Send E-Mail To Darwin Team
Send E-Mail To Darwin Team
Contents
Introduction 5
• Warning 5
• Installing DARwin6 5
Overview 7
General features 7
• DARwin file edition 7
• Graphical export 8
File menu 16
• View File 16
• Importation / Exportation 16
Import data matrix 16
Import sequence 17
Import dissimilarity 19
Export dissimilarity 21
Export dissimilarity as column 21
Import tree 22
Export tree 23
Dissimilarity menu 25
• Method 25
• Dissimilarity estimation 26
Common options 27
Dissimilarity for Single data 29
Dissimilarity for Allelic data 32
Dissimilarity for Sequence data 34
• Dissimilarity bargraph 40
• Dissimilarity extreme values 40
• Dissimilarity properties 41
• Metric index 41
• Euclidean index 42
• Furnas portraits 42
Method 42
Procedure 44
• Dissimilarity transformations 44
• Weighted sum of dissimilarities 46
Factorial analysis 47
• Method 47
• Analysis 48
• Graphical display 49
Graph parameters 49
Identification and illustration 49
Graph exportation 50
Tree construction 51
• Method 51
‘Neighbourhood’ definition 51
Dissimilarity updating 52
Edge lengths 54
Bootstraps 54
• Hierarchical tree 55
Method 55
Procedure 55
• Neighbor-Joining 56
Method 56
Procedure 57
• Scores 58
Method 58
Procedure 58
• Ordinal Neighbor-Joining 59
Method 59
Procedure 59
• Ordinal Scores 60
Method 60
Procedure 60
• Neighbor-Joining under topological constraints 61
Method 61
Applications 61
Procedure 62
• Influential unit detection 63
Method 63
Procedure 63
Trees… 65
• Draw 65
Tree draw toolbar 65
Internal edge contraction 68
Group definition 69
• Edge length bargraph 70
• Tree distance 71
• Fit criterion 71
• Least-squares re-estimation of edge lengths 72
Method 72
Procedure 72
• Pruning 73
• Grafting 73
Method 73
Procedure 74
• Max length sub tree 74
Method 74
Procedure 75
• Add a 2-degree node 78
• Remove all 2-degree nodes 78
• Reticulations 78
Method 78
Procedure 80
Tree comparison 82
• Consensus and tree distances 82
Consensus methods 82
‘Bipartition’ distance between trees 83
Procedure 84
• Maximum agreement sub-tree (MAST) 84
Method 84
MAST order as tree distance 85
Maximal length MAST 86
Procedure 86
• Quartet distance 87
Method 87
Procedure 88
Disequilibrium 89
• Background 89
• Method 89
Max length sub tree 89
Min SD subset 90
Haplotypes 90
Linkage versus structure disequilibrium 90
Disequilibria on a set of loci 92
Random samples as reference 92
Allele richness 92
Algorithm for Max length subtree 93
Algorithm for Min SD subset 93
• Procedure 94
• Export to 'PHASE' software 99
Method 99
Procedure 99
• Import from 'PHASE' software 101
Method 101
Procedure 101
Tools 102
• Random 0/1 data 102
• Random dissimilarities 102
• Random tree 103
• Transpose data file 104
• Merge data files 105
• Single data correlations 107
• Re-label trees for common identifiers 108
• Pooling SSR alleles 110
Method 110
Marker selection 112
Pooling alleles for a marker 114
? 115
• User’s manual (PDF) 115
• How to cite DARwin 115
Bibliography 115
Introduction
Warning
DARwin6 is provided free for use in research and education however the program
is not open source.
Installing DARwin6
DARwin6 can be directly downloaded from the web site http://darwin.cirad.fr/.
You will be able to unregister at any time, and your email address will not be
used for any purpose other than DARwin information.
System requirements
New features
DARwin 6 is now developed on Visual Studio 2010 (Visual Basic .Net 2010). The
software build runs on .Net Framework 4. This solution allows to exploit multi
core exploitation on 32 bits (X86) and 64 bits (X64) operating systems.
5
Most of DARwin procedures are now parallelized to exploit multi core processors.
Algorithms have been optimized to improve both accuracy and speed.
DARwin hasn’t real Dataset size limit. The size of the dataset which can be
treated depends only of computer’s physical characteristics: available
memory and disk space.
Computing time in DARwin for most procedure will depend of computer
performances: core number, frequency and Ram size.
6
Overview
DARwin is mainly focused on diversity structure description based on distance
methods. It is organized in four logical parts: (i) dissimilarity measure, (ii) tree
construction from dissimilarities, (iii) tree representation and edition, (iv) tree
comparison. A fifth part is more specific and is devoted to sampling procedures
to minimize disequilibria in a collection. Each part is independent and manages
its own input data that can be inherited from other parts or directly imported
from other sources.
For each part, main classical methods are implemented but some more original
approaches are also offered.
- Various dissimilarity and distance estimations are proposed for different data:
quantitative, qualitative, binary, DNA sequence… Properties of dissimilarities are
largely explored and transformations are proposed to restore suitable properties
when necessary.
- Principal Coordinate analysis that searches for graphical representations on
Euclidean plans that conserve at best distances between units.
- Tree construction methods include hierarchical trees with various aggregation
criteria (weighted or unweighted), Neighbor-Joining tree (weighted or
unweighted), Scores method. Ordinal extensions of NJTree and Scores attempt
to reduce sensibility to data error. NJTree under topological constraints allows
forcing the a priori known tree structure of some data subsets. Bootstrapping in
NJTree and an original method to detect influent units can be used to estimate
how the tree is supported by the data.
- Tree representation. Many graphical tools are offered to make graphs easy to
read and ready to insert in publication or other document.
- Tree comparisons. When several data sets are used to construct trees on the
same unit set, consensus methods, maximum agreement subtree, distances
between trees are proposed to compare or synthesize these trees.
This documentation follows the organization of the software menu. Each chapter
begins with a brief description of the applied methods or introduces necessary
technical features. Input windows, options/parameters and output are then
described.
General features
DARwin file edition
All the files used by DARwin software are in windows ASCII text format with Tab
separator.
These files can be viewed or edited with any Windows text editor. We
recommend using of Notepad++ (free software available at http://notepad-plus-
plus.org/).
This text format is also compatible with spreadsheet programs (Microsoft Excel
for example).
7
Graphical export
In the ‘Tree’-‘Draw’ and ‘Factorial Analysis’-‘Graphical representation’ windows,
it’s possible to export and save the drawing windows in EMF (Enhanced Meta
File) format.
These EMF files can be imported in vector graphical editors and can be modified,
embedded, converted in other formats and more… to insert them in any
document like publications or other.
The EMF files are directly compatible with all the Microsoft Office Suite
components.
To edit an EMF file in Microsoft PowerPoint software:
- Insert as picture on a slide ;
- Right click on the picture and ungroup the elements as long as the
option is purposed (number of groups depends on graph complexity) ;
- Picture external frame can be deleted ;
- All tools are now available depending on type of element (TextBox
options for texts, Line options for lines, Shape options for unit
symbols…)
The modified picture can be Re-grouped in a single element (Select all, right click
and Group). This element can be exported in different file formats (Right click on
picture, Save as Picture…
8
Data and file formats
DARwin uses its own formats for data files but import/export from/to standard
formats in phylogeny are proposed. All files are text ASCII files with Tab as
separators; they can be edited with any text editor. They can also be imported or
exported directly from spreadsheets like Excel in saving files in text format with
Tab as separators. The file structure as described below has to be scrupulously
duplicated and the example files provided with the software can be used as
models. It is often a convenient way to create or modify data files.
.TXT
Sequences: data
import
FASTA, PHYLIP,
NEXUS, MEGA2
.VAR file
(.AFT file)
.TXT
.TXT
import tree
PHYLIP, NEXUS
PHYLIP, NEXUS .ARB file
export
The size of the data set is constrained only by the available physical and virtual
memory.
The algorithmic complexity of a lot of methods is in n2 or n3 and even
exponential for some ones. Although implemented algorithms are time
optimized, some procedures require very long time when the number of
units becomes large.
The first line in DARwin files is always a signature giving the DARwin version
used to create the file (in order to manage compatibility between successive
versions) and the type of the file. This header format must be strictly conform
(the best is to make a copy/paste from the data examples provided with the
software).
A comment field may be found at the end of the file where information on file
creation is automatically recorded or updated (cf. sequence data example). This
field can be modified by the user with any external editor, NotePad++ for
example.
9
When a file is asked in input, opens a window giving the main characteristics
of the selected file and displaying its comment field.
Unit identifiers are always positive numerical values (see .DON files), they are
not necessarily consecutive. However as this value is used as array index in the
programme, it is better to keep the greatest value as low as possible and avoid
for example identifying a set of four accessions by 1, 10, 100, 1000, that will
require tables of dimension 1000 for only 4 values!
This numerical unit identifier cannot exceed the maximal dimension for
integer arrays (32 767).
Single data
Each unit is characterized by a single value for each variable. This very general
format can be used for example in genetics for haploids, for homozygote
diploids, for dominant markers…
Variables have continuous or discrete numeric values, including counts, 0/1
data…
10
Allelic data
This format is used to record allelic composition for diploids or polyploids, the
ploidy π being given in the header. In second line, are given the number of units
and the total number of alleles (= π x number of loci). Each unit receives π
consecutive values for each of the loci. Allele order has no particular meaning
excepted when haplotypes are required. In this case, the alleles of each
haplotypes are always in the same order for each locus.
Variables have numeric values identifying the alleles of each locus. The allele
code is free; for example, the number of repeats or the string length should be
provided as allele code for microsatellite data.
If phases are known, the alleles of the same haplotype will be recorded at the
same position for each locus. For example for unit 2, the first haplotype is 8 1 1
and the second one is 1 3 2.
Sequence data
11
@DARwin 5.0 - AFT
4 3
Unit CP 1 CP 2 CP 3
1 0.605848642256061 -0.274256439944485 -0.450259969274018
2 0.132039682872075 -0.604884179026046 -7.49942145023929E-02
3 -1.10549598783426 -0.752823165742376 -0.153755560336382
4 0.607204345501523 -0.170470389344589 -0.474296951474667
The first line is a fixed header, the second gives the number of units. They are
followed by the semi matrix where each unit is identified by its numerical code.
A dissimilarity value has at most 16 digits (including the decimal point), possibly
in exponential notation. This high precision on dissimilarity values is required by
many numerical algorithms. Of course it results in very large data files for high
numbers of units or high numbers of bootstrapped matrices. Negative values are
allowed but most of procedures require only non null dissimilarities.
DARwin files with extension .VRD have an identical structure (with VRD instead
of DIS in the header). They store the variances associated to dissimilarity values
in the companion .DIS file and are used by MVR Neighbor-Joining tree
construction.
12
Data file .ARB components
A DARwin file with extension .ARB stores a tree structure described by the list of
its edges and their length.
An edge is coded by the labels of the two connected nodes. An external node is
identified by the corresponding numerical unit identifier and each internal node
receives an increasing number beginning at u+1 where u is the greatest
numerical unit identifier found in the dissimilarity file (even if this unit is not
retained in the tree). In general, u is greater than the number of units, it will be
the same only if the u units are consecutively identified as 1, 2,…, u.
The following blocks are optional and keep track of all editing actions on the tree
(see Tree Draw). They allow to redisplay the tree exactly as it was saved. They
record different settings like rotation, root… (between 'Settings’ and ‘End_Settings’),
colors (between 'Colors’ and ‘End_Colors’), titles (between 'Titles’ and ‘End_Titles’)…
A comment field summarizes options retained for tree construction and the
dissimilarity comment field is copied.
Example for a tree on 6 units selected in a .DIS file where the greatest unit
identifier is 14:
13
End_Bootstraps
Settings
0 0 1 1 0 0 0 0 1 0
End_Settings
End_Tree_Parameters
Tree construction: Weighted Neighbor-Joining
calculated from dissimilarity file : test.dis
6 selected units on 14
Bootstraps: 100
Average 'edge' distance between bootstrapped trees: 0.7244
5-percentile: 0.6444
95-percentile: 0.8222
--------------
Dissimilarity calculated from ‘single’ data file: Test.var (type: presence/absence)
Dissimilarity index: Dice
Bootstraps: 100
Missing data options:
no missing data
Tree file format has been modified between version 5 and version 6.
However tree files from version 5 are compatible with the version 6 and will
be converted while reading.
A same .DON file may correspond to several different files, it is sufficient that all
units of a file have a corresponding entry in the .DON file. For example a tree
build on a subset of units may use the initial .DON file that references the whole
unit set.
This file is also used to store outputs of some procedures. For example, when
user defines clusters in a tree, an identifier is created in a .DON file to store the
cluster which the unit belongs to.
The first line is a fixed header, the second line gives the number of units and the
number of external identifiers, these external identifiers receives a name in the
third line. Following lines give for each unit referenced by its numerical identifier,
the list of external identifier values.
At the end a comment field is automatically filled by the programme (for
importation for example).
14
@DARwin 5.0 - DON
5 6
N° Code Name Type Loc. cl1 cl2
1 B35 Poyo acu. China 1 1.0
3 B22 Amer. acu. Cam. 1 0.5
4 H3 Blug. balb. India 1 0.3
6 H7 Klue balb. India 2 0.1
7 B07 Mich. acu. Cuba 3 0.2
External Identifiers for file: Example.var
Imported Sequences...
from file (in Fasta format): Example.fas
15
File menu
View File
This function opens a window displaying the file content according to its type
(.VAR, .DIS, .ARB, .DON). Data cannot be modified here.
For .DIS file with bootstrap, a bootstrap navigation frame appears automatically.
The complete matrix is initially displayed but any bootstrapped matrix can be
selected.
For very large files, e.g. several thousands of units for a dissimilarity file or of
variables for a data file, the loading can be rather long. Display is now done by
parts. Each part represents 2 hundreds of units horizontally and vertically for
dissimilarity file, 2 hundreds of variables horizontally and 2 hundreds of units
vertically for data files. A navigation frame appears automatically if needed to
select vertical and horizontal range of data and validation is done when pressing
the ‘View’ button.
Copy sends current part of data to the window clipboard for copying in
any word processor or spreadsheet.
View File window is multi instantiable and can be opened several times.
Importation / Exportation
Import data matrix
This function creates a .VAR file from a data matrix in text format with Tab
separators, as produced by Excel for example.
The first line of the matrix includes a generic name for the units followed by the
identifiers of each variable.
The following lines give the identifier of each unit followed by the value of this
unit for each variable. Blanks will be coded as missing data.
16
@DARwin 5.0 - SINGLE @DARwin 5.0 - DON
6 4 6 1
Unit a b c d Unit Unit
1 67 44 67 73 1 u1
2 20 87 4 999 2 u2
3 69 23 80 36 3 u9
4 40 999 77 62 4 u4
5 22 31 18 77 5 u5
6 24 81 67 19 6 u8
Imported Single data... External identifiers for file: datamatrix.var
Imported Single data...
• File to import
The user has to select the file to import, the default extension is .TXT but any
other file extension is allowed.
• Data type
Select the type Single or Allelic.
For allelic data, the ploidy π must be specified and each block of π consecutive
variables is regarded as a locus. The procedure aborts if the number of variables
in the .TXT file is not a multiple of π.
Import sequence
DARwin supports conversions from most common sequence file formats into
DARwin format. FASTA, PHYLIP and NEXUS (PAUP) formats are directly
converted. For less common formats, we propose to use MEGA2 as intermediate.
It is a free software (http://www.megasoftware.net/) developed by S. Kumar, K.
Tamura, I. Jakobsen and M. Nei, that offers conversion from several formats like
CLUSTAL, GCG, PIR, NBRF, MSF, IG, Internet (NCBI) XML in .MEG format.
DARwin proposes conversion from .MEG format to import the intermediate files
created with MEGA2.
DARwin allows only hyphen (-) as valid symbol for gaps. Any other
character, except A, T(U),G,C (upper or lower case) is recorded but will be
regarded as missing value.
17
Examples for each imported format are given below.
. Fasta format
>Homo
AGTCGAGTC---GCAGAAACGCATGAC-GACCACATTTT-CC
TTGCAAAG
>Pan pani
AGTCGCGTCG--GCAGAAACGCATGACGGACCACATCAT-CC
TTGCAAAG
>Gorilla
AGTCGCGTCG--GCAGATACGCATCACGGAC-ACATCATCCC
TCGCAGAG
>Pongo
AGTCGCGTCGAAGCAGA--CGCATGACGGACCACATCATCCC
TTGCAGAG
. PHYLIP format
PHYLIP interleaved format PHYLIP non-interleaved (sequential) format
4 50 4 50
Homo AGTCGAGTC---GCAGAAACGCATGAC Homo AGTCGAGTC---GCAGAAACGCATGAC
Pan pani AGTCGCGTCG--GCAGAAACGCATGAC -GACCACATTTT-CCTTGCAAAG
Gorilla AGTCGCGTCG--GCAGATACGCATCAC Pan pani AGTCGCGTCG—GCAGAAACGCATGAC
Pongo AGTCGCGTCGAAGCAGA--CGCATGAC GGACCACATCAT-CCTTGCAAAG
-GACCACATTTT-CCTTGCAAAG Gorilla AGTCGCGTCG—GCAGATACGCATCAC
GGACCACATCAT-CCTTGCAAAG GGAC-ACATCATCCCTCGCAGAG
GGAC-ACATCATCCCTCGCAGAG Pongo AGTCGCGTCGAAGCAGA—CGCATGAC
GGACCACATCATCCCTTGCAGAG GGACCACATCATCCCTTGCAG
. NEXUS format
#nexus
begin data;
dimensions ntax=4 nchar=50;
format datatype=dna interleave=yes gap=- missing=?;
matrix
Homo AGTCGAGTC---GCAGAAACGCATGAC
Pan pani AGTCGCGTCG--GCAGAAACGCATGAC
Gorilla AGTCGCGTCG--GCAGATACGCATCAC
Pongo AGTCGCGTCGAAGCAGA--CGCATGAC
Homo -GACCACATTTT-CCTTGCAAAG
Pan pani GGACCACATCAT-CCTTGCAAAG
Gorilla GGAC-ACATCATCCCTCGCAGAG
Pongo GGACCACATCATCCCTTGCAGAG
;
end
. MEGA format
#mega
TITLE : DNA sequence data - test
#Homo
AGTCGAGTC---GCAGAAACGCATGAC-GACCACATTTT-CCTTGCAAAG
#Pan pani
AGTCGCGTCG--GCAGAAACGCATGACGGACCACATCAT-CCTTGCAAAG
#Gorilla
AGTCGCGTCG--GCAGATACGCATCACGGAC-ACATCATCCCTCGCAGAG
#Pongo
AGTCGCGTCGAAGCAGA--CGCATGACGGACCACATCATCCCTTGCAGAG
18
• File to import
The user has to select the file to import, he can select a file type (.FAS, .PHY,
.PAU, .MEG) but any other file extension is allowed.
If the file extension is a known extension (.FAS, .PHY, .PAU, .MEG), the file will
be assumed to be in this format (e.g. Fatsa for .FAS) but another import format
can be specified: FASTA, PHYLIP, PAUP(NEXUS), MEGA.
The procedure aborts if the file does not correspond to the specified format or if
sequences have not the same length.
N.B. In MEGA files, the point symbol is allowed and codes for the same symbol
as in the first sequence. DARwin replaces the point by the symbol met in the first
sequence.
Some formats allow recording several data sets in a same file (for example,
SEQBOOT procedure in PHYLIP) but DARwin will import only the first set.
Import dissimilarity
DARwin supports conversions from NTSYS format and PHYLIP format which is the
most common format and is read by all major software.
19
Example for semi-matrix PHYLIP file:
10
U68591
U68664 0.394891
U68592 0.414843 0.442027
U68686 0.371826 0.414843 0.276453
U68609 0.490123 0.521929 0.416497 0.364001
U68638 0.363032 0.389033 0.268092 0.061001 0.376207
U68643 0.518779 0.583528 0.556294 0.485847 0.316086 0.474782
U68659 0.422482 0.514325 0.277780 0.114629 0.393321 0.095229 0.505483
U68627 0.500022 0.523433 0.420349 0.371596 0.054455 0.360652 0.340769
0.395244
U68633 0.395174 0.428856 0.298352 0.159261 0.365873 0.169421 0.422792
0.165149 0.377522
• File to import
The user has to select the file to import, he can select a file type (.PHY or other)
but any other file extension is allowed.
If the file extension is a known extension (.PHY), the file will be assumed to be in
this format (e.g. PHYLIP for .PHY) but the correct import format can be specified:
PHYLIP or NTSYS.
20
@DARwin 5.0 - DON
5 1
Unit Name
1 Cow
2 Carp
3 Chicken
4 Human
5 Loach
External Identifiers for file: seq.var
from file (in PHYLIP format): dist_phy.phy
Export dissimilarity
DARwin supports conversions from .DIS format into NTSYS format and PHYLIP
format which is a standard format read by all major software.
• Dissimilarity
The input file is necessarily a .DIS file.
Open a window summarizing main characteristics of the selected
dissimilarity.
• Identifiers
An external identifier can be selected in an associated .DON file. This identifier
will be used as unit label in exported file. If no identifier is chosen, the numerical
identifier read in the .DIS file will be used as unit identifier in the output file.
If the file extension is a known extension (.PHY), the file will be assumed to be in
this format (e.g. PHYLIP for .PHY) but another export format can be specified:
PHYLIP or NTSYS.
DARwin can export from .DIS format into text column file format.
• Dissimilarity
The input file is necessarily a .DIS file.
21
Open a window summarizing main characteristics of the selected
dissimilarity.
Import tree
PHYLIP and NEXUS are very common treefile formats used by a lot of major
programs. They are based on the Newick Standard that uses a system of nested
parentheses for coding a tree.
(For consensus from bootstrapped trees, PHYLIP gives the bootstrap values as
branch lengths.)
NEXUS format adds to the Newick tree description some commands relevant to
other programs such as PAUP:
22
#NEXUS
Begin trees;
Tree PAUP_1 = [&U] (Bovine:0.69395,(Gibbon:0.36079,(Orang:0.33636,
(Gorilla:0.17147,(Chimp:0.19268, Human:0.11927):0.08386):0.06124)
:0.15057):0.54939,Mouse:1.21460);
end;
• File to import
The user has to select the file to import, he can select a file type (.PHY, .TRE or
other) but any other file extension is allowed.
If the file extension is a known extension (.PHY or .TRE), the file will be assumed
to be in this format (PHYLIP for .PHY and NEXUS for .TRE) but another import
format can be specified: PHYLIP or NEXUS.
If branch lengths are not specified in the imported tree, they will be set to 1
in the DARwin file.
Export tree
DARwin supports conversions from .ARB tree format into PHYLIP and NEXUS
formats that are standard formats read by all major software.
• Tree to export
The input file is necessarily a .ARB file.
• Tree parameters
Open the tree display window to define tree parameters required by the export
format:
- Newick tree format is not invariant with the root position. The root
retained for exportation will be the current root used to draw the tree, it
can be modified with the appropriate tool.
- Newick format requires a single unit identifier. This identifier will be the
current identifier used for the tree display, it can be the numerical
identifier as read in the .ARB file or any external identifier selected in the
associated .DON file.
23
All not valid symbols in PHYLIP identifiers will be translated in a valid
symbol: accented vowel in non-accented vowel…
If the file extension is a known extension (.PHY or .TRE), the file will be assumed
to be in this format (PHYLIP for .PHY or NEXUS for .TRE) but another export
format can be specified: PHYLIP or NEXUS.
24
Dissimilarity menu
Method
The most general mathematical object representing the difference between two units of a
set E is a dissimilarity. It is a function d of the set of pairs (i,j) of ExE in the positive or
null real numbers, which is symmetrical ( d ( i , j ) = d ( j , i ) ) and such that d(i,i) = 0 for any i.
This definition is relatively simple and covers a large number of possible measures but,
on the other hand, opens up only a few mathematical properties.
It is often necessary to opt for more constrained definitions when particular mathematical
properties are required by the applied methods.
This general definition allows some incoherencies since for two identical units (d(i,j) = 0)
it is possible that for some unit k, d ( i , k ) ≠ d ( j , k ) . So we often add the condition:
dissimilarity).
A distance, called also a metric, is a particular even dissimilarity obtained by adding the
condition d (i , j ) = 0 ⇒ i = j and the triangular inequality between three units:
d (i , j ) = ∑ x(i , k ) − x( j , k )
K
d (i , j ) = ∑ (x ( i , k ) − x ( j , k ))
2
These two distances have some interesting properties for geometrical representation,
and Euclidean distance for example is required for factorial analysis.
25
Of course, Manhattan or Euclidean distances are obtained when the distance is calculated
from a table of units × variables by summing, the absolute values or the squares of the
deviations between i and j. However, some indices, for example those calculated on
presence/absence data, can be of either of these two types without this following
evidently from the mode of construction.
Manhattan and Euclidean distances belong to the same distance family and are linked. It
can be shown, for example, that any Euclidean distance is a Manhattan distance and that
the square root of a Manhattan distance is a Euclidean distance.
Finally, some very constrained distances have the property that they can be represented
as the path length between leaves in a tree. Tree construction methods all aim to
approximate as closely as possible the observed dissimilarity by one of these particular
distances.
The best known of these distances is the ultrametric which satisfies the ultrametric
condition: for any three units i, j and k:
d (i , j ) ≤ max (d (i , k ), d ( j , k ))
This condition expresses that among the three distances between three points, the two
largest are equal. Any triplet of points thus forms a sharp isosceles triangle. This
property allows a representation in the usual form of a dendrogram, which is a tree that
has a particular point, the root, located at an equal distance from all the leaves of the
tree.
In the 1970s, the distance called the additive tree distance was proposed. It verifies the
four points condition:
d (i , j ) + d (k , l ) ≤ max (d (i , k ) + d ( j , l ), d (i , l ) + d ( j , k ))
which expresses that for any four individuals i, j, k and l, among the three sums of
distances two by two, the two largest are equal. This property allows a tree
representation where leaves are not constrained to be at an equal distance from a root
as for ultrametrics. This lesser constraint thus enables a more faithful representation of
initial dissimilarities. The ultrametric condition is shown to be only a particular case of the
four points condition.
Dissimilarity estimation
A dissimilarity matrix is computed from unit by variable data read in a .VAR file
and is stored in a .DIS file. Specific windows are opened according to the data
type (single, allelic or sequence).
26
Common options
A .VAR file is selected as input. The reading procedure aborts if the type read in
the file header does not correspond to the expected type.
A name for the output .DIS file has to be chosen. By default, DARwin proposes to
keep the same name as the input file with the .DIS extension.
Missing data
Dissimilarity between two units can be evaluated only for variables with valid
values for the two units, so any invalid value (missing data) has to be discarded
for the dissimilarity calculation.
Except for Sequence data, the variable value retained to code a missing data in
the .VAR file has to be specified by the user (Integer code for missing data).
The two first options discard all missing data from the data set. They should be
used when missing data are concentrated in some units or variables only. If
missing data are distributed more or less at random, a great number of valid
data will be also discarded with complete deletion options. Pairwise deletion
option avoids this loss of information in removing only missing data for the
considered pair.
27
…p…q…
For example, let i, j, k be three DNA sequences of length n
i …A…N…
j …N…G… that are exactly the same except for two positions p and q (N
k …A…T… being a missing value).
Unit selection
Variable selection
If checked, this option creates a new .VAR file recording a data matrix with only
units and variables selected by the user. The unit numerical identifiers are those
28
of the initial .VAR file and any associated .DON file stays operational. By default,
the proposed filename is name_sel.VAR where name is the initial .VAR file name.
This option is very useful when a same tedious selection has to be used for
several purposes.
Bootstrap
Bootstrap analysis creates a series of bootstrap samples of the same size as the
original data: same units on a variable set of same size but in drawing at random
and with replacement each variable in the initial variable set. So each variable in
the initial dataset may appear 0, 1, 2, 3 … times in a bootstrap sample.
Dissimilarity matrices are computed for bootstrap samples with the same options
as for initial matrix, they are successively stored at the end of the .DIS file.
In case of missing data, random sampling may generate units with many missing
data. If the number of missing data for a pair in the initial data exceeds a fixed
threshold, a warning window points out to the user that dissimilarities might be
estimated in bootstraps on a small number of variables for this pair. The
threshold for missing data is equal to 0.8 times the threshold chosen for initial
data.
Data of different nature can be stored as ‘Single’ data and only a specific family
of dissimilarity indices is relevant for each one. So the user has to specify what
kind of data is used: Continuous, Counts, Modalities, Presence/Absence.
The list of available dissimilarity indices is contextually adapted according to this
specification.
The procedure is not able to verify that the data correspond to the user
specification, except for presence/absence where the procedure aborts if it finds
a value not equal to one of the three codes defined for presence, absence or
missing data.
Missing data
29
Unit selection / variable selection
(See above Unit selection, Variable selection and Record selected subset in
Common options)
Bootstrap
(See above Bootstrap in Common options)
Euclidean and Manhattan distances are commonly used for continuous data. The
square in Euclidean distances emphasizes on large differences comparatively to
small differences. Manhattan distance has a more neutral point of view.
These distances are often divided by the number of variables, thus distance
values can be compared between data sets with different numbers of variables.
Manhattan distances can be reduced by the range (max – min) to keep variations
in [0,1].
However the range depends only on two particular values of the distribution and
these extremes may correspond to very particular units, to some abnormal
measures or possibly to errors… We would prefer a criterion based on the whole
data set (like the standard deviation). If a Gaussian distribution can be assumed
for the variables, an expected range can be deduced from the standard
deviation:
ER n = δ nσ
where δ n depends on the number of units in the data set.
If differences greater than the expected range are met, the contribution of the
variable is truncated to 1.
notations:
dij: dissimilarity between units i and j
xik, xjk: values of variable k for units i and j
xi., xj., x.k: mean for units i and j or variable k
x..: overall mean
maxk – mink: range for variable k
ERn: expected range for a set of n units
K: number of variables
30
1 K
• Mean Euclidean d ij =
K
∑1 ( x ik − x jk ) 2
1
• Manhattan (=City-Block, = L1) d ij =
K
∑1K x ik − x jk
1 K x ik − x jk
• 'range' Manhattan d ij = ∑
K 1 max k − min k
x ik − x jk
∑1 min ,1
1 K
• 'Expected range' Manhattan d ij =
K ER n
Standardized option divides each xik by the standard deviation of the variable k
calculated on the selected units.
This measure expresses a value xik as its contribution to the sum xi. on all
variables and is a comparison of unit profiles.
x.. x ik x ik 2
• Chi-2 d ij = ∑1K ( −
x.k x i . x j .
)
notations:
dij: dissimilarity between units i and j
u: number of unmatching variables
m: number of matching variables
2u
• Rogers & Tanimoto d ij =
m + 2u
u
• Sokal & Michener (=simple matching) d ij =
m+u
u
• Sokal & Sneath (un1) d ij =
2m + u
31
Dissimilarity indices – Presence/Absence
Usually ‘presence’ is coded as 1 and ‘absence’ as 0 but the user can specify any
other coding values.
notations:
dij: dissimilarity between units i and j
xi, xj: variable values for units i and j
a: number of variables where xi = presence and xj = presence
b: number of variables where xi = presence and xj = absence
c: number of variables where xi = absence and xj = presence
b+c
• Dice d ij =
2a + (b + c )
a
• Ochiai d ij = 1 −
(a + b )(a + c )
b+c
• Jaccard d ij =
a + (b + c )
2(b + c )
• Sokal & Sneath (un2) d ij =
a + 2(b + c )
32
Missing data
(See above Missing data in Common options)
Code for missing value concerns allele values but complete or pairwise
deletion does not consider each allele value but the blocks of the π alleles of
a same locus. A locus is missing for a unit as soon as one of its π alleles is
missing.
Unit selection
(See above Unit selection, Variable selection and Record selected subset in
Common options)
Locus selection
Bootstrap
Dissimilarity indices
notations:
dij : dissimilarity between units i and j
L : number of loci
π : ploidy
ml : number of matching alleles for locus l
ex: for π = 2
i 11 12 12 11 11 12 12 11 11 12
j 11 12 21 12 21 23 32 22 23 34
ml 2 2 2 1 1 1 1 0 0 0
33
1 L ml
• Simple matching d ij = 1 − ∑
L l =1 π
Latter, in relaxing some assumptions of the Jukes and Cantor evolution model,
several other corrections were proposed in the literature. DARwin includes only
simple models requiring few parameters since for more sophisticated models,
parameter estimations are rarely available.
notations:
dij : dissimilarity between sequences i and j
us : number of transitions
uv : number of transversions
u = us + uv : total number of unmatching sites
m : number of matching sites
L=u+m : number of valid sites
ug : number of unmatching gaps (or gap blocks)
mg : number of matching gaps (or gap blocks)
a : gamma parameter
(See above Unit selection, Variable selection and Record selected subset in
Common options)
34
Like in other modules, Unit selection or Site selection allow the user to define
units and/or sites which have to be discarded for computing dissimilarities.
In each case, the button Statistics on current selection opens a window
summarizing information on numbers of selected units or sites, on gaps, on
missing data and gives for each selected unit or site, the numbers and the
frequencies of gaps, missing data, valid values, A, T/U, G and C.
Codon position
Obviously sequences must be continuous strings in the input file and a codon
position code (1, 2 or 3) is affected sequentially to successive sites of the
sequence, the position of the first site in the codon being given as parameter.
Missing data
Gaps
Then a gap could be seen as a fifth element. However corrections for multiple
substitutions (see below) are not necessary since multiple indel events at the
same position seems improbable. DARwin proposes to estimate dissimilarity as
the weighted sum of two terms, the first one accounting for substitutions and its
correction for multiple substitutions, the second one accounting for deletions and
insertions.
35
For example for a Jukes & Cantor multiple substitution correction (see above for
notation):
3 mg + ug ug
d ij =
m+u − Ln 1 − 4 u +
m +u +m +u 4 3 L m +u +m +u m + u
g g g g g g
• the first term between [] is the Jukes & Cantor correction for valid sites
• the second term is the unmatching index for gaps
• the two terms between brackets are weights corresponding to part of
valid sites and gaps in the total number of sites.
The variance of dij is the variance of a sum of two terms and is function of the
variances of each term but also of their covariance. The frequencies of
substitutions and indels are very probably linked, the two terms cannot be
regarded as independent but their covariance is not known. We will assume that
the two terms are completely positively linked and the covariance will be taken
as the product of the two variance square roots. The variance will be so over
estimated but in any case under estimated.
Component V(Y) is estimated assuming a Poisson model for insertion/deletion
events. Component V(X) is the variance of substitution events depending on the
retained model, for example for Jukes and Cantor model:
2
u u 4u
V ( X ) = 1 − 1 − L
L L 3 L
The previous formula for dissimilarity considers that each site with a gap
corresponds to an indel event (single gap correction). However indel events
concern often blocks of consecutive sites and a row of adjacent gaps has to be
treated as a single gap, regardless of its length (gap block correction). Then ug
and mg in the previous equation are numbers of unmatching and matching gap
blocks.
36
The gap option sub-window proposes:
(N.B. a missing data in a gap block does not interrupt the block)
Ex:
unit i: A C T C A - - - A A G - C T G A G T C - - G T C
unit j: T A T G A G T A A G G - T G G - G T C - - T T C
Example:
- user deletion of sites 6, 7, 8
- complete site deletion for missing data
- restriction to codon positions 2 and 3 for strings beginning in position 2
site 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
A T C N N A A C N G X T T A G
codon position 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1
user selection + + + + + - - - + + + + + + +
codon selection + + - + + - + + - + + - + + -
missing data + + + - - + + + - + - + + + +
resulting selection + + - - - - - - - + - - + + -
(+/- selected/unselected sites)
Bootstrap
37
Dissimilarity indices
1u 4
Tajima & Nei (1984) d ij = −bLn 1 − b = 1− ∑ g n2
b L n =1
gn is the frequency of the n-th type of nucleotide and is estimated from the data
as the average for all the sequences analyzed.
−1 / a
a 3
−1 / a
u u 1 u
Nei (1991) d ij = 1 − 2 s − v + 1 − 2 v −
2 L L 2 L 2
38
Assumptions on evolution model are summarized for each case in the following
table:
no simple matching
Constant Kimura
Variable Equal
variable Nei
Gamma model
Under assumption of equal substitution rate for all sites, a fixed rate, say 1, is
assigned to each site. In real data, variations are often observed between sites
and this assumption becomes unrealistic. A more suitable model would assign its
own rate to each site. Of course we are unable to estimate each of these rates
but it would be sufficient to know their distribution.
39
regards this as an error and stops at the first pair of units causing the
problem; a sub-window indicates which pair is concerned and the bootstrap
number if error occurs in a bootstrap sample. To avoid this error, it would
be necessary to remove too distant units or to limit analysis to more
conserved parts of the sequences. If the error occurs in a bootstrap sample,
it may sometimes result only from a particular random effect and it may be
sufficient to try again with the same data.
Dissimilarity bargraph
This graphal tool displays the distribution of the dissimilarities for a selected .DIS
file. Bargraph parameters can be modified by the user:
• Start value: lower limit of the first class.
• Class number
• Step: class range
Any value lower than the start value is joined to the first class. Any value greater
than the superior limit of the last class is joined to this last class.
Text window
Click on i, j, Id(i), Id(j) or d(i,j) column header: sort the list in
increasing or decreasing order of the column.
40
Dissimilarity properties
These procedures check that a dissimilarity read in .DIS file in input verifies or
not some particular properties (see method).
Distance (Metric)
Verify that the dissimilarity is even and if it is the case verify that for any
triplet d (i , j ) ≤ d (i , k ) + d ( j , k )
The procedure stops at the first triplet which does not verify the relation.
Euclidean distance
Verify firstly that the dissimilarity is even and is a distance, and if it is
the case, verify that the W matrix has not negative eigenvalues.
The W matrix is the scalar product matrix relative to an arbitrary unit m:
( 1
)
W m (i , j ) = d 2 (i , m ) + d 2 ( j , m ) − d 2 (i , j )
2
This matrix is diagonalized with a simple Jacobi algorithm that returns
the eigenvalues.
Optionally, the calculated W matrix, the diagonalized matrix and the
sorted eigenvalue list can be displayed in the text window.
Ultrametric
verify firstly that the dissimilarity is even and is a distance, and if it is
the case, verify that for any triplet, the two greatest distances are equal.
The procedure stops at the first triplet which does not verify the relation.
Metric index
It can be shown that, if d is a dissimilarity, it is always possible to find a value p
(between 0 and 1) such that for any l (0 ≤ l ≤ p), d is a distance. This function
l
returns the p value that can be used with power dissimilarity transformation to
transform a dissimilarity in a distance.
41
The p value cannot be analytically expressed and has to be numerically
estimated for each triplet. The algorithm approaches the solution in refining
iteratively the extremes of a search interval. The final result will be the smallest
value among all triplets, this ensures that the metric condition holds for any
triplet.
If only the final result is asked, the superior limit of the search interval for the
current triplet is set to the smallest value found on previous triplets. So for a lot
of triplets, the metric condition is already verified for this initial value and the
procedure stops immediately for this triplet.
Index distribution. It may be useful to display the index distribution for all
triplets in order to identify some extreme and possibly aberrant triplets. Then the
right value has to be estimated for each triplet and the procedure may be longer.
Euclidean index
It can be shown that if d is a distance, it is always possible to find a value p
(between 0 and 1) such that for any l (0 ≤ l ≤ p), d is an Euclidean distance.
l
In some cases, the p values are analytically known; for example, it has already
been indicated that the square root (p = ½) of a City-Block distance is a
Euclidean distance. Often this value is not known and must be numerically
estimated on the data.
The algorithm approaches the result in refining iteratively the extremes of a
search interval, starting from 0 and the metric index as initial extremes. It has
been optimized to limit the needed number of matrix diagonalizations.
This function returns the p value which can be used with power dissimilarity
transformation to transform a dissimilarity in a Euclidean distance.
Furnas portraits
Method
This graphical tool was proposed by Furnas (1989) to illustrate some dissimilarity
properties. Let d be a dissimilarity defined on a triplet t: (a,b,c). This triplet can be
located in the three dimensional space corresponding to d(a,b), d(a,c), d(b,c). If each
dissimilarity is normalized by the sum of the three dissimilarities, then the triplet t is
projected on the canonical plan (d(a,b)+ d(a,c)+ d(b,c) = 1) or more precisely on the
triangle intersection between this canonical plan and the 3-dimensions space.
42
For a set E, all triplets (i,j,k) can be positioned on this canonical plan and their
distribution in the triangle depends on the conditions satisfied by d and is related to its
metric index.
If the points occupy the whole triangle, d is a simple dissimilarity without any particular
property.
If they are enclosed in the small internal blue triangle, d is a distance.
In terms of the metric index p, a simple dissimilarity corresponds to p>1 and a distance
to 0< p ≤1. Intermediate p values can also be mapped on this plan. For instance, if all
the points are in the green circle as illustrated on the figure, corresponding to p=2, then
d1/2 is a distance. More generally, the envelope corresponding to a particular p value can
be drawn in the triangle. If all triplets are enclosed in this envelope, then d1/p is a
distance.
At the limit, the envelope corresponding to p=0 is restricted to the red internal 3-
branches star that corresponds to the ultrametric.
d(b,c)
1
p→∞
p =2
p=1
d(a,c) p =1/2
1
p→0
(ultrametric)
0
1
d(a,b)
This graphical tool is useful to detect some aberrant triplets or to approach graphically
the metric index.
43
Procedure
This procedure can take long time with more than one hundred units. Partial
triangle draws fewer points than full triangle (6 times less) and run faster.
Dissimilarity transformations
This menu proposes mathematical transformations of an initial dissimilarity d
read in input file in a new dissimilarity d’ recorded in an output file.
44
- A particular transformation adds a random noise to a dissimilarity. This
function has only a methodological application and can be used to test sensibility
of tree methods to data error.
An error level e is defined by the user as a percent. For each dissimilarity d(i,j), a
value a is randomly drawn in a uniform distribution between –e and +e. If dm is
the average dissimilarity between all i and j, then
a
d' = d + dm
100
(a negative d’ is not allowed and in this case, a new a value is drawn)
D o (i , j ) = ∑ Duv
o
(i , j )
u,v
45
Weighted sum of dissimilarities
This function calculates the sum term by term of several dissimilarity matrices
estimated on a same set of units, from several sets of variables. A weight can be
affected to each dissimilarity.
If d1, d2 and d3 are three dissimilarities on a same set of units and if w1, w2 and
w3 are the weight factors affected to these dissimilarities, the weighted sum d is:
w1 w2 w3
d (i , j ) = d1(i , j ) + d 2 (i , j ) + d 3 (i , j )
w1 + w 2 + w 3 w1 + w 2 + w 3 w1 + w 2 + w 3
If all the dissimilarities have not the same number of units, the sum will be
calculated only on the subset of units which are present in all input files:
Unit number: number of units in the file
Removed units: number of units in this file that are not found in other
dissimilarities and that have to be removed
Bootstraps: if the input files include bootstrap matrices, the same weighted
sum is calculated on the first bootstrap matrix of each input file, on the second
one and so on. If all input files have not the same number of bootstrap matrices,
the number of bootstraps in the output file will be the smallest number among
input files.
46
Factorial analysis
Method
Principal coordinates analysis (PCoA) is a member of the factorial analysis family working
on distance matrices. It considers the space of high dimension defined by the distances
between units two by two. This space has too high dimension to be readable so PCoA
searches for a subspace of low dimension where distances between units are as close as
possible to the originate distances. PCoA extracts a first axis (one dimension) such that
∑i , j (d ij − δ ij )2 is minimum (where dij is the observed distance between i and j, δij is the
distance between the projections of i and j on this axis). Then it extracts a second axis,
orthogonal to the previous one (independence condition) minimizing the squared
differences and so on. Solutions are given by eigenvectors and eigenvalues of the matrix
W of scalar products between elements that is defined from the dij according to the
Torgerson formula: Wij = – (dij2 – di.2 – d.j2 + d2)/2.
The output is the list of coordinates of each unit on each axis. In general, the first axes
(3 or 4) summarize a large part of the complete space information and plans of axis 1-2,
1-3, 2-3… are sufficient to exhibit the main structure of the data. The part of information
retains by each axis is given by the percent inertia (the eigenvalue of this axis on the
sum of all eigenvalues).
The coordinate of a unit on an axis is given by the projection of this unit on this axis. But
this unit is well represented by its projection only if the distance between the unit in the
full space and its projection on the axis is small. The quality of representation is given by
the squared cosinus of the angle between the unit and its projection (small distance →
small angle → cos2 close to 1, large angle → cos2 close to 0). These cos2 are used to
avoid misinterpretation of unit neighbourhood on the plans.
PCoA is related to multidimensional scaling methods (MDS) which search for a unique
decomposition on a fixed number of axes rather than decompositions axis by axis
successively. For a given number of axes, MDS may produce slightly better results than
PCoA but these iterative methods require considerable time to treat large numbers of
units so only PCoA was developed in DARwin.
Factorial analysis and tree methods constitute two very different approaches for the
representation of diversity structure. Factorial methods aim mainly to give an
overall representation of diversity and are not really interested in individual effects.
On the other hand, tree methods tend to represent individual relations faithfully
and may be less accurate for the overall structure. They are thus two different ways
of viewing the data and must be considered complementary rather than concurrent.
47
PCoA requires an Euclidean distance, if this property is not verified (Dissimilarity
properties), the Euclidean index gives the power transformation required to obtain
an Euclidean distance (Dissimilarity transformations).
Analysis
Input / output files
• .AFT file
This file stores the coordinates of each unit on the retained axes. It has
exactly the same structure as .VAR file except the signature in the first
line: @DARwin 5.0 – AFT.
Eigenvalue and inertia% for each axis are recorded in the comment field.
Parameters
Unit selection
Text window
48
Graphical window
Show the resulting PCoA if ‘Display when done’ is checked.
Graphical display
• This window is automatically opened at the end of the analysis when the option
‘Display when done’ is selected.
• When directly call from the main menu, this function asks for an .AFT file
name.
Graph parameters
Select axes in X or in Y (by default, the graph displays the plan of axes
1and 2)
Zoom: select zoom factor in list box from 100% to 1 000%
External identifiers
‘Open identifiers file’ to select a .DON file
select an identifier in the proposed list
49
The list of units is identified by the current identifier (unit number or
external identifier), this list can be sorted by identifier (left column) or
by unit number (right column), ascendant or descendant by clicking on
column header
Selection of a subset of units (shift or control for multiple selection)
Moving the cursor on a color applies temporary this color to the
selected units.
Click on the color button to apply the color to the selected units.
This window is sizeable
Display units with identifier and number (default mode) and column
widths are sizeable
Display only the unit identifier on multi
Apply and record color selection. The ‘close window’ button will
discard any changes
Open Windows selection Font and size choice for texts in the graph
Graph exportation
Open print window for selecting printer and options to print the graph
50
Tree construction
Method
The principle of any tree construction method is to approach as closely as possible the
dissimilarity d, chosen for its relevance in describing the relationships between units, by
a distance δ that can be represented as a tree.
To find the exact solution, we must enumerate all possible tree topologies for n units. For
each topology, a fit criterion is calculated from edge length estimations and finally, we
will retain the tree topology which optimizes this fit criterion. The number of different
∏3 (2i − 5) . For n
n
binary tree topologies over n units is = 10, there are more than 2 106
different trees and more than 2 1020 for n = 20. It is thus impossible to enumerate all the
trees when n goes beyond some tens, even with the most powerful computers. In such
situations, the only possibility is to construct, from reasonable heuristics, solutions that
will be the best possible but that can never be guaranteed to be optimal.
DARwin proposes methods based on the common agglomerative heuristic that proceeds
by successive ascending agglomerations. Initially, the matrix treated has as many
elements as units in the population and the tree has a star structure. At each iteration,
two elements, units or groups already formed, are defined as neighbours and joined to
form a node in the tree. This node is a new fictive element which replaces the two
combined elements. The two edge lengths between this node and the two combined
elements are estimated. The matrix is updated by estimation of a dissimilarity between
this new element and the other elements and its dimension is reduced by one unit. The
process is reiterated until all the units are in a single group. The proposed methods are
characterized by different choices at the three key points of each iteration:
‘neighbourhood’ definition, dissimilarity matrix updating, and edge length estimations.
‘Neighbourhood’ definition
51
defined by minimizing a criterion Q(i,j), function of d(i,j) and of the average of
dissimilarities from i and j at the n – 2 other elements k:
Sattath and Tversky (1977) adopt a very different approach. They start from the
characterization of an additive tree distance by the four point’s condition. For a quartet
(i,j,k,l), if δ(i,j) + δ(k,l) is the smallest of the three sums of distances two by two, then
the two largest are equal: δ(i,k) + δ(j,l) = δ(i,l) + δ(j,k). The initial dissimilarity d is not
an additive tree distance but it is always possible to form the sums of dissimilarities two
by two. Among these three sums, one is the smallest, d(i,j) + d(k,l), for example; the
pairs (i,j) and (k,l) are thus considered good candidates to be neighbours. They are
assigned a score of 1, while other pairs (i,k), (j,l), (i,l) and (j,k), are attributed a null
score. All the quartets are scanned and the elements of the pair of largest total score are
defined as neighbours. This definition of topological neighbourhood is ordinal in nature,
since it depends only on the order of the three sums, and not directly on the dissimilarity
values.
Dissimilarity updating
Given i and j the elements (units or groups of units) combined in a new element s, ci and
cj the unit numbers of these elements, and k another element, a general definition of
d(s,k) is the weighted average of dissimilarities between k and elements i and j:
d ( s, k ) = λi d (i, k ) + λ j d ( j , k ) with λi + λ j = 1
Elements i and j are groups of ci and cj units and to the weights λi and λj correspond
weights wi and wj attributed to each unit of elements i and j, then:
∑ w i d (u, k )
u ∈i 1 1
d (i , k ) = = ∑ d (u, k ) , d ( j, k ) = ∑ d (u, k )
∑wi c i u ∈i c j u∈ j
u ∈i
ci w i c jw j
and λi = , λj =
ci w i + c j w j ci w i + c j w j
52
‘unweighted solution’: a first solution is to define weights λ as function of the element
numbers ci and cj:
ci cj
d (s, k ) = d (i , k ) + d ( j, k )
ci + c j ci + c j
d (s, k ) =
1
[d (i, k ) + d ( j, k )]
2
which corresponds to a ‘weighted’ criterion since it is obtained if elements of i and j
receive different weights: w i = 1/ c i and w j = 1/ c j
The choice between these two criteria depends on the nature of the population studied. If
the whole arises from a real process of sampling on a given structure of diversity, then
the number of units in each element has a meaning and must be taken into account in
the dissimilarity estimations. On the other hand, if the population does not result of a
real sampling procedure, the size of each group has no real meaning and has not to be
taken into account.
53
Edge lengths
Let l(i,s) and l(j,s) be the edge lengths between elements i and j combined to form the
node s. For adjustment to an ultrametric, d(i,j) is simply divided equally between the two
edges:
l (i , s ) = l ( j , s ) = d (i , j ) / 2
For adjustment to an additive tree distance, d(i,j) is divided proportionally to the mean
dissimilarities of i and j to all other elements k. This can be written:
Bootstraps
If the dissimilarity file includes bootstrapped matrices, tree construction methods use the
trees inferred from these bootstrapped dissimilarities to assess the uncertainty of the
tree structure. Concretely, a bootstrap value is given to each edge that indicates the
occurrence frequency of this edge in the bootstrapped trees.
Two approaches can be used to summarize bootstrapped trees. A first one produces a
majority-rule consensus of the bootstrapped trees. According to the majority rule, only
edges which are found in more than 50% of the trees are present in the consensus. So a
bootstrap value (in percent) varies between 50 and 100. A second approach, retained in
DARwin, is to consider that the best tree is not the consensus tree but, indeed, the tree
inferred from the initial data. So the produced result is the initial tree where each edge
receives a bootstrap value corresponding to its occurrence frequency in the bootstrapped
trees. Then bootstrap values range between 0 and 100. Moreover, a dissimilarity
between each bootstrapped trees and the initial tree is estimated as the fraction of edges
that are present in one tree and not in the other one (the ‘edge distance’ equivalent to
the Robinson and Foulds distance). The mean and the 95 and 5 percentiles of these
dissimilarities are calculated, to describe the dispersion of the bootstrapped trees around
the initial tree.
54
Hierarchical tree
Method
smallest dissimilarity observed for this iteration, all pairs with d ' ≤ d + ε d will be grouped
at this step.
A supplementary node of degree 2 is added for the root of the tree. Normally, a node
corresponds to a divergence and its degree is at least 3. This particular node is only used
to allow representing the tree as a dendrogram.
Procedure
Parameters
• Single linkage, Complete linkage, Ward, UPGMA or WPGMA to select
the method
Unit selection
55
Text window
Neighbor-Joining
Method
The Neighbor-Joining method proposed by Saitou and Nei (1987) is often used in genetic
diversity. It uses the criterion of relative neighbourhood, weighted average for
dissimilarity updating, and adjustment to an additive tree distance. The algorithm
complexity is in n3 and allows to analyse matrices of some hundreds of units. Gascuel
(1997) proposes UNJ (unweighted Neighbor-joining), which uses a criterion of weighted
average. As the neighbourhood criterion calculated for each pair results of a complex
formula involving all dissimilarities, the probability of equal criterion for several pairs is
very low. So the implemented algorithm groups only one pair at each iteration and the
trees are always binary trees.
the precision on dissimilarities could be taken into account in increasing the weight for
well estimated dissimilarities and conversely in decreasing the weight for poor
estimations.
MVR retains an error model where an observed d(i,j) is the sum of the true value D(i,j)
and an error ε(i,j), errors are assumed independent and normally distributed with a
variance V(d(i,j)). These variances are used to estimate the weights λ.
This method finds an application for sequence data when dissimilarities with correction
for multiple substitutions are used since variances of corrected dissimilarities are known
(see Dissimilarity for Sequence data).
56
Procedure
Parameters
Bootstraps
When the .DIS file includes bootstrapped dissimilarities, this option offers
to estimate edge bootstrap values. (bootstrap analysis is not available
for MVR method)
Unit selection
Text window
57
Scores
Method
Sattath and Tversky (1977) propose the Score algorithm which uses a topological
neighbourhood definition, weighted average for dissimilarity updating, and an adjustment
to an additive tree distance. The complexity in n5 is higher than that of Neighbor-Joining.
This method may be very long for large data sets but it could be preferred for its
topological point of view.
At each iteration, all quartets are analysed to fill the matrix of scores between pairs.
The two pairs involved in the smallest sum among the three sums of dissimilarities two
by two receive a score of 1 and the four other ones, a score of 0. If the two smallest
sums are equal, the four involved pairs receive a score of 1/2. If the three sums are
equal, each pair receives a score of 1/3.
The pair of maximal score is grouped to form a new node. If several pairs reach this
maximal score, they are grouped at the same iteration. If several pairs of maximal score
involve identical units, the new node groups all the involved units. For example, if
(12,20) and (15,20) have a maximal score, the node will group 12,15 and 20. So
multifurcations may be created in the tree and some nodes may have a degree greater
than 3.
As the complexity is in n5, bootstrap analysis would be impracticable even for moderate
size data, it was not implemented in DARwin.
Procedure
Unit selection
Text window
58
remaining elements, maximal score really found, the pairs of elements
corresponding to this maximum and their nodes
• the list of edges and their length
Ordinal Neighbor-Joining
Method
Procedure
Parameters
Weighted, Unweighted
Unit selection
59
• [optional] select a .DON file and an identifier in this .DON file to
facilitate unit selection
Text window
A text window displays the main results:
• the list of selected units
• for each iteration: the two elements grouped at this step and the
corresponding node
• the list of edges and their length
Ordinal Scores
Method
Procedure
Unit selection
Text window
60
Neighbor-Joining under topological constraints
Method
This modified version of Neighbor-Joining (the weighted version of Saitou and Nei) allows
forcing the a priori known topology of one or several unit subsets such that the
topologies of these subsets will be respected in the tree inferred on the whole set. The
topology of a subset is described by a tree structure which is read in a .ARB file and is
translated in a list of bipartitions which will be considered as constraints by the
algorithm. If several unit subset constraints are defined and if the intersection between
these subsets is not empty, the constraints on these intersection units must be
compatible.
As for classical Neighbor-Joining, the pair optimising the criterion defines the two
neighbours. Grouping these two elements forms a bipartition: units belonging to these
two elements against all other units. If this bipartition is compatible with the bipartitions
defined as constraints, the group is accepted. In contrary case, this group is refused and
the following pair optimising the criterion is examined until a compatible pair is found. If
no more pair satisfies the constraints, all remaining elements are grouped to the same
internal node, giving a local star structure.
Applications
61
but all information coming from C2 would be lost. Another solution is to construct a tree
on E1 with dissimilarities calculated on C1 + C2 variables. This tree inferred from all the
variables is assumed to be a better solution for this subset. Then this tree is specified as
constraint for an analysis on E1+E2 based on dissimilarities calculated only on C1.
- Multiple outgroups
Outgroups by definition are relatively distant units and they often disturb the resulting
tree. A solution would be to graft a posteriori these outgroups on a tree build on the
active units (see Grafting function). When several outgroups are used, we may be also
interested by their own structure that will not be revealed by grafting one by one. A
better solution could be to apply a tree construction method only to the active units. This
inferred tree is not disturbed by the outgroups and is expected as it in the tree including
also the outgroups. For that, it will be specified as constraint in an analysis including the
active units and the outgroups.
Procedure
Parameters
• Constraint tree selection:
to add or remove trees of constraints as .ARB files
Unit selection
Text window
62
• Print the text window on the current printer
Procedure
Input file
• The input file is necessarily a .DIS file.
Parameters
• Method:
• Weighted Neighbor-Joining and mean least square grafting
• Score tree and score grafting
Unit selection
63
Text window
• tree construction for the whole unit set, as for NJ or Score
• numbers of resolved and unresolved quartets for this tree
• a table giving for each removed unit (sorted in increasing order of the
quartet distance):
- R resolved quartets for the grafted partial tree
- U unresolved quartets for the grafted partial tree
- R/Rs resolved quartets with the same topology
- R/Ru resolved quartets with different topologies
- R/U resolved quartets in a tree and unresolved in the other one
- U/U quartets unresolved in the two trees
- Qd the quartet distance between the two trees
• the list of edges and their length
The quartet tree distance estimation procedure takes long time for big datasets. As
this procedure is called for each unit of the dataset to compare initial tree and tree
obtained without this unit then grafted, complete exploration of the whole dataset
can take several hours with more than 300 units.
64
Trees…
Draw
Display a tree read in a .ARB file in input. Several functions are proposed to
modify the tree representation and facilitate its interpretation (color, label,
rotation, root…). All the user choices are recorded in the tree file (see .ARB file
components) that allows to redisplay the tree exactly as it was saved.
• actions
They are applied at the whole tree and do no depend on the choice of a particular
element of the tree: mirror, external identifiers, police, titles…
• tools
They are applied to particular nodes and require a user action to select these
nodes (root, zoom, rotation, branch swapping…).
The selection of a tool gives to the cursor a particular shape. Then a node can be
selected directly on the graph in clicking with the cursor on this node or chosen
in a list.
A special zone is opened at the right of the toolbar, for example for the edge
contraction tool:
where
Icon identifying the current tool
Two particular functions are also included in the toolbar because they are applied
interactively on the tree itself and work like tools. They do not modify the tree
representation but create new information:
. Edge contraction modifies the structure of the tree giving a new tree which is
recorded in a new tree file.
. Group definition records a group identifier in a .DON file.
65
Record tree and graph
- Save tree: save the tree (and the edition
actions, see .ARB file components) in the same
.ARB file
- Save tree as…: save the tree (and the edition
actions) in a new .ARB file
- Record EMF graph: record the tree graph in a
.EMF file (Windows enhanced metafile)
Tree representation
Select the mode of representation.
Root selection: toggle tool to change the current root (the node in red)
by clicking on another node or by selecting its number in the node list.
Edition: toggle the tree edition toolbar witch appears vertically on the
upper left side of the tree window.
Rotation: tool (only for radial representation)
- on the root to rotate the whole tree
- on a node to rotate the edge ending at this node
- left button: left (anti-clockwise) rotation 1°
- shift + left button: left (anti-clockwise) rotation 5°
- right button: right (clockwise) rotation 1°
- shift + right button: (clockwise) right rotation 5°
66
Branch swapping: toggle tool for branch swapping by clicking on
the node or choosing its number in the node list.
Horizontal mirror
Vertical mirror
Topology: toggle for setting all edge lengths to one in order toexhibit
the tree structure in case of very short edges
Unit colours: open a window for choosing particular colours for selected
subsets of units: Unit_color_selection
- selection of a subset of units identified by their current identifier
(numerical or external identifier) with usual shift and control function
for block or unitary selection
- choice of a colour for this subset (select black to undo a colour)
External identifiers
Click on “Open identifiers file” to select a .DON file
Each identifier is added to list items
Click on identifier item: select identifier as unit label
Font: font, style, size for texts (unit identifiers, node numbers, titles…)
67
root) a selected node.
Left or right button on a node for zoom in or out or selection in the
node list.
This function creates a new tree (in a new .ARB file) where some internal edges
are contracted (external edges cannot be contracted). The resulting tree shows
multifurcations, and at the limit, if all internal edges are contracted the tree is a
star.
This function is used to remove internal edges regarded as unreliable because
they have too short length or are not strongly supported by bootstrap analysis. It
is preferred to retain a multifurcation that shows an uncertainty rather than to
maintain an edge that may be inaccurate.
- Left clicking on a node (or selecting it in the node list) contracts all edges
of the sub-tree rooted on this node relatively to the current root of the tree.
The contracted edges appear as dashed lines.
- Left Clicking on a node in a sub-tree previously contracted undoes the
contraction for the part of the sub-tree rooted on this node and for the edge
ending at this node.
With an appropriate sequence of selecting / unselecting actions, it is
possible to contract any internal edge subset.
- Right clicking on a node is equivalent to simultaneous left clicks on all
nodes that are at an equal or greater distance from the current root. It is an
automatic mode that contracts all edges beyond a user defined level.
Open a window to record the contracted tree in a new .ARB file. A new tree
draw window is automatically opened for this tree.
68
Examples:
5 5
10 10
4
6 4
14 6 14
3
8 3
8
7
7
15
15 9
11 11
9
2 2
13 13 1 12
1 12
5
5
10
10
6 4
6 4
14 14
3 3
8 8
7
7
15
15 9
11
11
9
2
2 13 1 12
13
1 12
Group definition
This function partitions the unit set in groups, a group gathering all units of the
sub-tree rooted on a selected node. A unit not implied in a sub-tree defines its
own group. A group is identified by the node number or by the unit number for
single unit groups. This group identifier affected to each unit is recorded in a new
or a pre-existing .DON file. This group identifier will be used as external identifier
in other analysis.
- Left clicking on a node (or selecting it in the node list) affects all units of
the sub-tree rooted on this node (relatively to the current root of the tree)
to a same group, the edges of this sub-tree appear as bold lines.
- Left clicking on a node previously selected undoes the action. Selecting a
sub-tree that includes previously defined groups, merges all concerned units
in a same group.
69
- Right clicking on a node is equivalent to simultaneous left clicks on all
nodes at an equal or greater distance from the root.
Examples:
c1
5 c1 5
1 10
c7 4
0
c2 c2
6 6 4
1 14
43 3
8 8
7 7
15 1
c6 1
5
11
1 9 9
2 2
1
1 1
c3 c4 13
1 1
3
c5
2 2 c3
c4
Groups (bold lines), Groups (bold lines), automatic mode
arrows: user selected nodes arrow: user selected threshold
Graphical window
Any value lower than the start value is joined to the first class. Any value greater
than the superior limit of the last class is joined to this last class.
70
Copy graph to clipboard:
Left click: EMF (vector) format
Right click: BMP (raster) format
Tree distance
Additive tree distances between units two by two are calculated and stored in a
dissimilarity matrix
Output window
Display the resulting dissimilarity matrix if ‘Display when done’ is
checked.
Fit criterion
This function calculates some criteria to evaluate the fit between the initial
dissimilarities d and the distances δ as represented in a tree.
Input files
Text window
∑ (δ (i, j ) − d (i, j ))
1
• mean error:
n i, j
1
• mean absolute error: ∑ δ (i, j ) − d (i, j )
n i, j
• maximum absolute error: max δ (i, j ) − d (i, j )
1
∑ (δ (i, j ) − d (i, j ))2
• mean square error: n i, j
71
• Print the text window on the current printer
Procedure
Input files:
• a .ARB file for tree topology
• a .DIS file for dissimilarities. The .DIS file read in the tree file comment
field is automatically proposed but another .DIS file can be selected.
Output file: a new .ARB file to record the tree with its new edge lengths. By
default, the proposed filename is name_Adjusted.ARB where name is the initial
.ARB file name.
Graphical window: show the resulting tree if ‘Display when done’ is checked.
72
Pruning
This function deletes one or several units in a tree. The corresponding external
edges are removed and the resulting nodes of degree 2 are removed by merging
the two corresponding edges.
Output file: a new .ARB file to record the pruned tree. By default, the proposed
filename is name_Pruned.ARB where name is the initial .ARB file name.
Graphical window: show the pruned tree if ‘Display when done’ is checked.
Grafting
Method
This function adds a new unit to a tree such that the tree distances between this new
point and all the units in the tree are as close as possible of the corresponding initial
dissimilarities.
The edge and the position of the grafting point on this edge have to be defined. The
implemented algorithm examines successively each edge and estimates the position on
the edge according to an optimality criterion. Finally, the edge which optimizes the
criterion is retained.
Two optimality criterions are proposed. The first one is a least square criterion that might
be used when the tree is inferred with Neighbor-Joining method. If x is the unit to graft,
d the dissimilarity and δ the additive tree distance, the position of the grafting point
optimizes the quantity:
1
∑ (δ (i , x ) − d (i , x ))2
n i
The second criterion is analogue to the criterion used in Score method. Consider a triplet
(i,j,k), the unit x to graft and a given edge for grafting. The smallest of three sums of
dissimilarities two by two for this quartet gives a first topology. The choice of an edge for
grafting gives a tree topology for this quartet. If these two topologies are the same, the
73
score of the edge is set to 1. The resulting score for this edge is the sum for all triplets.
Finally the edge giving the higher score is retained to graft the new point.
This function is particularly useful when an outgroup is added to the unit set in order to
define a more ancestral node which will be used as root for the tree. However, outgroups
by definition are relatively distant units and they often disturb the tree build on data
including this outgroup. A better solution would be to graft a posteriori this outgroup on a
tree build on the unit set (without the outgroup) and to regard the grafting point as the
ancestral root.
Procedure
Input files:
a .ARB file
a .DIS file for dissimilarities. The .DIS file read in the tree file comment
field is automatically proposed but another .DIS file can be selected.
Output file: a new .ARB file to record the resulting tree. By default, the
proposed filename is name_Grafted.ARB where name is the initial .ARB file
name.
Graphical window: show the grafted tree if ‘Display when done’ is checked, the
new edge is in red.
Starting from a set of units, this procedure searches for a subset of units minimizing the
redundancy between units and limiting if possible the loss of diversity. Redundancy
means that some units are very close and then bring in part the same information on the
diversity. The diversity is here expressed by the tree as build on the initial set of units.
Two units are regarded as redundant if their distance in the tree is small. The choice
between these two units relies on their edge lengths. By construction, the unit with the
longest edge has more uncommon characters than the unit with the smallest edge which
shares characters with other units more frequently. So, in order to maintain at best the
diversity in the tree, we choose to remove the unit with the smallest edge and to keep
the unit with the longest edge.
74
3rd step
2nd step
1st step
At each step, two indices are calculated to characterize the shape of the tree:
- the ‘sphericity index’ that is the ratio of the lengths of external edges to the total length
of the current sub tree. This index has low values for trees with numerous redundant
units (a lot of small external edges) and tends towards 1 when all units are independent
(a lot of long external edges, the tree tends towards a star-like tree).
- the length of the pruned edge expressed in percent of the initial tree length,
The procedure lets to the user the choice of the sample size to retain. For a selected size,
the sample composition and the corresponding sub tree can be recorded.
(This procedure is also used in a particular genetic background, see sampling for
disequilibria)
This procedure is not equivalent to remove at each step the unit k
with the smallest edge. This would not be efficient to reduce
redundancy, ex: i and j are the redundant units although k has i
the smallest edge.
j
Procedure
Input file
A .ARB file in input.
Units
75
• Removable units: these units are neither excluded nor forced and are
available for selection in the procedure.
Remark: the current selected identifier will be used in the text window to identify
units.
Graphical window
- ‘sphericity index’
- ratio pruned edge on initial tree length.
Text window
A first line in red is for the initial tree on the whole data set. The line in blue is
for the step 0 on the active unit set.
76
• Print the text window on the current printer
Sub tree
• Unit number
The user chooses the retained sub tree by its size. It is a value between the
number of active units (without the excluded units) and the number of forced
units or 3, the three last units, if there is no forced unit.
• Identifier file
A .DON file is selected to record the results of the procedure for each unit. It may
be an existing .DON file where all units of the .ARB file in input are necessarily
present, the new fields will added after the fields already existing. It may be also
a new .DON file which is initialized with the units of the input .ARB file and if an
identifier has been selected in Units sub menu, the first recorded field is this unit
identifier.
• Record Identifier
- The first recorded field is the step at which the unit has been removed (forced
units have all the value of the last step). For excluded units the value is 0. This
identifier is independent of the selected sample size and can be used to
characterize any subset: for a size m, all units with a value lower or equal to m
are in the subset. The label of this field is by default 'Tree remove order' but it
can be modified by the user.
- The second recorded field is proper to the user selected sub tree and takes
values:
'Excluded' if the unit was excluded (value 0 in the previous field)
'Removed' if the unit was removable and has been effectively removed,
'Kept' if the unit was removable but has been kept in this sub tree,
'Forced' if the unit was forced (kept in any case in the sub tree).
The label of this identifier is by default 'Tree sample_m' for a sub tree of size m,
but it can be modified by the user.
If several subsets of different size are recorded, 'Tree remove order' field will not
be repeated.
• Record subtree
Ask for the name of a new .ARB file to record the sub tree corresponding to the
selected 'Unit number' value, and open automatically a window to display this
tree.
77
Add a 2-degree node
This function adds a node of degree 2 on a user-defined edge of a tree. This
node creates two new edges of equal length. This function is used for example
for a more convenient representation in rooting the tree on an ancestral node
created on the edge between an outgroup and the other units. It is used also to
define a common root to two trees compared with the rooted MAST procedure.
Output file: a new .ARB file to record the resulting tree. By default, the
proposed filename is name_2-Node.ARB where name is the initial .ARB file name.
Edge selection
. Select an edge in the ‘Edges list’
Graphical window: show the resulting tree if 'Display when done' is selected
Input file: a .ARB file. If selected has no 2-degree node, input file procedure
fails with a user message.
Output file: a new .ARB file to record the resulting tree. By default, the
proposed filename is name_R2-Node.ARB where name is the initial .ARB file
name.
Graphical window: show the resulting tree if 'Display when done’ is checked.
Reticulations
Method
We consider a dissimilarity δ on a set of n units and T the associated tree. This tree can
be interpreted as a phylogenetic tree only under assuming a model of evolution by
accumulation of inherited mutations excluding any form of genetic exchange between
separated branches. This model is valid in case of asexual multiplication or for
mitochondria or chloroplast markers that have single parent heredity. It is still usable
when analysed taxa are geographically isolated and cannot exchange. In other cases it
may produce partially false results, the diversity structure being a network and not a
tree.
78
Several attempts to represent diversity by networks can be found in the literature. The
most popular is the 'split-decomposition' (logiciel SplitTree, Bandelt and Dress) but which
in practice produces unreadable graphs with a huge number of edges when the number
of units exceeds a few tens. To recover a lower complexity, a way, proposed by Legendre
and Makarenkov (2004), is to start with a tree and to improve this tree by addition of
reticulations when necessary. This model assumes that the tree model is correct on the
whole but is locally disturbed by some rare events of horizontal exchange.
a
b
l
j
i A B
The fit between the data and the inferred tree can be estimated by the quadratic sum of
differences between the observed dissimilarity δ and the tree distance d.
W0 = ∑ ∑ (δ ij )
− d ij 2
i j ≠i
with d ij = d ia + d ab + d bj
When the reticulation (ab) is added, the quadratic sum becomes Wab, the distance in the
tree for a unit i in A and a unit j in B being taken as:
d ij = d ia + l + d bj
79
The gain in fit induced by the reticulation (ab) is given by a criterion Qab:
W 0 − W ab
Qab =
W0
and the length l is chosen to maximize this criterion:
l = d ab +
1
(
∑ ∑ δ ij − d ij
n A n B i ∈ A j ∈B
)
with the constraint 0 ≤ l ≤ d ab
The gain in fit is successively computed over all pairs of nodes (internal and external
nodes) providing an ordered list of all the potential reticulations. The best gain is retained
for the first reticulation (the four higher values are also displayed to detect possible
almost so good solutions). The distances in the tree for pairs of units in A and B are
updated to account for the shortcut passing by this first reticulation and the algorithm
iteratively detects the following reticulations.
A predefined least-squares threshold q can be used to retain only reticulations with a Q
value greater than this threshold.
Warning: the edge lengths of the tree must be previously corrected by a posterior
overall estimation (Least-squares re-estimation of edge lengths).
Tree algorithms like NJ estimate the edge lengths at each step as local least-
squares optima for the current step; that does not ensure that they are globally
optimal. So without posterior overall estimation, reticulations will mainly try to
correct this lack of optimality instead of accounting for genetic exchange between
divergent branches.
Procedure
Input files:
- a .ARB file for tree topology
- a .DIS file for dissimilarities. The .DIS file read in the tree file comment
field is automatically proposed but another .DIS file can be selected.
Number of reticulations
Stop the search when this maximal number of reticulations is reached.
LS threshold %
Stop the search when the least-squares gain Q becomes lower than this
threshold.
(these two parameters are combined and the search stops as soon as one of
these parameters is reached)
Output file: a new .ARB file to record the tree with added reticulations. By
default, the proposed filename is name_Reticulated.ARB where name is the initial
.ARB file name.
80
Text window:
- W0 the sum of squares for the initial tree
- for each successive reticulation, by decreasing order of adjustment
improvement:
• the two nodes linked by the reticulation
• DW, the decrease in sum of squares W0-Wab induced by this
reticulation
• DW/W0%, this decrease in percent of the initial sum of squares
• the same information for the 4 following best solutions at this
step
Graphical window: show the resulting tree if 'Display when done’ is checked.
The reticulations are illustrated by dotted red lines joining the nodes but the tree
geometry is preserved and the reticulations cannot be displayed at their true
lengths.
81
Tree comparison
Consensus and tree distances
Consensus methods
The same unit set is often characterized by several variable sets: molecular markers on
nuclear and mitochondrial DNA, several gene sequences … and a common analysis of
these data is logically a question of interest. A first solution would be to merge the
different variable sets in a unique set and to construct a tree on this set. But it is rarely
the right solution, for theoretical reasons when the different sets have not undergone the
same evolutionary process or for practical reasons, for example when several gene
sequences of very different lengths are compared, a direct concatenation would give
undesirable higher contribution to the longest genes. A better solution is to construct a
tree for each variable set and in a second time, to exhibit eventual common structure
between these trees.
Consensus methods construct a synthetic tree which exhibits the common information to
compared trees in retaining only the edges that are present in all elementary trees (or a
majority). It is a purely structural point of view since edges lengths that depend on each
particular variable set, are not directly comparable.
DARwin proposes the strict and the majority rule methods. The strict consensus only
retains the edges which are present in all the trees compared. The majority rule
consensus is less restrictive and retains the edges present in more than T% of the trees
where T=50 is often chosen as threshold but could be greater. If only two trees are
compared, the two methods are equivalent.
The edge lengths in the consensus tree are arbitrary set to 1. However, if some edges
have null length in the initial trees, the length in the consensus tree depends on the
chosen method:
- for strict consensus: if an edge has a null value in a least one tree, then this edge is
null in the consensus
- for majority rule consensus: a consensus edge is null only if this edge is null in more
than T% of the trees.
Nodes of degree 2 create two edges which are equivalent in terms of bipartition and
which do not contribute to the consensus construction, so they are ignored in the
procedure.
82
‘Bipartition’ distance between trees
In complement to the common structure revealed by the consensus tree, the difference
between two trees can be summarized by a distance measure between these trees. This
distance can be defined as the sum of differences of each one to their consensus tree
which is always simpler in structure than the initial trees. This structure is quantified by
an index of complexity v; the dissimilarity between two trees H and H′, of consensus Hc,
is thus:
d (H, H ' ) = v (H ) + v (H ' ) − 2v (H c )
Several definitions of complexity can be considered. A common way is to measure the
complexity of a tree by its number of edges. The ‘edge’ distance (=Robinson and
Foulds distance) is thus the number of edges which are present in one tree and not in the
other one and varies according to the number of internal edges conserved in the
consensus tree. This distance regards all edges equivalently wherever their position in
the tree may be. Another way is to weight the edges according to their ability to
‘structure’ the tree. These weights are defined from the corresponding bipartitions. If an
edge induces a bipartition of s units against n-s units, the weight for this edge will be
s(n-s). So the weights will be the smallest for an external edge (n-1) and maximal for a
more ‘structuring’ internal edge partitioning the units in two equal subsets (n2/4). Then
the complexity of a tree becomes:
v (H ) = ∑ s ( n − s )
E
The bipartition distance depends on the consensus complexity. If several trees are
concerned, we retain the consensus of all these trees. So the distance calculated
between two trees will not be the same if only these two trees are compared or if
other trees are implied in the consensus.
A statistical interpretation of this distance requires its distribution under a null hypothesis
that the trees are randomly drawn in the set of all possible trees on n units. This
distribution is not analytically defined so we can only propose results from large
simulations for binary trees. The following table gives for trees of 20 to 100 units the Db
value such that, among 6 000 random tree pairs, p% show a distance lower or equal to
Dq. This means for example that, for 100 units, a Db lower than .412 has only 5 chances
on 100 to be a random effect and only 1 chance if it is lower than .394.
83
n 1% 5% 10% 20%
20 .727 .753 .766 .782
40 .580 .600 .611 .626
60 .492 .511 .522 .537
80 .435 .453 .464 .477
100 .394 .412 .421 .434
Procedure
Input files: several .ARB files (necessarily on the same unit set).
• to add new tree files
Strict or Majority rule consensus and the threshold for majority rule.
Text window
Graphical window: show the consensus tree if ‘Display when done’ is checked.
Consensus methods suppose that all the units are correctly represented; the exchange of
an unit from one group to another is a strong indication that there is no real separation
of the groups. But in some cases, the compared trees seem to have a common structure
for almost all units except some ones which seem more erratic. For consensus trees,
these erratic units have the same weight as others and may mask a common structure.
Another point of view would be to identify and eliminate these ‘fluctuating’ units to
exhibit the common structure. The problem becomes that of determining the smallest set
of units that have to be pruned in each tree to obtain identical trees or, inversely, the
84
largest set of units having the same structure in the compared trees. These units form
the maximum agreement sub-tree.
The simple statement of the problem masks a relatively complex algorithmic problem.
DARwin uses an algorithm published by Kubicka et al. (1995) which gives an exact
solution with a sufficiently low complexity to be used in practice. The algorithm relies on
the enumeration of all possible solutions while limiting the depth of exploration of the
branches on a stop criterion.
The two compared trees can be either unrooted or rooted. A tree is regarded as rooted if
it has a node of degree 2 which will be taken as root (see Add a 2-degree node). If the
two trees are rooted, a rooted MAST is available; it is more restrictive than unrooted
MAST since common sub-structures have to respect the root position.
The order o of the MAST (the number of units conserved) can be considered as a
measure of the resemblance between trees. The maximum order is n, and it is obtained
for two identical trees, the minimal value is 3, since the single typology of three points is
necessarily common to two trees.
n−o
So a distance between trees is defined as d = (0 ≤ d ≤ 1)
n−3
The practical use of this criterion requires knowledge of the distribution of o under the
hypothesis of independence of trees. This distribution is not known but has been
approached by simulating pairs of random binary trees of 20 to 100 leaves. The above
table gives the proportion of random tree pairs found for a given order and the average
order for all the simulated pairs.
o= 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Mean
n=20 .01 .341 .497 .139 .012 .001 7.80
For example, for 60 units, random trees will have in average an order of 13 and an order
of 15 will appear in frequency of 0.063. This can be used to fix a rule of interpretation.
For example, it can be concluded that orders superior or equal to 10, 13, 16, 18 and 19
(when n varies from 20 to 100) will be a random effect in less than 5 cases on 100.
85
Maximal length MAST i
Procedure
Output files: a new .ARB file which stores the resulting tree.
For ordinary MAST, all edges are arbitrary set to 1.
For Maximal length MAST, the edge lengths are the weighted averages of
the initial lengths.
Parameters
86
• rooted or unrooted MAST (only if the two trees have a 2-degree
node)
Text window
Graphical window: show the resulting tree if ‘Display when done’ is checked.
Quartet distance
Method
The quartet distance estimates the difference between two trees as the number of
quartets which have not the same topology in the two trees. It is a purely topological
measure that does not depend on the edge lengths.
j
i k i i j i
k k
j l l l j l
k
(ij)/(kl) (ik)/(jl) (il)/(jk) (ijkl)
Four topologies are possible for a quartet (i, j, k, l), the three first are resolved
topologies with two units against the two others. The fourth is an unresolved topology
which implies a node of degree greater than 3.
Some algorithms never infer nodes of degree greater than 3 but some edges may
have a null length. The implemented quartet distance algorithm regards that as an
artefact and virtually contracts these edges of null length in creating virtual nodes
of degree greater than 3.
Let Nq be the total quartet number, Nr the number of resolved quartets of same topology
in the two trees and Nu the number of quartets which are unresolved simultaneously in
the two trees, then the quartet distance Dq is:
Dq = (1 − N r − N u ) / N q
87
A direct counting for all quartets would lead to a complexity in o(n4). The implemented
algorithm based on a topological tree decomposition allows a complexity in o(n3).
However this method may be very long for large data sets.
This quartet distance is only a measure of dissimilarity between two trees. For a
statistical interpretation of this value, it would be necessary to know the distribution of
this measure under the null hypothesis that the two trees are independent trees
randomly drawn in the population of all trees. This distribution is not known so we can
only propose results from large simulations for binary trees. The following table gives for
trees of 20 to 100 units the Dq value such that, among 6 000 random tree pairs, p%
show a distance lower or equal to Dq. This means for example that, for 100 units, a Dq
lower than .654 has only 5 chances on 100 to be a random effect and only 1 chance if it
is lower than .646.
n 1% 5% 10% 20%
20 .552 .598 .619 .641
40 .611 .634 .643 .655
60 .629 .646 .652 .659
80 .640 .651 .656 .661
100 .646 .654 .658 .662
This algorithm can be time consuming with large trees (over 2 hundred units).
Procedure
Input files: Two .ARB files (necessarily on the same unit set).
Text window:
- For each tree, resolved and unresolved quartet numbers
- Total number of quartets
- Number resolved in the two trees with the same topology
- Number of quartets resolved with different topologies
- Number of quartets resolved in a tree and unresolved in the other one
- Number of quartets unresolved in the two trees
- Quartet distance
88
Disequilibrium
Background
This submenu addresses a specific problem of linkage disequilibrium in genetic. The
background is the localization of genes involved in agronomic traits in using molecular
markers as tags. The closeness between gene and marker is detected by association
mapping based on disequilibrium between linked loci. For that, large germplasm
collections are often used in order to maximise the allelic diversity. But collections are
often complex pools of genetically differentiated objects accumulating various
demographic or breeding events. So these highly structured populations show disturbed
balance of alleles generating disequilibria even between unlinked loci leading to false
linkage disequilibria.
For association mapping analysis, a large number of accessions are genotyped for
molecular markers but phenotyping for phenotypic characters is long and expensive and
can concern only a small part of the collection. So combining the two problems: -
spurious associations in heterogeneous populations - sampling for phenotyping, arises to
the question: how to take advantage of the necessary sampling to minimize spurious
associations due to structures, if possible with a limited allelic diversity reduction?
The observed disequilibrium is the sum of a physical component due to linkage between
loci on the chromosome (LD) and a structural component due to structures in the
population (SD). The sampling procedures will work on a set of independent markers in
order to remove the linkage component.
Method
The proposed methods are heuristic procedures that find approximate solutions since
exact solutions should examine all possible subsets and are not feasible for large
populations. Two different heuristics are proposed. The first one starts from a diversity
tree on a set of unlinked makers and extracts a sub tree as unstructured as possible. The
second one starts from the disequilibria observed between loci and extracts a sample
minimizing these disequilibria.
89
unstructured tree -a star like tree- by successive pruning of redundant units, this sub
tree being of maximal length to maintain a sufficient allelic diversity. At each step,
disequilibria between pairs of loci are calculated to follow effect of redundancy decrease
on disequilibria.
This procedure is a development in a particular background of a general procedure to
prune a tree of its redundant units (see Max length sub tree).
Min SD subset
The second approach relies directly on the disequilibrium between loci observed on the
data set and tries to find a sub sample that shows the smallest disequilibrium. The
procedure is a stepwise algorithm removing at each step the unit with the greatest
contribution to the general disequilibrium between all pairs of loci.
These two procedures do not lead to the same result. The second one, on
disequilibria, gives logically best results in term of disequilibrium decrease but it
might be an ad hoc solution and the result on an other set of markers is
questionable. The sub tree procedure is often less efficient to reduce disequilibria
but it might give more robust samples. However the two procedures are not
exclusive. On real data, we applied with success a mixed strategy: max sub tree
was used in a first step to extract a sub sample where the most redundant units
were removed and in a second step, Min SD procedure was used on this sub sample
to effectively minimize the disequilibrium.
Haplotypes
We consider here only diploid species. Disequilibrium between two loci can be estimated
only if we can say which allele of a locus is associated to which allele of an other locus.
So it is assumed that the phases are known and that the two haplotypes of a
heterozygous diploid are identified.
In the absence of family data and molecular-haplotyping methods, statistical methods
are required for inferring haplotypes from genotypic data. Several software are available,
they often implement versions of the maximum-likelihood expectation/maximization
algorithm as proposed by Excoffier and Slatkin (1995). To contend with some limitations
of these algorithms, Stephens et al. (2001) propose a Bayesian approach using a Monte-
Carlo Markov chain algorithm. The procedure is implemented in the software PHASE,
available from http://www.stat.washington.edu/stephens/software.html. Two modules are proposed
to export DARwin files to Phase and to extract DARwin files from Phase outputs.
90
allelic frequencies, the margins, are fixed and have not changed since the date of
mutation.
Example:
B
. equilibrium . maximum
1 2
24+4 46-4 70 10 60 70
1 24 46 70
A 16-4 14+4 30 30 0 30
2 16 14 30
40 60 100 40 60 100 40 60 100
400
D' = = 0.22
1800
This measure can be extended to multiallelic loci, it is a weighted sum of D' calculated on
all possible 2x2 sub tables crossing an allele at a locus and the sum of all other ones:
K L
D' = ∑ ∑ pi p j Dij' with Dij' calculated on i non-i
i =1 j =1
j pj
non-j
pi
A rational for this extension is that disequilibrium depends only on the distance between
the two loci and consequently the same value should be obtained what were the alleles
considered.
But this measure of linkage disequilibrium cannot be used directly for structure
disequilibrium essentially and clearly because they have not the same origin. A first
question is the standardization. Disequilibrium is no longer a balance between cells and
the margins do not represent in any way the initial population. So the only possible
standardization term is the maximum value that occurs in the limit case with an half of
the population in two opposite cells of the contingency table:
B
. nearest equilibrium . maximum
1 2
24 46 70 50 0 50
1 24 46 70
A 16-7 14 23 0 50 50
2 16 14 30
40 60 100 33 60 100 50 50 100
400
D' = = 0.16
2500
A second question is the extension to multiallelic loci. Disequilibria are no longer proper
to the loci themselves but different pairs of alleles at a same locus may exhibit different
91
levels of disequilibrium. So we propose a new measure as a sum on all possible pairs of
alleles:
1
SD = ∑ ∑ ∑ ∑ (n ij n i ' j ' − n ij ' n i ' j )
Dmax i i ' ≠ i j j ' ≠ j
2
1 n
with Dmax = NA(NA − 1) where NA = min( K , L ) and K and L, the numbers of
2 NA
alleles at the two loci.
mean 95-percentile
A disequilibrium is calculated for each pairs of loci
0.05
%
(L(L-1)/2 values for L loci) and a population is
characterized by the distribution of these 0.04
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
these greatest values. So a better criterion to
reflect this queue of distribution is an upper
percentile (to a fixed threshold).
Allele richness
Two criteria inform on the loss of alleles in successive samples. The first one is the
number of present alleles in a sample expressed in percent of the initial number of
alleles. It can be considered also that the loss of a rare allele is less important that the
92
loss of a very frequent allele, so the second criterion takes into account the initial allele
frequencies.
At a given step, let slk=1 if allele l of marker k is present in the sample and 0 if it is
absent:
1 1
C1 = ∑ ∑ s lk
K k L l
(C1=C2=1 at step 0)
1
C 2 = ∑ ∑ flk s lk
K k l
where flk is the initial frequency of allele l for marker k, K the number of loci, L the
number of alleles at locus k.
It is a step by step procedure starting from a diversity tree inferred with a convenient
method. Distances d(i,j) between units in the tree are firstly evaluated.
Then for each step, the pair of remaining units (i,j) of minimal distance is selected.
The unit i is removed if li < lj and conversely, li and lj being the lengths of the external
edges in the tree.
The procedure iterates on this sub tree and so.
It is a stepwise algorithm removing at each step the unit with the greatest contribution to
the disequilibrium. This contribution, the score, is evaluated for each unit and the unit
with the highest score is removed.
For a pair of loci k and l, the partial score of unit i is the difference between the
disequilibrium with and without this unit (:
+i −i
X i( kl ) = SDkl − SDkl
Then Sci, the score of unit i, is the weighted sum on all pairs of loci of its partial scores:
Sc i = ∑ ∑ w kl X i(kl )
k l
The weight wkl is chosen as the square of the disequilibrium for this pair of loci, to favour
reduction of highest disequilibria:
(
+i
w kl = SDkl )
2
The unit of maximal score is removed, the procedure iterates on this sample and so on.
93
Procedure
Input files
Three ‘Tabs’ allows user to set options. ‘Options’ tab contains global options and
‘OK’ button to launch main procedure, ‘Random sampling’ tab contains random
sampling options, and ‘Record sample’ tab contains record sample options.
‘Options’ tab
Units
Remark: the last selected identifier will be used in the text window to identify
units.
94
Loci
Missing data
Check the box to indicate that some data are missing in the allelic data file. The
integer value retained to code a missing data has to be specified by the user
(code for missing data).
Disequilibrium for a pair of loci will be calculated only on haplotypes with present
data for the two loci.
All alleles in number lower than this frequency by two times (two haplotypes for
each unit) the size of the population at the current step will not be taken into
account in disequilibrium estimation. Note that the number of units decreases at
each step, so the threshold that depends on this number varies with steps.
Percentile
OK Launch the main procedure, display SD graph and the text window. It opens
also options for random sampling, sample recording…
Any modification in the previous options erases the graph and closes the
subsequent options until the procedure is launched again.
Display the distributions of disequilibria between pairs of loci, in blue for the
active data set (selected loci and removable+forced units), in red for a
given step selected by the user (sample size), this choice is proper to this
window and is independent of the value used to record the sample (see
below).
95
The number of classes, the starting value, and the class range can be
modified.
Record the disequilibria between pairs of loci for the active data set
(selected loci and removable+forced units) in a .DIS file on the
number of selected loci. The associated .DON file is also created to
record the labels of the loci. This matrix can be used to display a
topology of loci according to their disequilibria (groups of loci in
disequilibria) with a tree construction method on the transformed
matrix 1-d.
Graphical window
• SD graph
• 'tree' graph
For Max length sub tree, another graph displays, with the same x-axis, the
variations at each step of:
- ‘sphericity index’
- ratio pruned edge on initial tree length.
(see Max length sub tree – Method)
96
Text window
A table that lists the main results, it differs in part for the two procedures.
97
A first line in red gives the values for the initial tree on the whole data set (all
units and selected loci). The line in blue is for the step 0 on the active unit set
(removable and forced units).
• Sample size
The user chooses the retained sample by its size. It is a value between the
number of active units (without the excluded units) and the number of forced
units or 3, the three last units, if there is no forced unit.
• Identifier file
A .DON file is selected to record the results of the procedure for each unit. It may
be an existing .DON file where all units of the input file (.ARB file for Max length
sub tree or .VAR file for Min SD subset) are necessarily present, the new fields
will be added after the fields already existing. It may be also a new .DON file
which is initialized with the units of the input file and if an identifier has been
selected in Units sub menu, the first recorded field is this unit identifier.
• Identifier
Record fields in the selected .DON file.
- The first recorded field is the step at which the unit has been removed. All
forced units take the last step as value. For excluded units the value is 0. This
identifier is independent of the selected sample size and can be used to
characterize any subset: for a size m, all units with a non-null value lower or
equal to m are in the subset. The label of this field is by default 'Tree remove
order' but it can be modified by the user.
- The second recorded field is proper to the subset corresponding to the selected
'sample size' value. It takes values:
'Excluded' if the unit was excluded (value 0 in the previous field)
'Removed' if the unit was removable and has been effectively removed,
'Kept' if the unit was removable but has been kept in this sub tree,
'Forced' if the unit was forced (kept in any case in the sub tree).
The label of this identifier is by default 'Tree sample_m' for a sub tree of size m,
but it can be modified by the user.
If several subsets of different size are recorded, 'Tree remove order' field will not
be repeated.
98
Export to 'PHASE' software
Method
Procedure
99
Missing data
Check the box to indicate that some data are missing in the allelic data file. The
integer value used to code missing data has to be specified by the user (Integer
code for missing data).
These missing will be coded with the convenient value for PHASE.
Units
Loci
If checked, this option creates a new .VAR file recording a data matrix with only
units and loci selected by the user. The unit numerical identifiers are those of the
initial .VAR file and any associated .DON file stays operational. By default, the
proposed filename is name_sel.VAR where name is the initial .VAR file name.
This option is very useful when a same tedious selection has to be used for
several purposes.
100
Import from 'PHASE' software
Method
Phase produces in output a text file compiling the results. DARwin extracts in this file the
list of haplotypes inferred for each unit and record these data in a DARwin format.
In case of missing data, PHASE tries to infer the missing genotypes. In the output file,
the uncertain genotypes are enclosed in [], depending on their certainty. The level of
required certainty is controlled by the parameter –q in PHASE.
Procedure
Missing data
If values enclosed in brackets (estimated missing data) are found, two options
are proposed:
. Accept missing data estimation, as inferred by PHASE
. Refuse missing data estimation, these data will be coded as missing
data in the DARwin file with a code specified by the user: Integer code
for missing data.
101
Tools
Random 0/1 data
For methodological purposes, it may be useful to generate random binary
variables. A random value is created in drawing a random number between 0
and 1, if this value is greater than .5, the variable is set to 1 and to 0 if not.
Parameters
- Number of units
- Number of variables
- Random seed value
. Timer: references the system clock to initialize the seed, each run
will give a different result.
. User-defined: a seed is specified to override the system clock, each
run with the same specified seed will give same draw.
Output file: a .VAR file (type single) to record the generated data matrix.
Successive variables are labelled as V-1, V-2…
Output window: display the resulting data if ‘Display when done’ is checked.
Random dissimilarities
For methodological purposes, it may be useful to generate random dissimilarities
with particular properties (see Dissimilarity menu – Method for property
definitions) which are save in a .DIS file. For some dissimilarity types, a set of
variables is firstly generated and is used in a second step to calculate the
dissimilarities, it is proposed to save these data in a .VAR file.
Parameters
- Number of units
- Dissimilarity type:
102
• Simple matching: a set of q (q is the space dimension) 0/1 variables is
randomly generated for each unit. These q variables will be saved if
‘Record variables’ is checked. The simple matching is calculated as the
unmatching number between two units (01 or 10) standardized by the
variable number.
• Ultrametric distance: a binary tree structure is randomly generated with
random edge lengths such that the distance from each leaf to the root is
constant.
• Additive tree distance: the sum of an ultrametric and a star distance is
an additive tree distance; so an ultrametric is firstly generated and a
random star distance is added. For a more accurate tree distance
generation, use Random tree procedure and Tree distance to generate the
corresponding distance matrix.
• Robinson distance: this very particular distance is linked to pseudo-
hierarchies, called pyramids. Let v(i) be a valuation on each unit i and ≤
an order on this valuation, then a Robinson distance verifies the condition:
v (i ) ≤ v ( j ) ≤ v (k ) ⇒ d (i , k ) ≥ max (d (i , j ), d ( j , k )) .
Output files
- A .DIS file to record the generated dissimilarity matrix.
- If a set of q variables is firstly generated and if ‘Record variables’ is
checked, a .VAR file (type single) records these generated variables. It
automatically receives the same name as the dissimilarity with
extension .VAR. Successive variables are labelled as V-1, V-2… V-q.
Output window
Display the resulting dissimilarity matrix if ‘Display when done’ is
checked.
Random tree
For methodological purposes, it may be useful to generate random trees. Three
types of tree are proposed:
• Complete trees where some internal nodes may have a degree greater
than 3, with as many leaves as units
• General trees where some internal nodes may have a degree greater
than 3, some units may label internal nodes, so the number of leaves is
lower than the number of units.
103
Tree generation starts from a tree on 3 units, the following units are successively
randomly grafted on the tree.
• Parameters
- Tree type
. Binary
. Complete
. General
- Number of units
- Edge lengths
. All edges are set to 1
. Edge lengths are randomly generated in [0-1[
- Random seed value
. Timer: references the system clock to initialize the seed, each run
will give a different result.
. User-defined: a seed is specified to override the system clock,
each run with the same specified seed will give same draw.
• Graphical window: show the resulting tree if ‘Display when done’ is checked.
Example:
Input .VAR file with 6 rows and 5 columns and its associated .DON file
104
Output .VAR with 5 rows and 6 columns and its associated .DON file:
• Input files:
• Output files:
For allelic data, the ploidy in the input file has to be set at the ploïdy value
required by the output file, even if this value has no meaning for the input
file. The procedure verifies that the number of rows in the input file is a
multiple of the ploidy.
- Horizontal merging:
If the two files in input have the same number of units with identical numerical
identifiers (not necessarily in the same order) but two different sets of variables,
(no variable label in common) the output file merges the two sets of variables for
each unit.
105
@DARwin 5.0 – SINGLE
5 4
Unit Var1 Var2 Var3 Var4
2 610 140 60 10
3 475 90 250 30
9 10 10 495 110 @DARwin 5.0 – SINGLE
10 615 140 65 999 5 7
14 179 29 421 87 Unit Var1 Var2 Var3 Var4 V10 V20 V30
2 610 140 60 10 1 210 12
3 475 90 250 30 51 98 66
@DARwin 5.0 – SINGLE 9 10 10 495 110 19 9 41
5 3 10 615 140 65 999 41 75 125
Unit V10 V20 V30 14 179 29 421 87 15 40 5
10 41 75 125
3 51 98 66
2 1 210 12
14 15 40 5
9 19 9 41
- Vertical merging:
If the two files in input have two different sets of units (all the numerical
identifiers are different) but the same number of variables, with the same labels
and in the same order, the output file adds the second set of units at the end of
the first one.
Input files:
Output files:
106
Single data correlations
Calculate correlation coefficients between pairs of variables read in a single data
.VAR file.
Missing data
Correlation between two variables can be evaluated only on units with valid
values for the two variables, so any invalid value (missing data) has to be
discarded from for these variables.
Three options are proposed to discard missing data:
• Complete unit deletion
Discard any unit with at least one missing data for one variable. The
correlations will be calculated for all pairs of variables but only on the
subset of units without any missing value.
• Complete variable deletion
Discard any variable with at least one missing data (this variable is
discarded for all units). The correlations will be calculated on the
whole set of units but only for variables without any missing value.
• Pairwise deletion (option by default)
If for a pair of variables, at least one of the two values is missing for
a unit, this unit is discarded for computing correlation between these
variables (and only for them). The correlations will be calculated for
all pairs of variables but on a subset of units specific to the
considered pair of variables.
A minimal proportion of valid units for a pair of variables can be
chosen (50, 60, 70, 80 or 90%). For the first pair which does not
reach this threshold, the procedure aborts and a window identifies the
incriminate pair.
The two first options discard all missing data from the data set. They should be
used when missing data are concentrated in some units or variables only. If
missing data are distributed more or less at random, a great number of valid
data may be also discard with complete deletion options. Pairwise deletion option
avoids this loss of information in removing only missing data for the considered
pair.
Unit selection
107
The currently unselected/selected units are listed in the left/right columns.
Variable selection
Text window
108
Each initial tree is duplicated in a new tree file where these new numerical
identifiers replace the initial numerical identifiers. A common identifier file is
created which records the correspondence between the numerical code and the
value for the common key identifier. Following fields (a field for each tree) code
for presence (1) or absence (0) of a unit in each of these trees.
Example for two trees H1 and H2 by merging the two unit lists on the key
identifier ‘Name’. In output, the common H1H2.DON and the recoded trees
H1_R.ARB and H2_R.ARB.
H1.DON
Text window
109
Pooling SSR alleles
Method
SSR markers are known to present a high mutation rate, classically described by a
stepwise mutation model (gain or loss of one repeat unit at each mutation). So SSR
markers may exhibit a high number of alleles when observed on a population covering a
large genetic diversity (for example, up to 30 alleles for SSR markers on a collection of
660 sorghum accessions). This hypervariability is an advantage for some genetic
applications but it becomes a severe limitation in other cases: phylogeny, association
analyses…
A pragmatic solution should be to reduce the number of alleles by pooling alleles that
bring in part the same information. For that, it is assumed that the observed allelic
diversity results from (i) the genetic structure of the population due to demographic and
breeding events, and (ii) secondary and recent mutational events following the SSR
stepwise mutation model.
It can be shown that under a stepwise model, the secondary distributions can be
approximated by Gaussian distributions with the initial marker length as mean and the
product mutation rate by time of divergence as variance.
Consequently, the observed distribution of alleles can be seen as a Gaussian mixture
model which parameters (mean and variance of each Gaussian component and
proportion of each component) have to be estimated. Mixture parameters cannot be
directly achieved and an iterative Expectation-Minimization (EM) algorithm must be used.
For a given number of classes, the algorithm starts with a random initial assignment of
alleles to classes and iteratively improves the solution to maximize the likelihood of the
data. To avoid effect of initial random draw, several starting points are explored (see
parameter 'random' in the procedure) and the better solution is retained.
110
The classical EM algorithm is based on the probability that an allele belongs to a class.
Then an allele is not assigned to a single class but is assigned to every class with a
probability. For the doubly mutational process that is retained here, this assignment in
probability has a no real meaning and an allele is, or is not, in a class and it would be
better founded to assign at each step an allele to only one class. This can be done using
CEM algorithm, a classification version of the EM algorithm which adds a C-step (for
Classification) assigning an allele to its class of maximal probability. Note that CEM does
not maximise the same likelihood as EM and so does not converge necessarily to the
same set of estimators. CEM is the option by default in the procedure.
A second issue of the double stochastic process concerns the definition of the assignment
rule. The classical assignment rule means that a unit has more chances to belong to a
frequent class rather than to a rare class and when means and variances of these classes
are close, the class frequencies become the main factor of assignment decision. A
consequence is to emphasize the frequent classes (and their variance) and to empty the
uncommon classes. There is no reason in our case which a particular allele belongs to a
class rather than to another. This leads to question the prior probability in the Bayes's
rule. Instead of the frequencies of classes, the prior probability that an allele belongs to a
class is chosen here as a uniform probability of one on the number of classes.
The algorithm returns the likelihood and the parameters of the better solution for a given
number of classes but does not say anything on the best number of classes. The
likelihood necessarily increases with the number of classes and is maximal for a number
of classes equal to the number of alleles. So an other criterion must be used to select the
optimal solution. We have retained here the Elbow Likelihood criterion (EL) which
measures the increase of the likelihood between steps K and K+1 (in proportion of the
likelihood L1):
LK +1 − LK
ELK =
L1
(in practice, we consider – ELK to have a positive criterion).
111
When this increase becomes very low, it can be suspected that the addition of a new
class does not improve the resolution. So the K value such that ELK is minimum can be
considered as the right solution. However this minimum is generally reached very slowly
and the best solution is often for a lower K value. So the optimal solution is defined here
as the first K such that:
α
− ELK ≤ −(1 + )ELmin
100
where α is a user-defined parameter (if α =0 it is the absolute minimum), by default,
Marker selection
The first window proposes the list of SSR markers in a .VAR file in input.
. A .VAR file (allelic data type) has to be selected in input. The reading procedure
aborts if the type read in the file header does not correspond to the expected
type.
. A name for the output .VAR file (allelic data type) has to be chosen. By default,
the proposed filename is name_pool.VAR where name is the initial .VAR file
name.
Unit selection
The currently unselected/selected units are listed in the left/right columns.
Locus selection
112
• Statistics on current selection: open a window listing synthetic
parameters for each selected locus: locus identifier, number of missing
units, number of alleles, min value and max value for allele code.
Missing data
Check the box to indicate that some data are missing in the allelic data file. The
integer value used to code missing data has to be specified by the user (code
for missing data).
If checked, this option creates a new .VAR file recording a data matrix with only
units and variables selected by the user. The unit numerical identifiers are those
of the initial .VAR file and any associated .DON file stays operational. By default,
the proposed filename is name_sel.VAR where name is the initial .VAR file name.
Marker list
For each marker, the number of presences (for example, twice the number of
units for a diploid), the number of alleles, the number of classes after pooling (at
the opening, is equal to the number of alleles), the number of alleles set to
'missing' (is null at the opening).
. click on a marker opens or updates a frame giving for each allele of the
selected locus its value and the number of this allele in the dataset (or closes
this frame if it is open for this locus).
Allele list
. double click on an allele put this allele to 'missing' or conversely.
Pooling button
Opens a specific window to define classes of non-missing alleles that have to be
pooled.
Record button
Record under the output filename the resulting data for the selected units and
the selected markers. The initial allele values are replaced by the corresponding
class. Initial missing data and alleles defined as missing keep the code for
missing data (999 by default).
The correspondences between pooled classes and initial alleles are recorded in
the comment field of the output file.
113
Pooling alleles for a marker
At the opening, the algorithm is launched for the selected marker with the
parameters by default. It returns for every number of classes from 1 to Kmaxi
(see parameters) the assignment of alleles to classes that optimizes the
likelihood.
Parameters
The user can modify the parameters of the algorithm:
. EM or CEM algorithm (by default CEM)
. Kmax: maximum number of classes considered by the algorithm (1 to
the number of alleles). By default, this value is the number of alleles if
lower than 10 or 10 if not.
. random: the number of random iterations for each class number (10 to
500 step 10, by default 100)
. alpha: the parameter of the EL threshold to select the optimal number of
classes (0 to 10 step 0.5, by default 1%)
. Run again: to launch the algorithm with the new parameters
LH graph
The algorithm results are summarized on the likelihood graph that displays for
each number of classes the loglikelihood (red curve) and the EL criterion (blue
curve). This graph does not depend on the selected number of classes; it is
updated only if algorithm parameters are modified.
. -LHmax gives the maximum on LH axis, this value can be changed to
modify the scale on this axis.
. -ELmax gives the maximum on EL axis, this value can be changed to
modify the scale on this axis.
Kc
This box gives the selected number of classes and the corresponding likelihood.
By default it is the number of classes as defined by the EL criterion (this Kopt
value is displayed beside the Kc box with its likelihood). The user can selected
any other value for Kc between 1 and Kmaxi. The results are updated for this
new Kc value in the allele table and on the Frequency graph.
Allele table
This table lists the allele values, their frequency in the selected dataset and their
class of assignment for the selected number of classes Kc.
. dble click
The limits of the classes can be manually modified by the user.
- A double click on the first allele of a class (if it is not the first one) moves
this allele to the previous class.
- A double click on the last allele of a class (if it is not the last one) moves
this allele to the following class.
If the class limits are modified, the representations of the classes on the
frequency graph are updated. The likelihood is calculated for these new
classes and displayed in the Kc box.
114
Frequency graph
This graph displays the frequencies in vertical axis in function of the allele length
in horizontal axis.
. max Freq gives the maximum on the vertical axis, this value can be
changed to modify the scale on this axis.
. Y step fixes the step on EL axis, this value can be modified, for example,
2 for a dinucleotide SSR.
The graph shows also the current class definition: the alleles linked by a red line
belong to the same class. The red triangle indicates the value that will be
assigned to the class in the output file. It is the value of the most frequent allele
of the class or, if several alleles are equally frequent, it is the value of the allele
the closest to the mean of the class.
Validate button
Record the current class definition for this marker, close this window and come
back to the previous window to select another marker.
?
User’s manual (PDF)
Open a PDF version of this manual.
Bibliography
Bonnot, F., Guénoche, A., Perrier, X. (1996). Properties of an order distance
associated with a tree distance. In: Diday, E., Lechevallier, Y. ,Optiz, O. Ed.,
Ordinal and Symbolic Data Analysis. Springer. Paris. 252-261.
115
Gascuel, O. (1997). Concerning the NJ algorithm and its unweighted version,
UNJ. In : Mathematical Hierarchies and Biology. DIMACS workshop, Series in
Discrete Mathematics and Theoretical Computer Science. American Mathematical
Society. Vol 37: 149-170.
Saitou, N., Nei, M. (1987). The Neighbor-Joining method: a new method for
reconstructing phylogenetic trees. Molecular Biology and Evolution. 4(4): 406-
425.
116