1.1 Brief History: Dna Computing
1.1 Brief History: Dna Computing
INTRODUCTION
1
DNA COMPUTING
2
DNA COMPUTING
3
DNA COMPUTING
4
DNA COMPUTING
As is often the case with breakthrough technologies, a great deal of hyperbole has
surrounded the development of micro and nano array diagnostic technologies,
popularly known as DNA or genetic chips. Yet much of the optimism expressed in
such statements is almost certainly justified. Industry analysts agree that when their
promise begins to fulfilled probably sometime early in the next decade, DNA chips
will usher in a new era in medical care.
Although the DNA-chip marketplace is in its infancy, with considerable
challenges remaining to be overcome, the speed with which manufacturers are
progressing towards commercialization will soon make DNA chips viable
alternatives to traditional chemical assays. Indeed, if analysts are correct, within a
decade they will usher in a era in diagnosis and treatment for diseases and
conditions that have genetic origins.
Basic Principles
A variety of recent technological breakthroughs have made possible the
development of DNA chips. Fundamentally, however, genetic chips are the result
of achievements in two fields:
1) Molecular biology.
2) Micro fabrication technology.
Molecular Biology
5
DNA COMPUTING
• In 1950 Watson and Crick determined that the DNA molecules found in
living organisms are composed of a structure of two twisted strands (the
famous double helix) latticed together with pairs of nitrogenous
bases(A,T,C,G).
• They also discovered that these bases always recur in the same two pairs:
Adenine with Thymine, and Cytosine with Guanine. Thus, by knowing
part of the molecular structure of a specific genetic segment, one can
determine the other part.
• Moreover, these uniquely complementary strands of DNA can be sought
out by using one of the strands to test for its biochemical mate; this is the
basis of a gene probe.
• The process of one strand of DNA matching up with its counterpart strand
is called hybridization. It is this technique that is used to determine a
base-pair sequence in a DNA sample, also called genetic sequencing.
• Hybridization can be performed either in solution or on a solid support.
• In traditional gene sequencing, the most common format for hybridization
is the Southern blot, which uses a nitrocellulose sheet. However, some
companies use solution-based processes, and there is considerable
experimentation in the field to develop new hybridization formats.
• DNA-chip manufacturers are also exploring variations of both solid-phase
and solution-based hybridization for use in their microassays. At present,
however, most DNA-chip companies use a solid-phase technique.
• DNA chips are designed to identify hybridization products in the same
fashion as with traditional sequencers. Once hybridization has been
completed, phosphorescent chemicals that bind to the hybridized
sequences are scanned with a light source, making it easy to detect their
presence with automated colorimetric or fluorimetric equipment.
6
DNA COMPUTING
7
DNA COMPUTING
8
DNA COMPUTING
1) photosensitive masks,
Using conventional
techniques such as
polymerase chain reaction
and biochemical synthesis,
strands of identified DNA
are made and purified. A
variety of probes are
available from commercial
sources, many of which also
offer custom production
services.
9
DNA COMPUTING
Completed chips are checked for quality, packaged, labeled, and sent to clients. In
use, chips enable researchers to identify the components of probes deposited on the
chips, usually with the help of phosphorescent tags.
10
DNA COMPUTING
11
DNA COMPUTING
12
DNA COMPUTING
OPERATIONS ON DNA
1. Merge - This is the simple operation of combining the contents of 2 test tubes in
a third test tube.
2. Anneal - This is the process by which 2 strands are paired to form the famous
double-helix structure of Watson and Crick. Annealing is achieved by cooling a
DNA solution, which encourages pairing. Adleman uses this in step 1 to generate
all legal paths through the graph.
13
DNA COMPUTING
5. Seperation by sequence - This operation allows one to remove from solution all
the DNA strands that contain a desired sequence. This newly generated strand is
attached to the magnetic substance, which is used to extract the sequences after
annealing. This operation is crux of Adleman’s step 4.
6. Copying / Amplification - Copies are made of DNA strands in a test tube. The
strands to be copied must have known sequences at both the beginning and end in
order for this operation to be performed.
7. Append - This operation makes the DNA strand longer by adding a character or
strand to the end of each sequence.
14
DNA COMPUTING
DNA is the major information storage molecule in living cells, and billions
of years of evolution have tested and refined both this wonderful informational
molecule and highly specific enzymes that can duplicate information in DNA
molecules or transmit this information to other DNA molecules.
Instead of using electrical impulses to represent bits of information, the
DNA computer uses chemical properties of these molecules by examining the
patterns of combination or growth of the molecules or strings. DNA can do this
through the manufacture of the enzymes, which are biological catalysts that could
be called the ‘software’ used to execute the desired calculation.
A DNA computer uses the 4 deoxyribonucleic acids:
A (adenine)
C (cytosine)
G (guanine)
T (thymine)
as the memory units and recombinant DNA techniques already in
existence carry out the fundamental operations.
• In a DNA computer, computation takes place in test tubes or on a
glass slide coated in 24k gold.
• The input and output both are strands of DNA, whose genetic
sequences encode certain information.
• A program on a DNA is executed as a series of biochemical
operations, which have the effect of synthesizing, extracting,
modifying and cloning the DNA strands.
• Their potential power underscores how nature could be capable of
crunching number better and faster than the most advanced silicon
chips.
15
DNA COMPUTING
16
DNA COMPUTING
17
DNA COMPUTING
It should take you only a moment to see that there is only one route.
Starting from L.A. you need to fly to Chicago, Dallas, Miami and then to N.Y.
Any other choice of cities will force you to miss a destination, visit a city twice, or
not make it to N.Y. For six, seven, or even eight cities, the problem is still
manageable. However, as the number of cities increases, the problem quickly gets
out of hand. Assuming a random distribution of connecting routes, the number of
itineraries you need to check increases exponentially.
Adleman accomplished this task with standard molecular biology
techniques as follows:
Part I: Generate all possible routes
Strategy: Encode city names in short DNA sequences. Encode itineraries
by connecting the city sequences for which routes exist.
DNA can simply be treated as a string of data. For example, each city can
be represented by a "word" of six bases.
The entire itinerary can be encoded by simply stringing together these
DNA sequences that represent specific cities. For example, the route from L.A ->
Chicago -> Dallas -> Miami -> New York would simply be
GCTACGCTAGTATCGTACCTACGGATGCCG, or equivalently it could be
represented in double stranded form with its complement sequence.
So how do we generate this? Synthesizing short single stranded DNA is
now a routine process, so encoding the city names is straightforward. The
molecules can be made by a machine called a DNA synthesizer or even custom
ordered from a third party. Itineraries can then be produced from the city
encodings by linking them together in proper order. To accomplish this you can
take advantage of the fact that DNA hybridizes with its complimentary sequence.
For example, you can encode the routes between cities by encoding the
compliment of the second half (last three letters) of the departure city and the first
half (first three letters) of the arrival city. For example City Encoding = Miami
(CTACGG) and NY (ATGCCG)
Route Encoding = CGG + ATG = CGGATG
Taking Complement we get route from Miami to NY = GCCTAC
This will connect the DNA representing Miami and NY by hybridizing itself to
Miami (...CGG) and NY (ATG...) as shown below:
19
DNA COMPUTING
Random itineraries can be made by mixing city encodings with the route
encodings. Finally, the DNA strands can be connected together by an enzyme
called ligase. What we are left with are strands of DNA representing itineraries
with a random number of cities and random set of routes. For example:
Part II: Select itineraries that start and end with the correct cities
Strategy: Selectively copy and amplify only the section of the DNA that
starts with LA and ends with NY by using the Polymerase Chain Reaction.
After Part I, we now have a test tube full of various lengths of DNA that
encode possible routes between cities. What we want are routes that start with LA
and end with NY. To accomplish this we can use a technique called Polymerase
Chain Reaction (PCR), which allows you to produce many copies of a specific
sequence of DNA. We can amplify exponentially the number of DNA strands in
the test tube that start with LA and stop with NY using this technique.
Part III: Select itineraries that contain the correct number of cities.
20
DNA COMPUTING
Strategy: Sort the DNA by length and select the DNA whose length
corresponds to 5 cities.
Our test tube is now filled with DNA encoded itineraries that start with LA
and end with NY, where the number of cities in between LA and NY varies. We
now want to select those itineraries that are five cities long. To accomplish this we
can use a technique called Gel Electrophoresis, which is a common procedure used
to resolve the size of DNA. The basic principle behind Gel Electrophoresis is to
force DNA through a gel matrix by using an electric field. DNA is a negatively
charged molecule under most conditions, so if placed in an electric field it will be
attracted to the positive potential. However since the charge density of DNA is
constant (charge per length) long pieces of DNA move as fast as short pieces when
suspended in a fluid.
21
DNA COMPUTING
The beads are then mixed with the DNA. DNA, which contains the
sequence you're after then hybridizes with the complement sequence on the beads.
These beads can then be retrieved and the DNA isolated.
So we now affinity purify fives times, using a different city complement for
each run. For example, for the first run we use L.A.'-beads (where the ' indicates
compliment strand) to fish out DNA sequences which contain the encoding for
L.A. (which should be all the DNA because of step 3), the next run we use Dallas'-
beads, and then Chicago'-beads, Miami'-beads, and finally NY'-beads. The order
isn’t important. If an itinerary is missing a city, then it will not be "fished out"
during one of the runs and will be removed from the candidate pool. What we are
left with are the are itineraries that start in LA, visit each city once, and end in NY.
This is exactly what we are looking for. If the answer exists we would retrieve it at
this step
22
DNA COMPUTING
COMPARISON
23
DNA COMPUTING
Advantages
• Parallelism – The speed of any computer, biological or not, is
determined by 2 factors: 1) number of parallel processes. 2) How
many steps each one can perform per unit time. A small amount of
water contains about 10^22 molecules. Thus, biological
computations could potentially have vastly more parallelism than
conventional ones.
• Gigantic Memory Capacity – The bases of DNA molecules are
spaced every 0.34 nanometers along the DNA molecule (Fig.1)
giving DNA a remarkable data density of nearly 18 Mbits per inch.
• Low Power Dissipation – “Biochemical operations dissipate so
little energy”. DNA can perform 2 x 1019 ligation operations per
joule.
• Suitable for Combinatorial Problems – After Adleman, Lipton
used DNA computer to break Data Encryption Standard(DES). N-
Queens problem is also solved.
• Generate a complete set of complete solutions.
• As long as there are cellular organisms, there will always be a
supply of DNA.
• Unlike the toxic materials used to make traditional microprocessors,
DNA biochips can be made cleanly.
• DNA computers are many times smaller than today’s computers.
Disadvantages
• Occasionally slow- When people use DNA to solve complex problems
more and more laborious separation and detection steps are required. But
these problems may be overcome by using autonomous methods of DNA
computation which executes multiple steps of computation without outside
intervention.
24
DNA COMPUTING
25
DNA COMPUTING
APPLICATIONS
26
DNA COMPUTING
• It is even said that DNA can be used in devising the wiring schematics for
circuits. Another application being mentioned nowadays at the review
session is that DNA computing can do cryptography.
• DNA computers can be used to control chemical and biological systems in
a way that’s analogous to the way we use electronic computers to control
electrical and mechanical systems.
27
DNA COMPUTING
Organization Focus
Duke
University/Cal Working on massively parallel addition using DNA tiles
tech
New York
Assembling complex nanostructures out of DNA
University
28
DNA COMPUTING
FUTURE SCOPE
It’s different way of thinking about computing. It’s different way of thinking about
chemistry,” says Dr. Corn, a chemistry professor at the University of Wisconsin at
Madison who is collaborating on a DNA-computer project with three other
Madison faculty members: Lloyd M. Smith, a chemistry professor, Max G.
Lagally, a materials-science professor, and Anne E. Condon, a computer science
professor.
The Wisconsin approach would use the gold-plated square of glass as
something akin (related blood) to a conventional memory chip. As many as a
trillion individual strands of DNA would be anchored (fixed firmly) to the glass,
each strand containing information being stored in the DNA computer.
A rival approach, pioneered by Leonard M. Adleman allows the bits of
DNA to float freely in a test-tube. Dr. Adleman, in 1994 solved the traveling
salesman problem using his test-tube approach. The TSP on a large scale is
effectively unsolvable by conventional computer systems (it’s theoretically
possible, but would take an extremely long time).
His work was picked up by Dr. Donald Beaver, among others, who
analyzed the approach and organized it into a highly accessible web page which
includes concise annotated bibliography. One major contributor to this page is the
research group of Dr. Richard Lipton, Dan Bonech and Christopher Dunworth-a
professor of computer science and two graduate students at Princeton University.
They are currently using a DNA computer to break the government’s DES.
In Lipton’s article speeding up computation via molecular biology he
shows how DNA can be used to construct a Turing machine, a universal computer
capable of performing any calculation. While it currently exists only in theory, it’s
possible that in years to come computers based on work of Adleman, Lipton, and
others will come to replace traditional silicon-based machines.
In other words of Dr. Goodman “it’s clearly theoretically possible,” “the
question is whether the chemical operations can actually be done with a low-
enough error frequency. In my opinion this can be achieved.”
29
DNA COMPUTING
5.1 Goals
5.1.1 Short-term goals
Some of the short term goals of the DNA computing research are:
1) Test the bio-operations used in Adleman’s experiment for usability under other
conditions and for other computational problems.
2) Test other molecular procedures potentially useful for DNA computing ligation,
restriction enzyme digestion, and nuclease digestion on immobilized substrates, for
applicability, implementability, scalability, error robustness, cost and possibility of
automatisation.
3) Search for other types of problems that can potentially be solved by DNA
computing Preference will be given to problems that have practical applications,
for example scheduling problems, DNA memories and robotics or weather
prediction.
5.1.2: Long-term goals
Some of the longer term goals of DNA computing research are:
1) Evaluate existing models of DNA computing from the point of view of their in-
vitro implementability.
2) Design a viable DNA computability model based on operations specific to DNA
processing.
3) Study the computational aspects of the designed model. In particular, compare
the model with existing models of computability especially Turing machines and
Chomsky grammars.
4) Define and study computational complexity, biological complexity and
implementability measures for DNA computing.
5) Search for primitive bio-operations necessary for describing a molecular high-
level language. A population of DNA sequences is a set of strings; therefore these
operations should include basic set operations, string operations and some control
operations. The operations should be easily implementable and easy to automatize
and it should be possible to combine them in order to form instructions for solving
a large class of problems.
30
DNA COMPUTING
31
DNA COMPUTING
32
DNA COMPUTING
This sort of detection can also be used to isolate an endonuclease, or to find a drug
which crosses a cell membrane and then binds a particular host membrane, and
therefore cannot be anchored.
5 6 7 8
9 10 11 12
13 14 15 16
33
DNA COMPUTING
In the other, also destroy all the molecules in which either position 2, 3, 4,
5, 9, 13, 6, 11 or position 16 was on--the positions from which a queen can attack
square 1. The remixed pool represents chessboards in which space 1 is empty
whenever a queen is present in either space 2, 3, 4, 5, 9, 13, 6, 11 or 16.
After repeating the same operation with every other pair of mutually
exclusive board positions, analyze what is left. The molecules if chosen at random
will include possible solutions.
Although such devices are unlikely to out compete silicon in computations
such as the N-Queens problem, a more likely application, would be in game theory
algorithms, which involve selecting optimum strategies from a vast range of
possibilities.
34
DNA COMPUTING
CONCLUSION
35
DNA COMPUTING
BIBLIOGRAPHY
• http://www.arstechnica.com/reviews/2q00/dna/
• http://computer.howstuffworks.com/dna-computer.html
• http://www.cs.princeton.edu/~dabo/biocomp.html
• http://[email protected]/
• http://hagi.is.s.u-tokyo.ac.jp/MCP/
• http://www.devicelink.com/ivdt/archive/98/09/009.html
• http://www.wired.com/news/news
36