IBAT ingWAT eWAT
100 100 100
Hsd11b1/Tbp
Hsd11b1/Tbp
Hsd11b1/Tbp
80 80 80
**
60 *** 60 60
40 40 ***
40 Fig. 12. The expression of Hsd11b1 in
20 20 20 murine adipose tissues. Hsd11b1 gene
0 0 0 expression levels in interscapular BAT
(IBAT), inguinal WAT (ingWAT) and
RT
RT
h
h
RT
h
Ve
Ve
Ve
O
O
O
epidydimal WAT (eWAT) of C57Bl/6J
C
C
C
Hsd11b1/Tbp
80 80 80
*** ***
60 60 60 CTCTCTGTGTCCTTGGCCTC, reverse
40 40 40 primer: AGTACACCTCGCTTTTGCGT.
20 20 20
Data are represented as mean ± SEM, n =
7. ** P < 0.01, *** P < 0.001, Student’s t-
0 0 0
test.
RT
RT
h
h
RT
h
Ve
Ve
Ve
O
O
O
C
C
C
46
to which glucocorticoids modulate UCP1-dependent thermogenesis. For this purpose, I
discuss how downregulation of the HSD enzymes affects BAT functioning in Chapter
3.6.1, and I discuss how upregulation of the HSD enzymes affects BAT functioning in
Chapter 3.6.2.
47
HSD1-KO mice do display an increase in core body temperature (Morton et al., 2004;
Zeng et al., 2016) (Fig. 15B). The nature of this increase remains to be determined.
More pronounced effects of the loss of HSD1 on BAT functioning are visible
when HSD1-KO mice are challenged with an excess of circulating glucocorticoids. In
wild-type mice housed both at 21 °C and 30 °C and supplemented with 50 µg/ml
corticosterone in their drinking water, we show an increase in BAT weight, lipid
accumulation in BAT, and BAT Hsd11b1 gene expression (Paper I; Figs. 12, 15C). In
addition, mice with endogenously high circulating levels of glucocorticoids (DAdKO
mice) also show an increase in Hsd11b1 gene expression across several adipose tissues
(Fig. 13). In a model of glucocorticoid excess similar to our studies, HSD1-KO mice are
housed at 21 °C and supplemented with 100 µg/ml corticosterone in their drinking water
(Doig et al., 2017). The effects of glucocorticoid excess on BAT in wild-type mice and
DAdKO mice housed at 21 °C that we report are all attenuated in these HSD1-KO mice
(Doig et al., 2017) (Fig. 15D). In addition, the decrease in BAT UCP1 levels per µg
protein that we report in response to glucocorticoid treatment (Paper I) is also reversed
in the HSD1-KO mice (Doig et al., 2017) (Fig. 15D). Unfortunately, Doig and
colleagues provide no data on total UCP1 protein levels in the BAT of HSD1-KO mice
following corticosterone treatment, nor do they test nonshivering thermogenic capacity.
Since we show that total BAT UCP1 protein levels, as well as whole-body thermogenic
capacity, in mice housed at 21 °C are not affected by hypercortisolism (Paper I), it
remains unclear whether the absence of HSD1 affects BAT thermogenic functioning, or
whether it merely affects the accumulation of lipids in BAT in response to
glucocorticoid treatment.
Fold-change
Fold-change
Fold-change
Fold-change
0 0 0 0
KO
KO
KO
KO
D WT
D WT
D WT
D WT
Ad
Ad
Ad
Ad
Fig. 13. The expression of Hsd11b1 in adipose tissues of DAdKO mice. Hsd11b1 gene expression
levels in adipose tissues of 7-month old WT or DAdKO female mice housed at 21 °C. Abbreviations
and genotypes as in Fig 9. Primers as in Fig. 12. Data are represented as mean ± SEM, WT n = 13,
DAdKO n = 3. ** P < 0.01, Student’s t-test.
48
protein levels are increased 4-fold compared to young mice (15 weeks old), which
correlates with reported decreases in BAT UCP1 protein levels (per µg protein) in aging
mice (Graja and Schulz, 2015). The reported decrease in UCP1 protein in aging mice
may partly be due to high exposure to glucocorticoids. This hypothesis is supported by
the observation that aged HSD1-KO mice show a 3-fold increase in BAT UCP1 protein
levels (per µg protein) compared to aged wild-type mice, even in the absence of any
exogenous glucocorticoid treatment (Doig et al., 2017). Although it again remains to be
determined whether this is a ‘true’ increase in total BAT UCP1 protein levels and to
what extent this translates into alterations in whole body UCP1-dependent thermogenic
capacity, it provides a tentative indication that a glucocorticoid-mediated suppression of
UCP1 may contribute to the development of obesity associated with age.
It may be so that the reported changes in BAT functioning due to lowering whole-body
HSD1 levels in vivo either pharmacologically or through genetic modifications are
secondary to effects that the absence of HSD1 has on other tissues. Indeed, the
downregulation of HSD1 (and thus the lowering of active glucocorticoid levels) only in
visceral WAT and liver using i.p. injected antisense oligonucleotides mildly influences
gene expression in BAT, as it results in an upregulation of the transcription of genes
such as Dio2, Dgat1 and Cox8b (Li et al., 2012). Although it is currently not possible to
test in vivo whether the effects of the ablation of HSD1 on BAT are direct or secondary
to other physiological effects, as BAT-specific HSD1-KO mouse models do not exist,
it may be possible to some draw conclusions on this matter from the inhibition of HSD1
in vitro in cell cultures of brown adipocytes.
First, we show that treatment of cultured primary brown adipocytes with 1 µM
DEX during differentiation increases Hsd11b1 gene expression 5-fold, and reduces
Ucp1 gene expression 2-fold (Paper II, Fig. 14). In primary brown adipocytes isolated
from HSD1-KO mice and differentiated in the presence of 1 µM DEX, Ucp1 mRNA
levels are significantly increased compared to the levels seen in brown adipocytes
isolated from wild-type mice (Doig et al., 2017). Finally, both the pharmacological
inhibition of HSD1 by BVT.2733 as well as the downregulation of HSD1 by siRNA
significantly increases Ucp1 gene expression in cultured primary brown adipocytes
differentiated in the presence of 1 mM cortisone (Liu et al., 2013). In these brown
adipocytes, also lipid droplet size is significantly decreased in the absence of HSD1,
which may be due to an upregulation of the levels of proteins associated with lipid
droplets and fatty acid β-oxidation (Liu et al., 2013).
Taken together, these results indicate that in vitro, lower levels of HSD1, and
thus of active glucocorticoids, are associated with an increase in Ucp1 transcription in
brown adipocytes. This means that the effects of the ablation of HSD1 on brown
adipocytes are at least partly cell autonomous, and not secondary to effects of HSD1
ablation on other tissues.
49
BA WA Fig. 14. The expression of Hsd11b1 in
*** cultured brown and white adipocytes.
10 10 ** Hsd11b1 gene expression levels in primary
Hsd11b1/TfIIb
Hsd11b1/TfIIb
Fold-change
Fold-change
8 8
*** cultures differentiated for 7 days in the
6 *** 6 presence of vehicle (95% EtOH) or DEX (1
4 4 µ M) and treated with vehicle (PCR-grade
H2O) or NE (1 µ M) 2 h before harvest.
2 2
Primers as in Fig. 12. Data are represented as
0 0 mean ± SEM, n = 7. ** P < 0.01, *** P <
V D V D V D V D
0.001, one-way ANOVA with Tukey post-
-NE +NE -NE +NE
test.
50
hypercortisolism. Indeed, the downregulation of Ucp1 mRNA levels in response to a
short-term treatment of wild-type adipocytes with 1 µM corticosterone (in accordance
with our own data), is not significantly reversed in the absence of HSD1 (Doig et al.,
2017).
Finally, it is important to note that lowering HSD1 levels, and thus the amounts
of active glucocorticoids in tissues, in vivo in mice, lowers food intake (Li et al., 2012).
This agrees with our data that show that exogenous corticosterone supplementation
increases food intake in mice (Paper I). Although part of the effects of lower tissue
levels of active glucocorticoids may be secondary to the effect of HSD1 ablation on
food intake, both we and other groups have shown that the glucocorticoid-induced
changes in body weight, fat mass and UCP1 protein levels happen at least partly
independently of changes in food intake (Li et al., 2012; Paper I). Thus, it is likely that
the presence of HSD1 affects BAT physiology at least partly independently of effects
on food intake in a cell-autonomous manner.
Fig. 15. (page 52) The effects of the absence of HSD1 on BAT. (A) In wild-type (WT) mice
housed at 21 °C and treated with an HSD1 inhibitor, the expression of the lipolytic enzymes
perilipin and carnitine palmitoyltransferase 1A (CPT1a) is upregulated, but also triglyceride
(TG) uptake into BAT is increased. The expression of Ucp1 is upregulated; whether this alters
total BAT UCP1 protein levels remains to be determined. (B) In mice lacking HSD1 (HSD1-
KO) housed at 21 °C, no differences are visible in BAT histology compared to WT mice. HSD1-
KO mice do show an increased core body temperature (BT). (C) WT mice housed at 21 °C and
treated with glucocorticoids become obese, and show an increase in lipid accumulation and a
decrease in UCP1 protein per µg protein in BAT. (D) HSD1-KO mice housed at 21 °C and treated
with glucocorticoids do not become obese, and do not show an increase in lipid accumulation
nor a decrease in UCP1 protein per µg protein in BAT.
51
52
3.6.2 Overexpression of HSD1
The effects of glucocorticoids on BAT lipid metabolism and possibly thermogenesis are
further highlighted in studies showing the effects of overexpression rather than
downregulation of HSD1.
In transgenic mice overexpressing HSD1 under control of the Fabp4 promoter-
enhancer region, HSD1 enzyme activity, and thereby the amount of active
glucocorticoid in the tissue, is increased in all adipose tissue depots, including BAT
(Masuzaki et al., 2001). BAT Ucp1 mRNA levels are significantly downregulated in
these mice (Masuzaki et al., 2001). Unfortunately, no measurements have been made of
UCP1 protein levels or in vivo thermogenic capacity of HSD1-transgenic mice.
A mouse model in which the overexpression of HSD1 is established in a more
indirect manner has also been developed. The expression of Hsd11b1 is endogenously
controlled by the lysine-specific demethylase 1 (LSD1), a corepressor that binds to the
promoter region of the Hsd11b1 gene. To reverse the inhibition of Hsd11b1 gene
expression by LSD1 and thus induce an upregulation of HSD1 protein levels, mice have
been created that lack LSD1 in all adipose tissues (Zeng et al., 2016). In these mice,
BAT Hsd11b1 mRNA levels are upregulated and BAT HSD1 enzyme activity is
increased, thus most likely leading to a higher content of active glucocorticoids in BAT
(although this has not been measured). The increased activity of BAT HSD1 in these
mice goes hand in hand with an increase in BAT mass and lipid content, a 2-fold
decrease in BAT Ucp1 mRNA levels, and a decrease in NE-induced brown adipocyte
respiration rate (Zeng et al., 2016). These effects are reversed in animals in which HSD1
is simultaneously knocked-out together with LSD1, indicating that they are the result of
the upregulation of HSD1 through the absence of LSD1.
Finally, the effects of overexpression of HSD1 on brown adipocytes have been
investigated in vitro. A 4-fold increase in HSD1 protein levels is achieved in cultured
primary brown adipocytes by lentiviral infection (Liu et al., 2013). The overexpression
of HSD1 decreases brown adipocyte Ucp1 transcription, and increases lipid droplet size
in brown adipocytes. These effects can all be reversed by successive treatment of the
cells with the HSD1 inhibitor BVT.2733, again indicating that they are due to the
increased HSD1 levels (Liu et al., 2013).
53
conclusion, measurements are needed of total thermogenic capacity in animals in which
HSD1 levels are increased and that are housed at thermoneutrality.
However, independent of the effects of glucocorticoids on UCP1, it does seem
clear that in the presence of high tissue-specific levels of glucocorticoids, lipid
accumulation in BAT is increased.
54
3.7 GLUCOCORTICOID SIGNALING:
THE GLUCOCORTICOID RECEPTOR
After the diffusion of un-bound circulating glucocorticoids into target cells, and after
the successive intracellular conversion of inactive forms of glucocorticoids into their
active forms by the HSD1 enzyme, active glucocorticoids can exert their intracellular
effects. Glucocorticoids mainly affect cellular physiology through binding to the
intracellular GR. In this chapter, I will discuss in what way the signaling of
glucocorticoids through the GR affects UCP1-dependent thermogenesis. First, I discuss
the different isoforms and the tissue distribution of the GR (Chapter 3.7.1). Next, I
discuss the function of the GR as a ligand-dependent transcription factor, i.e. the ways
in which the liganded GR can affect gene expression (Chapter 3.7.2). The effects of
pharmacological inhibition of the GR or genetic modification of the GR on BAT
functioning in rodents is discussed respectively in Chapters 3.7.3 and 3.7.4. Finally, I
discuss whether glucocorticoids may affect BAT through nongenomic signaling
pathways (Chapter 3.7.5).
55
Different isoforms of the GR have been shown to function in distinct ways. For example,
GRβ always resides in the nucleus, cannot bind glucocorticoids and does not directly
regulate gene expression, but inhibits the effects of GRα on gene expression (Kino et
al., 2009). Therefore, its level of expression within a certain tissue is believed to
determine the ability of that tissue to perceive glucocorticoid resistance. All 8 isoforms
of GRα have been detected in most tissues of mice (Lu and Cidlowski, 2005). Although
all isoforms of the GRα are capable of binding both ligand and DNA to a similar extent,
their subcellular localization and ability to recruit coregulators to target gene promoters
differs (Oakley and Cidlowski, 2011). These isoform-selective transcriptional effects
are believed to fine-tune glucocorticoid signaling and lead to tissue-specific effects of
glucocorticoids (Oakley and Cidlowski, 2011).
Forty years ago, it was discovered that BAT is also a glucocorticoid target organ
(Feldman, 1978). The GR is expressed in both pre- and mature brown adipocytes (Fig.
17), as well as in other cell types present in BAT, e.g. endothelial cells. The main GR
isoforms expressed in BAT seem to be GRα-A and GRα-B, but not GRα-C and GRα-
D (Lu and Cidlowski, 2005). No data have been published concerning the expression of
GRβ in BAT.
5 WT1 cells
Expression / Tbp
4
3 Fig. 17. The expression of Nr3c1
and Pparg in differentiating
2 WT1 cells. GR (Nr3c1) and
Pparg gene expression levels in
1 WT1 cells during day 2, 4, 6, 8 or
GR PPARg 10 of differentiation. Primers as
0 in Paper II. Data are represented
0 2 4 6 8 10 as mean ± SEM, n = 6.
Experiment performed by Yun
Days of differentiation Gao.
56
protein 70 (Hsp70), Hsp70-Hsp90 organizing protein (Hop), heat-shock protein 40
(Hsp40) and P23. The chaperone proteins facilitate the formation of GR-Hsp90
heterocomplexes, which is essential for GR’s ability to bind steroid. Hsp90, together
with the chaperone proteins, opens up GR’s steroid-binding cleft in an ATP-dependent
manner. The steroid-binding cleft remains open as long as Hsp90 is bound. Upon
binding of a glucocorticoid in the steroid-binding cleft of the GR, conformational
changes expose the GR’s nuclear localization sequences, which direct the transport of
liganded GR towards and into the nucleus. This process involves binding of the
chaperone proteins to dynein proteins that move along microtubules. The transport of
the liganded GR into the nucleus is dependent on importin proteins (Freedman and
Yamamoto, 2004). Inside the nucleus, the liganded GR may homodimerize, and
successively uses its DNA-binding domain containing two zinc-finger motifs to bind to
specific DNA sequences, named glucocorticoid response elements (GREs). Recent
research has shown that the binding of the liganded GR to a GRE and its transcriptional
activity when bound is also dependent on the GR chaperone proteins (Conway-
Campbell et al., 2011).
The binding of the GR to GREs in the promoter or enhancer regions of target
genes can elicit multiple effects. GRs can bind to GREs that either activate or repress
the transcription of target genes, in processes named transactivation and transrepression
(Ratman et al., 2013). The ‘simple’ GREs increase the transcription of target genes
through direct binding of the liganded GR and its association with coactivators (e.g.
histone acetyl transferases, C/EBP β ) (Lonard and O’Malley, 2007). Alternatively,
transactivation can occur through composite GREs or tethering GREs. The former
consist of binding sites for GR and associated binding sites for other transcription
factors. Gene transcription in this case is regulated synergistically upon binding of both
the GR and the additional transcription factor. Tethering GREs do not bind the liganded
GR, but rather attract other transcription factors that in their turn recruit the GR, thereby
indirectly activating gene transcription (e.g. NF-kB, AP-1) (Kassel and Herrlich, 2007).
Transrepression can be mediated through composite or tethering GREs in a similar
manner to transactivation. In addition, the liganded GR can bind to a response element
where another transcription factor may usually bind, and thereby in a competitive
manner block that transcription factor from binding, thus repressing transcription
(Ratman et al., 2013). It is usually assumed that transrepression does not occur through
the ‘simple’ direct binding of a liganded GR to a target gene promoter region. However,
more recent research has shown that, in several cases, the liganded GR and corepressors
do bind to negative GREs and thereby directly suppress gene transcription (Surjit et al.,
2011).
The effects of glucocorticoids on adipose tissue physiology are also mediated through
the binding of the GR to GREs in regulatory regions of target genes and thereby
57
affecting gene expression. The GR has binding sites in the regulatory regions of many
genes in WAT, as several researchers have determined by ChIP-seq analysis. In 3T3-L1
adipocytes treated with DEX, 619 genes have been shown to be regulated by
glucocorticoids (421 activated, 198 repressed) and of these, 337 contain a GRE in or
around their regulatory regions (Yu et al., 2010). Most of these genes code for proteins
involved in triglyceride synthesis as well as in lipolysis. The regulation of gene
expression by the GR has also been shown in human white adipocytes isolated from the
abdominal region and treated with DEX (Singh et al., 2015). In these cells, 123 GR
target genes have been identified, associated with 136 GREs (4 genes had multiple
GREs). For BAT, GR binding sites have previously only been determined in SV40 T-
immortalized preadipocytes isolated from murine BAT 0 and 4 hours after the induction
of differentiation (in the presence of DEX) (Park and Ge, 2017). 247 genes are
upregulated in a GR-dependent manner during this time-frame, among them many genes
that promote adipogenesis, such as the C/EBPs. In this thesis, we show in BAT isolated
from C57Bl/6 mice that also the Ucp1 gene has GR binding sites in its promoter and
enhancer regions (Paper II) (Fig. 18).
The mere presence of a GR binding site in the regulatory regions of e.g. the Ucp1 gene
does not confer any information on whether the binding of the GR will result in an up-
or down-regulation of the expression of that gene. To determine this, information has to
be obtained on the type of GRE that is present in the regulatory region.
The consensus GRE is a 6 bp inverted repeat separated by 3 nonspecific bases:
5`-AGAACAnnnTGTTCT-3` (Strähle et al., 1987). However, the GRE may be present
in several variations of this consensus sequence and may thereby differ in its affinity for
binding the liganded GR. For example, a tethering GRE does not contain a binding-site
for GR, but binding sites for other transcription factors. Correspondingly, one study
found that in human lung epithelial carcinoma cells, only 62 % of the DEX-induced
DNA-binding of GR occurs at sites containing at least one GRE (Reddy et al., 2009).
Thus, the binding of the GR on Ucp1 regulatory regions may or may not indicate the
presence of a GRE and may or may not indicate an upregulation of gene transcription.
Researchers have so far been unable to predict whether the binding of the
liganded GR to a GRE will activate or suppress the transcription of the target gene. One
indication for the future effects of the GR on transcription may however be the distance
of the specific GRE the GR binds to from the transcription start site of the target gene.
GREs are known to be present not only in the promoter region or the 5´-untranslated
region of a target gene, but also very much upstream of the target gene. Target genes the
expression of which is upregulated by the GR are much more likely to have a GRE close
to the transcription start site compared to target genes of which the expression is
downregulated by GR (Reddy et al., 2009). The nearest GR binding occurs on an
average distance of 6 kb from the transcription start site in upregulated genes and 119
58
kb from the transcription start site in downregulated genes (Reddy et al., 2009). These
very distant GREs may still affect gene expression upon GR-binding due to the looping
nature of chromatin.
The binding of GR to GREs in Ucp1 regulatory regions that we report is found
both 2-5 kb upstream of the transcription start site of Ucp1, and also around 12 to 13 kb
upstream of the Ucp1 transcription start site (Paper II) (Fig. 18). Based on the
information provided above, it may be expected that glucocorticoids upregulate the
expression of Ucp1, due to the proximity of these GR binding sites to the Ucp1
transcription start site. However, in Paper II we report on the basis of luciferase reporter
assays that upon a 24 h DEX treatment, the liganded GR actually downregulates Ucp1
gene expression through binding at a regulatory region 0-4 kb upstream of the Ucp1
transcription start site (Fig. 18). Although initially surprising, this may indicate that
there is a direct negative GRE present at this site. On the other hand, it is possible that
the binding of the GR at this site interferes or works synergistically with the binding of
factors that are present in the cell culture serum, and thereby downregulates gene
expression. Based on our reported experiments, further conclusions on this matter
cannot be drawn. From our research, it can also not be concluded whether the reported
GR binding sites in Ucp1 regulatory regions are the only ones that may influence Ucp1
gene expression. There may be additional distal GR binding sites regulating Ucp1
transcription, but we have not performed any luciferase reporter assays for GREs further
upstream than 13 kb from the Ucp1 transcription start site. Furthermore, Ucp1 gene
expression is interestingly upregulated in this system after a 48 h DEX treatment (Paper
II). What this indicates remains to be determined.
As a side note, where the liganded GR binds in the regulatory regions of target genes
may not solely be determined by the presence of GREs. Recent research suggests that
the genome-wide binding patterns of the GR also seem to be determined to a large extent
by pre-existing chromatin availability. For example, the in vitro DNA-binding of the
GR upon DEX treatment shows a high correspondence with patterns of high chromatin
availability determined in the cells pre-DEX treatment (John et al., 2011). The
availability of chromatin for the GR to bind may depend on the methylation status of
the chromatin, as it has been shown that transcription factor binding sites are often
hypomethylated (Choy et al., 2010). This may also be relevant for GR-binding in BAT.
For example. in SV40 T-immortalized preadipocytes isolated from murine BAT 4 hours
after induction of differentiation (in the presence of DEX), binding of the GR colocalizes
with H3K4me1 and H3K27ac, an enhancer mark and an active enhancer mark,
respectively (Park and Ge, 2017). Also, we show in Paper II that in BAT isolated from
C57Bl/6 mice, the DNA-binding sites of the GR around the Ucp1 gene show a high
correspondence to H3K27ac. Thus, in BAT, histone acetylation may also be a
59
determinant of where the GR will bind to the DNA, although we cannot conclude to
which extent these chromatin acetylations were already in place before GR binding.
Fig. 18. The binding of the liganded GR to Ucp1 regulatory regions. A 24 h dexamethasone
treatment induces glucocorticoid receptor (GR) translocation into the nucleus. In the nucleus, the
liganded GR binds to regulatory regions 2, 3, 4, 5, 12 and 13 kb upstream of the Ucp1 transcription
start site (TSS). The Ucp1 promoter region contains binding sites for CREB and C/EBPs (among
others), the Ucp1 distal enhancer region ~2.5 kb upstream of the TSS contains binding sites for
PPARs and ATF2 (among others). Binding of the GR to a region 0-4 kb upstream of the Ucp1 TSS
(blue box) inhibits Ucp1 gene expression.
60
this finding for the physiological functioning of UCP1-dependent thermogenesis may
be determined in models in which GR functioning is altered, for example through
pharmacological inhibition. Indeed, several groups have investigated to what extent
pharmacological inhibition of the GR in vivo and in vitro affects BAT functioning. Their
findings will be discussed here.
The most widely used pharmacological GR antagonist is the synthetic steroid
RU-38486, also known as mifepristone (here referred to as RU486). RU486 has a high
affinity for the GR, 2-3 times higher than that of DEX, and a very low dissociation rate
from its complex with the GR (t1/2 >> 24 h, DEX t1/2 = 12 h) (Gagne et al., 1985).
Consequently, RU486 fully inhibits the cellular effects of DEX. RU486 does not exhibit
any glucocorticoid agonist activity at the GR below concentrations of 10 µM in cell
culture (liver cells) and 50 mg/kg in rats (Gagne et al., 1985), and can therefore be
considered to solely exhibit antagonistic properties in most studies.
Being a non-selective inhibitor, RU486 not only blocks GR signaling, but also
blocks signaling through the progesterone receptor. Although the progesterone receptor
is predominantly expressed in reproductive organs, the bladder and smooth muscle cells,
the presence of progesterone receptor mRNA has also been reported in BAT (although
the Ct values for detection are not mentioned) and progesterone treatment may influence
BAT gene expression in vitro (Rodriguez-Cuenca et al., 2007; Rodriguez et al., 2002).
Thus, it cannot be fully ruled out that some of the reported effects of RU486 on brown
adipocyte functioning are in part a result of a reduction in progesterone receptor
signaling.
61
the inhibition of glucocorticoid signaling through the GR are also visible in mice (Fig.
19). In C57Bl/6 mice receiving RU486 in their food for 4 weeks, BAT Ucp1 mRNA
levels show a 50 % increase, BAT Pgc1a, Lpl and Cd36 mRNA levels also increase,
and BAT lipid content decreases (van den Heuvel et al., 2016) (Fig. 19). These results
indicate that even in the absence of hypercortisolism, physiological concentrations of
glucocorticoids may suppress Ucp1 transcription and may induce lipid accumulation in
BAT. These effects are reversed upon the inhibition of the GR (Fig. 19).
Interestingly, the effects of RU486 administration on BAT are visible already
after a single injection. In rats, one peripheral injection of RU486 leads to a rapid (30-
60 min) increase in O2 consumption (Hardwick et al., 1989). This increase is mediated
through the adrenergic signaling pathway, as it is prevented by prior treatment with the
b-adrenergic antagonist propranolol, and may be UCP1-dependent, as GDP-binding to
BAT mitochondria of these rats is increased (Hardwick et al., 1989). These results have
been reproduced in ob/ob mice, where a single RU486 injection increases GDP-binding
to BAT mitochondria after 120 min (Chen and Romsos, 1994). Additionally, in
adrenalectomized ob/ob mice (lacking endogenous glucocorticoid production), an acute
RU486 treatment reverses the decrease in BAT mitochondrial GDP-binding that results
from an acute DEX injection (Chen and Romsos, 1994). These rapid effects of RU486
may indicate that in normal situations, UCP1 is ‘masked’ by liganded GR, and RU486
induces an ‘unmasking’. How this manifests itself remains to be determined.
From these data, it can be concluded that glucocorticoids inhibit the expression of Ucp1
in brown adipocytes perhaps even at normal physiological circulating levels through
binding to the GR (Fig. 19). These effects most likely occur in a cell-autonomous
manner, as they occur both in vivo and in vitro. The increase in BAT lipid content seen
upon an in vivo glucocorticoid treatment (Paper I) may also be a result of glucocorticoid
signaling through the GR. Furthermore, the reversal of the glucocorticoid-induced
downregulation of Ucp1 expression by RU486 may be physiologically significant, as
RU486 treatment decreases metabolic efficiency. However, no measurements have been
made of total BAT Ucp1 mRNA or protein levels nor of whole-body UCP1-dependent
thermogenic capacity in response to RU486 treatment. Thus, whether the increase in
Ucp1 expression is real, and whether it successively affects energy expenditure in
animals housed at thermoneutrality, remains to be determined (Fig. 19).
As a side note: RU486 may exert effects on UCP1-dependent thermogenesis in
itself (i.e. independent of its GR-antagonism) when administrated in high
concentrations. In primary brown pre-adipocyte cultures differentiated in vitro and
treated with 10 µM RU486 for 24 h in serum-free medium, NE-induced Ucp1 mRNA
levels are upregulated (Rodríguez and Palou, 2004). In these cultures, basal and NE-
induced UCP1 protein levels are upregulated at an RU486 concentration >100 µM
(Rodríguez and Palou, 2004). Since there cannot be any glucocorticoids present in the
62
culture medium in serum-free conditions, it can be excluded that these effects are due
to GR antagonistic properties. Thus, they have to be due to intrinsic agonist properties
of RU486 itself. However, for most studies, this finding may be irrelevant, as RU486 is
usually supplemented at concentrations below 10 µM, and will therefore solely exhibit
receptor antagonist properties.
As mentioned above, RU486 is an antagonist for the GR, as well as for the progesterone
receptor. This lack of selectivity is an issue when RU486 is used for pharmacological
purposes, as e.g. Cushing’s patients treated with RU486 can suffer from endometrial
thickening or irregular vaginal bleeding as a result of RU486’s progesterone antagonism
(Hunt et al., 2017). In addition, also as mentioned above, RU486 exhibits partial agonist
effects when administrated in high concentrations.
Because of these disadvantages of RU486, researchers have been developing
novel, more selective GR antagonists that do not exhibit partial agonist properties. One
of these novel GR antagonists is CORT125281. This compound inhibits cellular
corticosterone signaling through the GR at an IC50 of ~500 nM (IC50 of RU486 ~50
nM, HEK293T cells), and does not affect progesterone signaling through the
progesterone receptor (Hunt et al., 2017; Kroon et al., 2018). In vivo, CORT125281
63
administration lowers plasma TG and FFA levels in mice fed a high-fat diet, and
increases whole-body fatty acid oxidation (Kroon et al., 2018). Whether this GR
antagonist affects BAT functioning has also been investigated. Similarly to the effects
of RU486, treatment with CORT125281 partially reverses the downregulation of NE-
induced Ucp1 mRNA levels by corticosterone (Kroon et al., 2018). CORT125281 also
increases FFA uptake in BAT, but simultaneously reduces lipid content (Kroon et al.,
2018). Similarly to results reported in mice supplemented with an HSD1 inhibitor, this
may indicate an enhanced lipid turnover in the absence of glucocorticoid signaling
(Berthiaume et al., 2007; Kroon et al., 2018; see Chapter 3.6). Although these results
again indicate that UCP1-dependent thermogenesis may be increased, and lipid
accumulation may be decreased, in the absence of glucocorticoid signaling through the
GR, again no measurements have been made of the thermogenic capacity of these mice.
It therefore remains unclear whether these effects lead to physiologically relevant
changes in UCP1-dependent thermogenic capacity, and also whether the increased lipid
turnover may be a result of an increase in BAT UCP1 recruitment or activation.
Another novel GR antagonist that has been investigated for its effects on BAT
physiology is C108297 (van den Heuvel et al., 2016). Interestingly, in mice fed a high-
fed diet, BAT lipid accumulation and gene expression remain unchanged compared to
control mice upon treatment with C108297 (van den Heuvel et al., 2016). These results
are in contrast to the reported effects of RU486 and CORT125281 on BAT, and thus
indicate that the effects of GR antagonism may be antagonist-specific. Nevertheless, it
is interesting to note that mice treated with CORT125281 and C108297 both show a
decrease in body weight and fat mass (van den Heuvel et al., 2016; Kroon et al., 2018).
Thus, it can be concluded that these effects happen independently of the presence or
absence of glucocorticoid signaling through the GR in BAT. From this, it can be
extrapolated that these data are in agreement with our data that show that BAT UCP1 is
dispensable for the development of glucocorticoid-induced obesity (Paper I).
64
distress and an inability to activate perinatal gluconeogenesis in the liver (Cole et al.,
1995). The remaining 10% of mice survive to adulthood but show a reduction in
catecholamine (mainly epinephrine) production in the adrenal gland (Cole et al., 1995).
A second mouse model for a whole-body knock-out of the GR was created by
crossing actin-Cre mice with mice homozygous for a loxP-flanked Nr3c1 gene (Bauerle
et al., 2018). In these mice, the embryonic development of white fat pads has been
tracked, and has been reported to develop normally (Bauerle et al., 2018). This may
indicate that GR signaling is not required for in vivo white adipogenesis.
The relevance of the whole-body presence of the GR for BAT functioning has not
been investigated in either of these two GR-KO models, most likely due to the low
number of mice that survive to adulthood. Because of the difficulties that studying the
GR-KO mouse presents, several labs have developed mouse models that allow for the
study of the significance of the presence of the GR only in adipose tissues. These are
mice in which the GR is knocked-out in an adipose tissue-specific manner (here denoted
AGR-KO).
One way of making an adipose-specific GR-KO mouse, is by crossing adiponectin-
Cre mice with GRfl/fl (exon 2 or 3 of the Nr3c1 gene) mice (Bose et al., 2016; Desarzens
and Faresse, 2016; de Kloet et al., 2015; Mueller et al., 2017; Shen et al., 2017). In these
mice, the GR is functionally knocked-out in mature brown and white adipocytes, but is
still present in the adipose tissue stromal-vascular fractions containing preadipocytes.
Knocking-out the GR in this adipose-tissue specific manner might attenuate the
development of obesity as well as the accumulation of WAT mass in response to high-
fat diet feeding and aging, but these results are still controversial (Bose et al., 2016;
Desarzens and Faresse, 2016; de Kloet et al., 2015; Mueller et al., 2017; Shen et al.,
2017). Concerning the functioning of BAT, there seems to be little difference between
AGR-KO and wild-type mice. It has been reported that AGR-KO mice show a
significantly decreased core body temperature compared to wild-type mice upon acute
cold exposure, but this may be an indication of a reduced shivering capacity rather than
a reduced UCP1-dependent thermogenic capacity, as no differences in BAT UCP1 or
respiratory complex protein levels have been reported in AGR-KO mice (Mueller et al.,
2017; Shen et al., 2017). Furthermore, in AGR-KO animals fed a high-fat diet for 14
weeks, no histological differences are observed in BAT tissues compared to wild-type
mice (Shen et al., 2017). Although these results seem to indicate that the presence of the
GR is completely dispensable for BAT functioning, a relevant function for the GR in
BAT physiology nevertheless becomes visible in situations of hypercortisolism (Fig.
20). For example, when AGR-KO mice are injected with DEX, the upregulation of the
expression of genes involved in lipolysis (Hsl, Atgl) and lipogenesis (Gpat4, Dgat2)
normally seen in BAT after DEX injections is severely blunted (Bose et al., 2016) (Fig.
20). Moreover, in contrast to wild-type mice, no lipid accumulation is seen in the BAT
of AGR-KO mice after an 8-week DEX treatment (Shen et al., 2017). These changes in
65
BAT lipid metabolism in the absence of the GR happen despite the fact that UCP1
protein levels remain unchanged (Shen et al., 2017) (Fig. 20). This thus indicates that in
situations of hypercortisolism, the glucocorticoid-induced lipid accumulation in BAT
requires signaling through the GR. However, this lipid accumulation but may be a result
of altered expression patterns of lipogenic and lipolytic enzymes rather than of a
reduction in BAT thermogenic capacity, in agreement with Paper I of this thesis.
Fig. 20. The effects of the genetic ablation of the GR in adipose tissues (AGR-KO) on BAT
functioning. (A) In wild-type (WT) mice housed at 21 °C and treated with glucocorticoids, the
expression of the lipolytic enzymes hormone-sensitive lipase (Hsl) and adipose triglyceride lipase
(Atgl), and of the lipogenic enzymes glycerol-3-phosphate acyltransferase 4 (Gpat4) and
diacylglycerol O-acyltransferase 2 (Dgat2) are upregulated in BAT. (B) In AGR-KO mice housed
at 21 °C and treated with glucocorticoids, the expression of lipolytic and lipogenic enzymes in BAT
remains unaffected, as well as the expression of Ucp1.
A second mouse model that can be used to test the necessity for glucocorticoid
signaling through the GR for BAT functioning, is a mouse model in which the GR is
deleted specifically in brown mature- and pre-adipocytes (and skeletal muscle and
interscapular WAT). This is achieved by crossing Myf5-Cre with GRfl/fl mice (here
denoted BAGR-KO) (Park and Ge, 2017). In agreement with the analysis of AGR-KO
mice, analysis of BAGR-KO mice also shows that the GR most likely has a minimal
66
role in BAT functioning when circulating glucocorticoid levels are in the physiological
range; BAGR-KO mice do not show a change in cold tolerance or cold-induced Ucp1
gene expression compared to wild-type mice (Park and Ge, 2017). The GR is also not
essential for the development of BAT, as both 18.5-day-old embryos and 6-week-old
BAGR-KO mice do not show any changed in the expression of genes used as markers
for adipogenesis or thermogenesis compared to wild-type mice.
Thus, in situations of hypercortisolism, the GR may play an important role in
regulating the accumulation of lipids in BAT. However, and surprisingly, the
transcription of BAT Ucp1 is not affected by the absence of the GR. Furthermore, under
normal physiological situations, the GR is most likely dispensable for BAT functioning.
67
Non-genomic actions of glucocorticoids in category I involve glucocorticoids altering
the biophysical properties of the plasma membrane (Fig. 21A). For example, in vivo
glucocorticoid administration decreases the fluidity of the plasma membrane in several
cell types (Gerritsen et al., 1991; Neu et al., 1986). This decrease in membrane fluidity
is associated with an increase in the cholesterol/phospholipid ratio of membrane lipids
(Gerritsen et al., 1991). Additionally, glucocorticoids may affect the function of ion
channels or receptor proteins that are embedded in the membrane (Fig. 21A). For
example, the rapid suppression of glucose-induced insulin secretion by glucocorticoids
is believed to be due to a glucocorticoid-mediated inhibition of Ca2+-channels and
thereby an inhibition of calcium influx into the cell (Billaudel et al., 1984). The actions
of glucocorticoids on the plasma membrane are so far only measurable at high doses of
glucocorticoid administration, and it is therefore questionable whether they are
physiologically relevant. However, because endogenous glucocorticoid levels increase
many-fold in response to stress, the direct effects of glucocorticoids on the plasma
membrane may be relevant in these situations.
Non-genomic actions of glucocorticoids in category II involve glucocorticoid
signaling through a plasma-membrane receptor that is distinct from the classical
cytosolic GR (Fig. 21B). The presence of this glucocorticoid signaling pathway has been
proposed after observations of rapid, non-genomic glucocorticoid-induced effects that
are only observed when cells are treated with membrane-impermeable forms of
glucocorticoids (glucocorticoids linked to bovine serum albumin (BSA) e.g. DEX-BSA,
corticosterone-BSA) (Liu et al., 2007). In addition, these rapid effects cannot be
inhibited by simultaneous treatment with a GR antagonist and do not occur when
glucocorticoids are delivered intracellularly (Liu et al., 2007). Thus, these actions are
proposed to be mediated by a glucocorticoid-binding receptor that is distinct from the
classical GR. The nature of this additional glucocorticoid-binding receptor has not been
discovered yet, but the most likely candidates have been proposed to be G protein-
coupled receptors (Groeneweg et al., 2012) (Fig. 21B). Indeed, glucocorticoid-induced
endocannabinoid synthesis depends on a Gs-cAMP-PKA signaling pathway (Di et al.,
2003). However, glucocorticoid-binding sites on the membrane vary in affinity and
selectivity for glucocorticoids, and therefore possibly consist of several non-classical
glucocorticoid-binding receptors that remain to be discovered (Groeneweg et al., 2012).
Non-genomic actions of glucocorticoids in category III involve glucocorticoid
signaling through a membrane-bound ‘classical’ cytosolic GR (Fig. 21C). The presence
of the classical GR in the plasma membrane was demonstrated in the 90’s by
experiments showing the binding of radiolabeled DEX to membrane proteins, and
successive immunoblotting with antibodies against the cytosolic GR (Gametchu et al.,
1991, 1993). The membrane-bound GR (mGR) is currently hypothesized to be
transcribed from the same gene as the cytosolic GR (Nr3c1), to undergo similar splicing
patterns as the cytosolic GR, but to undergo differential posttranslational modifications
68
that transform the cytosolic GR into a membrane protein (Strehl et al., 2011). However,
so far, no transmembrane domains or modifications that facilitate insertion of the GR
into the membrane have been found. The mGR is physiologically present only in low
numbers and is therefore challenging to detect, but is nevertheless believed to have a
significant physiological relevance. Scientists have used membrane-impermeable DEX-
BSA and corticosterone-BSA to show that mGR signaling in the brain is essential for
the rapid negative feedback of glucocorticoids on the HPA-axis (Chapter 3.3) and for
the rapid changes in adaptive behavior and memory in stressful situations (Groeneweg
et al., 2012). The rapid actions of glucocorticoids on the immune and cardiovascular
system (inhibition of inflammation and vasoconstriction) are also mediated by the mGR
(Groeneweg et al., 2012). Correspondingly, rapid, non-genomic effects of
glucocorticoids through mGR signaling are believed to align with classical
glucocorticoid effects through cytosolic GR signaling, and are therefore proposed to
‘prime’ the cell for these classical glucocorticoid effects (Vernocchi et al., 2013). How
the mGR exerts its intracellular effects is not fully known, and may vary considerably
across cells. The liganded mGR may transduce signals through p38MAP kinase, the
PI3K-Akt pathway and by altering adenylyl cyclase or ion-channel activity, but no
generally accepted model has been put forward so far (Groeneweg et al., 2012; Strehl
and Buttgereit, 2014) (Fig. 21C).
Fig. 21. Non-genomic glucocorticoid signaling. (A) Glucocorticoids may alter the biophysical
properties of the plasma membrane or may alter the functioning of ion channels or receptor proteins
that are embedded in the membrane. (B) Glucocorticoids may bind to a membrane receptor other
than the classical, cytosolic glucocorticoids receptor (GR). This receptor is most likely a GPCR
and functions through a Gs-cAMP-PKA signaling pathway. (C) Glucocorticoids may bind to a
membrane-bound classical ‘cytosolic’ GR. Hereby, they may alter AC activity, alter ion-channel
activity, or signal through P38MAPK or PI3K.
69
Concerning BAT, no rapid, nongenomic effects of glucocorticoids have been reported.
It thus remains to be determined whether any of the effects of glucocorticoids on BAT
function that we report (Paper I, Paper II) are mediated through nongenomic
mechanisms. However, the data discussed above (Chapter 3.7) do provide some
indications. For example, the phenotype of AGR-KO mice (Chapter 3.7.4) indicates that
the effects of glucocorticoid administration on lipid accumulation in BAT require
signaling through the classical GR and do not depend on nongenomic signaling
mechanisms. On the other hand, the effects of glucocorticoids on Ucp1 transcription in
brown adipocytes occur very rapidly. As shown in Paper II, DEX treatment inhibits
NE-induced Ucp1 transcription in primary brown adipocytes and WT1 cells within 24
h after treatment. In unpublished data, we have shown that even when DEX is added
simultaneously with NE 2 hours before harvest of the cells, Ucp1 transcription is
inhibited in primary brown adipocytes (experiments by Ana Lukic). However, these
effects still occur within the time-frame required for genomic signaling to occur. Indeed,
when DEX is added only 1 hour before harvest, NE-induced Ucp1 transcription remains
unaltered (Soumano et al., 2000). In addition, the inhibition of Ucp1 transcription by
glucocorticoids can be reversed by RU486 (Chapter 3.7.3). Thus, the effects of
glucocorticoids on BAT are most likely mediated through classical, cytosolic GR
signaling, with little or no role for non-genomic GR signaling.
70
3.8.1 Extrapolating rodent data to humans
The first factor that complicates direct extrapolation of rodent data to humans, is that
the notion that glucocorticoids always suppress BAT thermogenesis in rodents is false.
As we show in Paper I, in mice housed at 21 °C, the increased sympathetic output to
BAT (needed to activate the production of heat) overrules any suppressive effects of
glucocorticoids on BAT UCP1 protein levels. This effect only becomes visible upon
calculation of total IBAT UCP1 protein levels. Thus, in order to draw any conclusions
about physiologically relevant BAT UCP1 levels, it is crucial to include this calculation
in the analysis of the data. Because none of the studies mentioned above include this
calculation, it can be assumed that at least part of the conclusions drawn from these
studies about the effects of glucocorticoids on BAT in rodents are erroneous. Thus, it
may be speculated that also in humans, hypercortisolism does not affect total BAT
UCP1 protein levels.
Second, it has to be considered that the vast majority of the studies mentioned
above has been executed on rodents housed at 21 °C. As mentioned in Chapter 2, this
temperature is ~ 10 °C below the thermoneutral zone of mice, and thus causes a
continuous activation of thermoregulatory energy expenditure, followed by a
continuous compensatory increase in food intake. Humans, on the other hand, spend the
vast majority of their lives at thermoneutrality and thus do not expend extra energy or
consequently increase their food intake to defend their body temperature. Thus, even if
a ‘true’ glucocorticoid-induced decrease in total BAT UCP1 protein levels would have
been reported in mice housed at 21 °C, the applicability of this finding to humans would
be questionable. To circumvent this issue, we report the effects of glucocorticoids on
BAT in mice housed at thermoneutrality (30 °C) (Paper I). These mice can thus be said
to be thermally humanized. At this temperature, glucocorticoids do suppress the
transcription of Ucp1 in BAT, ultimately leading to a functionally lower total BAT
UCP1 protein content. This indicates that glucocorticoids may indeed also lower total
BAT UCP1 protein content in thermoneutral humans. However, it still remains to be
determined whether this affects the development of glucocorticoid-induced obesity, as
we show in rodents that glucocorticoid-induced obesity develops independently of
UCP1 (Paper I).
71
patient-groups suffering from cortisol-producing adenomas and secondary
hypercortisolism (33.3 % and 16.7 % respectively) than in patient-groups suffering from
aldosterone-producing adenomas, pheochromocytomas and non-functioning adenomas
(46.9 %, 62.5 % and 100 % respectively) (Betz et al., 2013). In addition, in the same
study, a trend was found for a negative correlation between urinary cortisol secretion
and retroperitoneal UCP1 expression (P=0.094) (Betz et al., 2013). The prevalence of
BAT-positive individuals is also decreased in patients receiving chronic glucocorticoid
medication (1.7 %) compared to matched controls (6.7 %) (Ramage et al., 2016). These
findings suggest that long-term hypercortisolism suppress BAT function (or at least
18
FDG uptake) in humans.
In addition to these observational studies, an experimental study has been
published in which healthy volunteers received long-term exogenous glucocorticoid
supplementation. In this double-blind cross-over placebo-controlled trial, 18FDG uptake
in BAT, as well as supraclavicular skin temperature, in response to cooling (19 °C) was
found to be decreased in individuals pre-treated with oral prednisolone for 7 days
(Thuzar et al., 2018) (Fig. 22A). Although both of these measurements do not
necessarily provide information about BAT thermogenic capacity, they do provide an
indication that BAT functioning in humans responds to long-term glucocorticoid
treatment in a manner similar to that in rodents.
Interestingly, the effects of glucocorticoids on human BAT seem to be strongly
time-dependent. Specifically, a more short-term infusion with hydrocortisone (14 h)
leads to an increased basal and isoprenaline-induced supraclavicular skin temperature
(Scotney et al., 2017). Short-term (36 h, 10 mg every 12 h) administration with
prednisolone also increases 8FDG uptake in BAT activated by exposure to mild cold (16
– 17 °C) (Ramage et al., 2016) (Fig. 22B). This increase occurs despite a decrease in
whole-body 18FDG uptake. Additionally, the same short-term prednisolone
supplementation leads to an increased supraclavicular skin temperature upon cold
exposure (Ramage et al., 2016) (Fig. 22B). These data indicate that, in contrast to results
reported for long-term hypercortisolism, short-term spikes in glucocorticoid levels may
increase BAT thermogenesis in humans.
The effects of glucocorticoids on human brown adipocytes have also been
investigated in vitro. In primary cultures of supraclavicular human brown adipocytes
differentiated for 9 days in the presence of 10 µM DEX, basal Ucp1 as well as Cidea
and Ppargc1a mRNA levels are upregulated (Barclay et al., 2015). In primary cultures
of deep supraclavicular human BAT, 24 h treatment with 100 nM cortisol also increases
basal Ucp1 and Glut4 levels (Ramage et al., 2016). In contrast, a 5 h DEX treatment
significantly suppresses the adrenergically-induced upregulation of Ucp1 expression
and uncoupled VO2 rate in mature primary brown adipocytes (Barclay et al., 2015).
Thus, basal Ucp1 expression in human adipocytes is affected by glucocorticoids in a
manner distinct from in rodent adipocytes (i.e. increased), whereas adrenergically-
72
induced Ucp1 expression is affected by glucocorticoids similarly in human and rodent
adipocytes (i.e. decreased).
The length of the glucocorticoid treatment also seems to influence experimental
outcomes in vitro. For example, whereas 24 h treatment with 100 nM cortisol increases
basal Ucp1 expression in human adipocytes, 48 h treatment with the same dose of
cortisol does not (Ramage et al., 2016). Moreover, 24 h treatment with 1 µM cortisol
also leaves Ucp1 gene expression unaffected, and 48 h 1 µM treatment even decreases
basal Ucp1 mRNA levels (Ramage et al., 2016).
Thus, although most studies indicate that also in humans, glucocorticoids may
suppress BAT function, this effect is probably both time- and dose-dependent. In
addition, no human study has reported to what extent alterations in BAT activity affect
the development of glucocorticoid-induced obesity.
73
74
CONCLUSIONS AND
FUTURE PERSPECTIVES
Recruiting and activating UCP1-dependent thermogenesis is a key strategy to increase energy
expenditure, and thereby possibly to lower body weight. Studies aiming to identify novel
modulators of UCP1-dependent thermogenesis are vital if we want to harness UCP1-dependent
thermogenic energy expenditure in the battle against obesity and obesity-related diseases.
However, in order to obtain meaningful results, it is important that such studies are executed
under optimal experimental conditions. When studying thermal physiology at temperatures
below thermoneutrality, any changes in e.g. insulation, shivering capacity, etc. due to genetic
mutations or compound supplementation have to be taken into account. Moreover, we find that
the only relevant thermogenic measure for physiological purposes is that of total, whole-body,
thermogenic capacity, thus including e.g. measurements of total BAT UCP1 protein.
In experiments executed in line with the guidelines above, we find that UCP1 mediates
facultative diet-induced thermogenesis in obesity-resistant mice fed a Western style diet, and
thus prevents these mice from gaining as much weight as they would in the absence of UCP1
(Paper V). It remains to be determined to what extent UCP1-dependent facultative diet-induced
thermogenesis also prevents weight gain in humans.
We further present two novel research models that, when experimented with under the
appropriate conditions, can be used to identify novel modulators of UCP1 (Papers II, III).
Especially the Thermomouse can facilitate the screening of compounds for their effects on
Ucp1 transcription, and can further be used in studies regarding UCP1 and aging.
We investigate the potential of glucocorticoids to modulate UCP1-dependent
thermogenesis (Papers I, II). Although we find that glucocorticoids are important regulators
of lipid metabolism in BAT, the proposed suppression of UCP1-dependent thermogenesis by
glucocorticoids is questionable. In situations of physiological circulating glucocorticoid levels,
BAT thermogenesis (but not lipid metabolism) remains unaffected by the absence of HSD1 or
of the GR. Upon glucocorticoid administration at temperatures below thermoneutrality, UCP1
protein per µg BAT protein is decreased, but not total UCP1 protein or whole-body thermogenic
capacity. In mice housed at thermoneutrality, glucocorticoids functionally decrease total UCP1
protein. This most likely happens independently of the adrenergic signaling pathway, but
through direct binding of the liganded GR to Ucp1 regulatory regions. The exact mechanism
behind this remains to be determined, but the physiological impact may be minimal.
The studies of murine ‘classical’ BAT (rather than murine brite fat) presented here
imply that certain modulators of UCP1-dependent thermogenesis may affect body weight also
in humans. However, we show that the amount of UCP1 protein does not affect the development
of glucocorticoid-induced obesity in mice. Thus, even though the effects of glucocorticoids on
human brown adipocytes remain to be further specified, the modulation of UCP1-dependent
thermogenesis may not be the answer to reducing obesity induced by glucocorticoids.
75
76
SAMMANFATTNING
PÅ SVENSKA
77
vi upptäckt två nya gener som är viktiga vid reglering av UCP1-genuttryck, nämligen
Mtus1 och Kcnk3, och substansen WWL113, som modulerar värmeproduktionen av
UCP1 i brunt fett.
78
NEDERLANDSE
SAMENVATTING
Het rekruteren en activeren van warmteproductie door bruin vetweefsel wordt gezien
als een nieuwe strategie om overgewicht en ziektes gerelateerd aan overgewicht tegen
te gaan. De warmte die bruin vetweefsel produceert wordt gegenereerd door Uncoupling
Protein-1 (UCP1), een eiwit dat gevonden wordt in de mitochondriën van uitsluitend
bruine vetcellen. Na rekrutering en activatie zorgt UCP1 ervoor dat de oxidatie van
nutriënten losgekoppeld wordt van de productie van ATP. Dit betekent dat alle energie
uit nutriënten wordt omgezet in hitte in plaats van in ATP, en dus wordt verspild. Als
we de verspilling van energie door bruin vetweefsel willen gebruiken als een manier om
gewicht te verliezen, zullen we de productie van hitte door bruin vetweefsel moeten
rekruteren en activeren. Tot nu toe is blootstelling aan kou de voornaamste manier die
we kennen om dit doel te bewerkstelligen. Echter, vanwege het oncomfortabele karakter
van blootstelling aan kou is het noodzaak om nieuwe manieren te ontdekken waarop
bruin vet geactiveerd of gerekruteerd kan worden. Het doel van dit proefschrift is om
een dieper inzicht te verschaffen in verschillende nieuwe factoren en processen die hitte
productie door UCP1 in bruin vet moduleren.
We onderzoeken in hoeverre glucocorticoïden de capaciteit van muizen
beïnvloeden om hitte te produceren via UCP1 in bruin vet. Als we muizen behandelen
met glucocorticoïden, zien we een duidelijke reductie in de hoeveelheid UCP1 eiwit in
bruin vet, maar alleen wanneer de muizen thermoneutraal zijn gehuisvest. Dit is een
nieuw inzicht dat hier voor de eerste keer gerapporteerd wordt. We laten zien dat
glucocorticoïden de genetische expressie van UCP1 verminderen doordat de receptor
voor glucocorticoïden direct bindt aan genetische sequenties die de expressie van UCP1
reguleren. We laten ook zien dat het overgewicht dat zich ontwikkelt ten gevolge van
de behandeling met glucocorticoïden niet beïnvloed wordt door de hoeveelheid UCP1
eiwit in bruin vet.
Hiernaast onderzoeken we ook het effect van verschillende diëten op de
rekrutering en activatie van UCP1 in bruin vet. We laten zien dat muizen die normaal
gesproken resistent zijn voor obesitas meer UCP1 eiwit in hun bruin vet krijgen als ze
gevoed worden met een dieet met een hoog vetpercentage. Als we deze muizen
genetisch modificeren zodat ze geen UCP1 eiwit meer bezitten, worden ze dikker dan
muizen die wel UCP1 eiwit hebben. Dit laat zien dat de rekrutering en activatie van
UCP1 in bruin vet ten gevolge van de consumptie van diëten met veel vet een belangrijk
mechanisme is tegen de ontwikkeling van obesitas.
79
Tenslotte presenteren we twee nieuwe modellen die gebruikt kunnen worden om
nieuwe factoren te ontdekken die hitte productie door UCP1 in bruin vet moduleren. De
eerste is een cellijn gemaakt van humane bruine vetcellen, de tweede is een muis die het
eiwit ‘luciferase’ tot expressie brengt onder de genetische promoter van UCP1. Met
behulp van deze modellen hebben we twee nieuwe genen ontdekt die belangrijk zijn in
de regulatie van UCP1 genexpressie, namelijk Mtus1 en Kcnk3, en het stofje WWL113,
dat hitte productie door UCP1 in bruin vet moduleert.
80
ACKNOWLEDGEMENTS
Doing a PhD is a long and sometimes frustrating process, and requires hard work and
dedication. As is the case for most PhD students, I experienced ups and downs during my PhD,
as well as periods of struggle and success. Throughout it all, I have been extremely fortunate to
have been surrounded by people who shared both the good and the bad with me, and sometimes
believed in me more than I believed in myself. Here, I thank all the people that have helped me,
supported me, and made me laugh during my PhD.
Jan and Barbara, I have thoroughly enjoyed spending the past years in the presence of two
people who have such a passion for science. Thank you for providing me with the opportunity
and the liberty to pursue my own research interests in your lab. Thank you for providing me
with an example of what thorough, honest science looks like. And thank you for helping me in
more ways than your job requires.
Tore, your enthusiasm and passion are contagious. I’m very happy I got to observe a tiny
fraction of what doing science outside of academia looks like. Thank you for checking up on
me every once in a while, and thank you for making sure everyone’s glasses are always filled
during our annual parties.
Anders, I’d like to think that you and I share a sort of epicurean life philosophy; the importance
of enjoying life should never be underestimated. Thank you for sharing parts of your wisdom
with me and for giving me advice when I needed it.
Martin, I wish I could stay around longer to see how your enthusiasm and vision will change
the way F3 works. Thank you for your scientific input, advice and Jägermeister. Also, I think
in Edinburgh I will never experience a shortage of niederschlag.
Laura, Kim, Ankita, Katie, even though I was supposed to be your teacher, you all have taught
me invaluable lessons. Thank you for all your enthusiasm and perseverance while working side-
by-side with me in the lab. You have truly contributed so much to my time as a PhD student,
and all your hard work has really pushed my science forward. I have no doubt in my mind that
you will all go far in life, please keep me updated on your whereabouts.
81
really come to appreciate your peculiar sense of humor. Even though I know your comments
are usually not meant to be jokes, they make me laugh and I will miss them. I wish you the best
of luck in your PhD studies and everything you will do after, I hope you get to live your version
of ‘the dream’. Jasper, het ging niet zonder slag of stoot, maar het lab heeft tegen alle
verwachting in nog soort van gefunctioneerd na je vertrek. Bedankt voor al je advies,
Nederlandse grappen en stroopwafels, en welkom terug in Zweden. Alex, I’ve learned to never
say goodbye when you leave, because you always appear again somehow somewhere. Even
though I get a bit frustrated when you’re around because you’re so much further ahead than the
average, miserable PhD student, the fact that we have so much fun together makes me hope that
we’ll be colleagues in science for a long time to come. Robert, Bo, thank you for organizing,
fixing, helping, cooking, drinking, writing, operating, decorating, ordering, and most of all:
preventing F3 from falling apart. Gabriella, thank you for supervising me during my very first
months in Stockholm, and for making the work so interesting that I decided to come back and
do my PhD here. Yun, thank you for helping me with my experiments when I ran out of time.
Good luck with your PhD studies! Gustavo, Josh, Ollie, Thomas, Marie, Noemi, Petr,
Patricia, Vera, Tania, Yanling, René, Antonia, Mette, Adriana, thank you all for your
science, jokes, and good times both inside and outside of the lab. Work would’ve been a lot
more boring without you.
Group Jacobsson:
Amanda, my bubbles, after all these years. Your unique outlook on life has fascinated me ever
since I’ve met you. I’m so happy we’ve grown into being close friends and I get to benefit from
your wisdom, life lessons, passion and continuous quest for fun (plus). I’m not going to wish
you good luck because I know you have all the tools you need to fulfill your dreams, you don’t
need luck. I hope I’ll be friends with you and Ludde for a long time. Anna, bubbles, it was so
nice to share an office with you. Thank you for your kindness, support and hugs when I needed
them. Abbeeeee, you are a man full of interesting theories that have enriched my life to a
variable extent. Thank you for regularly sneaking me into the staff gym when I didn’t have an
access card. All the best in your second career! Necati, Hoi, thank you for the fun you brought
to the F3 corridor!
Group(s) Bengtsson:
Nodi, Carina, I’m so grateful that I got to share an office with such strong women for so many
years. You have given me advice on so many matters; you ladies are so full of wisdom. Thank
you for putting up with me during the times I was ridiculously stressed out, I do truly apologize
for being a pain in the ass. Please continue to rule the world. Emanuela, my Italian sorella, I’m
happy we managed to solve our communication problems and ended up being family. I know
you’re still just as shocked as I am that nobody actually believes we’re sisters. I’m happy to
know that there’s someone wandering around on this planet that is the complete opposite of me
in literally everything. Grazie mille. Anastasia, Russian, you are the living proof that it is harder
to move from Sweden than it is to move to Sweden. Thank you for continuously being my
friend throughout my time here, for being funny, and for carrying our watermelon all around
Sicily. Hamzo, ‘God’s gift to humanity’, the lab would be a lot more boring without you. I
admire your choice for continuous optimism and your perseverance. You’re the only person I
82
know that actually becomes more motivated when nothing in the lab works. I’m looking
forward to seeing you change the world. Alice, thank you for our cozy discussion evenings.
Even though our wine consumption sometimes impeded the philosophizing, they have really
enriched my life. Anna S, Jessica, without you I would’ve never understood the importance of
having fika. I will do my best to export fika to Scotland and make you proud. Mia, your
perseverance and courage are inspiring, good luck with your next adventure! Jelena, thank you
for your kindness and for being helpful. The best of luck with your PhD studies! Benjamin,
Terik, Boubacar, thank you for opening my eyes to what real-life applications of molecular
bioscience might look like. I’m excited to see where Atrogi and Sigrid Therapeutics will go!
Sten, Emma, Kimmie, Sofia, Elisabete, Natalia, Mohammed, Anette, Jon, Deeptha, thank
you for lightening up the corridor during the times you spent at F3, you made working here so
much more fun!
Group Jastroch:
It feels food to be able to leave F3 with the peace of mind knowing that the lab is in good hands.
Susi, I’m sorry for turning our office into a tropical oasis on a regular basis, I secretly still
suspect you of breaking my heater. I wish you the best of luck with starting your own group,
you will be an awesome group leader! Michael, Merik, I’m a little jealous that you guys still
have your whole PhD adventure ahead of you. In between the science and stress, don’t forget
to also have fun! Maria, the lab is sparkling like it has never sparkled before because of your
hard work. I already can’t remember how F3 has ever functioned without you, you rock!
Michaela, the silent force in F3, thank you for being an inspiring scientist!
Animal house staff: Over the years, you made all the many transitions between animal
facilities run smoothly, thank you for always providing the best environment possible for both
the mice and the scientists. Also thank you for taking great care of all my little guys and for
helping me catch them when they escaped.
Basic course & C-course students: thank you for being so enthusiastic about measuring your
pulse and blood pressure, for contributing to the lab during your practical course works, and for
not completely electrocuting each other during the frog labs. Summer school students: thank
you for asking the simplest questions that were often the hardest to answer. You helped me
realize that really mastering a topic includes being able to teach it in the most basic way
possible.
The Kajimura lab: Shingo, Kosaku, Si, Nyasha, Linet, Dylan, Louis, Svetlana, Haemin,
Kana, Haruya. I have learned an unbelievable amount in the year I had the pleasure to work
with you guys in San Francisco. You have all been so helpful and generous in teaching me
everything you know. Thank you, thank you, thank you.
Hanna, Björn, Greg, Thibaud, Richie, and everyone else I’ve regularly had a beer with
after work: Thank you for showing me there’s also a life outside of the lab. If I could I would
take all of you with me to Edinburgh, but since that’s not possible, please come visit me!
83
Karin, thank you for changing my perspective on the world and on myself.
EJC Decaux! Pien, Petra, Erik, Lennart, Bartjan, Alex, Flore, Tim. Bedankt dat jullie me
na al die jaren nog niet helemaal vergeten zijn. Hoewel we na onze studententijd allemaal ouder
en (soort van) wijzer zijn geworden, ben ik blij dat het vaak nog net zo chaotisch is als 10 jaar
geleden als we elkaar weer zien. Ik hoop dat dat over nog eens 10 jaar nog zo is.
De miepjes: Marieke, Marlies, Sander, Angeline, Marita. Hoewel jullie tijdens colleges voor
de nodige afleiding hebben gezorgd, is het uiteindelijk toch nog goed gekomen met me.
Dankjulliewel voor de altijd gezellige reünies in Nederland, ik vind het superleuk om te zien
hoe we allemaal terecht zijn gekomen post-Wageningen. Marlies, onze tripjes zijn spannend,
maar toch ook fijn, en altijd een hoogtepunt van mijn jaar. Laten we de traditie vooral
voortzetten! Marieke, ik ben blij dat ik een deel van mijn tijd in Stockholm met je heb kunnen
delen. Kom je ook mee naar Edinburgh?
Mijn familie:
Bart, bedankt dat je altijd tijd vrij maakt voor een kleine reünie als ik in Nederland ben. Ik
vrees dat we het de komende 4 jaar daarmee moeten blijven doen, maar hopelijk zien we elkaar
daarna vaker. Mo, ik ben blij dat ik het lief en leed van mijn PhD met Dr. Luijten heb kunnen
delen, zelfs al was het dan voornamelijk via Skype. Je weet dat je mijn allerliefste zus bent, en
ik hoop dat we elkaar in de toekomst weer vaker in het echt kunnen knoevelen. Anna, Weizhen,
I’m very fortunate that my siblings have such an excellent taste in human beings, thank you for
being great additions to the Luijten family. Pap, Marie-Thérèse, bedankt voor al jullie
viennetta, app-spam, advies en onvoorwaardelijke liefde en steun. Hoe stressvol het leven soms
mag zijn, het helpt om te weten dat ik altijd bij jullie terecht kan, ongeacht wat mijn plannen
voor de toekomst zijn. Mam, door de jaren heen heb je altijd voor me klaargestaan, vooral op
de momenten dat ik het het meest nodig had. Bedankt voor je onvoorwaardelijke liefde en steun.
Ook al woon ik ver weg, je weet dat het altijd wederzijds zal zijn.
84
REFERENCES
Anbalagan, M., Huderson, B., Murphy, L., and Rowan, B.G. (2012). Post-translational modifications of
nuclear receptors and human disease. Nucl. Recept. Signal. 10.
Arvaniti, K., Ricquier, D., Champigny, O., and Richard, D. (1998). Leptin and Corticosterone Have
Opposite Effects on Food Intake and the Expression of UCP1 mRNA in Brown Adipose Tissue of lep
ob
/lep ob Mice. Endocrinology 139, 4000–4003.
Balsalobre, A., Brown, S.A., Marcacci, L., Tronche, F., Kellendonk, C., Reichardt, H.M., Schütz, G.,
and Schibler, U. (2000). Resetting of circadian time in peripheral tissues by glucocorticoid signaling.
Science 289, 2344–2347.
Barbatelli, G., Murano, I., Madsen, L., Hao, Q., Jimenez, M., Kristiansen, K., Giacobino, J.P., De
Matteis, R., and Cinti, S. (2010). The emergence of cold-induced brown adipocytes in mouse white fat
depots is determined predominantly by white to brown adipocyte transdifferentiation. Am. J. Physiol.
Metab. 298, E1244–E1253.
Barclay, J.L., Agada, H., Jang, C., Ward, M., Wetzig, N., and Ho, K.K.Y. (2015). Effects of
glucocorticoids on human brown adipocytes. J. Endocrinol. 224, 139–147.
Bartelt, A., Bruns, O.T., Reimer, R., Hohenberg, H., Ittrich, H., Peldschus, K., Kaul, M.G., Tromsdorf,
U.I., Weller, H., Waurisch, C., et al. (2011). Brown adipose tissue activity controls triglyceride
clearance. Nat. Med. 17, 200–205.
Bartness, T.J., Vaughan, C.H., and Song, C.K. (2010). Sympathetic and sensory innervation of brown
adipose tissue. Int. J. Obes. 34, S36–S42.
Bauerle, K.T., Hutson, I., Scheller, E.L., and Harris, C.A. (2018). Glucocorticoid Receptor Signaling Is
Not Required for In Vivo Adipogenesis. Endocrinology 159, 2050–2061.
Berthiaume, M., Laplante, M., Festuccia, W.T., Cianflone, K., Turcotte, L.P., Joanisse, D.R.,
Olivecrona, G., Thieringer, R., and Deshaies, Y. (2007). 11β-HSD1 inhibition improves triglyceridemia
through reduced liver VLDL secretion and partitions lipids toward oxidative tissues. Am. J. Physiol.
Metab. 293, E1045–E1052.
Betz, M.J., Slawik, M., Lidell, M.E., Osswald, A., Heglind, M., Nilsson, D., Lichtenauer, U.D.,
Mauracher, B., Mussack, T., Beuschlein, F., et al. (2013). Presence of Brown Adipocytes in
Retroperitoneal Fat From Patients With Benign Adrenal Tumors: Relationship With Outdoor
Temperature. J. Clin. Endocrinol. Metab. 98, 4097–4104.
van den Beukel, J.C., Grefhorst, A., Quarta, C., Steenbergen, J., Mastroberardino, P.G., Lombès, M.,
Delhanty, P.J., Mazza, R., Pagotto, U., van der Lely, A.J., et al. (2014). Direct activating effects of
adrenocorticotropic hormone (ACTH) on brown adipose tissue are attenuated by corticosterone. FASEB
J. 28, 4857–4867.
Billaudel, B., and Sutter, B.C. (1979). Direct Effect of Corticosterone upon Insulin Secretion Studied
by Three Different Techniques. Horm. Metab. Res. 11, 555–560.
Billaudel, B., Mathias, P.C., Sutter, B.C., and Malaisse, W.J. (1984). Inhibition by corticosterone of
calcium inflow and insulin release in rat pancreatic islets. J. Endocrinol. 100, 227–233.
Birnbacher, L., Maurer, S., Scheidt, K., Herzen, J., Pfeiffer, F., and Fromme, T. (2018). Electron Density
of Adipose Tissues Determined by Phase-Contrast Computed Tomography Provides a Measure for
Mitochondrial Density and Fat Content. Front. Physiol. 9, 707.
Biswas, H.M. (2017). Effect of adrenocorticotropic hormone on UCP1 gene expression in brown
85
adipocytes. J. Basic Clin. Physiol. Pharmacol. 28, 267–274.
Bose, S.K., Hutson, I., and Harris, C.A. (2016). Hepatic Glucocorticoid Receptor Plays a Greater Role
Than Adipose GR in Metabolic Syndrome Despite Renal Compensation. Endocrinology 157, 4943–
4960.
Bouillaud, F., Alves-Guerra, M.-C., and Ricquier, D. (2016). UCPs, at the interface between
bioenergetics and metabolism. Biochim. Biophys. Acta - Mol. Cell Res. 1863, 2443–2456.
Breuner, C.W., and Orchinik, M. (2002). Plasma binding proteins as mediators of corticosteroid action
in vertebrates. J. Endocrinol. 175, 99–112.
Bryan, T.M., and Reddel, R.R. (1994). SV40-induced immortalization of human cells. Crit. Rev. Oncog.
5, 331–357.
Cannon, B., and Nedergaard, J. (2004). Brown Adipose Tissue: Function and Physiological
Significance. Physiol. Rev. 84, 277–359.
Cannon, B., and Nedergaard, J. (2011). Nonshivering thermogenesis and its adequate measurement in
metabolic studies. J. Exp. Biol. 214, 242–253.
Cao, W., Daniel, K.W., Robidoux, J., Puigserver, P., Medvedev, A. V, Bai, X., Floering, L.M.,
Spiegelman, B.M., and Collins, S. (2004). p38 mitogen-activated protein kinase is the central regulator
of cyclic AMP-dependent transcription of the brown fat uncoupling protein 1 gene. Mol. Cell. Biol. 24,
3057–3067.
Cato, A.C.B., Nestl, A., and Mink, S. (2002). Rapid actions of steroid receptors in cellular signaling
pathways. Sci. STKE 2002, re9.
Chan, W.L., Carrell, R.W., Zhou, A., and Read, R.J. (2013). How changes in affinity of corticosteroid-
binding globulin modulate free cortisol concentration. J. Clin. Endocrinol. Metab. 98, 3315–3322.
Chechi, K., Voisine, P., Mathieu, P., Laplante, M., Bonnet, S., Picard, F., Joubert, P., and Richard, D.
(2017). Functional characterization of the Ucp1-associated oxidative phenotype of human epicardial
adipose tissue. Sci. Rep. 7, 15566.
Chen, H.C., and Farese, R. V. (1999). Steroid hormones: Interactions with membrane-bound receptors.
Curr. Biol. 9, R478–R481.
Chen, H.L., and Romsos, D.R. (1994). Type II glucocorticoid receptors in the CNS regulate metabolism
in ob/ob mice independent of protein synthesis. Am. J. Physiol. 266, E427-32.
Cheng, Y., Jiang, L., Keipert, S., Zhang, S., Hauser, A., Graf, E., Strom, T., Tschöp, M., Jastroch, M.,
and Perocchi, F. (2018). Prediction of Adipose Browning Capacity by Systematic Integration of
Transcriptional Profiles. Cell Rep. 23, 3112–3125.
Choy, M.-K., Movassagh, M., Goh, H.-G., Bennett, M.R., Down, T.A., and Foo, R.S.Y. (2010).
Genome-wide conserved consensus transcription factor binding motifs are hyper-methylated. BMC
Genomics 11, 519.
Cinti, S. (2012). The adipose organ at a glance. Dis. Model. Mech. 5, 588–594.
Cole, T.J., Blendy, J.A., Monaghan, A.P., Krieglstein, K., Schmid, W., Aguzzi, A., Fantuzzi, G.,
Hummler, E., Unsicker, K., and Schütz, G. (1995). Targeted disruption of the glucocorticoid receptor
gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev.
9, 1608–1621.
Cole, T.J., Myles, K., Purton, J.F., Brereton, P.S., Solomon, N.M., Godfrey, D.I., and Funder, J.W.
(2001). GRKO mice express an aberrant dexamethasone-binding glucocorticoid receptor, but are
profoundly glucocorticoid resistant. Mol. Cell. Endocrinol. 173, 193–202.
Conway-Campbell, B.L., George, C.L., Pooley, J.R., Knight, D.M., Norman, M.R., Hager, G.L., and
Lightman, S.L. (2011). The HSP90 Molecular Chaperone Cycle Regulates Cyclical Transcriptional
Dynamics of the Glucocorticoid Receptor and Its Coregulatory Molecules CBP/p300 During Ultradian
86
Ligand Treatment. Mol. Endocrinol. 25, 944–954.
Coudray, C., Charon, C., Komas, N., Mory, G., Diot-Dupuy, F., Manganiello, V., Ferre, P., and Bazin,
R. (1999). Evidence for the presence of several phosphodiesterase isoforms in brown adipose tissue of
Zucker rats: modulation of PDE2 by the fa gene expression. FEBS Lett. 456, 207–210.
Cypess, A.M., and Kahn, C.R. (2010). Brown fat as a therapy for obesity and diabetes. Curr. Opin.
Endocrinol. Diabetes. Obes. 17, 143–149.
Cypess, A.M., Lehman, S., Williams, G., Tal, I., Rodman, D., Goldfine, A.B., Kuo, F.C., Palmer, E.L.,
Tseng, Y.-H., Doria, A., et al. (2009). Identification and Importance of Brown Adipose Tissue in Adult
Humans. N. Engl. J. Med. 360, 1509–1517.
Cypess, A.M., White, A.P., Vernochet, C., Schulz, T.J., Xue, R., Sass, C.A., Huang, T.L., Roberts-
Toler, C., Weiner, L.S., Sze, C., et al. (2013). Anatomical localization, gene expression profiling and
functional characterization of adult human neck brown fat. Nat. Med. 19, 635–639.
Desarzens, S., and Faresse, N. (2016). Adipocyte glucocorticoid receptor has a minor contribution in
adipose tissue growth. J. Endocrinol. 230, 1–11.
Di, S., Malcher-Lopes, R., Halmos, K.C., and Tasker, J.G. (2003). Nongenomic glucocorticoid
inhibition via endocannabinoid release in the hypothalamus: a fast feedback mechanism. J. Neurosci.
23, 4850–4857.
Doig, C.L., Fletcher, R.S., Morgan, S.A., McCabe, E.L., Larner, D.P., Tomlinson, J.W., Stewart, P.M.,
Philp, A., and Lavery, G.G. (2017). 11β-HSD1 Modulates the Set Point of Brown Adipose Tissue
Response to Glucocorticoids in Male Mice. Endocrinology 158, 1964–1976.
Dubuc, P. (1977). Basal Corticosterone Levels of Young ob/ob Mice. Horm. Metab. Res. 9, 95–97.
Dumontet, T., Sahut-Barnola, I., Septier, A., Montanier, N., Plotton, I., Roucher-Boulez, F., Ducros, V.,
Lefrançois-Martinez, A.-M., Pointud, J.-C., Zubair, M., et al. (2018). PKA signaling drives reticularis
differentiation and sexually dimorphic adrenal cortex renewal. JCI Insight 3.
Enerbäck, S., Jacobsson, A., Simpson, E.M., Guerra, C., Yamashita, H., Harper, M.-E., and Kozak, L.P.
(1997). Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 387,
90–94.
von Essen, G., Lindsund, E., Cannon, B., and Nedergaard, J. (2017). Adaptive facultative diet-induced
thermogenesis in wild-type but not in UCP1-ablated mice. Am. J. Physiol. Endocrinol. Metab. 313,
E515–E527.
Fawcett, D.W., and Jones, I.C. (1949). The effects of hypophysectomy, adrenalectomy and of thiouracil
feeding on the cytology of brown adipose tissue. Endocrinology 45, 609–621.
Feig, P.U., Shah, S., Hermanowski-Vosatka, A., Plotkin, D., Springer, M.S., Donahue, S., Thach, C.,
Klein, E.J., Lai, E., and Kaufman, K.D. (2011). Effects of an 11β-hydroxysteroid dehydrogenase type 1
inhibitor, MK-0916, in patients with type 2 diabetes mellitus and metabolic syndrome. Diabetes, Obes.
Metab. 13, 498–504.
Feldman, D. (1978). Evidence that Brown Adipose Tissue Is a Glucocorticoid Target Organ.
Endocrinology 103, 2091–2097.
Feldmann, H.M., Golozoubova, V., Cannon, B., and Nedergaard, J. (2009). UCP1 Ablation Induces
Obesity and Abolishes Diet-Induced Thermogenesis in Mice Exempt from Thermal Stress by Living at
Thermoneutrality. Cell Metab. 9, 203–209.
Finlin, B.S., Memetimin, H., Confides, A.L., Kasza, I., Zhu, B., Vekaria, H.J., Harfmann, B., Jones,
K.A., Johnson, Z.R., Westgate, P.M., et al. (2018). Human adipose beiging in response to cold and
mirabegron. JCI Insight 3.
Fischer, A.W., Hoefig, C.S., Abreu-Vieira, G., de Jong, J.M.A., Petrovic, N., Mittag, J., Cannon, B.,
and Nedergaard, J. (2016). Leptin Raises Defended Body Temperature without Activating
Thermogenesis. Cell Rep. 14, 1621–1631.
87
Fischer, A.W., Shabalina, I.G., Mattsson, C.L., Abreu-Vieira, G., Cannon, B., Nedergaard, J., and
Petrovic, N. (2017). UCP1 inhibition in Cidea-overexpressing mice is physiologically counteracted by
brown adipose tissue hyperrecruitment. Am J Physiol Endocrinol Metab 312, 72–87.
Foster, D.O. (1984). Quantitative contribution of brown adipose tissue thermogenesis to overall
metabolism. Can. J. Biochem. Cell Biol. 62, 618–622.
Freedman, N.D., and Yamamoto, K.R. (2004). Importin 7 and importin alpha/importin beta are nuclear
import receptors for the glucocorticoid receptor. Mol. Biol. Cell 15, 2276–2286.
Frontini, A., and Cinti, S. (2010). Distribution and Development of Brown Adipocytes in the Murine
and Human Adipose Organ. Cell Metab. 11, 253–256.
Füchsl, A.M., Langgartner, D., and Reber, S.O. (2013). Mechanisms Underlying the Increased Plasma
ACTH Levels in Chronic Psychosocially Stressed Male Mice. PLoS One 8, e84161.
Funder, J.W. (2005). Mineralocorticoid Receptors: Distribution and Activation. Heart Fail. Rev. 10, 15–
22.
Gagne, D., Pons, M., and Philibert, D. (1985). RU 38486: a potent antiglucocorticoid in vitro and in
vivo. J. Steroid Biochem. 23, 247–251.
Gametchu, B., Watson, C.S., and Pasko, D. (1991). Size and steroid-binding characterization of
membrane-associated glucocorticoid receptor in S-49 lymphoma cells. Steroids 56, 402–410.
Gametchu, B., Watson, C.S., and Wu, S. (1993). Use of receptor antibodies to demonstrate membrane
glucocorticoid receptor in cells from human leukemic patients. FASEB J. 7, 1283–1292.
Garthwaite, T.L., Martinson, D.R., Tseng, L.F., Hagen, T.C., and Menahan, L.A. (1980). A longitudinal
hormonal profile of the genetically obese mouse. Endocrinology 107, 671–676.
Gasparini, S.J., Weber, M.-C., Henneicke, H., Kim, S., Zhou, H., and Seibel, M.J. (2016). Continuous
corticosterone delivery via the drinking water or pellet implantation: A comparative study in mice.
Steroids 116, 76–82.
Gerritsen, M.E., Schwarz, S.M., and Medow, M.S. (1991). Glucocorticoid-mediated alterations in
fluidity of rabbit cardiac muscle microvessel endothelial cell membranes: influences on eicosanoid
release. Biochim. Biophys. Acta 1065, 63–68.
Golozoubova, V., Hohtola, E., Matthias, A., Jacobsson, A., Cannon, B., and Nedergaard, J. (2001). Only
UCP1 can mediate adaptive nonshivering thermogenesis in the cold. FASEB J. 15, 2048–2050.
Gomez-Sanchez, E., and Gomez-Sanchez, C.E. (2014). The multifaceted mineralocorticoid receptor.
Compr. Physiol. 4, 965–994.
Graja, A., and Schulz, T.J. (2015). Mechanisms of aging-related impairment of brown adipocyte
development and function. Gerontology 61, 211–217.
Groeneweg, F.L., Karst, H., de Kloet, E.R., and Joëls, M. (2012). Mineralocorticoid and glucocorticoid
receptors at the neuronal membrane, regulators of nongenomic corticosteroid signalling. Mol. Cell.
Endocrinol. 350, 299–309.
Guerra, C., Koza, R.A., Yamashita, H., Walsh, K., and Kozak, L.P. (1998). Emergence of brown
adipocytes in white fat in mice is under genetic control. Effects on body weight and adiposity. J. Clin.
Invest. 102, 412–420.
Gulfo, J., Ledda, A., Serra, E., Cabot, C., Esteve, M., and Grasa, M. (2016). Altered lipid partitioning
and glucocorticoid availability in CBG-deficient male mice with diet-induced obesity. Obesity 24,
1677–1686.
Hanukoglus, I., Feuchtwanger, R., and Hanukogluq, A. (1990). Mechanism of Corticotropin and CAMP
Induction of Mitochondrial Cytochrome P450 System Enzymes in Adrenal Cortex Cells. J. Biol. Chem.
265, 199.
Hardwick, A.J., Linton, E.A., and Rothwell, N.J. (1989). Thermogenic Effects of the Antiglucocorticoid
88
RU-486 in the Rat: Involvement of Corticotropin-Releasing Factor and Sympathetic Activation of
Brown Adipose Tissue. Endocrinology 124, 1684–1688.
Harms, M., and Seale, P. (2013). Brown and beige fat: development, function and therapeutic potential.
Nat. Med. 19, 1252–1263.
Herrmann, M., Henneicke, H., Street, J., Modzelewski, J., Kalak, R., Buttgereit, F., Dunstan, C.R., Zhou,
H., and Seibel, M.J. (2009). The challenge of continuous exogenous glucocorticoid administration in
mice. Steroids 74, 245–249.
van den Heuvel, J.K., Boon, M.R., van Hengel, I., Peschier-van der Put, E., van Beek, L., van Harmelen,
V., van Dijk, K.W., Pereira, A.M., Hunt, H., Belanoff, J.K., et al. (2016). Identification of a selective
glucocorticoid receptor modulator that prevents both diet-induced obesity and inflammation. Br. J.
Pharmacol. 173, 1793–1804.
Himms-Hagen, J., and Desautels, M. (1978). A mitochondrial defect in brown adipose tissue of the
obese (ob/ob) mouse: reduced binding of purine nucleotides and a failure to respond to cold by an
increase in binding. Biochem. Biophys. Res. Commun. 83, 628–634.
Hinds, T.D., Ramakrishnan, S., Cash, H.A., Stechschulte, L.A., Heinrich, G., Najjar, S.M., Sanchez,
E.R., and Sanchez, E.R. (2010). Discovery of glucocorticoid receptor-beta in mice with a role in
metabolism. Mol. Endocrinol. 24, 1715–1727.
Hogan, S., and Himms-Hagen, J. (1980). Abnormal brown adipose tissue in obese (ob/ob) mice:
response to acclimation to cold. Am. J. Physiol. 239, E301–E309.
Holmes, P. V, and Dickson, A.D. (1971). X-zone degeneration in the adrenal glands of adult and
immature female mice. J. Anat. 108, 159–168.
Holt, S., and York, D. (1984). Effect of Adrenalectomy on Brown Adipose Tissue of Obese (ob/ob)
Mice. Horm. Metab. Res. 16, 378–379.
Holt, S., and York, D.A. (1982). The effect of adrenalectomy on GDP binding to brown-adipose-tissue
mitochondria of obese rat. Biochem. J. 208, 819–822.
Holt, S.J., and York, D.A. (1989). The effects of adrenalectomy, corticotropin releasing factor and
vasopressin on the sympathetic firing rate of nerves to interscapular brown adipose tissue in the Zucker
rat. Physiol. Behav. 45, 1123–1129.
Holt, S., York, D.A., and Fitzsimons, J.T. (1983). The effects of corticosterone, cold exposure and
overfeeding with sucrose on brown adipose tissue of obese Zucker rats (fa/fa). Biochem. J. 214, 215–
223.
Hunt, H.J., Belanoff, J.K., Walters, I., Gourdet, B., Thomas, J., Barton, N., Unitt, J., Phillips, T., Swift,
D., and Eaton, E. (2017). Identification of the Clinical Candidate ( R )-(1-(4-Fluorophenyl)-6-((1-
methyl-1 H -pyrazol-4-yl)sulfonyl)-4,4a,5,6,7,8-hexahydro-1 H -pyrazolo[3,4- g ]isoquinolin-4a-yl)(4-
(trifluoromethyl)pyridin-2-yl)methanone (CORT125134): A Selective Glucocorticoid Receptor (GR)
Antagonist. J. Med. Chem. 60, 3405–3421.
Infante, M., Armani, A., Mammi, C., Fabbri, A., and Caprio, M. (2017). Impact of Adrenal Steroids on
Regulation of Adipose Tissue. In Comprehensive Physiology, (Hoboken, NJ, USA: John Wiley & Sons,
Inc.), pp. 1425–1447.
Iwen, K.A.H., Senyaman, O., Schwartz, A., Drenckhan, M., Meier, B., Hadaschik, D., and Klein, J.
(2008). Melanocortin crosstalk with adipose functions: ACTH directly induces insulin resistance,
promotes a pro-inflammatory adipokine profile and stimulates UCP-1 in adipocytes. J. Endocrinol. 196,
465–472.
Jespersen, N.Z., Larsen, T.J., Peijs, L., Daugaard, S., Homøe, P., Loft, A., de Jong, J., Mathur, N.,
Cannon, B., Nedergaard, J., et al. (2013). A classical brown adipose tissue mRNA signature partly
overlaps with brite in the supraclavicular region of adult humans. Cell Metab. 17, 798–805.
John, K., Marino, J.S., Sanchez, E.R., Hinds, T.D., and Jr. (2016). The glucocorticoid receptor: cause
89
of or cure for obesity? Am. J. Physiol. Endocrinol. Metab. 310, E249-57.
John, S., Sabo, P.J., Thurman, R.E., Sung, M.-H., Biddie, S.C., Johnson, T.A., Hager, G.L., and
Stamatoyannopoulos, J.A. (2011). Chromatin accessibility pre-determines glucocorticoid receptor
binding patterns. Nat. Genet. 43, 264–268.
de Jong, J.M.., Sun, W., Pires, N.., Frontini, A., Balaz, M., Petrovic, K., Fischer, A.W., Bokhari, M..,
Niemi, T., Nuutila, P., et al. Human brown adipose tissue is phenocopied by classical brown (but not
beige) adipose tissue in physiologically humanized mice. Submitted.
de Jong, J.M.A., Larsson, O., Cannon, B., and Nedergaard, J. (2015). A stringent validation of mouse
adipose tissue identity markers. Am. J. Physiol. Metab. 308, E1085–E1105.
Kadmiel, M., and Cidlowski, J.A. (2013). Glucocorticoid receptor signaling in health and disease.
Trends Pharmacol. Sci. 34, 518–530.
Kalinovich, A. V., de Jong, J.M.A., Cannon, B., and Nedergaard, J. (2017). UCP1 in adipose tissues:
two steps to full browning. Biochimie 134, 127–137.
Kargi, A.Y., and Iacobellis, G. (2014). Adipose tissue and adrenal glands: novel pathophysiological
mechanisms and clinical applications. Int. J. Endocrinol. 2014, 614074.
Kassel, O., and Herrlich, P. (2007). Crosstalk between the glucocorticoid receptor and other
transcription factors: Molecular aspects. Mol. Cell. Endocrinol. 275, 13–29.
Keipert, S., and Jastroch, M. (2014). Brite/beige fat and UCP1 — is it thermogenesis? Biochim.
Biophys. Acta - Bioenerg. 1837, 1075–1082.
Kershaw, E.E., Morton, N.M., Dhillon, H., Ramage, L., Seckl, J.R., and Flier, J.S. (2005). Adipocyte-
Specific Glucocorticoid Inactivation Protects Against Diet-Induced Obesity. Diabetes 54, 1023–1031.
Kim, H.K., and Romsos, D.R. (1990). Adrenalectomy increases brown adipose tissue metabolism in
ob/ob mice housed at 35 degrees C. Am. J. Physiol. 259, E362-9.
Kino, T., Su, Y.A., and Chrousos, G.P. (2009). Human glucocorticoid receptor isoform β: recent
understanding of its potential implications in physiology and pathophysiology. Cell. Mol. Life Sci. 66,
3435–3448.
de Kloet, A.D., Krause, E.G., Solomon, M.B., Flak, J.N., Scott, K.A., Kim, D.-H., Myers, B., Ulrich-
Lai, Y.M., Woods, S.C., Seeley, R.J., et al. (2015). Adipocyte glucocorticoid receptors mediate fat-to-
brain signaling. Psychoneuroendocrinology 56, 110–119.
Knehans, A.W., and Romsos, D.R. (1982). Reduced norepinephrine turnover in brown adipose tissue of
ob/ob mice. Am. J. Physiol. Metab. 242, E253–E261.
Kotelevtsev, Y., Holmes, M.C., Burchell, A., Houston, P.M., Schmoll, D., Jamieson, P., Best, R.,
Brown, R., Edwards, C.R., Seckl, J.R., et al. (1997). 11beta-hydroxysteroid dehydrogenase type 1
knockout mice show attenuated glucocorticoid-inducible responses and resist hyperglycemia on obesity
or stress. Proc. Natl. Acad. Sci. U. S. A. 94, 14924–14929.
Kroon, J., Koorneef, L.L., van den Heuvel, J.K., Verzijl, C.R.C., van de Velde, N.M., Mol, I.M., Sips,
H.C.M., Hunt, H., Rensen, P.C.N., and Meijer, O.C. (2018). Selective Glucocorticoid Receptor
Antagonist CORT125281 Activates Brown Adipose Tissue and Alters Lipid Distribution in Male Mice.
Endocrinology 159, 535–546.
Labbé, S.M., Caron, A., Bakan, I., Laplante, M., Carpentier, A.C., Lecomte, R., and Richard, D. (2015).
In vivo measurement of energy substrate contribution to cold-induced brown adipose tissue
thermogenesis. FASEB J. 29, 2046–2058.
Lachance, J., and Page, E. (1953). Hormonal factors influencing fat deposition in the interscapular
brown adipose tissue of the white rat. Endocrinology 52, 57–64.
Lean, M.E. (1989). Brown adipose tissue in humans. Proc. Nutr. Soc. 48, 243–256.
Lee, M.-J., Pramyothin, P., Karastergiou, K., and Fried, S.K. (2014). Deconstructing the roles of
90
glucocorticoids in adipose tissue biology and the development of central obesity. Biochim. Biophys.
Acta 1842, 473–481.
Lee, P., Zhao, J.T., Swarbrick, M.M., Gracie, G., Bova, R., Greenfield, J.R., Freund, J., and Ho, K.K.Y.
(2011). High Prevalence of Brown Adipose Tissue in Adult Humans. J. Clin. Endocrinol. Metab. 96,
2450–2455.
Lee, Y.-H., Petkova, A.P., Konkar, A.A., and Granneman, J.G. (2015). Cellular origins of cold-induced
brown adipocytes in adult mice. FASEB J. 29, 286–299.
Li, G., Hernandez-Ono, A., Crooke, R.M., Graham, M.J., and Ginsberg, H.N. (2012). Antisense
reduction of 11β-hydroxysteroid dehydrogenase type 1 enhances energy expenditure and insulin
sensitivity independent of food intake in C57BL/6J mice on a Western-type diet. Metabolism 61, 823–
835.
Lidell, M.E., Betz, M.J., Leinhard, O.D., Heglind, M., Elander, L., Slawik, M., Mussack, T., Nilsson,
D., Romu, T., Nuutila, P., et al. (2013). Evidence for two types of brown adipose tissue in humans. Nat.
Med. 19, 631–634.
Liu, J., Kong, X., Wang, L., Qi, H., Di, W., Zhang, X., Wu, L., Chen, X., Yu, J., Zha, J., et al. (2013).
Essential roles of 11β-HSD1 in regulating brown adipocyte function. J. Mol. Endocrinol. 50, 103–113.
Liu, L., Wang, C., Ni, X., and Sun, J. (2007). A rapid inhibition of NMDA receptor current by
corticosterone in cultured hippocampal neurons. Neurosci. Lett. 420, 245–250.
Livingston, J.N., and Lockwood, D.H. (1975). Effect of Glucocorticoids on the Glucose Transport
System of Isolated Fat Cells. J. Biol. Chem. 250, 8353–8360.
Lonard, D.M., and O’Malley, B.W. (2007). Nuclear Receptor Coregulators: Judges, Juries, and
Executioners of Cellular Regulation. Mol. Cell 27, 691–700.
Long, J.Z., Svensson, K.J., Tsai, L., Zeng, X., Roh, H.C., Kong, X., Rao, R.R., Lou, J., Lokurkar, I.,
Baur, W., et al. (2014). A Smooth Muscle-Like Origin for Beige Adipocytes. Cell Metab. 19, 810–820.
Lu, N.Z., and Cidlowski, J.A. (2005). Translational Regulatory Mechanisms Generate N-Terminal
Glucocorticoid Receptor Isoforms with Unique Transcriptional Target Genes. Mol. Cell 18, 331–342.
Mao, L., Nie, B., Nie, T., Hui, X., Gao, X., Lin, X., Liu, X., Xu, Y., Tang, X., Yuan, R., et al. (2017).
Visualization and Quantification of Browning Using a Ucp1-2A-Luciferase Knock-in Mouse Model.
Diabetes 66, 407–417.
Marchington, D., Rothwell, N.J., Stock, M.J., and York, D.A. (1983). Energy balance, diet-induced
thermogenesis and brown adipose tissue in lean and obese (fa/fa) Zucker rats after adrenalectomy. J.
Nutr. 113, 1395–1402.
Margioris, A.N., and Tsatsanis, C. (2000). ACTH Action on the Adrenals (MDText.com, Inc.).
van Marken Lichtenbelt, W.D., and Schrauwen, P. (2011). Implications of nonshivering thermogenesis
for energy balance regulation in humans. Am. J. Physiol. Integr. Comp. Physiol. 301, R285–R296.
van Marken Lichtenbelt, W.D., Vanhommerig, J.W., Smulders, N.M., Drossaerts, J.M.A.F.L.,
Kemerink, G.J., Bouvy, N.D., Schrauwen, P., and Teule, G.J.J. (2009). Cold-Activated Brown Adipose
Tissue in Healthy Men. N. Engl. J. Med. 360, 1500–1508.
Martin, R.J., Wangsness, P.J., and Gahagan, J.H. (1978). Diurnal changes in serum metabolites and
hormones in lean and obese Zucker rats. Horm. Metab. Res. 10, 187–192.
Masuzaki, H., Paterson, J., Shinyama, H., Morton, N.M., Mullins, J.J., Seckl, J.R., and Flier, J.S. (2001).
A transgenic model of visceral obesity and the metabolic syndrome. Science 294, 2166–2170.
Mendel, C.M. (1989). The Free Hormone Hypothesis: A Physiologically Based Mathematical Model.
Endocr. Rev. 10, 232–274.
Milagro, F.I., Campión, J., and Martínez, J.A. (2007). 11-β Hydroxysteroid dehydrogenase type 2
expression in white adipose tissue is strongly correlated with adiposity. J. Steroid Biochem. Mol. Biol.
91
104, 81–84.
Moisan, M.-P. (2010). Genotype–phenotype associations in understanding the role of corticosteroid-
binding globulin in health and disease animal models. Mol. Cell. Endocrinol. 316, 35–41.
Morgan, S.A., McCabe, E.L., Gathercole, L.L., Hassan-Smith, Z.K., Larner, D.P., Bujalska, I.J.,
Stewart, P.M., Tomlinson, J.W., and Lavery, G.G. (2014). 11β-HSD1 is the major regulator of the tissue-
specific effects of circulating glucocorticoid excess. Proc. Natl. Acad. Sci. U. S. A. 111, E2482-91.
Morrison, S.F. (2016). Central neural control of thermoregulation and brown adipose tissue. Auton.
Neurosci. 196, 14–24.
Morton, N.M., Paterson, J.M., Masuzaki, H., Holmes, M.C., Staels, B., Fievet, C., Walker, B.R., Flier,
J.S., Mullins, J.J., and Seckl, J.R. (2004). Novel adipose tissue-mediated resistance to diet-induced
visceral obesity in 11 beta-hydroxysteroid dehydrogenase type 1-deficient mice. Diabetes 53, 931–938.
Mousovich-Neto, F., Matos, M.S., Costa, A.C.R., de Melo Reis, R.A., Atella, G.C., Miranda-Alves, L.,
Carvalho, D.P., Ketzer, L.A., and Corrêa da Costa, V.M. (2019). Brown adipose tissue remodeling
induced by corticosterone in Wistar male rats. Exp. Physiol.
Mueller, K.M., Hartmann, K., Kaltenecker, D., Vettorazzi, S., Bauer, M., Mauser, L., Amann, S., Jall,
S., Fischer, K., Esterbauer, H., et al. (2017). Adipocyte Glucocorticoid Receptor Deficiency Attenuates
Aging- and HFD-Induced Obesity and Impairs the Feeding-Fasting Transition. Diabetes 66, 272–286.
Naeser, P. (1975). Structure of the adrenal glands in mice with the obese-hyperglycaemic syndrome
(gene symbol ob). Acta Pathol. Microbiol. Scand. A. 83, 120–126.
Nedergaard, J., and Cannon, B. (2013a). How brown is brown fat? It depends where you look. Nat. Med.
19, 540–541.
Nedergaard, J., and Cannon, B. (2013b). UCP1 mRNA does not produce heat. Biochim. Biophys. Acta
1831, 943–949.
Nedergaard, J., Golozoubova, V., Matthias, A., Asadi, A., Jacobsson, A., and Cannon, B. (2001). UCP1:
the only protein able to mediate adaptive non-shivering thermogenesis and metabolic inefficiency.
Biochim. Biophys. Acta 1504, 82–106.
Nedergaard, J., Bengtsson, T., and Cannon, B. (2007). Unexpected evidence for active brown adipose
tissue in adult humans. Am. J. Physiol. Metab. 293, E444–E452.
Neu, J., Ozaki, C.K., and Angelides, K.J. (1986). Glucocorticoid-mediated alteration of fluidity of brush
border membrane in rat small intestine. Pediatr. Res. 20, 79–82.
Oakley, R.H., and Cidlowski, J.A. (2011). Cellular Processing of the Glucocorticoid Receptor Gene and
Protein: New Mechanisms for Generating Tissue-specific Actions of Glucocorticoids. J. Biol. Chem.
286, 3177–3184.
Oakley, R.H., Sar, M., and Cidlowski, J.A. (1996). The Human Glucocorticoid Receptor Isoform. J.
Biol. Chem. 271, 9550–9559.
Okada, S., Onai, T., Kilroy, G., York, D.A., and Bray, G.A. (1993). Adrenalectomy of the obese Zucker
rat: effects on the feeding response to enterostatin and specific mRNA levels. Am. J. Physiol. Integr.
Comp. Physiol. 265, R21–R27.
Oster, H., Damerow, S., Kiessling, S., Jakubcakova, V., Abraham, D., Tian, J., Hoffmann, M.W., and
Eichele, G. (2006). The circadian rhythm of glucocorticoids is regulated by a gating mechanism residing
in the adrenal cortical clock. Cell Metab. 4, 163–173.
Pagnon, J., Matzaris, M., Stark, R., Meex, R.C.R., Macaulay, S.L., Brown, W., O’Brien, P.E., Tiganis,
T., and Watt, M.J. (2012). Identification and Functional Characterization of Protein Kinase A
Phosphorylation Sites in the Major Lipolytic Protein, Adipose Triglyceride Lipase. Endocrinology 153,
4278–4289.
Park, Y.-K., and Ge, K. (2017). Glucocorticoid Receptor Accelerates, but Is Dispensable for,
92
Adipogenesis. Mol. Cell. Biol. 37, e00260-16.
Pasieka, A.M., and Rafacho, A. (2016). Impact of Glucocorticoid Excess on Glucose Tolerance: Clinical
and Preclinical Evidence. Metabolites 6, 24.
Peckett, A.J., Wright, D.C., and Riddell, M.C. (2011). The effects of glucocorticoids on adipose tissue
lipid metabolism. Metabolism 60, 1500–1510.
Peng, K., Pan, Y., Li, J., Khan, Z., Fan, M., Yin, H., Tong, C., Zhao, Y., Liang, G., and Zheng, C.
(2016). 11β-Hydroxysteroid Dehydrogenase Type 1(11β-HSD1) mediates insulin resistance through
JNK activation in adipocytes. Sci. Rep. 6, 37160.
Perdikari, A., Leparc, G.G., Balaz, M., Pires, N.D., Lidell, M.E., Sun, W., Fernandez-Albert, F., Müller,
S., Akchiche, N., Dong, H., et al. (2018). BATLAS: Deconvoluting Brown Adipose Tissue. Cell Rep.
25, 784–797.e4.
Perogamvros, I., Ray, D.W., and Trainer, P.J. (2012). Regulation of cortisol bioavailability—effects on
hormone measurement and action. Nat. Rev. Endocrinol. 8, 717–727.
Petersen, H.H., Andreassen, T.K., Breiderhoff, T., Brasen, J.H., Schulz, H., Gross, V., Grone, H.-J.,
Nykjaer, A., and Willnow, T.E. (2006). Hyporesponsiveness to Glucocorticoids in Mice Genetically
Deficient for the Corticosteroid Binding Globulin. Mol. Cell. Biol. 26, 7236–7245.
Pratt, W.B., Morishima, Y., Murphy, M., and Harrell, M. (2006). Chaperoning of Glucocorticoid
Receptors. Handb. Exp. Pharmacol. 111–138.
Ramage, L.E., Akyol, M., Fletcher, A.M., Forsythe, J., Nixon, M., Carter, R.N., van Beek, E.J.R.,
Morton, N.M., Walker, B.R., and Stimson, R.H. (2016). Glucocorticoids Acutely Increase Brown
Adipose Tissue Activity in Humans, Revealing Species-Specific Differences in UCP-1 Regulation. Cell
Metab. 24, 130–141.
Ratman, D., Vanden Berghe, W., Dejager, L., Libert, C., Tavernier, J., Beck, I.M., and De Bosscher, K.
(2013). How glucocorticoid receptors modulate the activity of other transcription factors: A scope
beyond tethering. Mol. Cell. Endocrinol. 380, 41–54.
Reddy, T.E., Pauli, F., Sprouse, R.O., Neff, N.F., Newberry, K.M., Garabedian, M.J., and Myers, R.M.
(2009). Genomic determination of the glucocorticoid response reveals unexpected mechanisms of gene
regulation. Genome Res. 19, 2163–2171.
Rockall, A.G., Sohaib, S.A., Evans, D., Kaltsas, G., Isidori, A.M., Monson, J.P., Besser, G.M.,
Grossman, A.B., and Reznek, R.H. (2003). Computed tomography assessment of fat distribution in male
and female patients with Cushing’s syndrome. Eur. J. Endocrinol. 149, 561–567.
Rodriguez-Cuenca, S., Monjo, M., Frontera, M., Gianotti, M., Proenza, A.M., and Roca, P. (2007). Sex
steroid receptor expression profile in brown adipose tissue. Effects of hormonal status. Cell. Physiol.
Biochem. 20, 877–886.
Rodriguez, A.M., Monjo, M., Roca, P., and Palou, A. (2002). Opposite actions of testosterone and
progesterone on UCP1 mRNA expression in cultured brown adipocytes. Cell. Mol. Life Sci. 59, 1714–
1723.
Rodríguez, A.M., and Palou, A. (2004). The steroid RU486 induces UCP1 expression in brown
adipocytes. Pflügers Arch. - Eur. J. Physiol. 449, 170–174.
Rosenwald, M., Perdikari, A., Rülicke, T., and Wolfrum, C. (2013). Bi-directional interconversion of
brite and white adipocytes. Nat. Cell Biol. 15, 659–667.
Rothwell, N.J., and Stock, M.J. (1979). A role for brown adipose tissue in diet-induced thermogenesis.
Nature 281, 31–35.
Rothwell, N.J., and Stock, M.J. (1985). Acute and chronic effects of ACTH on thermogenesis and brown
adipose tissue in the rat. Comp. Biochem. Physiol. A. Comp. Physiol. 81, 99–102.
Rowland, L.A., Maurya, S.K., Bal, N.C., Kozak, L., and Periasamy, M. (2016). Sarcolipin and
93
uncoupling protein 1 play distinct roles in diet-induced thermogenesis and do not compensate for one
another. Obesity (Silver Spring). 24, 1430–1433.
Sack, G.H., and Obie, C. (1981). Human cell transformation by simian virus 40. Biologic features of
cloned lines. Exp. Cell Res. 134, 425–432.
Sahut-Barnola, I., de Joussineau, C., Val, P., Lambert-Langlais, S., Damon, C., Lefrançois-Martinez,
A.-M., Pointud, J.-C., Marceau, G., Sapin, V., Tissier, F., et al. (2010). Cushing’s Syndrome and Fetal
Features Resurgence in Adrenal Cortex–Specific Prkar1a Knockout Mice. PLoS Genet. 6, e1000980.
Saito, M. (2013). Brown adipose tissue as a regulator of energy expenditure and body fat in humans.
Diabetes Metab. J. 37, 22–29.
Saito, M., and Bray, G.A. (1983). Diurnal rhythm for corticosterone in obese (ob/ob) diabetes (db/db)
and gold-thioglucose-induced obesity in mice. Endocrinology 113, 2181–2185.
Sanchez-Gurmaches, J., and Guertin, D.A. (2014). Adipocytes arise from multiple lineages that are
heterogeneously and dynamically distributed. Nat. Commun. 5, 4099.
Schnabl, K., Westermeier, J., Li, Y., and Klingenspor, M. (2019). Opposing Actions of
Adrenocorticotropic Hormone and Glucocorticoids on UCP1-Mediated Respiration in Brown
Adipocytes. Front. Physiol. 9, 1931.
Scotney, H., Symonds, M.E., Law, J., Budge, H., Sharkey, D., and Manolopoulos, K.N. (2017).
Glucocorticoids modulate human brown adipose tissue thermogenesis in vivo. Metabolism 70, 125–
132.
Seale, P., Bjork, B., Yang, W., Kajimura, S., Chin, S., Kuang, S., Scimè, A., Devarakonda, S., Conroe,
H.M., Erdjument-Bromage, H., et al. (2008). PRDM16 controls a brown fat/skeletal muscle switch.
Nature 454, 961–967.
Sears, I.B., MacGinnitie, M.A., Kovacs, L.G., and Graves, R.A. (1996). Differentiation-dependent
expression of the brown adipocyte uncoupling protein gene: regulation by peroxisome proliferator-
activated receptor gamma. Mol. Cell. Biol. 16, 3410–3419.
Sellers, E.A., Scott, J.W., and Thomas, N. (1954). Electrical Activity of Skeletal Muscle of Normal and
Acclimatized Rats on Exposure to Cold. Am. J. Physiol. 177, 372–376.
Shabalina, I.G., Ost, M., Petrovic, N., Vrbacky, M., Nedergaard, J., and Cannon, B. (2010). Uncoupling
protein-1 is not leaky. Biochim. Biophys. Acta - Bioenerg. 1797, 773–784.
Shabalina, I.G., Petrovic, N., de Jong, J.M.A., Kalinovich, A.V., Cannon, B., and Nedergaard, J. (2013).
UCP1 in Brite/Beige Adipose Tissue Mitochondria Is Functionally Thermogenic. Cell Rep. 5, 1196–
1203.
Shargill, N., Lupien, J., and Bray, G. (1989). Adrenalectomy in Genetically Obese ob/ob and db/db Mice
Increases the Proton Conductance Pathway. Horm. Metab. Res. 21, 463–467.
Sharma, S.T., Nieman, L.K., and Feelders, R.A. (2015). Cushing’s syndrome: epidemiology and
developments in disease management. Clin. Epidemiol. 7, 281–293.
Sharp, L.Z., Shinoda, K., Ohno, H., Scheel, D.W., Tomoda, E., Ruiz, L., Hu, H., Wang, L., Pavlova, Z.,
Gilsanz, V., et al. (2012). Human BAT Possesses Molecular Signatures That Resemble Beige/Brite
Cells. PLoS One 7, e49452.
Shay, J.W., and Wright, W.E. (1989). Quantitation of the frequency of immortalization of normal human
diploid fibroblasts by SV40 large T-antigen. Exp. Cell Res. 184, 109–118.
Shen, Y., Roh, H.C., Kumari, M., and Rosen, E.D. (2017). Adipocyte glucocorticoid receptor is
important in lipolysis and insulin resistance due to exogenous steroids, but not insulin resistance caused
by high fat feeding. Mol. Metab. 6, 1150–1160.
Shi, F., and Collins, S. (2017). Second messenger signaling mechanisms of the brown adipocyte
thermogenic program: an integrative perspective. Horm. Mol. Biol. Clin. Investig. 31.
94
Sidossis, L.S., Porter, C., Saraf, M.K., Børsheim, E., Radhakrishnan, R.S., Chao, T., Ali, A.,
Chondronikola, M., Mlcak, R., Finnerty, C.C., et al. (2015). Browning of Subcutaneous White Adipose
Tissue in Humans after Severe Adrenergic Stress. Cell Metab. 22, 219–227.
Singh, P., Brock, C.O., Volden, P.A., Hernandez, K., Skor, M., Kocherginsky, M., Park, J.E., Brady,
M.J., and Conzen, S.D. (2015). Glucocorticoid receptor ChIP-sequencing of subcutaneous fat reveals
modulation of inflammatory pathways. Obesity (Silver Spring). 23, 2286–2293.
So, A.Y.-L., Bernal, T.U., Pillsbury, M.L., Yamamoto, K.R., and Feldman, B.J. (2009). Glucocorticoid
regulation of the circadian clock modulates glucose homeostasis. Proc. Natl. Acad. Sci. U. S. A. 106,
17582–17587.
Solomon, J., Bradwin, G., Cocchia, M.A., Coffey, D., Condon, T., Garrity, W., and Grieco, W. (1977).
Effects of adrenalectomy on body weight and hyperglycemia in five months old Ob/Ob mice. Horm.
Metab. Res. 9, 152–156.
Soumano, K., Desbiens, S., Rabelo, R., Bakopanos, E., Camirand, A., and Silva, J.E. (2000).
Glucocorticoids inhibit the transcriptional response of the uncoupling protein-1 gene to adrenergic
stimulation in a brown adipose cell line. Mol. Cell. Endocrinol. 165, 7–15.
Strähle, U., Klock, G., and Schütz, G. (1987). A DNA sequence of 15 base pairs is sufficient to mediate
both glucocorticoid and progesterone induction of gene expression. Proc. Natl. Acad. Sci. U. S. A. 84,
7871–7875.
Strehl, C., and Buttgereit, F. (2014). Unraveling the functions of the membrane-bound glucocorticoid
receptors: first clues on origin and functional activity. Ann. N. Y. Acad. Sci. 1318, 1–6.
Strehl, C., Gaber, T., Löwenberg, M., Hommes, D.W., Verhaar, A.P., Schellmann, S., Hahne, M.,
Fangradt, M., Wagegg, M., Hoff, P., et al. (2011). Origin and functional activity of the membrane-bound
glucocorticoid receptor. Arthritis Rheum. 63, 3779–3788.
Surjit, M., Ganti, K.P., Mukherji, A., Ye, T., Hua, G., Metzger, D., Li, M., and Chambon, P. (2011).
Widespread Negative Response Elements Mediate Direct Repression by Agonist- Liganded
Glucocorticoid Receptor. Cell 145, 224–241.
Tainter, M.L., Stockton, A.B., and Cutting, W.C. (1933). Use of dinitrophenol in obesity and related
conditions. J. Am. Med. Assoc. 101, 1472.
Thonberg, H., Fredriksson, J.M., Nedergaard, J., and Cannon, B. (2002). A novel pathway for adrenergic
stimulation of cAMP-response-element-binding protein (CREB) phosphorylation: mediation via
alpha1-adrenoceptors and protein kinase C activation. Biochem. J. 364, 73–79.
Thuzar, M., Law, W.P., Ratnasingam, J., Jang, C., Dimeski, G., and Ho, K.K.Y. (2018). Glucocorticoids
suppress brown adipose tissue function in humans: A double-blind placebo-controlled study. Diabetes,
Obes. Metab. 20, 840–848.
Timmons, J.A., Wennmalm, K., Larsson, O., Walden, T.B., Lassmann, T., Petrovic, N., Hamilton, D.L.,
Gimeno, R.E., Wahlestedt, C., Baar, K., et al. (2007). Myogenic gene expression signature establishes
that brown and white adipocytes originate from distinct cell lineages. Proc. Natl. Acad. Sci. 104, 4401–
4406.
Tokuyama, K., and Himms-Hagen, J. (1987). Increased sensitivity of the genetically obese mouse to
corticosterone. Am. J. Physiol. 252, E202-8.
Tremblay, Y., Tretjakoff, I., Peterson, A., Antakly, T., Zhang, C.X., and Drouin, J. (1988). Pituitary-
specific expression and glucocorticoid regulation of a proopiomelanocortin fusion gene in transgenic
mice. Proc. Natl. Acad. Sci. U. S. A. 85, 8890–8894.
Vander Tuig, J.G., Ohshima, K., Yoshida, T., Romsos, D.R., and Bray, G.A. (1984). Adrenalectomy
increases norepinephrine turnover in brown adipose tissue of obese (ob/ob) mice. Life Sci. 34, 1423–
1432.
Venneri, M.A., Hasenmajer, V., Fiore, D., Sbardella, E., Pofi, R., Graziadio, C., Gianfrilli, D., Pivonello,
95
C., Negri, M., Naro, F., et al. (2018). Circadian Rhythm of Glucocorticoid Administration Entrains
Clock Genes in Immune Cells: A DREAM Trial Ancillary Study. J. Clin. Endocrinol. Metab. 103, 2998–
3009.
Verhoog, N., Allie-Reid, F., Vanden Berghe, W., Smith, C., Haegeman, G., Hapgood, J., and Louw, A.
(2014). Inhibition of corticosteroid-binding globulin gene expression by glucocorticoids involves
C/EBPβ. PLoS One 9, e110702.
Vernocchi, S., Battello, N., Schmitz, S., Revets, D., Billing, A.M., Turner, J.D., and Muller, C.P. (2013).
Membrane glucocorticoid receptor activation induces proteomic changes aligning with classical
glucocorticoid effects. Mol. Cell. Proteomics 12, 1764–1779.
Villarroya, F., Peyrou, M., and Giralt, M. (2017). Transcriptional regulation of the uncoupling protein-
1 gene. Biochimie 134, 86–92.
Virtanen, K.A., Lidell, M.E., Orava, J., Heglind, M., Westergren, R., Niemi, T., Taittonen, M., Laine,
J., Savisto, N.-J., Enerbäck, S., et al. (2009). Functional brown adipose tissue in healthy adults. N. Engl.
J. Med. 360, 1518–1525.
Wang, H., Bell, M., Sreenevasan, U., Hu, H., Liu, J., Dalen, K., Londos, C., Yamaguchi, T., Rizzo,
M.A., Coleman, R., et al. (2011). Unique Regulation of Adipose Triglyceride Lipase (ATGL) by
Perilipin 5, a Lipid Droplet-associated Protein. J. Biol. Chem. 286, 15707–15715.
Wang, H., Willershäuser, M., Karlas, A., Gorpas, D., Reber, J., Ntziachristos, V., Maurer, S., Fromme,
T., Li, Y., and Klingenspor, M. (2018). A dual Ucp1 reporter mouse model for imaging and quantitation
of brown and brite fat recruitment. Mol. Metab.
Wang, Q.A., Tao, C., Gupta, R.K., and Scherer, P.E. (2013). Tracking adipogenesis during white
adipose tissue development, expansion and regeneration. Nat. Med. 19, 1338–1344.
Westerberg, R., Tvrdik, P., Undén, A.-B., Månsson, J.-E., Norlén, L., Jakobsson, A., Holleran, W.H.,
Elias, P.M., Asadi, A., Flodby, P., et al. (2004). Role for ELOVL3 and fatty acid chain length in
development of hair and skin function. J. Biol. Chem. 279, 5621–5629.
WHO (2018). Obesity and overweight.
Wu, J., Boström, P., Sparks, L.M., Ye, L., Choi, J.H., Giang, A.-H., Khandekar, M., Virtanen, K.A.,
Nuutila, P., Schaart, G., et al. (2012). Beige Adipocytes Are a Distinct Type of Thermogenic Fat Cell
in Mouse and Human. Cell 150, 366–376.
York, D.A., and Al-Baker, I. (1984). Effect of corticotropin on brown adipose tissue mitochondrial GDP
binding in obese rats. Biochem. J. 223, 263–266.
Young, P., Arch, J.R., and Ashwell, M. (1984). Brown adipose tissue in the parametrial fat pad of the
mouse. FEBS Lett. 167, 10–14.
Yu, C.-Y., Mayba, O., Lee, J. V., Tran, J., Harris, C., Speed, T.P., and Wang, J.-C. (2010). Genome-
Wide Analysis of Glucocorticoid Receptor Binding Regions in Adipocytes Reveal Gene Network
Involved in Triglyceride Homeostasis. PLoS One 5, e15188.
Yubero, P., Manchado, C., Cassard-Doulcier, A.M., Mampel, T., Viñas, O., Iglesias, R., Giralt, M., and
Villarroya, F. (1994). CCAAT/enhancer binding proteins alpha and beta are transcriptional activators
of the brown fat uncoupling protein gene promoter. Biochem. Biophys. Res. Commun. 198, 653–659.
Yukimura, Y., and Bray, G.A. (1978). Effects of adrenalectomy on body weight and the size and number
of fat cells in the Zucker (fatty) rat. Endocr. Res. Commun. 5, 189–198.
Yukimura, Y., Bray, G.., and Wolfse, A.. (1978). Some Effects of Adrenalectomy in the Fatty Rat*.
Endocrinology 103, 1924–1928.
Zeng, X., Jedrychowski, M.P., Chen, Y., Serag, S., Lavery, G.G., Gygi, S.P., and Spiegelman, B.M.
(2016). Lysine-specific demethylase 1 promotes brown adipose tissue thermogenesis via repressing
glucocorticoid activation. Genes Dev. 30, 1822–1836.
96
Zhang, X. (2015). Molecular sensors and modulators of thermoreception. Channels (Austin). 9, 73–81.
Zingaretti, M.C., Crosta, F., Vitali, A., Guerrieri, M., Frontini, A., Cannon, B., Nedergaard, J., and Cinti,
S. (2009). The presence of UCP1 demonstrates that metabolically active adipose tissue in the neck of
adult humans truly represents brown adipose tissue. FASEB J. 23, 3113–3120.
97