0% found this document useful (0 votes)
922 views244 pages

Programming For Computations - Python

programming in Python

Uploaded by

Marcello Costa
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
922 views244 pages

Programming For Computations - Python

programming in Python

Uploaded by

Marcello Costa
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

15

Svein Linge Hans Petter Langtangen

Programming for
Computations
Python
Editorial Board
T. [Link]
[Link]
[Link]
[Link]
[Link]
[Link]
Texts in Computational
Science and Engineering
15

Editors
Timothy J. Barth
Michael Griebel
David E. Keyes
Risto M. Nieminen
Dirk Roose
Tamar Schlick
More information about this series at [Link]
Svein Linge  Hans Petter Langtangen

Programming for
Computations Python
A Gentle Introduction to Numerical
Simulations with Python
Svein Linge Hans Petter Langtangen
Department of Process, Energy and Simula Research Laboratory
Environmental Technology Lysaker, Norway
University College of Southeast Norway
Porsgrunn, Norway On leave from:

Department of Informatics
University of Oslo
Oslo, Norway

ISSN 1611-0994
Texts in Computational Science and Engineering
ISBN 978-3-319-32427-2 ISBN 978-3-319-32428-9 (eBook)
DOI 10.1007/978-3-319-32428-9
Springer Heidelberg Dordrecht London New York

Library of Congress Control Number: 2016945368

Mathematic Subject Classification (2010): 26-01, 34A05, 34A30, 34A34, 39-01, 40-01, 65D15, 65D25,
65D30, 68-01, 68N01, 68N19, 68N30, 70-01, 92D25, 97-04, 97U50

The Editor(s) (if applicable) and the Author(s) 2016 This book is published open access.
Open Access This book is distributed under the terms of the Creative Commons Attribution-Non-
Commercial 4.0 International License ([Link] which permits
any noncommercial use, duplication, adaptation, distribution and reproduction in any medium or format,
as long as you give appropriate credit to the original author(s) and the source, a link is provided to the
Creative Commons license and any changes made are indicated.
The images or other third party material in this book are included in the works Creative Commons
license, unless indicated otherwise in the credit line; if such material is not included in the works
Creative Commons license and the respective action is not permitted by statutory regulation, users will
need to obtain permission from the license holder to duplicate, adapt or reproduce the material.
This work is subject to copyright. All commercial rights are reserved by the Publisher, whether the whole
or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations,
recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or
information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar
methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publica-
tion does not imply, even in the absence of a specific statement, that such names are exempt from the
relevant protective laws and regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this book
are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or
the editors give a warranty, express or implied, with respect to the material contained herein or for any
errors or omissions that may have been made.

Printed on acid-free paper

Springer International Publishing AG Switzerland is part of Springer Science+Business Media


([Link])
Preface

Computing, in the sense of doing mathematical calculations, is a skill that mankind


has developed over thousands of years. Programming, on the other hand, is in
its infancy, with a history that spans a few decades only. Both topics are vastly
comprehensive and usually taught as separate subjects in educational institutions
around the world, especially at the undergraduate level. This book is about the
combination of the two, because computing today becomes so much more powerful
when combined with programming.
Most universities and colleges implicitly require students to specialize in com-
puter science if they want to learn the craft of programming, since other student
programs usually do not offer programming to an extent demanded for really mas-
tering this craft. Common arguments claim that it is sufficient with a brief introduc-
tion, that there is not enough room for learning programming in addition to all other
must-have subjects, and that there is so much software available that few really need
to program themselves. A consequence is that engineering students often graduate
with shallow knowledge about programming, unless they happened to choose the
computer science direction.
We think this is an unfortunate situation. There is no doubt that practicing engi-
neers and scientists need to know their pen and paper mathematics. They must also
be able to run off-the-shelf software for important standard tasks and will certainly
do that a lot. Nevertheless, the benefits of mastering programming are many.

Why learn programming?

1. Ready-made software is limited to handling certain standard problems. What do


you do when the problem at hand is not covered by the software you bought?
Fortunately, a lot of modern software systems are extensible via programming.
In fact, many systems demand parts of the problem specification (e.g., material
models) to be specified by computer code.
2. With programming skills, you may extend the flexibility of existing software
packages by combining them. For example, you may integrate packages that do
not speak to each other from the outset. This makes the work flow simpler, more
efficient, and more reliable, and it puts you in position to attack new problems.

v
vi Preface

3. It is easy to use excellent ready-made software the wrong way. Insight in


programming and the mathematics behind is fundamental for understanding
complex software, avoiding pitfalls, and become a safe user.
4. Bugs (errors in computer code) are present in most larger computer programs
(also in the ones from the shop!). What do you do when your ready-made
software gives unexpected results? Is it a bug, is it wrong use, or is it the math-
ematically correct result? Experience with programming of mathematics gives
you a good background for answering these questions. The one who can pro-
gram, can also make tailored code for a simplified problem setting and use that
to verify the computations done with off-the-shelf software.
5. Lots of skilled people around the world solve computational problems by writ-
ing their own code and offer their code for free on the Internet. To take advantage
of this truly great source of software in a reliable way, one must normally be able
to understand and possibly modify computer code offered by others.
6. It is recognized world wide that students struggle with mathematics and physics.
Too many find such subjects difficult and boring. With programming, we can
execute the good old subjects in a brand new way! According to the authors
own experience, students find it much more motivating and enlightening when
programming is made an integrated part of mathematics and physical science
courses. In particular, the problem being solved can be much more realistic than
when the mathematics is restricted to what you can do with pen and paper.
7. Finally, we launch our most important argument for learning computer program-
ming: the algorithmic thinking that comes with the process of writing a program
for a computational problem enforces a thorough understanding of both the
problem and solution method. We can simply quote the famous Norwegian
computer scientist Kristen Nyggaard: Programming is understanding.

In the authors experience, programming is an excellent pedagogical tool for un-


derstanding mathematics: You think you know when you can learn, are more sure
when you can write, even more when you can teach, but certain when you can
program (Alan Perlis, computer scientist, 1922-1990). Consider, for example, in-
tegration. A numerical method for integration has a much stronger focus on what
the integral actually is and means compared to analytical methods, where much
time and effort must be devoted to integration by parts, integration by substitution,
etc. Moreover, when programming the numerical integration formula, it becomes
evident that it works for all mathematical functions and that the implementation
should be in terms of a general function applicable to all integrals. In this way,
students learn to recognize a special problem as belonging to a class of problems
(e.g., integration, differential equations, root finding), for which we have general
numerical methods implemented in widely applicable software. When they write
this software, as we do in this book, they learn how to generalize and increase the
abstraction level of the mathematical problem. When they use this software, they
learn how a special case should be attacked by general methods and software for
the class of problems that comprises the special case at hand. This is the power of
mathematics in a nutshell, and it is paramount that students understand this way of
thinking.
Preface vii

Target audience and background knowledge This book was written for students,
teachers, engineers and scientists that know nothing about programming and nu-
merical methods from before, but who seek a minimum of the fundamental skills
required to get started with programming as a tool for solving scientific and engi-
neering problems. Some knowledge of one- and multi-variable calculus is assumed.
The basic programming concepts are presented in only 50 pages (Chapters 1 and
2), before practical applications of these concepts are demonstrated in important
mathematical subjects addressed in the remaining parts of the book (Chapters 3-6).
Each chapter is followed by a set of exercises that cover a wide range of application
areas, e.g. biology, geology, statistics, physics and mathematics. The exercises were
particularly designed to bring across important points from the text. The reader will
realize that the modest content of the first 50 pages can in fact bring you quite far
in powerful problem solving!
Learning the very basics of programming should not take long, but as with any
other craft, mastering the skill requires continued and extensive practice. Some
beginning practice is gained through Chapters 3-6, but the authors strongly empha-
size that this is only a start. Students should continue to practice programming in
subsequent courses, while those who exercise self-study, should keep up the learn-
ing process through continued application of the craft. The book is a good starting
point when teaching computer programming as an integrated part of standard uni-
versity courses in mathematics and physical sciences. In our experience, such an
integration is doable and indeed rewarding.

Numerical methods An overall goal with this book is to motivate computer pro-
gramming as a very powerful tool for doing mathematics. All examples are related
to mathematics and its use in engineering and science. However, to solve math-
ematical problems through computer programming, we need numerical methods.
Explaining basic numerical methods is therefore an integral part of the book. Our
choice of topics is governed by what is most needed in science and engineering, as
well as in the teaching of applied physical science courses. Mathematical models
are then central, with differential equations constituting the most frequent type of
models. Consequently, the numerical focus in this book is on differential equations.
As a soft pedagogical starter for the programming of mathematics, we have chosen
the topic of numerical integration. There is also a chapter on root finding, which
is important for the numerical solution on nonlinear differential equations. We re-
mark that the book is deliberately brief on numerical methods. This is because our
focus is on implementing numerical algorithms, but to develop reliable, working
programs, the programmer must be confident about the basic ideas of the numerical
approximations involved.

The computer language: Python We have chosen to use the programming lan-
guage Python, because this language gives very compact and readable code that
closely resembles the mathematical recipe for solving the problem at hand. Python
also has a gentle learning curve. There is a MATLAB/Octave companion of this
book in case that language is preferred. Comparing these two versions of the book
provides an excellent demonstration of how similar these languages are. Other
computer languages, like Fortran, C, and C++, have a strong position in science
and engineering. During the last two decades, however, there has been a significant
viii Preface

shift in popularity from these compiled languages to more high-level and easier-to-
read languages like Matlab, Python, R, Maple, Mathematica, and IDL, for instance.
This latter class of languages is computationally less efficient, but superior with re-
spect to overall human problem solving efficiency. This book emphasizes how to
think like a programmer, rather than focusing on technical language details. Thus,
the book should put the reader in a good position for learning other programming
languages later, including the classic ones: Fortran, C, and C++.

How this book is different There are numerous texts on computer programming
and numerical methods, so how does the present one differ from the existing lit-
erature? Compared to books on numerical methods, our book has a much stronger
emphasis on the craft of programming and on verification. We want to give students
a thorough understanding of how one thinks about programming as a problem solv-
ing method and how one can be sure that programs are correct (well, you can never
be completely sure, but we show how you can provide convincing evidence for
correctness).
Even though there are lots of books on numerical methods where many algo-
rithms have a corresponding computer implementation (see, e.g., [1, 36, 11, 16
18, 21, 24, 2631] the latter two are the only texts we know that apply Python),
it is assumed that the reader can program beforehand. The present book teaches
the craft of structured programming along with the fundamental ideas of numeri-
cal methods. Furthermore, we have so far not found any other numerical methods
book that has a strong emphasis on verifying implementations. In this book, unit
testing and corresponding test functions are introduced early on. We also put much
emphasis on coding algorithms as functions, as opposed to flat programs, which
often dominate in the literature and among practitioners. Functions are reusable
because they utilize the general formulation of a mathematical algorithm such that
it becomes applicable to a large class of problems.
There are also numerous books on computer programming, but to our knowledge
only one [13] that aims to teach how to think about programming in the context
of numerical methods and scientific applications. That book [13] has its primary
focus on teaching Python and is a very comprehensive introduction to Python as
a language and the thinking about programming as a computer scientist. Sometimes
one needs a text that does not go so deep into the language-specific details, but
instead targets the shortest path to reliable mathematical problem solving through
programming. With this attitude in mind, a lot of topics were left out of the present
book, simply because they were not strictly needed in the mathematical problem
solving process. Examples of such topics are object-oriented programming and
Python dictionaries (of which the latter omission is possibly subject to more debate).
If you find the present book too shallow, [13] might be the right choice for you. That
source should also work nicely as a more in-depth successor of the present text.
Whenever the need for a structured introduction to programming arises in sci-
ence and engineering courses, this book may be your option, either for self-study or
for use in organized teaching. The thinking, habits, and practice covered in a couple
of hundred pages will put readers in a firm position for utilizing and understanding
the power of computers for problem solving in science and engineering.
Preface ix

Supplementary materials All program and data files referred to in this book are
available from the books primary web site: [Link]

Acknowledgments First of all, we want to thank all students who attended the
courses FM1006 Modelling and simulation of dynamic systems, FM1115 Scientific
Computing, FB1012 Mathematics I and FB2112 Physics at the University College
of Southeast Norway over the last couple of years. They worked their way through
early versions of this text and gave us constructive and positive feedback that helped
us correct errors and improve the book in so many ways. Special acknowledgement
goes to Guandong Kou and Edirisinghe V. P. J. Manjula for their careful reading
of the manuscript and constructive suggestions for improvement. The careful proof
reading by Yapi Donatien Achou is also highly appreciated. We thank all our good
colleagues at the University College of Southeast Norway, University of Oslo, and
Simula Research Laboratory for their continued support and interest, enlightening
discussions, and for providing such an inspiring environment for teaching and sci-
ence. In particular, Svein Linge is thankful to Marius Lysaker for their fruitful
collaboration on introducing programming as an integral part of mathematics and
physics bachelor courses at the University College of Southeast Norway. Finally,
the authors must thank the Springer team with Dr. Martin Peters, Thanh-Ha Le Thi,
and Yvonne Schlatter for the effective editorial and production process.

The text was written in the DocOnce1 [12] markup language, which allowed us
to work with a single text source for both the Python and the Matlab version of this
book, and to produce various electronic versions of the book.

December 2015 Svein Linge and Hans Petter Langtangen

1
[Link]
Contents

1 The First Few Steps . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1


1.1 What Is a Program? And What Is Programming? . . . . . . . . . . . 1
1.2 A Python Program with Variables . . . . . . . . . . . . . . . . . . . . 3
1.2.1 The Program . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
1.2.2 Dissection of the Program . . . . . . . . . . . . . . . . . . . . . 4
1.2.3 Why Not Just Use a Pocket Calculator? . . . . . . . . . . . . 5
1.2.4 Why You Must Use a Text Editor to Write Programs . . . . 6
1.2.5 Installation of Python . . . . . . . . . . . . . . . . . . . . . . . 6
1.2.6 Write and Run Your First Program . . . . . . . . . . . . . . . 6
1.3 A Python Program with a Library Function . . . . . . . . . . . . . . 7
1.4 A Python Program with Vectorization and Plotting . . . . . . . . . . 9
1.5 More Basic Concepts . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
1.5.1 Using Python Interactively . . . . . . . . . . . . . . . . . . . . 12
1.5.2 Arithmetics, Parentheses and Rounding Errors . . . . . . . . 13
1.5.3 Variables and Objects . . . . . . . . . . . . . . . . . . . . . . . 13
1.5.4 Integer Division . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
1.5.5 Formatting Text and Numbers . . . . . . . . . . . . . . . . . . 15
1.5.6 Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
1.5.7 Plotting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
1.5.8 Error Messages and Warnings . . . . . . . . . . . . . . . . . . 21
1.5.9 Input Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23
1.5.10 Symbolic Computations . . . . . . . . . . . . . . . . . . . . . . 23
1.5.11 Concluding Remarks . . . . . . . . . . . . . . . . . . . . . . . . 25
1.6 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26

2 Basic Constructions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
2.1 If Tests, Colon and Indentation . . . . . . . . . . . . . . . . . . . . . . 29
2.2 Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
2.3 For Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
2.4 While Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40
2.5 Lists and Tuples Alternatives to Arrays . . . . . . . . . . . . . . . . 41
2.6 Reading from and Writing to Files . . . . . . . . . . . . . . . . . . . . 43
2.7 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44

xi
xii Contents

3 Computing Integrals . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55
3.1 Basic Ideas of Numerical Integration . . . . . . . . . . . . . . . . . . 56
3.2 The Composite Trapezoidal Rule . . . . . . . . . . . . . . . . . . . . . 57
3.2.1 The General Formula . . . . . . . . . . . . . . . . . . . . . . . . 59
3.2.2 Implementation . . . . . . . . . . . . . . . . . . . . . . . . . . . 60
3.2.3 Making a Module . . . . . . . . . . . . . . . . . . . . . . . . . . 62
3.2.4 Alternative Flat Special-Purpose Implementation . . . . . . 63
3.3 The Composite Midpoint Method . . . . . . . . . . . . . . . . . . . . 65
3.3.1 The General Formula . . . . . . . . . . . . . . . . . . . . . . . . 66
3.3.2 Implementation . . . . . . . . . . . . . . . . . . . . . . . . . . . 67
3.3.3 Comparing the Trapezoidal and the Midpoint Methods . . . 67
3.4 Testing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68
3.4.1 Problems with Brief Testing Procedures . . . . . . . . . . . . 68
3.4.2 Proper Test Procedures . . . . . . . . . . . . . . . . . . . . . . 69
3.4.3 Finite Precision of Floating-Point Numbers . . . . . . . . . . 71
3.4.4 Constructing Unit Tests and Writing Test Functions . . . . . 72
3.5 Vectorization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
3.6 Measuring Computational Speed . . . . . . . . . . . . . . . . . . . . . 77
3.7 Double and Triple Integrals . . . . . . . . . . . . . . . . . . . . . . . . 78
3.7.1 The Midpoint Rule for a Double Integral . . . . . . . . . . . 78
3.7.2 The Midpoint Rule for a Triple Integral . . . . . . . . . . . . 81
3.7.3 Monte Carlo Integration for Complex-Shaped Domains . . 84
3.8 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 88

4 Solving Ordinary Differential Equations . . . . . . . . . . . . . . . . . . 95


4.1 Population Growth . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96
4.1.1 Derivation of the Model . . . . . . . . . . . . . . . . . . . . . . 97
4.1.2 Numerical Solution . . . . . . . . . . . . . . . . . . . . . . . . . 99
4.1.3 Programming the Forward Euler Scheme; the Special Case 102
4.1.4 Understanding the Forward Euler Method . . . . . . . . . . . 105
4.1.5 Programming the Forward Euler Scheme; the General Case 105
4.1.6 Making the Population Growth Model More Realistic . . . 106
4.1.7 Verification: Exact Linear Solution of the Discrete Equations 109
4.2 Spreading of Diseases . . . . . . . . . . . . . . . . . . . . . . . . . . . 110
4.2.1 Spreading of a Flu . . . . . . . . . . . . . . . . . . . . . . . . . 110
4.2.2 A Forward Euler Method for the Differential Equation
System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113
4.2.3 Programming the Numerical Method; the Special Case . . . 114
4.2.4 Outbreak or Not . . . . . . . . . . . . . . . . . . . . . . . . . . . 116
4.2.5 Abstract Problem and Notation . . . . . . . . . . . . . . . . . 116
4.2.6 Programming the Numerical Method; the General Case . . 117
4.2.7 Time-Restricted Immunity . . . . . . . . . . . . . . . . . . . . 119
4.2.8 Incorporating Vaccination . . . . . . . . . . . . . . . . . . . . . 120
4.2.9 Discontinuous Coefficients: A Vaccination Campaign . . . 123
4.3 Oscillating One-Dimensional Systems . . . . . . . . . . . . . . . . . 124
4.3.1 Derivation of a Simple Model . . . . . . . . . . . . . . . . . . 124
4.3.2 Numerical Solution . . . . . . . . . . . . . . . . . . . . . . . . . 126
4.3.3 Programming the Numerical Method; the Special Case . . . 126
Contents xiii

4.3.4 A Magic Fix of the Numerical Method . . . . . . . . . . . . . 129


4.3.5 The 2nd-Order Runge-Kutta Method (or Heuns Method) . 131
4.3.6 Software for Solving ODEs . . . . . . . . . . . . . . . . . . . . 132
4.3.7 The 4th-Order Runge-Kutta Method . . . . . . . . . . . . . . 138
4.3.8 More Effects: Damping, Nonlinearity, and External Forces 141
4.3.9 Illustration of Linear Damping . . . . . . . . . . . . . . . . . . 144
4.3.10 Illustration of Linear Damping with Sinusoidal Excitation . 146
4.3.11 Spring-Mass System with Sliding Friction . . . . . . . . . . . 147
4.3.12 A finite Difference Method; Undamped, Linear Case . . . . 149
4.3.13 A Finite Difference Method; Linear Damping . . . . . . . . 151
4.4 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 153

5 Solving Partial Differential Equations . . . . . . . . . . . . . . . . . . . . 161


5.1 Finite Difference Methods . . . . . . . . . . . . . . . . . . . . . . . . . 163
5.1.1 Reduction of a PDE to a System of ODEs . . . . . . . . . . . 164
5.1.2 Construction of a Test Problem with Known Discrete
Solution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 166
5.1.3 Implementation: Forward Euler Method . . . . . . . . . . . . 166
5.1.4 Application: Heat Conduction in a Rod . . . . . . . . . . . . 168
5.1.5 Vectorization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172
5.1.6 Using Odespy to Solve the System of ODEs . . . . . . . . . 173
5.1.7 Implicit Methods . . . . . . . . . . . . . . . . . . . . . . . . . . 174
5.2 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 177

6 Solving Nonlinear Algebraic Equations . . . . . . . . . . . . . . . . . . . 185


6.1 Brute Force Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . 186
6.1.1 Brute Force Root Finding . . . . . . . . . . . . . . . . . . . . . 187
6.1.2 Brute Force Optimization . . . . . . . . . . . . . . . . . . . . . 189
6.1.3 Model Problem for Algebraic Equations . . . . . . . . . . . . 190
6.2 Newtons Method . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190
6.2.1 Deriving and Implementing Newtons Method . . . . . . . . 191
6.2.2 Making a More Efficient and Robust Implementation . . . . 193
6.3 The Secant Method . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 197
6.4 The Bisection Method . . . . . . . . . . . . . . . . . . . . . . . . . . . 199
6.5 Rate of Convergence . . . . . . . . . . . . . . . . . . . . . . . . . . . . 201
6.6 Solving Multiple Nonlinear Algebraic Equations . . . . . . . . . . . 203
6.6.1 Abstract Notation . . . . . . . . . . . . . . . . . . . . . . . . . . 203
6.6.2 Taylor Expansions for Multi-Variable Functions . . . . . . . 204
6.6.3 Newtons Method . . . . . . . . . . . . . . . . . . . . . . . . . . 205
6.6.4 Implementation . . . . . . . . . . . . . . . . . . . . . . . . . . . 205
6.7 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 206

A Getting Access to Python . . . . . . . . . . . . . . . . . . . . . . . . . . . . 209


A.1 Required Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 209
A.2 Anaconda and Spyder . . . . . . . . . . . . . . . . . . . . . . . . . . . . 211
A.2.1 Spyder on Mac . . . . . . . . . . . . . . . . . . . . . . . . . . . 211
A.2.2 Installation of Additional Packages . . . . . . . . . . . . . . . 211
A.3 How to Write and Run a Python Program . . . . . . . . . . . . . . . 211
xiv Contents

A.3.1 The Need for a Text Editor . . . . . . . . . . . . . . . . . . . . 212


A.3.2 Text Editors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 212
A.3.3 Terminal Windows . . . . . . . . . . . . . . . . . . . . . . . . . 212
A.3.4 Using a Plain Text Editor and a Terminal Window . . . . . . 213
A.3.5 Spyder . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 213
A.4 The SageMathCloud and Wakari Web Services . . . . . . . . . . . . 214
A.4.1 Basic Intro to SageMathCloud . . . . . . . . . . . . . . . . . . 214
A.4.2 Basic Intro to Wakari . . . . . . . . . . . . . . . . . . . . . . . . 215
A.4.3 Installing Your Own Python Packages . . . . . . . . . . . . . 215
A.5 Writing IPython Notebooks . . . . . . . . . . . . . . . . . . . . . . . . 215
A.5.1 A Simple Program in the Notebook . . . . . . . . . . . . . . . 216
A.5.2 Mixing Text, Mathematics, Code, and Graphics . . . . . . . 216

References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 219

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 221
List of Exercises

Exercise 1.1: Error messages . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26


Exercise 1.2: Volume of a cube . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
Exercise 1.3: Area and circumference of a circle . . . . . . . . . . . . . . . . . . 27
Exercise 1.4: Volumes of three cubes . . . . . . . . . . . . . . . . . . . . . . . . . 27
Exercise 1.5: Average of integers . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
Exercise 1.6: Interactive computing of volume and area . . . . . . . . . . . . . . 27
Exercise 1.7: Peculiar results from division . . . . . . . . . . . . . . . . . . . . . 28
Exercise 1.8: Update variable at command prompt . . . . . . . . . . . . . . . . . 28
Exercise 1.9: Formatted print to screen . . . . . . . . . . . . . . . . . . . . . . . . 28
Exercise 1.10: Python documentation and random numbers . . . . . . . . . . . 28
Exercise 2.1: Errors with colon, indent, etc. . . . . . . . . . . . . . . . . . . . . . 44
Exercise 2.2: Compare integers a and b . . . . . . . . . . . . . . . . . . . . . . . . 45
Exercise 2.3: Functions for circumference and area of a circle . . . . . . . . . . 45
Exercise 2.4: Function for area of a rectangle . . . . . . . . . . . . . . . . . . . . 45
Exercise 2.5: Area of a polygon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
Exercise 2.6: Average of integers . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46
Exercise 2.7: While loop with errors . . . . . . . . . . . . . . . . . . . . . . . . . . 47
Exercise 2.8: Area of rectangle versus circle . . . . . . . . . . . . . . . . . . . . . 47
Exercise 2.9: Find crossing points of two graphs . . . . . . . . . . . . . . . . . . 47
Exercise 2.10: Sort array with numbers . . . . . . . . . . . . . . . . . . . . . . . . 47
Exercise 2.11: Compute  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48
Exercise 2.12: Compute combinations of sets . . . . . . . . . . . . . . . . . . . . 48
Exercise 2.13: Frequency of random numbers . . . . . . . . . . . . . . . . . . . . 49
Exercise 2.14: Game 21 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49
Exercise 2.15: Linear interpolation . . . . . . . . . . . . . . . . . . . . . . . . . . . 49
Exercise 2.16: Test straight line requirement . . . . . . . . . . . . . . . . . . . . . 50
Exercise 2.17: Fit straight line to data . . . . . . . . . . . . . . . . . . . . . . . . . 50
Exercise 2.18: Fit sines to straight line . . . . . . . . . . . . . . . . . . . . . . . . 51
Exercise 2.19: Count occurrences of a string in a string . . . . . . . . . . . . . . 52
Exercise 3.1: Hand calculations for the trapezoidal method . . . . . . . . . . . . 88
Exercise 3.2: Hand calculations for the midpoint method . . . . . . . . . . . . . 88
Exercise 3.3: Compute a simple integral . . . . . . . . . . . . . . . . . . . . . . . 88
Exercise 3.4: Hand-calculations with sine integrals . . . . . . . . . . . . . . . . . 88
Exercise 3.5: Make test functions for the midpoint method . . . . . . . . . . . . 88

xv
xvi List of Exercises

Exercise 3.6: Explore rounding errors with large numbers . . . . . . . . . . . . 89


R4p
Exercise 3.7: Write test functions for 0 xdx . . . . . . . . . . . . . . . . . . . 89
Exercise 3.8: Rectangle methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89
Exercise 3.9: Adaptive integration . . . . . . . . . . . . . . . . . . . . . . . . . . . 90
Exercise 3.10: Integrating x raised to x . . . . . . . . . . . . . . . . . . . . . . . . 90
Exercise 3.11: Integrate products of sine functions . . . . . . . . . . . . . . . . . 91
Exercise 3.12: Revisit fit of sines to a function . . . . . . . . . . . . . . . . . . . 91
Exercise 3.13: Derive the trapezoidal rule for a double integral . . . . . . . . . 92
Exercise 3.14: Compute the area of a triangle by Monte Carlo integration . . . 92
Exercise 4.1: Geometric construction of the Forward Euler method . . . . . . . 153
Exercise 4.2: Make test functions for the Forward Euler method . . . . . . . . 153
Exercise 4.3: Implement and evaluate Heuns method . . . . . . . . . . . . . . . 153
Exercise 4.4: Find an appropriate time step; logistic model . . . . . . . . . . . . 154
Exercise 4.5: Find an appropriate time step; SIR model . . . . . . . . . . . . . . 154
Exercise 4.6: Model an adaptive vaccination campaign . . . . . . . . . . . . . . 154
Exercise 4.7: Make a SIRV model with time-limited effect of vaccination . . . 154
Exercise 4.8: Refactor a flat program . . . . . . . . . . . . . . . . . . . . . . . . . 155
Exercise 4.9: Simulate oscillations by a general ODE solver . . . . . . . . . . . 155
Exercise 4.10: Compute the energy in oscillations . . . . . . . . . . . . . . . . . 155
Exercise 4.11: Use a Backward Euler scheme for population growth . . . . . . 156
Exercise 4.12: Use a Crank-Nicolson scheme for population growth . . . . . . 156
Exercise 4.13: Understand finite differences via Taylor series . . . . . . . . . . 157
Exercise 4.14: Use a Backward Euler scheme for oscillations . . . . . . . . . . 158
Exercise 4.15: Use Heuns method for the SIR model . . . . . . . . . . . . . . . 159
Exercise 4.16: Use Odespy to solve a simple ODE . . . . . . . . . . . . . . . . . 159
Exercise 4.17: Set up a Backward Euler scheme for oscillations . . . . . . . . . 159
Exercise 4.18: Set up a Forward Euler scheme for nonlinear and damped
oscillations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160
Exercise 4.19: Discretize an initial condition . . . . . . . . . . . . . . . . . . . . . 160
Exercise 5.1: Simulate a diffusion equation by hand . . . . . . . . . . . . . . . . 177
Exercise 5.2: Compute temperature variations in the ground . . . . . . . . . . . 178
Exercise 5.3: Compare implicit methods . . . . . . . . . . . . . . . . . . . . . . . 178
Exercise 5.4: Explore adaptive and implicit methods . . . . . . . . . . . . . . . . 179
Exercise 5.5: Investigate the  rule . . . . . . . . . . . . . . . . . . . . . . . . . . . 179
Exercise 5.6: Compute the diffusion of a Gaussian peak . . . . . . . . . . . . . . 180
Exercise 5.7: Vectorize a function for computing the area of a polygon . . . . 181
Exercise 5.8: Explore symmetry . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181
Exercise 5.9: Compute solutions as t ! 1 . . . . . . . . . . . . . . . . . . . . . 182
Exercise 5.10: Solve a two-point boundary value problem . . . . . . . . . . . . 183
Exercise 6.1: Understand why Newtons method can fail . . . . . . . . . . . . . 206
Exercise 6.2: See if the secant method fails . . . . . . . . . . . . . . . . . . . . . 207
Exercise 6.3: Understand why the bisection method cannot fail . . . . . . . . . 207
Exercise 6.4: Combine the bisection method with Newtons method . . . . . . 207
Exercise 6.5: Write a test function for Newtons method . . . . . . . . . . . . . 207
Exercise 6.6: Solve nonlinear equation for a vibrating beam . . . . . . . . . . . 207
The First Few Steps
1

1.1 What Is a Program? And What Is Programming?

Today, most people are experienced with computer programs, typically programs
such as Word, Excel, PowerPoint, Internet Explorer, and Photoshop. The interaction
with such programs is usually quite simple and intuitive: you click on buttons, pull
down menus and select operations, drag visual elements into locations, and so forth.
The possible operations you can do in these programs can be combined in seemingly
an infinite number of ways, only limited by your creativity and imagination.
Nevertheless, programs often make us frustrated when they cannot do what we
wish. One typical situation might be the following. Say you have some measure-
ments from a device, and the data are stored in a file with a specific format. You

The Author(s) 2016 1


S. Linge, H.P. Langtangen, Programming for Computations Python,
Texts in Computational Science and Engineering 15, DOI 10.1007/978-3-319-32428-9_1
2 1 The First Few Steps

may want to analyze these data in Excel and make some graphics out of it. How-
ever, assume there is no menu in Excel that allows you to import data in this specific
format. Excel can work with many different data formats, but not this one. You start
searching for alternatives to Excel that can do the same and read this type of data
files. Maybe you cannot find any ready-made program directly applicable. You
have reached the point where knowing how to write programs on your own would
be of great help to you! With some programming skills, you may write your own
little program which can translate one data format to another. With that little piece
of tailored code, your data may be read and analyzed, perhaps in Excel, or perhaps
by a new program tailored to the computations that the measurement data demand.
The real power of computers can only be utilized if you can program them.
By programming you can get the computer to do (most often!) exactly what you
want. Programming consists of writing a set of instructions in a very specialized
language that has adopted words and expressions from English. Such languages
are known as programming or computer languages. The set of instructions is given
to a program which can translate the meaning of the instructions into real actions
inside the computer.
The purpose of this book is to teach you to write such instructions dedicated to
solve mathematical and engineering problems by fundamental numerical methods.
There are numerous computer languages for different purposes. Within the en-
gineering area, the most widely used computer languages are Python, MATLAB,
Octave, Fortran, C, C++, and to some extent Maple, and Mathematica. How you
write the instructions (i.e. the syntax) differs between the languages. Let us use an
analogy.
Assume you are an international kind of person, having friends abroad in Eng-
land, Russia and China. They want to try your favorite cake. What can you do?
Well, you may write down the recipe in those three languages and send them over.
Now, if you have been able to think correctly when writing down the recipe, and
you have written the explanations according to the rules in each language, each of
your friends will produce the same cake. Your recipe is the computer program,
while English, Russian and Chinese represent the computer languages with their
own rules of how to write things. The end product, though, is still the same cake.
Note that you may unintentionally introduce errors in your recipe. Depending on
the error, this may cause baking execution to stop, or perhaps produce the wrong
cake. In your computer program, the errors you introduce are called bugs (yes,
small insects! . . . for historical reasons), and the process of fixing them is called
debugging. When you try to run your program that contains errors, you usually
get warnings or error messages. However, the response you get depends on the er-
ror and the programming language. You may even get no response, but simply the
wrong cake. Note that the rules of a programming language have to be followed
very strictly. This differs from languages like English etc., where the meaning might
be understood even with spelling errors and slang included.
This book comes in two versions, one that is based on Python, and one based on
Matlab. Both Python and Matlab represent excellent programming environments
for scientific and engineering tasks. The version you are reading now, is the Python
version.
Some of Pythons strong properties deserve mention here: Many global func-
tions can be placed in only one file, functions are straightforwardly transferred as
1.2 A Python Program with Variables 3

arguments to other functions, there is good support for interfacing C, C++ and For-
tran code (i.e., a Python program may use code written in other languages), and
functions explicitly written for scalar input often work fine (without modification)
also with vector input. Another important thing, is that Python is available for free.
It can be downloaded from the Internet and will run on most platforms.
Readers who want to expand their scientific programming skills beyond the
introductory level of the present exposition, are encouraged to study the book
A Primer on Scientific Programming with Python [13]. This comprehensive book
is as suitable for beginners as for professional programmers, and teaches the art
of programming through a huge collection of dedicated examples. This book is
considered the primary reference, and a natural extension, of the programming
matters in the present book.

Some computer science terms


Note that, quite often, the terms script and scripting are used as synonyms for
program and programming, respectively.
The inventor of the Perl programming language, Larry Wall, tried to explain
the difference between script and program in a humorous way (from perl.com1 ):
Suppose you went back to Ada Lovelace2 and asked her the difference between
a script and a program. Shed probably look at you funny, then say something
like: Well, a script is what you give the actors, but a program is what you give
the audience. That Ada was one sharp lady . . . Since her time, we seem to
have gotten a bit more confused about what we mean when we say scripting. It
confuses even me, and Im supposed to be one of the experts.
There are many other widely used computer science terms to pick up. Writing
a program (or script or code) is often expressed as implementing the program.
Executing a program means running the program. An algorithm is a recipe for
how to construct a program. A bug is an error in a program, and the art of
tracking down and removing bugs is called debugging. Simulating or simulation
refers to using a program to mimic processes in the real world, often through
solving differential equations that govern the physics of the processes.

1.2 A Python Program with Variables

Our first example regards programming a mathematical model that predicts the po-
sition of a ball thrown up in the air. From Newtons 2nd law, and by assuming
negligible air resistance, one can derive a mathematical model that predicts the ver-
tical position y of the ball at time t. From the model one gets the formula

y D v0 t  0:5gt 2 ;

where v0 is the initial upwards velocity and g is the acceleration of gravity, for
which 9:81 ms2 is a reasonable value (even if it depends on things like location
on the earth). With this formula at hand, and when v0 is known, you may plug in
a value for time and get out the corresponding height.

1
[Link]
2
[Link]
4 1 The First Few Steps

1.2.1 The Program

Let us next look at a Python program for evaluating this simple formula. Assume
the program is contained as text in a file named [Link]. The text looks as follows
(file [Link]):

# Program for computing the height of a ball in vertical motion

v0 = 5 # Initial velocity
g = 9.81 # Acceleration of gravity
t = 0.6 # Time

y = v0*t - 0.5*g*t**2 # Vertical position

print y

Computer programs and parts of programs are typeset with a blue background
in this book. A slightly darker top and bottom bar, as above, indicates that the code
is a complete program that can be run as it stands. Without the bars, the code is just
a snippet and will (normally) need additional lines to run properly.

1.2.2 Dissection of the Program

A computer program is plain text, as here in the file [Link], which contains in-
structions to the computer. Humans can read the code and understand what the
program is capable of doing, but the program itself does not trigger any actions on
a computer before another program, the Python interpreter, reads the program text
and translates this text into specific actions.

You must learn to play the role of a computer


Although Python is responsible for reading and understanding your program, it is
of fundamental importance that you fully understand the program yourself. You
have to know the implication of every instruction in the program and be able to
figure out the consequences of the instructions. In other words, you must be able
to play the role of a computer. The reason for this strong demand of knowledge is
that errors unavoidably, and quite often, will be committed in the program text,
and to track down these errors, you have to simulate what the computer does
with the program. Next, we shall explain all the text in [Link] in full detail.

When you run your program in Python, it will interpret the text in your file line
by line, from the top, reading each line from left to right. The first line it reads is

# Program for computing the height of a ball in vertical motion.

This line is what we call a comment. That is, the line is not meant for Python to read
and execute, but rather for a human that reads the code and tries to understand what
is going on. Therefore, one rule in Python says that whenever Python encounters
1.2 A Python Program with Variables 5

the sign # it takes the rest of the line as a comment. Python then simply skips
reading the rest of the line and jumps to the next line. In the code, you see several
such comments and probably realize that they make it easier for you to understand
(or guess) what is meant with the code. In simple cases, comments are probably not
much needed, but will soon be justified as the level of complexity steps up.
The next line read by Python is

v0 = 5 # Initial velocity

In Python, a statement like v0 = 5 is known as an assignment statement (very


different from a mathematical equation!). The result on the right-hand side, here the
integer 5, becomes an object and the variable name on the left-hand side is a named
reference for that object. Whenever we write v0, Python will replace it by an integer
with value 5. Doing v1 = v0 creates a new name, v1, for the same integer object
with value 5 and not a copy of an integer object with value 5. The next two lines

g = 9.81 # Acceleration of gravity


t = 0.6 # Time

are of the same kind, so having read them too, Python knows of three variables (v0,
g, t) and their values. These variables are then used by Python when it reads the
next line, the actual formula,

y = v0*t - 0.5*g*t**2 # Vertical position

Again, according to its rules, Python interprets * as multiplication, - as minus and


** as exponent (let us also add here that, not surprisingly, + and / would have
been understood as addition and division, if such signs had been present in the
expression). Having read the line, Python performs the mathematics on the right-
hand side, and then assigns the result (in this case the number 1.2342) to the variable
name y. Finally, Python reads

print y

This makes Python print the value of y out in that window on the screen where
you started the program. When [Link] is run, the number 1.2342 appears on the
screen.
In the code above, you see several blank lines too. These are simply skipped by
Python and you may use as many as you want to make a nice and readable layout
of the code.

1.2.3 Why Not Just Use a Pocket Calculator?

Certainly, finding the answer as done by the program above could easily have been
done with a pocket calculator. No objections to that and no programming would
have been needed. However, what if you would like to have the position of the ball
6 1 The First Few Steps

for every milli-second of the flight? All that punching on the calculator would have
taken you something like four hours! If you know how to program, however, you
could modify the code above slightly, using a minute or two of writing, and easily
get all the positions computed in one go within a second. A much stronger argu-
ment, however, is that mathematical models from real life are often complicated and
comprehensive. The pocket calculator cannot cope with such problems, even not
the programmable ones, because their computational power and their programming
tools are far too weak compared to what a real computer can offer.

1.2.4 Why You Must Use a Text Editor to Write Programs

When Python interprets some code in a file, it is concerned with every character
in the file, exactly as it was typed in. This makes it troublesome to write the code
into a file with word processors like, e.g., Microsoft Word, since such a program
will insert extra characters, invisible to us, with information on how to format the
text (e.g., the font size and type). Such extra information is necessary for the text
to be nicely formatted for the human eye. Python, however, will be much annoyed
by the extra characters in the file inserted by a word processor. Therefore, it is
fundamental that you write your program in a text editor where what you type on
the keyboard is exactly the characters that appear in the file and that Python will
later read. There are many text editors around. Some are stand-alone programs
like Emacs, Vim, Gedit, Notepad++, and TextWrangler. Others are integrated in
graphical development environments for Python, such as Spyder. This book will
primarily refer to Spyder and its text editor.

1.2.5 Installation of Python

You will need access to Python and several add-on packages for doing mathemat-
ical computations and display graphics. An obvious choice is to install a Python
environment for scientific computing on your machine. Alternatively, you can use
cloud services for running Python, or you can remote login on a computer system
at a school or university. Available and recommended techniques for getting access
to Python and the needed packages are documented in Appendix A.
The quickest way to get started with a Python installation for this book on your
Windows, Mac, or Linux computer, is to install Anaconda3 .

1.2.6 Write and Run Your First Program

Reading only does not teach you computer programming: you have to program
yourself and practice heavily before you master mathematical problem solving via
programming. Therefore, it is crucial at this stage that you write and run a Python
program. We just went through the program [Link] above, so let us next write
and run that code.

3
[Link]
1.3 A Python Program with a Library Function 7

But first a warning: there are many things that must come together in the right
way for [Link] to run correctly on your computer. There might be problems
with your Python installation, with your writing of the program (it is very easy
to introduce errors!), or with the location of the file, just to mention some of the
most common difficulties for beginners. Fortunately, such problems are solvable,
and if you do not understand how to fix the problem, ask somebody. Typically,
once you are beyond these common start-up problems, you can move on to learn
programming and how programs can do a lot of otherwise complicated mathematics
for you.
We describe the first steps using the Spyder graphical user interface (GUI), but
you can equally well use a standard text editor for writing the program and a termi-
nal window (Terminal on Mac, Power Shell on Windows) for running the program.
Start up Spyder and type in each line of the program [Link] shown earlier. Then
run the program. More detailed descriptions of operating Spyder are found in Ap-
pendix A.3.
If you have had the necessary luck to get everything right, you should now get
the number 1.2342 out in the rightmost lower window in the Spyder GUI. If so,
congratulations! You have just executed your first self-written computer program
in Python, and you are ready to go on studying this book! You may like to save the
program before moving on (File, save as).

1.3 A Python Program with a Library Function

Imagine you stand on a distance, say 10 m away, watching someone throwing a ball
upwards. A straight line from you to the ball will then make an angle with the
horizontal that increases and decreases as the ball goes up and down. Let us consider
the ball at a particular moment in time, at which it has a height of 10 m.
What is the angle of the line then? Again, this could easily be done with a cal-
culator, but we continue to address gentle mathematical problems when learning
to program. Before thinking of writing a program, one should always formulate
the algorithm, i.e., the recipe for what kind of calculations that must be performed.
Here, if the ball is x m away and y m up in the air, it makes an angle  with the
ground, where tan  D y=x. The angle is then tan1 .y=x/.
Let us make a Python program for doing these calculations. We introduce names
x and y for the position data x and y, and the descriptive name angle for the angle
. The program is stored in a file ball_angle_first_try.py:

x = 10 # Horizontal position
y = 10 # Vertical position

angle = atan(y/x)

print (angle/pi)*180

Before we turn our attention to the running of this program, let us take a look
at one new thing in the code. The line angle = atan(y/x), illustrates how the
function atan, corresponding to tan1 in mathematics, is called with the ratio
8 1 The First Few Steps

y/x as input parameter or argument. The atan function takes one argument,
and the computed value is returned from atan. This means that where we see
atan(y/x), a computation is performed (tan1 .y=x/) and the result replaces the
text atan(y/x). This is actually no more magic than if we had written just y/x:
then the computation of y/x would take place, and the result of that division would
replace the text y/x. Thereafter, the result is assigned to the name angle on the
left-hand side of =.
Note that the trigonometric functions, such as atan, work with angles in radians.
The return value of atan must hence be converted to degrees, and that is why we
perform the computation (angle/pi)*180. Two things happen in the print
statement: first, the computation of (angle/pi)*180 is performed, resulting in
a real number, and second, print prints that real number. Again, we may think that
the arithmetic expression is replaced by its results and then print starts working
with that result.
If we next execute ball_angle_first_try.py, we get an error message on
the screen saying

NameError: name atan is not defined


WARNING: Failure executing file: <ball_angle_first_try.py>

We have definitely run into trouble, but why? We are told that

name atan is not defined

so apparently Python does not recognize this part of the code as anything famil-
iar. On a pocket calculator the inverse tangent function is straightforward to use
in a similar way as we have written in the code. In Python, however, this function
has not yet been imported into the program. A lot of functionality is available to
us in a program, but much more functionality exists in Python libraries, and to ac-
tivate this functionality, we must explicitly import it. In Python, the atan function
is grouped together with many other mathematical functions in the library called
math. Such a library is referred to as a module in correct Python language. To get
access to atan in our program we have to write

from math import atan

Inserting this statement at the top of the program and rerunning it, leads to a new
problem: pi is not defined. The variable pi, representing , is also available in the
math module, but it has to be imported too:

from math import atan, pi

It is tedious if you need quite some math functions and variables in your program,
e.g., also sin, cos, log, exp, and so on. A quick way of importing everything in
math at once, is

from math import *


1.4 A Python Program with Vectorization and Plotting 9

We will often use this import statement and then get access to all common
mathematical functions. This latter statement is inserted in a program named
ball_angle.py:

from math import *

x = 10 # Horizontal position
y = 10 # Vertical position

angle = atan(y/x)

print (angle/pi)*180

This program runs perfectly and produces 45.0 as output, as it should.


At first, it may seem cumbersome to have code in libraries, since you have to
know which library to import to get the desired functionality. Having everything
available anytime would be convenient, but this also means that you fill up the
memory of your program with a lot of information that you rather would use for
computations on big data. Python has so many libraries with so much functionality
that one simply needs to import what is needed in a specific program.

1.4 A Python Program with Vectorization and Plotting

We return to the problem where a ball is thrown up in the air and we have a formula
for the vertical position y of the ball. Say we are interested in y at every milli-
second for the first second of the flight. This requires repeating the calculation of
y D v0 t  0:5gt 2 one thousand times.
We will also draw a graph of y versus t for t 2 0; 1. Drawing such graphs on
a computer essentially means drawing straight lines between points on the curve,
so we need many points to make the visual impression of a smooth curve. With one
thousand points, as we aim to compute here, the curve looks indeed very smooth.
In Python, the calculations and the visualization of the curve may be done with
the program ball_plot.py, reading

from numpy import linspace


import [Link] as plt

v0 = 5
g = 9.81
t = linspace(0, 1, 1001)

y = v0*t - 0.5*g*t**2

[Link](t, y)
[Link](t (s))
[Link](y (m))
[Link]()
10 1 The First Few Steps

This program produces a plot of the vertical position with time, as seen in Fig-
ure 1.1. As you notice, the code lines from the [Link] program in Chapter 1.2
have not changed much, but the height is now computed and plotted for a thousand
points in time!
Let us take a look at the differences between the new program and our previous
program. From the top, the first difference we notice are the lines

from numpy import *


from [Link] import *

You see the word import here, so you understand that numpy must be a library, or
module in Python terminology. This library contains a lot of very useful functional-
ity for mathematical computing, while the [Link] module contains
functionality for plotting curves. The above import statement constitutes a quick
way of populating your program with all necessary functionality for mathematical
computing and plotting. However, we actually make use of only a few functions
in the present program: linspace, plot, xlabel, and ylabel. Many computer
scientists will therefore argue that we should explicitly import what we need and
not everything (the star *):

from numpy import linspace


from [Link] import plot, xlabel, ylabel

Others will claim that we should do a slightly different import and prefix library
functions by the library name:

import numpy as np
import [Link] as plt
...
t = [Link](0, 1, 1001)
...
[Link](t, y)
[Link](t (s))
[Link](y (m))

We will use all three techniques, and since all of them are in so widespread use, you
should be familiar with them too. However, for the most part in this book we shall
do
from numpy import *
from [Link] import *

for convenience and for making Python programs that look very similar to their
Matlab counterparts.
The function linspace takes 3 parameters, and is generally called as

linspace(start, stop, n)

This is our first example of a Python function that takes multiple arguments. The
linspace function generates n equally spaced coordinates, starting with start
1.4 A Python Program with Vectorization and Plotting 11

Fig. 1.1 Plot generated by the script ball_plot.py showing the vertical position of the ball at
a thousand points in time

and ending with stop. The expression linspace(0, 1, 1001) creates 1001 co-
ordinates between 0 and 1 (including both 0 and 1). The mathematically inclined
reader will notice that 1001 coordinates correspond to 1000 equal-sized intervals in
0; 1 and that the coordinates are then given by ti D i=1000 (i D 0; 1; : : : ; 1000).
The value returned from linspace (being stored in t) is an array, i.e., a collec-
tion of numbers. When we start computing with this collection of numbers in the
arithmetic expression v0*t - 0.5*g*t**2, the expression is calculated for every
number in t (i.e., every ti for i D 0; 1; : : : ; 1000), yielding a similar collection of
1001 numbers in the result y. That is, y is also an array.
This technique of computing all numbers in one chunk is referred to as vec-
torization. When it can be used, it is very handy, since both the amount of code and
computation time is reduced compared to writing a corresponding for or while
loop (Chapter 2) for doing the same thing.
The plotting commands are simple:

1. plot(t, y) means plotting all the y coordinates versus all the t coordinates
2. xlabel(t (s)) places the text t (s) on the x axis
3. ylabel(y (m)) places the text y (m) on the y axis

At this stage, you are strongly encouraged to do Exercise 1.4. It builds on the
example above, but is much simpler both with respect to the mathematics and the
amount of numbers involved.
12 1 The First Few Steps

1.5 More Basic Concepts

So far we have seen a few basic examples on how to apply Python programming to
solve mathematical problems. Before we can go on with other and more realistic
examples, we need to briefly treat some topics that will be frequently required in
later chapters. These topics include computer science concepts like variables, ob-
jects, error messages, and warnings; more numerical concepts like rounding errors,
arithmetic operator precedence, and integer division; in addition to more Python
functionality when working with arrays, plotting, and printing.

1.5.1 Using Python Interactively

Python can also be used interactively. That is, we do not first write a program in
a file and execute it, but we give statements and expressions to what is known as
a Python shell. We recommend to use IPython as shell (because it is superior to
alternative Python shells). With Spyder, Ipython is available at startup, appearing
as the lower right window. Following the IPython prompt In [1]: ( a prompt
means a ready sign, i.e. the program allows you to enter a command, and different
programs often have different looking prompts), you may do calculations:

In [1]: 2+2
Out [1]: 4

In [2]: 2*3
Out [2]: 6

In [3]: 10/2
Out [3]: 5

In [4]: 2**3
Out [4]: 8

The response from IPython is preceded by Out [q]:, where q equals p when the
response is to input number p.
Note that, as in a program, you may have to use import before using pi or
functions like sin, cos, etc. That is, at the prompt, do the command from math
import * before you use pi or sin, etc. Importing other modules than math may
be relevant, depending on what your aim is with the computations.
You may also define variables and use formulas interactively as

In [1]: v0 = 5

In [2]: g = 9.81

In [3]: t = 0.6

In [4]: y = v0*t - 0.5*g*t**2

In [5]: print y
------> print(y)
1.2342
1.5 More Basic Concepts 13

Sometimes you would like to repeat a command you have given earlier, or per-
haps give a command that is almost the same as an earlier one. Then you can use
the up-arrow key. Pressing this one time gives you the previous command, pressing
two times gives you the command before that, and so on. With the down-arrow key
you can go forward again. When you have the relevant command at the prompt,
you may edit it before pressing enter (which lets Python read it and take action).

1.5.2 Arithmetics, Parentheses and Rounding Errors

When the arithmetic operators +, -, *, / and ** appear in an expression, Python


gives them a certain precedence. Python interprets the expression from left to right,
taking one term (part of expression between two successive + or -) at a time. Within
each term, ** is done before * and /. Consider the expression x = 1*5**2 +
10*3 - 1.0/4. There are three terms here and interpreting this, Python starts
from the left. In the first term, 1*5**2, it first does 5**2 which equals 25. This is
then multiplied by 1 to give 25 again. The second term is 10*3, i.e., 30. So the first
two terms add up to 55. The last term gives 0.25, so the final result is 54.75 which
becomes the value of x.
Note that parentheses are often very important to group parts of expressions
together in the intended way. Let us say x = 4 and that you want to divide 1.0 by
x + 1. We know the answer is 0.2, but the way we present the task to Python is
critical, as shown by the following example.

In [1]: x = 4

In [2]: 1.0/x+1
Out [2]: 1.25

In [3]: 1.0/(x+1)
Out [3]: 0.20000000000000001

In the first try, we see that 1.0 is divided by x (i.e., 4), giving 0.25, which is
then added to 1. Python did not understand that our complete denominator was
x+1. In our second try, we used parentheses to group the denominator, and we
got what we wanted. That is, almost what we wanted! Since most numbers can be
represented only approximately on the computer, this gives rise to what is called
rounding errors. We should have got 0.2 as our answer, but the inexact number
representation gave a small error. Usually, such errors are so small compared to the
other numbers of the calculation, that we do not need to bother with them. Still,
keep it in mind, since you will encounter this issue from time to time. More details
regarding number representations on a computer is given in Section 3.4.3.

1.5.3 Variables and Objects

Variables in Python will be of a certain type. If you have an integer, say you have
written x = 2 in some Python program, then x becomes an integer variable, i.e.,
a variable of type int. Similarly, with the statement x = 2.0, x becomes a float
14 1 The First Few Steps

variable (the word float is just computer language for a real number). In any case,
Python thinks of x as an object, of type int or float. Another common type of
variable is str, i.e. a string, needed when you want to store text. When Python
interprets x = "This is a string", it stores the text (in between the quotes) in
the variable x. This variable is then an object of type str. You may convert between
variable types if it makes sense. If, e.g., x is an int object, writing y = float(x)
will make y a floating point representation of x. Similarly, you may write int(x)
to produce an int if x is originally of type float. Type conversion may also occur
automatically, as shown just below.
Names of variables should be chosen so that they are descriptive. When com-
puting a mathematical quantity that has some standard symbol, e.g. , this should
be reflected in the name by letting the word alpha be part of the name for the cor-
responding variable in the program. If you, e.g., have a variable for counting the
number of sheep, then one appropriate name could be no_of_sheep. Such naming
makes it much easier for a human to understand the written code. Variable names
may also contain any digit from 0 to 9, or underscores, but can not start with a digit.
Letters may be lower or upper case, which to Python is different. Note that certain
names in Python are reserved, meaning that you can not use these as names for vari-
ables. Some examples are for, while, if, else, global, return and elif. If
you accidentally use a reserved word as a variable name you get an error message.
We have seen that, e.g., x = 2 will assign the value 2 to the variable x. But how
do we write it if we want to increase x by 4? We may write an assignment like x
= x + 4, or (giving a faster computation) x += 4. Now Python interprets this as:
take whatever value that is in x, add 4, and let the result become the new value of
x. In other words, the old value of x is used on the right hand side of =, no matter
how messy the expression might be, and the result becomes the new value of x. In
a similar way, x -= 4 reduces the value of x by 4, x *= 4 multiplies x by 4, and x
/= 4 divides x by 4, updating the value of x accordingly.
What if x = 2, i.e., an object of type int, and we add 4.0, i.e., a float? Then
automatic type conversion takes place, and the new x will have the value 6.0, i.e.,
an object of type float as seen here,

In [1]: x = 2

In [2]: x = x + 4.0

In [3]: x
Out [3]: 6.0

Note that Python programmers, and Python (in printouts), often write, e.g., 2. which
by definition is the integer 2 represented as a float.

1.5.4 Integer Division

Another issue that is important to be aware of is integer division. Let us look at


a small example, assuming we want to divide one by four.
1.5 More Basic Concepts 15

In [1]: 1/4
Out [1]: 0

In [2]: 1.0/4
Out [2]: 0.25

We see two alternative ways of writing it, but only the last way of writing it gave
the correct (i.e., expected) result! Why?
With Python version 2, the first alternative gives what is called integer division,
i.e., all decimals in the answer are disregarded, so the result is rounded down to
the nearest integer. To avoid it, we may introduce an explicit decimal point in
either the numerator, the denominator, or in both. If you are new to programming,
this is certainly strange behavior. However, you will find the same feature in many
programming languages, not only Python, but actually all languages with significant
inheritance from C. If your numerator or denominator is a variable, say you have
1/x, you may write 1/float(x) to be on safe grounds.
Python version 3 implements mathematical real number division by / and re-
quires the operator // for integer division (// is also available in Python version 2).
Although Python version 3 eliminates the problems with unintended integer divi-
sion, it is important to know about integer division when doing computing in most
other languages.

1.5.5 Formatting Text and Numbers

Results from scientific computations are often to be reported as a mixture of text and
numbers. Usually, we want to control how numbers are formatted. For example, we
may want to write 1/3 as 0.33 or 3.3333e-01 (3:3333101). The print command
is the key tool to write out text and numbers with full control of the formatting. The
first argument to print is a string with a particular syntax to specify the formatting,
the so-called printf syntax. (The peculiar name stems from the printf function in
the programming language C where the syntax was first introduced.)
Suppose we have a real number 12.89643, an integer 42, and a text some
message that we want to write out in the following two alternative ways:

real=12.896, integer=42, string=some message


real=1.290e+01, integer= 42, string=some message

The real number is first written in decimal notation with three decimals, as 12.896,
but afterwards in scientific notation as 1.290e+01. The integer is first written as
compactly as possible, while on the second line, 42 is formatted in a text field of
width equal to five characters.
The following program, formatted_print.py, applies the printf syntax to con-
trol the formatting displayed above:
16 1 The First Few Steps

real = 12.89643
integer = 42
string = some message
print real=%.3f, integer=%d, string=%s % (real, integer, string)
print real=%9.3e, integer=%5d, string=%s % (real, integer, string)

The output of print is a string, specified in terms of text and a set of variables
to be inserted in the text. Variables are inserted in the text at places indicated by %.
After % comes a specification of the formatting, e.g, %f (real number), %d (integer),
or %s (string). The format %9.3f means a real number in decimal notation, with 3
decimals, written in a field of width equal to 9 characters. The variant %.3f means
that the number is written as compactly as possible, in decimal notation, with three
decimals. Switching f with e or E results in the scientific notation, here 1.290e+01
or 1.290E+01. Writing %5d means that an integer is to be written in a field of width
equal to 5 characters. Real numbers can also be specified with %g, which is used
to automatically choose between decimal or scientific notation, from what gives the
most compact output (typically, scientific notation is appropriate for very small and
very large numbers and decimal notation for the intermediate range).
A typical example of when printf formatting is required, arises when nicely
aligned columns of numbers are to be printed. Suppose we want to print a column
of t values together with associated function values g.t/ D t sin.t/ in a second
column. The simplest approach would be

from math import sin

t0 = 2
dt = 0.55

# Unformatted print
t = t0 + 0*dt; g = t*sin(t)
print t, g

t = t0 + 1*dt; g = t*sin(t)
print t, g

t = t0 + 2*dt; g = t*sin(t)
print t, g

with output

2.0 1.81859485365
2.55 1.42209347935
3.1 0.128900053543

(Repeating the same set of statements multiple times, as done above, is not good
programming practice - one should use a for loop, as explained later in Section 2.3.)
Observe that the numbers in the columns are not nicely aligned. Using the printf
syntax %6.2f %8.3f % (t, g) for t and g, we can control the width of each
column and also the number of decimals, such that the numbers in a column are
1.5 More Basic Concepts 17

aligned under each other and written with the same precision. The output then
becomes
Formatting via printf syntax
2.00 1.819
2.55 1.422
3.10 0.129

We shall frequently use the printf syntax throughout the book so there will be
plenty of further examples.

The modern alternative to printf syntax


Modern Python favors the new format string syntax over printf:

print At t={t:g} s, y={y:.2f} [Link](t=t, y=y)

which corresponds to the printf syntax

print At t=%g s, y=%.2f m % (t, y)

The slots where variables are inserted are now recognized by curly braces, and
in format we list the variable names inside curly braces and their equivalent
variables in the program.
Since the printf syntax is so widely used in many programming languages,
we stick to that in the present book, but Python programmers will frequently also
meet the newer format string syntax, so it is important to be aware its existence.

1.5.6 Arrays

In the program ball_plot.py from Chapter 1.4 we saw how 1001 height com-
putations were executed and stored in the variable y, and then displayed in a plot
showing y versus t, i.e., height versus time. The collection of numbers in y (or
t, respectively) was stored in what is called an array, a construction also found in
most other programming languages. Such arrays are created and treated according
to certain rules, and as a programmer, you may direct Python to compute and handle
arrays as a whole, or as individual array elements. Let us briefly look at a smaller
such collection of numbers.
Assume that the heights of four family members have been collected. These
heights may be generated and stored in an array, e.g., named h, by writing

h = zeros(4)
h[0] = 1.60
h[1] = 1.85
h[2] = 1.75
h[3] = 1.80

where the array elements appear as h[0], h[1], etc. Generally, when we read or
talk about the array elements of some array a, we refer to them by reading or saying
18 1 The First Few Steps

a of zero (i.e., a[0]), a of one (i.e., a[1]), and so on. The very first line in the
example above, i.e.

h = zeros(4)

instructs Python to reserve, or allocate, space in memory for an array h with four
elements and initial values set to 0. The next four lines overwrite the zeros with the
desired numbers (measured heights), one number for each element. Elements are,
by rule, indexed (numbers within brackets) from 0 to the last element, in this case 3.
We say that Python has zero based indexing. This differs from one based indexing
(e.g., found in Matlab) where the array index starts with 1.
As illustrated in the code, you may refer to the array as a whole by the name h,
but also to each individual element by use of the index. The array elements may
enter in computations as individual variables, e.g., writing z = h[0] + h[1] +
h[2] + h[3] will compute the sum of all the elements in h, while the result is
assigned to the variable z. Note that this way of creating an array is a bit different
from the one with linspace, where the filling in of numbers occurred automati-
cally behind the scene.
By the use of a colon, you may pick out a slice of an array. For example,
to create a new array from the two elements h[1] and h[2], we could write
slice_h = h[1:3]. Note that the index specification 1:3 means indices 1 and 2,
i.e., the last index is not included. For the generated slice_h array, indices are as
usual, i.e., 0 and 1 in this case. The very last entry in an array may be addressed as,
e.g., h[-1].
Copying arrays requires some care since simply writing new_h = h will, when
you afterwards change elements of new_h, also change the corresponding elements
in h! That is, h[1] is also changed when writing

new_h = h
new_h[1] = 5.0
print h[1]

In this case we do not get 1.85 out on the screen, but 5.0. To really get a copy that
is decoupled from the original array, you may write new_h = copy(h). However,
copying a slice works straightforwardly (as shown above), i.e. an explicit use of
copy is not required.

1.5.7 Plotting

Sometimes you would like to have two or more curves or graphs in the same plot.
Assume we have h as above, and also an array H with the heights 0.50 m, 0.70 m,
1.90 m, and 1.75 m from a family next door. This may be done with the program
plot_heights.py given as
1.5 More Basic Concepts 19

Fig. 1.2 Generated plot for the heights of family members from two families

from numpy import zeros


import [Link] as plt

h = zeros(4)
h[0] = 1.60; h[1] = 1.85; h[2] = 1.75; h[3] = 1.80
H = zeros(4)
H[0] = 0.50; H[1] = 0.70; H[2] = 1.90; H[3] = 1.75

family_member_no = zeros(4)
family_member_no[0] = 0; family_member_no[1] = 1
family_member_no[2] = 2; family_member_no[3] = 3

[Link](family_member_no, h, family_member_no, H)
[Link](Family member number)
[Link](Height (m))
[Link]()

Running the program gives the plot shown in Figure 1.2.


Alternatively, the two curves could have been plotted in the same plot by use of
two plot commands, which gives more freedom as to how the curves appear. To do
this, you could plot the first curve by

[Link](family_member_no, h)
[Link](on)
20 1 The First Few Steps

Then you could (in principle) do a lot of other things in your code, before you plot
the second curve by

[Link](family_member_no, H)
[Link](off)

Notice the use of hold here. hold(on) tells Python to plot also the following
curve(s) in the same window. Python does so until it reads hold(off). If you
do not use the hold(on) or hold(off) command, the second plot command
will overwrite the first one, i.e., you get only the second curve.
In case you would like the two curves plotted in two separate plots, you can do
this by plotting the first curve straightforwardly with

[Link](family_member_no, h)

then do other things in your code, before you do

[Link]()
[Link](family_member_no, H)

Note how the graphs are made continuous by Python, drawing straight lines be-
tween the four data points of each family. This is the standard way of doing it and
was also done when plotting our 1001 height computations with ball_plot.py in
Chapter 1.4. However, since there were so many data points then, the curve looked
nice and smooth. If preferred, one may also plot only the data points. For example,
writing

[Link](h, *)

will mark only the data points with the star symbol. Other symbols like circles etc.
may be used as well.
There are many possibilities in Python for adding information to a plot or for
changing its appearance. For example, you may add a legend by the instruction

[Link](This is some legend)

or you may add a title by

[Link](This is some title)

The command

[Link]([xmin, xmax, ymin, ymax])

will define the plotting range for the x axis to stretch from xmin to xmax and,
similarly, the plotting range for the y axis from ymin to ymax. Saving the figure to
file is achieved by the command
1.5 More Basic Concepts 21

[Link](some_plot.png) # PNG format


[Link](some_plot.pdf) # PDF format
[Link](some_plot.jpg) # JPG format
[Link](some_plot.eps) # Encanspulated PostScript format

For the reader who is into linear algebra, it may be useful to know that standard
matrix/vector operations are straightforward with arrays, e.g., matrix-vector multi-
plication. What is needed though, is to create the right variable types (after having
imported an appropriate module). For example, assume you would like to calculate
the vector y (note that boldface is used for vectors and matrices) as y D Ax, where
A is a 2  2 matrix and x is a vector. We may do this as illustrated by the program
matrix_vector_product.py reading

from numpy import zeros, mat, transpose

x = zeros(2)
x = mat(x)
x = transpose(x)
x[0] = 3; x[1] = 2 # Pick some values

A = zeros((2,2))
A = mat(A)
A[0,0] = 1; A[0,1] = 0
A[1,0] = 0; A[1,1] = 1

# The following gives y = x since A = I, the identity matrix


y = A*x
print y

Here, x is first created as an array, just as we did above. Then the variable type
of x is changed to mat, i.e., matrix, by the line x = mat(x). This is followed
by a transpose of x from dimension 1  2 (the default dimension) to 2  1 with
the statement x = transpose(x), before some test values are plugged in. The
matrix A is first created as a two dimensional array with A = zeros((2,2)) before
conversion and filling in values take place. Finally, the multiplication is performed
as y = A*x. Note the number of parentheses when creating the two dimensional
array A. Running the program gives the following output on the screen:

[[3.]
[2.]]

1.5.8 Error Messages and Warnings

All programmers experience error messages, and usually to a large extent during the
early learning process. Sometimes error messages are understandable, sometimes
they are not. Anyway, it is important to get used to them. One idea is to start with
a program that initially is working, and then deliberately introduce errors in it, one
by one. (But remember to take a copy of the original working code!) For each error,
22 1 The First Few Steps

you try to run the program to see what Pythons response is. Then you know what
the problem is and understand what the error message is about. This will greatly
help you when you get a similar error message or warning later.
Very often, you will experience that there are errors in the program you have
written. This is normal, but frustrating in the beginning. You then have to find the
problem, try to fix it, and then run the program again. Typically, you fix one error
just to experience that another error is waiting around the corner. However, after
some time you start to avoid the most common beginners errors, and things run
more smoothly. The process of finding and fixing errors, called debugging, is very
important to learn. There are different ways of doing it too.
A special program (debugger) may be used to help you check (and do) different
things in the program you need to fix. A simpler procedure, that often brings you
a long way, is to print information to the screen from different places in the pro-
gram. First of all, this is something you should do (several times) during program
development anyway, so that things get checked as you go along. However, if the
final program still ends up with error messages, you may save a copy of it, and do
some testing on the copy. Useful testing may then be to remove, e.g., the latter half
of the program (by inserting comment signs #), and insert print commands at clever
places to see what is the case. When the first half looks ok, insert parts of what
was removed and repeat the process with the new code. Using simple numbers and
doing this in parallel with hand calculations on a piece of paper (for comparison) is
often a very good idea.
Python also offers means to detect and handle errors by the program itself! The
programmer must then foresee (when writing the code) that there is a potential for
error at some particular point. If, for example, some user of the program is asked
(by the running program) to provide a number, and intends to give the number 5, but
instead writes the word five, the program could run into trouble. A try-exception
construction may be used by the programmer to check for such errors and act appro-
priately (see Chapter 6.2 for an example), avoiding a program crash. This procedure
of trying an action and then recovering from trouble, if necessary, is referred to as
exception handling and is the modern way of dealing with errors in a program.
When a program finally runs without error messages, it might be tempting to
think that Ah. . . , I am finished!. But no! Then comes program testing, you need to
verify that the program does the computations as planned. This is almost an art and
may take more time than to develop the program, but the program is useless unless
you have much evidence showing that the computations are correct. Also, having
a set of (automatic) tests saves huge amounts of time when you further develop the
program.

Verification versus validation


Verification is important, but validation is equally important. It is great if your
program can do the calculations according to the plan, but is it the right plan? Put
otherwise, you need to check that the computations run correctly according to
the formula you have chosen/derived. This is verification: doing the things right.
Thereafter, you must also check whether the formula you have chosen/derived
is the right formula for the case you are investigating. This is validation: doing
the right things. In the present book, it is beyond scope to question how well
the mathematical models describe a given phenomenon in nature or engineering,
1.5 More Basic Concepts 23

as the answer usually involves extensive knowledge of the application area. We


will therefore limit our testing to the verification part.

1.5.9 Input Data

Computer programs need a set of input data and the purpose is to use these data to
compute output data, i.e., results. In the previous program we have specified input
data in terms of variables. However, one often wants to get the input through some
dialog with the user. Here is one example where the program asks a question, and
the user provides an answer by typing on the keyboard:

age = input(What is your age? )


print "Ok, so youre half way to %d, wow!" % (age*2)

So, after having interpreted and run the first line, Python has established the variable
age and assigned your input to it. The second line combines the calculation of
twice the age with a message printed on the screen. Try these two lines in a little
test program to see for yourself how it works.
The input function is useful for numbers, lists (Chapter 2), and tuples (Chap-
ter 2). For pure text, the user must either enclose the input in quotes, or the program
must use the raw_input function instead:

name = raw_input(What is your name? )

There are other ways of providing input to a program as well, e.g., via a graphical
interface (as many readers will be used to) or at the command line (i.e., as param-
eters succeeding, on the same line, the command that starts the program). Reading
data from a file is yet another way. Logically, what the program produces when run,
e.g. a plot or printout to the screen or a file, is referred to as program output.

1.5.10 Symbolic Computations

Even though the main focus in this book is programming of numerical methods,
there are occasions where symbolic (also called exact or analytical) operations are
useful. Doing symbolic computations means, as the name suggests, that we do com-
putations with the symbols themselves rather than with the numerical values they
could represent. Let us illustrate the difference between symbolic and numerical
computations with a little example. A numerical computation could be

x = 2
y = 3
z = x*y
print z

which will make the number 6 appear on the screen. A symbolic counterpart of this
code could be
24 1 The First Few Steps

from sympy import *


x, y = symbols(x y)
z = x*y
print z

which causes the symbolic result x*y to appear on the screen. Note that no numer-
ical value was assigned to any of the variables in the symbolic computation. Only
the symbols were used, as when you do symbolic mathematics by hand on a piece
of paper.
Symbolic computations in Python make use of the SymPy package. Each symbol
is represented by a standard variable, but the name of the symbol must be declared
with Symbol(name) for a single symbol, or symbols(name1 name2 ...) for
multiple symbols.. The following script example_symbolic.py is a quick demon-
stration of some of the basic symbolic operations that are supported in Python.

from sympy import *

x = Symbol(x)
y = Symbol(y)

print 2*x + 3*x - y # Algebraic computation


print diff(x**2, x) # Differentiates x**2 wrt. x
print integrate(cos(x), x) # Integrates cos(x) wrt. x
print simplify((x**2 + x**3)/x**2) # Simplifies expression
print limit(sin(x)/x, x, 0) # Finds limit of sin(x)/x as x->0
print solve(5*x - 15, x) # Solves 5*x = 15

Other symbolic calculations like Taylor series expansion, linear algebra (with
matrix and vector operations), and (some) differential equation solving are also
possible.
Symbolic computations are also readily accessible through the (partly) free on-
line tool WolframAlpha4 , which applies the very advanced Mathematica5 package
as symbolic engine. The disadvantage with WolframAlpha compared to the SymPy
package is that the results cannot automatically be imported into your code and
used for further analysis. On the other hand, WolframAlpha has the advantage that
it displays many additional mathematical results related to the given problem. For
example, if we type 2x + 3x - y in WolframAlpha, it not only simplifies the ex-
pression to 5x - y, but it also makes plots of the function fR.x; R y/ D 5x  y,
solves the equation 5x  y D 0, and calculates the integral .5x C y/dxdy.
The commercial Pro version can also show a step-by-step of the analytical compu-
tations in the problem. You are strongly encouraged to try out these commands in
WolframAlpha:

 diff(x^2, x) or diff(x**2, x)
 integrate(cos(x), x)
 simplify((x**2 + x**3)/x**2)

4
[Link]
5
[Link]
1.5 More Basic Concepts 25

 limit(sin(x)/x, x, 0)
 solve(5*x - 15, x)

WolframAlpha is very flexible with respect to syntax.


Another impressive tool for symbolic computations is Sage6 , which is a very
comprehensive package with the aim of creating a viable free open source alterna-
tive to Magma, Maple, Mathematica and Matlab. Sage is implemented in Python.
Projects with extensive symbolic computations will certainly benefit from exploring
Sage.

1.5.11 Concluding Remarks

Programming demands you to be accurate!


In this chapter, you have seen some examples of how simple things may be done
in Python. Hopefully, you have tried to do the examples on your own. If you
have, most certainly you have discovered that what you write in the code has
to be very accurate. For example, with our previous example of four heights
collected in an array h, writing h(0) instead of h[0] gives an error, even if you
and I know perfectly well what you mean! Remember that it is not a human
that runs your code, it is a machine. Therefore, even if the meaning of your
code looks fine to a human eye, it still has to comply in detail to the rules of the
programming language. If not, you get warnings and error messages. This also
goes for lower and upper case letters. If you do from math import * and give
the command pi, you get 3:1415 : : :. However, if you write Pi, you get an error
message. Pay attention to such details also when they are given in later chapters.

Remember to insert comments to explain your code


When you write a computer program, you have two very different kinds of read-
ers. One is Python, which will interpret and run your program according to the
rules. The other is some human, for example, yourself or a peer. It is very impor-
tant to organize and comment the code so that you can go back to your own code
after, e.g., a year and still understand what clever constructions you put in there.
This is relevant when you need to change or extend your code (which usually
happens often in reality). Organized coding and good commenting is even more
critical if other people are supposed to understand code that you have written.

Fast code versus readable and correct code


Numerical computing has a strong tradition in paying much attention to creating
fast code. Real industrial applications of numerical computing often involves
simulations that run for hours, days, and even weeks. Fast code is tremendously
important in those cases. The problem with a strong focus on fast code, un-
fortunately, is sometimes that clear and easily understandable constructions are
replaced by clever and less readable, but faster code. However, for beginners it is
most important to learn to write readable and correct code. We will make some

6
[Link]
26 1 The First Few Steps

comments on constructions that are fast or slow, but the main focus of this book
is to teach how to write correct programs, not the fastest possible programs.

Deleting data no longer in use


Python has automatic garbage collection, meaning that there is no need to delete
variables (or objects) that are no longer in use. Python takes care of this by
itself. This is opposed to, e.g., Matlab, where explicit deleting sometimes may
be required.

Tip: how to deal with long lines


If a statement in a program gets too long, it may be continued on the next line by
inserting a back-slash at the end of the line before proceeding on the next line.
However, no blanks must occur after the back-slash!

The present introductory book just provides a tiny bit of all the functionality
that Python has to offer. An important source of information is the official Python
documentation website ([Link] which provides a Python tutorial,
the Python Library Reference, a Language Reference, and more. Several excel-
lent books are also available ([Link] but not so
many with a scientific computing focus. One exception is Langtangens compre-
hensive book A Primer on Scientific Programming with Python, Springer, 2016.

1.6 Exercises

Exercise 1.1: Error messages


Save a copy of the program [Link] and confirm that the copy runs as the original.
You are now supposed to introduce errors in the code, one by one. For each error
introduced, save and run the program, and comment how well Pythons response
corresponds to the actual error. When you are finished with one error, re-set the
program to correct behavior (and check that it works!) before moving on to the next
error.

a) Insert the word hello on the empty line above the assignment to v0.
b) Remove the # sign in front of the comment initial velocity.
c) Remove the = sign in the assignment to v0.
d) Change the reserved word print into pint.
e) Change the calculation of y to y = v0*t.
f) Change the line print y to print x.
g) Replace the statement

y = v0*t - 0.5*g*t**2

by

y = v0*t - (1/2)*g*t**2

Filename: testing_ball.py.
1.6 Exercises 27

Exercise 1.2: Volume of a cube


Write a program that computes the volume V of a cube with sides of length L D 4
cm and prints the result to the screen. Both V and L should be defined as separate
variables in the program. Run the program and confirm that the correct result is
printed.

Hint See [Link] in the text.


Filename: cube_volume.py.

Exercise 1.3: Area and circumference of a circle


Write a program that computes both the circumference C and the area A of a circle
with radius r D 2 cm. Let the results be printed to the screen on a single line with
an appropriate text. The variables C , A and r should all be defined as a separate
variables in the program. Run the program and confirm that the correct results are
printed.
Filename: circumference_and_area.py.

Exercise 1.4: Volumes of three cubes


We are interested in the volume V of a cube with length L: V D L3 , computed for
three different values of L.

a) Use the linspace function to compute three values of L, equally spaced on the
interval 1; 3.
b) Carry out by hand the computation V D L3 if L is an array with three elements.
That is, compute V for each value of L.
c) In a program, write out the result V of V = L**3 when L is an array with three
elements as computed by linspace in a). Compare the resulting volumes with
your hand calculations.
d) Make a plot of V versus L.

Filename: [Link].

Exercise 1.5: Average of integers


Write a program that stores the sum 1 C 2 C 3 C 4 C 5 in one variable and then
creates another variable with the average of these five numbers. Print the average to
the screen and check that the result is correct.
Filename: average_int.py.

Exercise 1.6: Interactive computing of volume and area

a) Compute the volume in Exercise 1.2 by using Python interactively, i.e., do the
computations at the command prompt (in a Python shell as we also say). Com-
pare with what you got previously from the written program.
b) Do the same also for Exercise 1.3.
28 1 The First Few Steps

Exercise 1.7: Peculiar results from division


Consider the following interactive Python session:

In [1]: x=2; y=4

In [2]: x/y
Out[2]: 0

What is the problem and how can you fix it?

Exercise 1.8: Update variable at command prompt


Invoke Python interactively and perform the following steps.

1. Initialize a variable x to 2.
2. Add 3 to x. Print out the result.
3. Print out the result of x + 1*2 and (x+1)*2. (Observe how parentheses make
a difference).
4. What variable type is x?

Exercise 1.9: Formatted print to screen


Write a program that defines two variables as x = pi and y = 2. Then let the
program compute the product z of these two variables and print the result to the
screen as

Multiplying 3.14159 and 2 gives 6.283

Filename: formatted_print.py.

Exercise 1.10: Python documentation and random numbers


Write a program that prints four random numbers to the screen. The numbers should
be drawn from a uniform distribution over the interval 0; 10/ (0 inclusive, 10 exclu-
sive). Find the information needed for the task, see for example [Link]
org.

Hint Python has a module random that contains a function by the name uniform.
Filename: drawing_random_numbers.py.

Open Access This chapter is distributed under the terms of the Creative Commons Attribution-
NonCommercial 4.0 International License ([Link]
which permits any noncommercial use, duplication, adaptation, distribution and reproduction
in any medium or format, as long as you give appropriate credit to the original author(s) and the
source, a link is provided to the Creative Commons license and any changes made are indicated.
The images or other third party material in this chapter are included in the works Creative
Commons license, unless indicated otherwise in the credit line; if such material is not included
in the works Creative Commons license and the respective action is not permitted by statutory
regulation, users will need to obtain permission from the license holder to duplicate, adapt or
reproduce the material.
Basic Constructions
2

2.1 If Tests, Colon and Indentation

Very often in life, and in computer programs, the next action depends on the out-
come of a question starting with if. This gives the possibility to branch into
different types of action depending on some criterion. Let us as usual focus on
a specific example, which is the core of so-called random walk algorithms used in
a wide range of branches in science and engineering, including materials manufac-
turing and brain research. The action is to move randomly to the north (N), east (E),
south (S), or west (W) with the same probability. How can we implement such an
action in life and in a computer program?
We need to randomly draw one out of four numbers to select the direction in
which to move. A deck of cards can be used in practice for this purpose. Let the
four suits correspond to the four directions: clubs to N, diamonds to E, hearts to S,
and spades to W, for instance. We draw a card, perform the corresponding move,
and repeat the process a large number of times. The resulting path is a typical
realization of the path of a diffusing molecule.
In a computer program, we need to draw a random number, and depending on
the number, update the coordinates of the point to be moved. There are many ways
to draw random numbers and translate them into (e.g.) four random directions, but
the technical details usually depend on the programming language. Our technique
here is universal: we draw a random number in the interval 0; 1/ and let 0; 0:25/
correspond to N, 0:25; 0:5/ to E, 0:5; 0:75/ to S, and 0:75; 1/ to W. Let x and y

The Author(s) 2016 29


S. Linge, H.P. Langtangen, Programming for Computations Python,
Texts in Computational Science and Engineering 15, DOI 10.1007/978-3-319-32428-9_2
30 2 Basic Constructions

hold the coordinates of a point and let d be the length of the move. A pseudo code
(i.e., not real code, just a sketch of the logic) then goes like

r = random number in [0,1)


if 0 <= r < 0.25
move north: y = y + d
else if 0.25 <= r < 0.5
move east: x = x + d
else if 0.5 <= r < 0.75
move south: y = y - d
else if 0.75 <= r < 1
move west: x = x - d

Note the need for first asking about the value of r and then performing an action.
If the answer to the if question is positive (true), we are done and can skip the
next else if questions. If the answer is negative (false), we proceed with the next
question. The last test if 0:75  r < 1 could also read just else, since we here
cover all the remaining possible r values.
The exact code in Python reads

import random
r = [Link]() # random number in [0,1)
if 0 <= r < 0.25:
# move north
y = y + d
elif 0.25 <= r < 0.5:
# move east
x = x + d
elif 0.5 <= r < 0.75:
# move south
y = y - d
else:
# move west
x = x - d

We use else in the last test to cover the different types of syntax that is allowed.
Python recognizes the reserved words if, elif (short for else if), and else and
expects the code to be compatible with the rules of if tests:

 The test reads if condition:, elif condition:, or else:, where


condition is a boolean expression that evaluates to True or False. Note
the closing colon (easy to forget!).
 If condition is True, the following indented block of statements is executed
and the remaining elif or else branches are skipped.
 If condition is False, the program flow jumps to the next elif or else
branch.

The blocks after if, elif, or else may contain new if tests, if desired. Regard-
ing colon and indent, you will see below that these are required in several other
programming constructions as well.
Working with if tests requires mastering boolean expressions. Here are some
basic boolean expressions involving the logical operators ==, !=, <, <=, >, and
2.2 Functions 31

>=. Given the assignment to temp, you should go through each boolean expression
below and determine if it is true or false.

temp = 21 # assign value to a variable


temp == 20 # temp equal to 20
temp != 20 # temp not equal to 20
temp < 20 # temp less than 20
temp > 20 # temp greater than 20
temp <= 20 # temp less than or equal to 20
temp >= 20 # temp greater than or equal to 20

2.2 Functions

Functions are widely used in programming and is a concept that needs to be mas-
tered. In the simplest case, a function in a program is much like a mathematical
function: some input number x is transformed to some output number. One ex-
ample is the tanh1 .x/ function, called atan in computer code: it takes one real
number as input and returns another number. Functions in Python are more gen-
eral and can take a series of variables as input and return one or more variables, or
simply nothing. The purpose of functions is two-fold:

1. to group statements into separate units of code lines that naturally belong to-
gether ( a strategy which may dramatically ease the problem solving process),
and/or
2. to parameterize a set of statements such that they can be written only once and
easily be re-executed with variations.

Examples will be given to illustrate how functions can be written in various con-
texts.
If we modify the program [Link] from Sect. 1.2 slightly, and include a func-
tion, we could let this be a new program ball_function.py as

def y(t):
v0 = 5 # Initial velocity
g = 9.81 # Acceleration of gravity
return v0*t - 0.5*g*t**2

time = 0.6 # Just pick one point in time


print y(time)
time = 0.9 # Pick another point in time
print y(time)

When Python reads and interprets this program from the top, it takes the code
from the line with def, to the line with return, to be the definition of a function
with the name y (note colon and indentation). The return statement of the function
y, i.e.

return v0*t - 0.5*g*t**2


32 2 Basic Constructions

will be understood by Python as first compute the expression, then send the result
back (i.e., return) to where the function was called from. Both def and return are
reserved words. The function depends on t, i.e., one variable (or we say that it takes
one argument or input parameter), the value of which must be provided when the
function is called.
What actually happens when Python meets this code? The def line just tells
Python that here is a function with name y and it has one argument t. Python does
not look into the function at this stage (except that it checks the code for syntax
errors). When Python later on meets the statement print y(time), it recognizes
a function call y(time) and recalls that there is a function y defined with one ar-
gument. The value of time is then transferred to the y(t) function such that t
= time becomes the first action in the y function. Then Python executes one line
at a time in the y function. In the final line, the arithmetic expression v0*t -
0.5*g*t**2 is computed, resulting in a number, and this number (or more pre-
cisely, the Python object representing the number) replaces the call y(time) in the
calling code such that the word print now precedes a number rather than a function
call.
Python proceeds with the next line and sets time to a new value. The next print
statement triggers a new call to y(t), this time t is set to 0.9, the computations
are done line by line in the y function, and the returned result replaces y(time).
Instead of writing print y(time), we could alternatively have stored the returned
result from the y function in a variable,

h = y(time)
print h

Note that when a function contains if-elif-else constructions, return may


be done from within any of the branches. This may be illustrated by the following
function containing three return statements:

def check_sign(x):
if x > 0:
return x is positive
elif x < 0:
return x is negative
else:
return x is zero

Remember that only one of the branches is executed for a single call on check_
sign, so depending on the number x, the return may take place from any of the
three return alternatives.

To return at the end or not


Programmers disagree whether it is a good idea to use return inside a function
where you want, or if there should only be one single return statement at the
end of the function. The authors of this book emphasize readable code and think
that return can be useful in branches as in the example above when the function
is short. For longer or more complicated functions, it might be better to have
2.2 Functions 33

one single return statement. Be prepared for critical comments if you return
wherever you want. . .

An expression you will often encounter when dealing with programming, is main
program, or that some code is in main. This is nothing particular to Python, and sim-
ply refers to that part of the program which is outside functions. However, note that
the def line of functions is counted into main. So, in ball_function.py above,
all statements outside the function y are in main, and also the line def y(t):.
A function may take no arguments, or many, in which case they are just listed
within the parentheses (following the function name) and separated by a comma.
Let us illustrate. Take a slight variation of the ball example and assume that the
ball is not thrown straight up, but at an angle, so that two coordinates are needed to
specify its position at any time. According to Newtons laws (when air resistance is
negligible), the vertical position is given by y.t/ D v0y t 0:5gt 2 and the horizontal
position by x.t/ D v0x t. We can include both these expressions in a new version of
our program that prints the position of the ball for chosen times. Assume we want
to evaluate these expressions at two points in time, t D 0:6s and t D 0:9s. We
can pick some numbers for the initial velocity components v0y and v0x, name the
program ball_position_xy.py, and write it for example as

def y(v0y, t):


g = 9.81 # Acceleration of gravity
return v0y*t - 0.5*g*t**2

def x(v0x, t):


return v0x*t

initial_velocity_x = 2.0
initial_velocity_y = 5.0

time = 0.6 # Just pick one point in time


print x(initial_velocity_x, time), y(initial_velocity_y, time)
time = 0.9 # ... Pick another point in time
print x(initial_velocity_x, time), y(initial_velocity_y, time)

Now we compute and print the two components for the position, for each of the
two chosen points in time. Notice how each of the two functions now takes two
arguments. Running the program gives the output

1.2 1.2342
1.8 0.52695

A function may also have no return value, in which case we simply drop the re-
turn statement, or it may return more than one value. For example, the two functions
we just defined could alternatively have been written as one:

def xy(v0x, v0y, t):


g = 9.81 # acceleration of gravity
return v0x*t, v0y*t - 0.5*g*t**2
34 2 Basic Constructions

Notice the two return values which are simply separated by a comma. When call-
ing the function (and printing), arguments must appear in the same order as in the
function definition. We would then write

print xy(initial_x_velocity, initial_y_velocity, time)

The two returned values from the function could alternatively have been assigned
to variables, e.g., as

x_pos, y_pos = xy(initial_x_velocity, initial_y_velocity, time)

The variables x_pos and y_pos could then have been printed or used in other ways
in the code.
There are possibilities for having a variable number of function input and output
parameters (using *args and **kwargs constructions for the arguments). How-
ever, we do not go further into that topic here.
Variables that are defined inside a function, e.g., g in the last xy function, are
local variables. This means they are only known inside the function. Therefore,
if you had accidentally used g in some calculation outside the function, you would
have got an error message. The variable time is defined outside the function and is
therefore a global variable. It is known both outside and inside the function(s). If
you define one global and one local variable, both with the same name, the function
only sees the local one, so the global variable is not affected by what happens with
the local variable of the same name.
The arguments named in the heading of a function definition are by rule local
variables inside the function. If you want to change the value of a global variable
inside a function, you need to declare the variable as global inside the function.
That is, if the global variable was x, we would need to write global x inside the
function definition before we let the function change it. After function execution,
x would then have a changed value. One should strive to define variables mostly
where they are needed and not everywhere.
Another very useful way of handling function parameters in Python, is by defin-
ing parameters as keyword arguments. This gives default values to parameters and
allows more freedom in function calls, since the order and number of parameters
may vary.
Let us illustrate the use of keyword arguments with the function xy. Assume we
defined xy as

def xy(t, v0x=0, v0y=0):


g = 9.81 # acceleration of gravity
return v0x*t, v0y*t - 0.5*g*t**2

Here, t is an ordinary or positional argument, whereas v0x and v0y are keyword
arguments or named arguments. Generally, there can be many positional argu-
ments and many keyword arguments, but the positional arguments must always be
listed before the keyword arguments in function definition. Keyword arguments
are given default values, as shown here with v0x and v0y, both having zero as de-
2.2 Functions 35

fault value. In a script, the function xy may now be called in many different ways.
For example,

print xy(0.6)

would make xy perform the computations with t = 0.6 and the default values (i.e
zero) of v0x and v0y. The two numbers returned from xy are printed to the screen.
If we wanted to use another initial value for v0y, we could, e.g., write

print xy(0.6,v0y=4.0)

which would make xy perform the calculations with t = 0.6, v0x = 0 (i.e. the
default value) and v0y = 4.0. When there are several positional arguments, they
have to appear in the same order as defined in the function definition, unless we
explicitly use the names of these also in the function call. With explicit name spec-
ification in the call, any order of parameters is acceptable. To illustrate, we could,
e.g., call xy as

print xy(v0y=4.0, v0x=1.0, t=0.6)

In any programming language, it is a good habit to include a little explanation


of what the function is doing, unless what is done by the function is obvious, e.g.,
when having only a few simple code lines. This explanation is called a doc string,
which in Python should be placed just at the top of the function. This explanation
is meant for a human who wants to understand the code, so it should say something
about the purpose of the code and possibly explain the arguments and return values
if needed. If we do that with our xy function from above, we may write the first
lines of the function as
def xy(v0x, v0y, t):
"""Compute the x and y position of the ball at time t"""

Note that other functions may be called from within other functions, and function
input parameters are not required to be numbers. Any object will do, e.g., string
variables or other functions.
Functions are straightforwardly passed as arguments to other functions, as illus-
trated by the following script function_as_argument.py:

def sum_xy(x, y):


return x + y

def prod_xy(x, y):


return x*y

def treat_xy(f, x, y):


return f(x, y)

x = 2; y = 3
print treat_xy(sum_xy, x, y)
print treat_xy(prod_xy, x, y)
36 2 Basic Constructions

When run, this program first prints the sum of x and y (i.e., 5), and then it
prints the product (i.e., 6). We see that treat_xy takes a function name as its first
parameter. Inside treat_xy, that function is used to actually call the function that
was given as input parameter. Therefore, as shown, we may call treat_xy with
either sum_xy or prod_xy, depending on whether we want the sum or product of x
and y to be calculated.
Functions may also be defined within other functions. It that case, they become
local functions, or nested functions, known only to the function inside which they
are defined. Functions defined in main are referred to as global functions. A nested
function has full access to all variables in the parent function, i.e. the function within
which it is defined.
Short functions can be defined in a compact way, using what is known as
a lambda function:

f = lambda x, y: x + 2*y

# Equivalent
def f(x, y):
return x + 2*y

The syntax consists of lambda followed by a series of arguments, colon, and some
Python expression resulting in an object to be returned from the function. Lambda
functions are particularly convenient as function arguments:

print treat_xy(lambda x, y: x*y, x, y)

Overhead of function calls


Function calls have the downside of slowing down program execution. Usu-
ally, it is a good thing to split a program into functions, but in very computing
intensive parts, e.g., inside long loops, one must balance the convenience of call-
ing a function and the computational efficiency of avoiding function calls. It is
a good rule to develop a program using plenty of functions and then in a later
optimization stage, when everything computes correctly, remove function calls
that are quantified to slow down the code.
Here is a little example in IPython where we calculate the CPU time for doing
array computations with and without a helper function:

In [1]: import numpy as np

In [2]: a = [Link](1000000)

In [3]: def add(a, b):


...: return a + b
...:

In [4]: %timeit for i in range(len(a)): a[i] = add(i, i+1)


The slowest run took 16.01 times longer than the fastest.
This could mean that an intermediate result is being cached
1 loops, best of 3: 178 ms per loop

In [5]: %timeit for i in range(len(a)): a[i] = i + (i+1)


10 loops, best of 3: 109 ms per loop
2.3 For Loops 37

We notice that there is some overhead in function calls. The impact of the over-
head reduces quickly with the amount of computational work inside the function.

2.3 For Loops

Many computations are repetitive by nature and programming languages have cer-
tain loop structures to deal with this. Here we will present what is referred to as
a for loop (another kind of loop is a while loop, to be presented afterwards). Assume
you want to calculate the square of each integer from 3 to 7. This could be done
with the following two-line program.

for i in [3, 4, 5, 6, 7]:


print i**2

Note the colon and indentation again!


What happens when Python interprets your code here? First of all, the word
for is a reserved word signalling to Python that a for loop is wanted. Python then
sticks to the rules covering such constructions and understands that, in the present
example, the loop should run 5 successive times (i.e., 5 iterations should be done),
letting the variable i take on the numbers 3; 4; 5; 6; 7 in turn. During each iteration,
the statement inside the loop (i.e. print i**2) is carried out. After each iteration,
i is automatically (behind the scene) updated. When the last number is reached,
the last iteration is performed and the loop is finished. When executed, the program
will therefore print out 9; 16; 25; 36 and 49. The variable i is often referred to as
a loop index, and its name (here i) is a choice of the programmer.
Note that, had there been several statements within the loop, they would all be
executed with the same value of i (before i changed in the next iteration). Make
sure you understand how program execution flows here, it is important.
In Python, integer values specified for the loop variable are often produced by
the built-in function range. The function range may be called in different ways,
that either explicitly, or implicitly, specify the start, stop and step (i.e., change) of
the loop variable. Generally, a call to range reads

range(start, stop, step)

This call makes range return the integers from (and including) start, up to
(but excluding!) stop, in steps of step. Note here that stop-1 is the last integer
included. With range, the previous example would rather read

for i in range(3, 8, 1):


print i**2

By default, if range is called with only two parameters, these are taken to be
start and stop, in which case a step of 1 is understood. If only a single parameter
is used in the call to range, this parameter is taken to be stop. The default step of
38 2 Basic Constructions

1 is then used (combined with the starting at 0). Thus, calling range, for example,
as

range(6)

would return the integers 0, 1, 2, 3, 4, 5.


Note that decreasing integers may be produced by letting start > stop com-
bined with a negative step. This makes it easy to, e.g., traverse arrays in either
direction.
Let us modify ball_plot.py from Sect. 1.4 to illustrate how useful for loops
are if you need to traverse arrays. In that example we computed the height of the
ball at every milli-second during the first second of its (vertical) flight and plotted
the height versus time.
Assume we want to find the maximum height during that time, how can we do
it with a computer program? One alternative may be to compute all the thousand
heights, store them in an array, and then run through the array to pick out the maxi-
mum. The program, named ball_max_height.py, may look as follows.

import [Link] as plt

v0 = 5 # Initial velocity
g = 9.81 # Acceleration of gravity
t = linspace(0, 1, 1000) # 1000 points in time interval
y = v0*t - 0.5*g*t**2 # Generate all heights

# At this point, the array y with all the heights is ready.


# Now we need to find the largest value within y.

largest_height = y[0] # Starting value for search


for i in range(1, 1000):
if y[i] > largest_height:
largest_height = y[i]

print "The largest height achieved was %f m" % (largest_height)

# We might also like to plot the path again just to compare


[Link](t,y)
[Link](Time (s))
[Link](Height (m))
[Link]()

There is nothing new here, except the for loop construction, so let us look at it
in more detail. As explained above, Python understands that a for loop is desired
when it sees the word for. The range() function will produce integers from, and
including, 1, up to, and including, 999, i.e. 1000  1. The value in y[0] is used
as the preliminary largest height, so that, e.g., the very first check that is made is
testing whether y[1] is larger than this height. If so, y[1] is stored as the largest
height. The for loop then updates i to 2, and continues to check y[2], and so on.
Each time we find a larger number, we store it. When finished, largest_height
2.3 For Loops 39

will contain the largest number from the array y. When you run the program, you
get

The largest height achieved was 1.274210 m

which compares favorably to the plot that pops up.


To implement the traversing of arrays with loops and indices, is sometimes chal-
lenging to get right. You need to understand the start, stop and step length choices
for an index, and also how the index should enter expressions inside the loop. At the
same time, however, it is something that programmers do often, so it is important
to develop the right skills on these matters.
Having one loop inside another, referred to as a double loop, is sometimes useful,
e.g., when doing linear algebra. Say we want to find the maximum among the
numbers stored in a 4  4 matrix A. The code fragment could look like

largest_number = A[0][0]

for i in range(4):
for j in range(4):
if A[i][j] > largest_number:
largest_number = A[i][j]

Here, all the j indices (0 - 3) will be covered for each value of index i. First, i
stays fixed at i = 0, while j runs over all its indices. Then, i stays fixed at i = 1
while j runs over all its indices again, and so on. Sketch A on a piece of paper and
follow the first few loop iterations by hand, then you will realize how the double
loop construction works. Using two loops is just a special case of using multiple or
nested loops, and utilizing more than two loops is just a straightforward extension
of what was shown here. Note, however, that the loop index name in multiple loops
must be unique to each of the nested loops. Note also that each nested loop may
have as many code lines as desired, both before and after the next inner loop.
The vectorized computation of heights that we did in ball_plot.py (Sect. 1.4)
could alternatively have been done by traversing the time array (t) and, for each t
element, computing the height according to the formula y D v0 t  12 gt 2 . However,
it is important to know that vectorization goes much quicker. So when speed is
important, vectorization is valuable.

Use loops to compute sums


One important use of loops, is to calculate sums. As a simple example, assume
some variable x given by the mathematical expression

X
N
xD 2  i;
i D1

i.e., summing up the N first even numbers. For some given N , say N D 5, x
would typically be computed in a computer program as:
40 2 Basic Constructions

N = 5
x = 0
for i in range(1, N+1):
x += 2*i
print x

Executing this code will print the number 30 to the screen. Note in particular
how the accumulation variable x is initialized to zero. The value of x then gets
updated with each iteration of the loop, and not until the loop is finished will
x have the correct value. This way of building up the value is very common in
programming, so make sure you understand it by simulating the code segment
above by hand. It is a technique used with loops in any programming language.

2.4 While Loops

Python also has another standard loop construction, the while loop, doing iterations
with a loop index very much like the for loop. To illustrate what such a loop may
look like, we consider another modification of ball_plot.py in Sect. 1.4. We will
now change it so that it finds the time of flight for the ball. Assume the ball is
thrown with a slightly lower initial velocity, say 4:5 ms1 , while everything else is
kept unchanged. Since we still look at the first second of the flight, the heights at the
end of the flight become negative. However, this only means that the ball has fallen
below its initial starting position, i.e., the height where it left the hand, so there is
no problem with that. In our array y we will then have a series of heights which
towards the end of y become negative. Let us, in a program named ball_time.py
find the time when heights start to get negative, i.e., when the ball crosses y D 0.
The program could look like this

from numpy import linspace

v0 = 4.5 # Initial velocity


g = 9.81 # Acceleration of gravity
t = linspace(0, 1, 1000) # 1000 points in time interval
y = v0*t - 0.5*g*t**2 # Generate all heights

# Find where the ball hits y=0


i = 0
while y[i] >= 0:
i += 1

# Now, y[i-1]>0 and y[i]<0 so lets take the middle point


# in time as the approximation for when the ball hits h=0
print "y=0 at", 0.5*(t[i-1] + t[i])

# We plot the path again just for comparison


import [Link] as plt
[Link](t, y)
[Link](t, 0*t, g--)
[Link](Time (s))
[Link](Height (m))
[Link]()
2.5 Lists and Tuples Alternatives to Arrays 41

If you type and run this program you should get

y=0 at 0.917417417417

The new thing here is the while loop only. The loop (note colon and indentation)
will run as long as the boolean expression y[i] > 0 evaluates to True. Note that
the programmer introduced a variable (the loop index) by the name i, initialized it
(i = 0) before the loop, and updated it (i += 1) in the loop. So for each iteration,
i is explicitly increased by 1, allowing a check of successive elements in the array y.
Compared to a for loop, the programmer does not have to specify the number
of iterations when coding a while loop. It simply runs until the boolean expression
becomes False. Thus, a loop index (as we have in a for loop) is not required. Fur-
thermore, if a loop index is used in a while loop, it is not increased automatically;
it must be done explicitly by the programmer. Of course, just as in for loops and
if blocks, there might be (arbitrarily) many code lines in a while loop. Any for
loop may also be implemented as a while loop, but while loops are more general
so not all of them can be expressed as a for loop.
A problem to be aware of, is what is usually referred to as an infinite loop. In
those unintentional (erroneous) cases, the boolean expression of the while test
never evaluates to False, and the program can not escape the loop. This is one
of the most frequent errors you will experience as a beginning programmer. If you
accidentally enter an infinite loop and the program just hangs forever, press Ctrl+c
to stop the program.

2.5 Lists and Tuples Alternatives to Arrays

We have seen that a group of numbers may be stored in an array that we may treat
as a whole, or element by element. In Python, there is another way of organiz-
ing data that actually is much used, at least in non-numerical contexts, and that is
a construction called list.
A list is quite similar to an array in many ways, but there are pros and cons
to consider. For example, the number of elements in a list is allowed to change,
whereas arrays have a fixed length that must be known at the time of memory allo-
cation. Elements in a list can be of different type, i.e you may mix integers, floats
and strings, whereas elements in an array must be of the same type. In general, lists
provide more flexibility than do arrays. On the other hand, arrays give faster com-
putations than lists, making arrays the prime choice unless the flexibility of lists is
needed. Arrays also require less memory use and there is a lot of ready-made code
for various mathematical operations. Vectorization requires arrays to be used.
The range() function that we used above in our for loop actually returns a list.
If you for example write range(5) at the prompt in ipython, you get [0, 1,
2, 3, 4] in return, i.e., a list with 5 numbers. In a for loop, the line for i in
range[5] makes i take on each of the numbers 0; 1; 2; 3; 4 in turn, as we saw
above. Writing, e.g., x = range(5), gives a list by the name x, containing those
five numbers. These numbers may now be accessed (e.g., as x[2], which contains
the number 2) and used in computations just as we saw for array elements. As with
arrays, indices run from 0 to n  1, when n is the number of elements in a list. You
may convert a list to an array by x = array(L).
42 2 Basic Constructions

A list may also be created by simply writing, e.g.,

x = [hello, 4, 3.14, 6]

giving a list where x[0] contains the string hello, x[1] contains the integer 4, etc.
We may add and/or delete elements anywhere in the list as shown in the following
example.

x = [hello, 4, 3.14, 6]
[Link](0, -2) # x then becomes [-2, hello, 4, 3.14, 6]
del x[3] # x then becomes [-2, hello, 4, 6]
[Link](3.14) # x then becomes [-2, hello, 4, 6, 3.14]

Note the ways of writing the different operations here. Using append() will always
increase the list at the end. If you like, you may create an empty list as x = []
before you enter a loop which appends element by element. If you need to know
the length of the list, you get the number of elements from len(x), which in our
case is 5, after appending 3.14 above. This function is handy if you want to traverse
all list elements by index, since range(len(x)) gives you all legal indices. Note
that there are many more operations on lists possible than shown here.
Previously, we saw how a for loop may run over array elements. When we want
to do the same with a list in Python, we may do it as this little example shows,

x = [hello, 4, 3.14, 6]
for e in x:
print x element: , e
print This was all the elements in the list x

This is how it usually is done in Python, and we see that e runs over the elements
of x directly, avoiding the need for indexing. Be aware, however, that when loops
are written like this, you can not change any element in x by changing e. That is,
writing e += 2 will not change anything in x, since e can only be used to read (as
opposed to overwrite) the list elements.
There is a special construct in Python that allows you to run through all elements
of a list, do the same operation on each, and store the new elements in another list.
It is referred to as list comprehension and may be demonstrated as follows.

List_1 = [1, 2, 3, 4]
List_2 = [e*10 for e in List_1]

This will produce a new list by the name List_2, containing the elements 10,
20, 30 and 40, in that order. Notice the syntax within the brackets for List_2,
for e in List_1 signals that e is to successively be each of the list elements in
List_1, and for each e, create the next element in List_2 by doing e*10. More
generally, the syntax may be written as

List_2 = [E(e) for e in List_1]

where E(e) means some expression involving e.


2.6 Reading from and Writing to Files 43

In some cases, it is required to run through 2 (or more) lists at the same time.
Python has a handy function called zip for this purpose. An example of how to use
zip is provided in the code file_handling.py below.
We should also briefly mention about tuples, which are very much like lists, the
main difference being that tuples cannot be changed. To a freshman, it may seem
strange that such constant lists could ever be preferable over lists. However, the
property of being constant is a good safeguard against unintentional changes. Also,
it is quicker for Python to handle data in a tuple than in a list, which contributes to
faster code. With the data from above, we may create a tuple and print the content
by writing

x = (hello, 4, 3.14, 6)
for e in x:
print x element: , e
print This was all the elements in the tuple x

Trying insert or append for the tuple gives an error message (because it cannot
be changed), stating that the tuple object has no such attribute.

2.6 Reading from and Writing to Files

Input data for a program often come from files and the results of the computations
are often written to file. To illustrate basic file handling, we consider an example
where we read x and y coordinates from two columns in a file, apply a function f
to the y coordinates, and write the results to a new two-column data file. The first
line of the input file is a heading that we can just skip:

# x and y coordinates
1.0 3.44
2.0 4.8
3.5 6.61
4.0 5.0

The relevant Python lines for reading the numbers and writing out a similar file are
given in the file file_handling.py

filename = [Link]
infile = open(filename, r) # Open file for reading
line = [Link]() # Read first line
# Read x and y coordinates from the file and store in lists
x = []
y = []
for line in infile:
words = [Link]() # Split line into words
[Link](float(words[0]))
[Link](float(words[1]))
[Link]()
44 2 Basic Constructions

# Transform y coordinates
from math import log

def f(y):
return log(y)

for i in range(len(y)):
y[i] = f(y[i])

# Write out x and y to a two-column file


filename = tmp_out.dat
outfile = open(filename, w) # Open file for writing
[Link](# x and y coordinates\n)
for xi, yi in zip(x, y):
[Link](%10.5f %10.5f\n % (xi, yi))
[Link]()

Such a file with a comment line and numbers in tabular format is very com-
mon so numpy has functionality to ease reading and writing. Here is the same
example using the loadtxt and savetxt functions in numpy for tabular data (file
file_handling_numpy.py):

filename = [Link]
import numpy
data = [Link](filename, comments=#)
x = data[:,0]
y = data[:,1]
data[:,1] = [Link](y) # insert transformed y back in array
filename = tmp_out.dat
filename = tmp_out.dat
outfile = open(filename, w) # open file for writing
[Link](# x and y coordinates\n)
[Link](outfile, data, fmt=%10.5f)

2.7 Exercises

Exercise 2.1: Errors with colon, indent, etc.


Write the program ball_function.py as given in the text and confirm that the
program runs correctly. Then save a copy of the program and use that program
during the following error testing.
You are supposed to introduce errors in the code, one by one. For each error
introduced, save and run the program, and comment how well Pythons response
corresponds to the actual error. When you are finished with one error, re-set the
program to correct behavior (and check that it works!) before moving on to the next
error.

a) Change the first line from def y(t): to def y(t), i.e., remove the colon.
b) Remove the indent in front of the statement v0 = 5 inside the function y, i.e.,
shift the text four spaces to the left.
2.7 Exercises 45

c) Now let the statement v0 = 5 inside the function y have an indent of three
spaces (while the remaining two lines of the function have four).
d) Remove the left parenthesis in the first statement def y(t):
e) Change the first line of the function definition from def y(t): to def y():,
i.e., remove the parameter t.
f) Change the first occurrence of the statement print y(time) to print y().

Filename: errors_colon_indent_etc.py.

Exercise 2.2: Compare integers a and b


Explain briefly, in your own words, what the following program does.

a = input(Give an integer a: )
b = input(Give an integer b: )

if a < b:
print "a is the smallest of the two numbers"
elif a == b:
print "a and b are equal"
else:
print "a is the largest of the two numbers"

Proceed by writing the program, and then run it a few times with different values
for a and b to confirm that it works as intended. In particular, choose combinations
for a and b so that all three branches of the if construction get tested.
Filename: compare_a_and_b.py.

Exercise 2.3: Functions for circumference and area of a circle


Write a program that takes a circle radius r as input from the user and then computes
the circumference C and area A of the circle. Implement the computations of C and
A as two separate functions that each takes r as input parameter. Print C and A to
the screen along with an appropriate text. Run the program with r D 1 and confirm
that you get the right answer.
Filename: functions_circumference_area.py.

Exercise 2.4: Function for area of a rectangle


Write a program that computes the area A D bc of a rectangle. The values of b
and c should be user input to the program. Also, write the area computation as
a function that takes b and c as input parameters and returns the computed area.
Let the program print the result to screen along with an appropriate text. Run the
program with b D 2 and c D 3 to confirm correct program behavior.
Filename: function_area_rectangle.py.

Exercise 2.5: Area of a polygon


One of the most important mathematical problems through all times has been to
find the area of a polygon, especially because real estate areas often had the shape
of polygons, and it was necessary to pay tax for the area. We have a polygon as
depicted below.
46 2 Basic Constructions

The vertices (corners) of the polygon have coordinates .x1 ; y1 /, .x2 ; y2 /, : : :,


.xn ; yn /, numbered either in a clockwise or counter clockwise fashion. The area A
of the polygon can amazingly be computed by just knowing the boundary coordi-
nates:
1
A D j.x1 y2 C x2 y3 C    C xn1 yn C xn y1 /
2
.y1 x2 C y2 x3 C    C yn1 xn C yn x1 /j :

Write a function polyarea(x, y) that takes two coordinate arrays with the ver-
tices as arguments and returns the area. Assume that x and y are either lists or
arrays.
Test the function on a triangle, a quadrilateral, and a pentagon where you can
calculate the area by alternative methods for comparison.

Hint Since Python lists and arrays has 0 as their first index, it is wise to rewrite the
mathematical formula in terms of vertex coordinates numbered as x0 ; x1 ; : : : ; xn1
and y0 ; y1 ; : : : ; yn1 .
Filename: [Link].

Exercise 2.6: Average of integers


Write a program that gets an integer N > 1 from the user and computes the average
of all integers i D 1; : : : ; N . The computation should be done in a function that
takes N as input parameter. Print the result to the screen with an appropriate text.
Run the program with N D 5 and confirm that you get the correct answer.
Filename: average_1_to_N.py.
2.7 Exercises 47

Exercise 2.7: While loop with errors


Assume some program has been written for the task of adding all integers i D
1; 2; : : : ; 10:

some_number = 0
i = 1
while i < 11
some_number += 1
print some_number

a) Identify the errors in the program by just reading the code and simulating the
program by hand.
b) Write a new version of the program with errors corrected. Run this program and
confirm that it gives the correct output.

Filename: while_loop_errors.py.

Exercise 2.8: Area of rectangle versus circle


Consider one circle and one rectangle. The circle has a radius r D 10:6. The
rectangle has sides a and b, but only a is known from the outset. Let a D 1:3 and
write a program that uses a while loop to find the largest possible integer b that
gives a rectangle area smaller than, but as close as possible to, the area of the circle.
Run the program and confirm that it gives the right answer (which is b D 271).
Filename: area_rectangle_vs_circle.py.

Exercise 2.9: Find crossing points of two graphs


Consider two functions f .x/ D x and g.x/ D x 2 on the interval 4; 4.
Write a program that, by trial and error, finds approximately for which values
of x the two graphs cross, i.e., f .x/ D g.x/. Do this by considering N equally
distributed points on the interval, at each point checking whether jf .x/g.x/j < ,
where  is some small number. Let N and  be user input to the program and let
the result be printed to screen. Run your program with N D 400 and  D 0:01.
Explain the output from the program. Finally, try also other values of N , keeping
the value of  fixed. Explain your observations.
Filename: crossing_2_graphs.py.

Exercise 2.10: Sort array with numbers


The import statement from random import * will give access to a function
uniform that may be used to draw (pseudo-)random numbers from a uniform
distribution between two numbers a (inclusive) and b (inclusive). For example,
writing x = uniform(0,10) makes x a float value larger than, or equal to, 0, and
smaller than, or equal to, 10.
Write a script that generates an array of 6 random numbers between 0 and 10.
The program should then sort the array so that numbers appear in increasing order.
Let the program make a formatted print of the array to the screen both before and
after sorting. The printouts should appear on the screen so that comparison is made
easy. Confirm that the array has been sorted correctly.
Filename: sort_numbers.py.
48 2 Basic Constructions

Exercise 2.11: Compute 


Up through history, great minds have developed different computational schemes
for the number . We will here consider two such schemes, one by Leibniz (1646 
1716), and one by Euler (1707  1783).
The scheme by Leibniz may be written
1
X 1
 D8 ;
.4k C 1/.4k C 3/
kD0

while one form of the Euler scheme may appear as


v
u 1
u X 1
 Dt6 :
k2
kD1

If only the first N terms of each sum are used as an approximation to , each
modified scheme will have computed  with some error.
Write a program that takes N as input from the user, and plots the error develop-
ment with both schemes as the number of iterations approaches N . Your program
should also print out the final error achieved with both schemes, i.e. when the num-
ber of terms is N. Run the program with N D 100 and explain briefly what the
graphs show.
Filename: compute_pi.py.

Exercise 2.12: Compute combinations of sets


Consider an ID number consisting of two letters and three digits, e.g., RE198. How
many different numbers can we have, and how can a program generate all these
combinations?
If a collection of n things can have m1 variations of the first thing, m2 of the sec-
ond and so on, the total number of variations of the collection equals m1 m2    mn .
In particular, the ID number exemplified above can have 2626101010 D 676; 000
variations. To generate all the combinations, we must have five nested for loops.
The first two run over all letters A, B, and so on to Z, while the next three run over
all digits 0; 1; : : : ; 9.
To convince yourself about this result, start out with an ID number on the form
A3 where the first part can vary among A, B, and C, and the digit can be among 1,
2, or 3. We must start with A and combine it with 1, 2, and 3, then continue with
B, combined with 1, 2, and 3, and finally combine C with 1, 2, and 3. A double for
loop does the work.

a) In a deck of cards, each card is a combination of a rank and a suit. There are 13
ranks: ace (A), 2, 3, 4, 5, 6, 7, 8, 9, 10, jack (J), queen (Q), king (K), and four
suits: clubs (C), diamonds (D), hearts (H), and spades (S). A typical card may
be D3. Write statements that generate a deck of cards, i.e., all the combinations
CA, C2, C3, and so on to SK.
b) A vehicle registration number is on the form DE562, where the letters vary from
A to Z and the digits from 0 to 9. Write statements that compute all the possible
registration numbers and stores them in a list.
2.7 Exercises 49

c) Generate all the combinations of throwing two dice (the number of eyes can
vary from 1 to 6). Count how many combinations where the sum of the eyes
equals 7.

Filename: combine_sets.py.

Exercise 2.13: Frequency of random numbers


Write a program that takes a positive integer N as input and then draws N random
integers in the interval 1; 6 (both ends inclusive). In the program, count how many
of the numbers, M , that equal 6 and write out the fraction M=N . Also, print all the
random numbers to the screen so that you can check for yourself that the counting
is correct. Run the program with a small value for N (e.g., N = 10) to confirm that
it works as intended.

Hint Use [Link](1,6) to draw a random integer between 1 and 6.


Filename: count_random_numbers.py.

Remarks For large N , this program computes the probability M=N of getting six
eyes when throwing a die.

Exercise 2.14: Game 21


Consider some game where each participant draws a series of random integers
evenly distributed from 0 and 10, with the aim of getting the sum as close as pos-
sible to 21, but not larger than 21. You are out of the game if the sum passes 21.
After each draw, you are told the number and your total sum, and are asked whether
you want another draw or not. The one coming closest to 21 is the winner.
Implement this game in a program.

Hint Use [Link](0,10) to draw random integers in 0; 10.


Filename: game_21.py.

Exercise 2.15: Linear interpolation


Some measurements yi , i D 0; 1; : : : ; N (given below), of a quantity y have been
collected regularly, once every minute, at times ti D i, i D 0; 1; : : : ; N . We want
to find the value y in between the measurements, e.g., at t D 3:2 min. Computing
such y values is called interpolation.
Let your program use linear interpolation to compute y between two consecutive
measurements:

1. Find i such that ti  t  ti C1 .


2. Find a mathematical expression for the straight line that goes through the points
.i; yi / and .i C 1; yi C1 /.
3. Compute the y value by inserting the users time value in the expression for the
straight line.

a) Implement the linear interpolation technique in a function that takes an array


with the yi measurements as input, together with some time t, and returns the
interpolated y value at time t.
50 2 Basic Constructions

b) Write another function with a loop where the user is asked for a time on the
interval 0; N  and the corresponding (interpolated) y value is written to the
screen. The loop is terminated when the user gives a negative time.
c) Use the following measurements: 4:4; 2:0; 11:0; 21:5; 7:5, corresponding to
times 0; 1; : : : ; 4 (min), and compute interpolated values at t D 2:5 and t D 3:1
min. Perform separate hand calculations to check that the output from the
program is correct.

Filename: linear_interpolation.py.

Exercise 2.16: Test straight line requirement


Assume the straight line function f .x/ D 4x C 1. Write a script that tests the
point-slope form for this line as follows. Within a chosen interval on the x-axis
(for example, for x between 0 and 10), randomly pick 100 points on the line and
check if the following requirement is fulfilled for each point:

f .xi /  f .c/
D a; i D 1; 2; : : : ; 100 ;
xi  c
where a is the slope of the line and c defines a fixed point .c; f .c// on the line. Let
c D 2 here.
Filename: test_straight_line.py.

Exercise 2.17: Fit straight line to data


Assume some measurements yi ; i D 1; 2; : : : ; 5 have been collected, once every
second. Your task is to write a program that fits a straight line to those data.

a) Make a function that computes the error between the straight line f .x/ D axCb
and the measurements:

X
5
eD .axi C b  yi /2 :
i D1

b) Make a function with a loop where you give a and b, the corresponding value of
e is written to the screen, and a plot of the straight line f .x/ D ax C b together
with the discrete measurements is shown.

Hint To make the plotting from the loop to work, you may have to insert from
[Link] import * at the top of the script and also add show() after
the plot command in the loop.

c) Given the measurements 0:5; 2:0; 1:0; 1:5; 7:5, at times 0; 1; 2; 3; 4, use the func-
tion in b) to interactively search for a and b such that e is minimized.

Filename: fit_straight_line.py.

Remarks Fitting a straight line to measured data points is a very common task. The
manual search procedure in c) can be automated by using a mathematical method
called the method of least squares.
2.7 Exercises 51

Exercise 2.18: Fit sines to straight line


A lot of technology, especially most types of digital audio devices for processing
sound, is based on representing a signal of time as a sum of sine functions. Say the
signal is some function f .t/ on the interval ;  (a more general interval a; b
can easily be treated, but leads to slightly more complicated formulas). Instead of
working with f .t/ directly, we approximate f by the sum

X
N
SN .t/ D bn [Link]/; (2.1)
nD1

where the coefficients bn must be adjusted such that SN .t/ is a good approximation
to f .t/. We shall in this exercise adjust bn by a trial-and-error process.

a) Make a function sinesum(t, b) that returns SN .t/, given the coefficients bn


in an array b and time coordinates in an array t. Note that if t is an array, the
return value is also an array.
b) Write a function test_sinesum() that calls sinesum(t, b) in a) and deter-
mines if the function computes a test case correctly. As test case, let t be an
array with values =2 and =4, choose N D 2, and b1 D 4 and b2 D 3.
Compute SN .t/ by hand to get reference values.
c) Make a function plot_compare(f, N, M) that plots the original function f .t/
together with the sum of sines SN .t/, so that the quality of the approximation
SN .t/ can be examined visually. The argument f is a Python function imple-
menting f .t/, N is the number of terms in the sum SN .t/, and M is the number
of uniformly distributed t coordinates used to plot f and SN .
d) Write a function error(b, f, M) that returns a mathematical measure of the
error in SN .t/ as an approximation to f .t/:
sX
ED .f .ti /  SN .ti //2 ;
i

where the ti values are M uniformly distributed coordinates on ; . The
array b holds the coefficients in SN and f is a Python function implementing the
mathematical function f .t/.
e) Make a function trial(f, N) for interactively giving bn values and getting
a plot on the screen where the resulting SN .t/ is plotted together with f .t/.
The error in the approximation should also be computed as indicated in d). The
argument f is a Python function for f .t/ and N is the number of terms N in the
sum SN .t/. The trial function can run a loop where the user is asked for the bn
values in each pass of the loop and the corresponding plot is shown. You must
find a way to terminate the loop when the experiments are over. Use M=500 in
the calls to plot_compare and error.

Hint To make this part of your program work, you may have to insert from
[Link] import * at the top and also add show() after the plot
command in the loop.
52 2 Basic Constructions

f) Choose f .t/ to be a straight line f .t/ D 1 t on ; . Call trial(f, 3)


and try to find through experimentation some values b1 , b2 , and b3 such that the
sum of sines SN .t/ is a good approximation to the straight line.
g) Now we shall try to automate the procedure in f). Write a function that has
three nested loops over values of b1 , b2 , and b3 . Let each loop cover the interval
1; 1 in steps of 0.1. For each combination of b1 , b2 , and b3 , the error in the
approximation SN should be computed. Use this to find, and print, the smallest
error and the corresponding values of b1 , b2 , and b3 . Let the program also plot
f and the approximation SN corresponding to the smallest error.

Filename: fit_sines.py.

Remarks

1. The function SN .x/ is a special case of what is called a Fourier series. At


the beginning of the 19th century, Joseph Fourier (1768-1830) showed that any
function can be approximated analytically by a sum of cosines and sines. The
approximation improves as the number of terms (N ) is increased. Fourier series
are very important throughout science and engineering today.
(a) Finding the coefficients bn is solved much more accurately in Exercise 3.12,
by a procedure that also requires much less human and computer work!
(b) In real applications, f .t/ is not known as a continuous function, but func-
tion values of f .t/ are provided. For example, in digital sound applications,
music in a CD-quality WAV file is a signal with 44,100 samples of the cor-
responding analog signal f .t/ per second.

Exercise 2.19: Count occurrences of a string in a string


In the analysis of genes one encounters many problem settings involving searching
for certain combinations of letters in a long string. For example, we may have
a string like

gene = AGTCAATGGAATAGGCCAAGCGAATATTTGGGCTACCA

We may traverse this string, letter by letter, by the for loop for letter in gene.
The length of the string is given by len(gene), so an alternative traversal over an
index i is for i in range(len(gene)). Letter number i is reached through
gene[i], and a substring from index i up to, but not including j, is created by
gene[i:j].

a) Write a function freq(letter, text) that returns the frequency of the letter
letter in the string text, i.e., the number of occurrences of letter divided
by the length of text. Call the function to determine the frequency of C and G
in the gene string above. Compute the frequency by hand too.
b) Write a function pairs(letter, text) that counts how many times a pair
of the letter letter (e.g., GG) occurs within the string text. Use the function
to determine how many times the pair AA appears in the string gene above.
Perform a manual counting too to check the answer.
2.7 Exercises 53

c) Write a function mystruct(text) that counts the number of a certain structure


in the string text. The structure is defined as G followed by A or T until a double
GG. Perform a manual search for the structure too to control the computations
by mystruct.

Filename: count_substrings.py.

Remarks You are supposed to solve the tasks using simple programming with
loops and variables. While a) and b) are quite straightforward, c) quickly involves
demanding logic. However, there are powerful tools available in Python that can
solve the tasks efficiently in very compact code: a) [Link](letter)/float
(len(text)); b) [Link](letter*2); c) len([Link](G[AT]+?GG,
text)). That is, there is rich functionality for analysis of text in Python and this is
particularly useful in analysis of gene sequences.

Open Access This chapter is distributed under the terms of the Creative Commons Attribution-
NonCommercial 4.0 International License ([Link]
which permits any noncommercial use, duplication, adaptation, distribution and reproduction
in any medium or format, as long as you give appropriate credit to the original author(s) and the
source, a link is provided to the Creative Commons license and any changes made are indicated.
The images or other third party material in this chapter are included in the works Creative
Commons license, unless indicated otherwise in the credit line; if such material is not included
in the works Creative Commons license and the respective action is not permitted by statutory
regulation, users will need to obtain permission from the license holder to duplicate, adapt or
reproduce the material.
Computing Integrals
3

We now turn our attention to solving mathematical problems through computer


programming. There are many reasons to choose integration as our first application.
Integration is well known already from high school mathematics. Most integrals
are not tractable by pen and paper, and a computerized solution approach is both
very much simpler and much more powerful you can essentially treat all integrals
Rb
a f .x/dx in 10 lines of computer code (!). Integration also demonstrates the
difference between exact mathematics by pen and paper and numerical mathematics
on a computer. The latter approaches the result of the former without any worries
about rounding errors due to finite precision arithmetics in computers (in contrast to
differentiation, where such errors prevent us from getting a result as accurate as we
desire on the computer). Finally, integration is thought of as a somewhat difficult
mathematical concept to grasp, and programming integration should greatly help
with the understanding of what integration is and how it works. Not only shall we
understand how to use the computer to integrate, but we shall also learn a series
of good habits to ensure your computer work is of the highest scientific quality.
In particular, we have a strong focus on how to write Python code that is free of
programming mistakes.
Calculating an integral is traditionally done by
Zb
f .x/ dx D F .b/  F .a/; (3.1)
a

where
dF
f .x/ D :
dx
The Author(s) 2016 55
S. Linge, H.P. Langtangen, Programming for Computations Python,
Texts in Computational Science and Engineering 15, DOI 10.1007/978-3-319-32428-9_3
56 3 Computing Integrals

The major problem with this procedure is that we need to find the anti-derivative
F .x/ corresponding to a given f .x/. For some relatively simple integrands f .x/,
finding F .x/ is a doable task, but it can very quickly become challenging, even
impossible!
The method (3.1) provides an exact or analytical value of the integral. If we
relax the requirement of the integral being exact, and instead look for approximate
values, produced by numerical methods, integration becomes a very straightforward
task for any given f .x/ (!).
The downside of a numerical method is that it can only find an approximate an-
swer. Leaving the exact for the approximate is a mental barrier in the beginning, but
remember that most real applications of integration will involve an f .x/ function
that contains physical parameters, which are measured with some error. That is,
f .x/ is very seldom exact, and then it does not make sense to compute the integral
with a smaller error than the one already present in f .x/.
Another advantage of numerical methods is that we can easily integrate a func-
tion f .x/ that is only known as samples, i.e., discrete values at some x points,
and not as a continuous function of x expressed through a formula. This is highly
relevant when f is measured in a physical experiment.

3.1 Basic Ideas of Numerical Integration

We consider the integral


Zb
f .x/dx : (3.2)
a

Most numerical methods for computing this integral split up the original integral
into a sum of several integrals, each covering a smaller part of the original inte-
gration interval a; b. This re-writing of the integral is based on a selection of
integration points xi , i D 0; 1; : : : ; n that are distributed on the interval a; b.
Integration points may, or may not, be evenly distributed. An even distribution sim-
plifies expressions and is often sufficient, so we will mostly restrict ourselves to that
choice. The integration points are then computed as

xi D a C ih; i D 0; 1; : : : ; n; (3.3)

where
ba
hD : (3.4)
n
Given the integration points, the original integral is re-written as a sum of inte-
grals, each integral being computed over the sub-interval between two consecutive
integration points. The integral in (3.2) is thus expressed as

Zb Zx1 Zx2 Zxn


f .x/dx D f .x/dx C f .x/dx C : : : C f .x/dx : (3.5)
a x0 x1 xn1

Note that x0 D a and xn D b.


3.2 The Composite Trapezoidal Rule 57

Proceeding from (3.5), the different integration methods will differ in the way
they approximate each integral on the right hand side. The fundamental idea is that
each term is an integral over a small interval xi ; xi C1 , and over this small interval,
it makes sense to approximate f by a simple shape, say a constant, a straight line,
or a parabola, which we can easily integrate by hand. The details will become clear
in the coming examples.

Computational example To understand and compare the numerical integration


methods, it is advantageous to use a specific integral for computations and graphical
illustrations. In particular, we want to use an integral that we can calculate by hand
such that the accuracy of the approximation methods can easily be assessed. Our
specific integral is taken from basic physics. Assume that you speed up your car
from rest and wonder how far you go in T seconds. The distance is given by the
RT
integral 0 v.t/dt, where v.t/ is the velocity as a function of time. A rapidly
increasing velocity function might be
3
v .t/ D 3t 2 e t : (3.6)

The distance after one second is

Z1
v.t/dt; (3.7)
0

which is the integral we aim to compute by numerical methods. Fortunately, the


chosen expression of the velocity has a form that makes it easy to calculate the
anti-derivative as
3
V .t/ D e t  1 : (3.8)
We can therefore compute the exact value of the integral as V .1/  V .0/  1:718
(rounded to 3 decimals for convenience).

3.2 The Composite Trapezoidal Rule


Rb
The integral a f .x/dx may be interpreted as the area between the x axis and the
graph y D f .x/ of the integrand. Figure 3.1 illustrates this area for the choice
R1
(3.7). Computing the integral 0 f .t/dt amounts to computing the area of the
hatched region.
If we replace the true graph in Fig. 3.1 by a set of straight line segments, we
may view the area rather as composed of trapezoids, the areas of which are easy to
compute. This is illustrated in Fig. 3.2, where 4 straight line segments give rise to
4 trapezoids, covering the time intervals 0; 0:2/, 0:2; 0:6/, 0:6; 0:8/ and 0:8; 1:0.
Note that we have taken the opportunity here to demonstrate the computations with
time intervals that differ in size.
58 3 Computing Integrals

Fig. 3.1 The integral of v.t / interpreted as the area under the graph of v

Fig. 3.2 Computing approximately the integral of a function as the sum of the areas of the trape-
zoids
3.2 The Composite Trapezoidal Rule 59

The areas of the 4 trapezoids shown in Fig. 3.2 now constitute our approximation
to the integral (3.7):

Z1    
v.0/ C v.0:2/ v.0:2/ C v.0:6/
v.t/dt  h1 C h2
2 2
0
   
v.0:6/ C v.0:8/ v.0:8/ C v.1:0/
C h3 C h4 ; (3.9)
2 2

where

h1 D .0:2  0:0/; (3.10)


h2 D .0:6  0:2/; (3.11)
h3 D .0:8  0:6/; (3.12)
h4 D .1:0  0:8/ (3.13)

3
With v.t/ D 3t 2 e t , each term in (3.9) is readily computed and our approximate
computation gives
Z1
v.t/dt  1:895 : (3.14)
0

Compared to the true answer of 1.718, this is off by about 10 %. However, note
that we used just 4 trapezoids to approximate the area. With more trapezoids, the
approximation would have become better, since the straight line segments in the
upper trapezoid side then would follow the graph more closely. Doing another hand
calculation with more trapezoids is not too tempting for a lazy human, though,
but it is a perfect job for a computer! Let us therefore derive the expressions for
approximating the integral by an arbitrary number of trapezoids.

3.2.1 The General Formula


Rb
For a given function f .x/, we want to approximate the integral a f .x/dx by n
trapezoids (of equal width). We start out with (3.5) and approximate each integral
on the right hand side with a single trapezoid. In detail,

Zb Zx1 Zx2 Zxn


f .x/ dx D f .x/dx C f .x/dx C : : : C f .x/dx;
a x0 x1 xn1
f .x0 / C f .x1 / f .x1 / C f .x2 /
h Ch [Link]
2 2
f .xn1 / C f .xn /
Ch (3.15)
2
60 3 Computing Integrals

By simplifying the right hand side of (3.15) we get

Zb
h
f .x/ dx  f .x0 / C 2f .x1 / C 2f .x2 / C : : : C 2f .xn1 / C f .xn / (3.16)
2
a

which is more compactly written as

Zb " #
1 X
n1
1
f .x/ dx  h f .x0 / C f .xi / C f .xn / : (3.17)
2 i D1
2
a

Composite integration rules


The word composite is often used when a numerical integration method is ap-
plied with more than one sub-interval. Strictly speaking then, writing, e.g., the
trapezoidal method, should imply the use of only a single trapezoid, while the
composite trapezoidal method is the most correct name when several trapezoids
are used. However, this naming convention is not always followed, so saying just
the trapezoidal method may point to a single trapezoid as well as the composite
rule with many trapezoids.

3.2.2 Implementation

Specific or general implementation? Suppose our primary goal was to compute


R1 3
the specific integral 0 v.t/dt with v.t/ D 3t 2 e t . First we played around with
a simple hand calculation to see what the method was about, before we (as one
often does in mathematics) developed a general formula (3.17) for the general or
Rb R1
abstract integral a f .x/dx. To solve our specific problem 0 v.t/dt we must
then apply the general formula (3.17) to the given data (function and integral limits)
in our problem. Although simple in principle, the practical steps are confusing for
many because the notation in the abstract problem in (3.17) differs from the notation
in our special problem. Clearly, the f , x, and h in (3.17) correspond to v, t, and
perhaps t for the trapezoid width in our special problem.

The programmers dilemma


1. Should we write a special program for the special integral, using the ideas
from the general rule (3.17), but replacing f by v, x by t, and h by t?
2. Should we implement the general method (3.17) as it stands in a general
function trapezoid(f, a, b, n) and solve the specific problem at hand
by a specialized call to this function?

Alternative 2 is always the best choice!

The first alternative in the box above sounds less abstract and therefore more
attractive to many. Nevertheless, as we hope will be evident from the examples,
the second alternative is actually the simplest and most reliable from both a math-
ematical and programming point of view. These authors will claim that the second
3.2 The Composite Trapezoidal Rule 61

alternative is the essence of the power of mathematics, while the first alternative is
the source of much confusion about mathematics!
Rb
Implementation with functions For the integral a f .x/dx computed by the for-
mula (3.17) we want the corresponding Python function trapezoid to take any f ,
a, b, and n as input and return the approximation to the integral.
We write a Python function trapezoidal in a file [Link] as close
as possible to the formula (3.17), making sure variable names correspond to the
mathematical notation:

def trapezoidal(f, a, b, n):


h = float(b-a)/n
result = 0.5*f(a) + 0.5*f(b)
for i in range(1, n):
result += f(a + i*h)
result *= h
return result

Solving our specific problem in a session Just having the trapezoidal func-
tion as the only content of a file [Link] automatically makes that file
a module that we can import and test in an interactive session:

>>> from trapezoidal import trapezoidal


>>> from math import exp
>>> v = lambda t: 3*(t**2)*exp(t**3)
>>> n = 4
>>> numerical = trapezoidal(v, 0, 1, n)
>>> numerical
1.9227167504675762

Let us compute the exact expression and the error in the approximation:

>>> V = lambda t: exp(t**3)


>>> exact = V(1) - V(0)
>>> exact - numerical
-0.20443492200853108

Is this error convincing? We can try a larger n:

>>> numerical = trapezoidal(v, 0, 1, n=400)


>>> exact - numerical
-2.1236490512777095e-05

Fortunately, many more trapezoids give a much smaller error.

Solving our specific problem in a program Instead of computing our special


problem in an interactive session, we can do it in a program. As always, a chunk
of code doing a particular thing is best isolated as a function even if we do not see
any future reason to call the function several times and even if we have no need for
arguments to parameterize what goes on inside the function. In the present case,
62 3 Computing Integrals

we just put the statements we otherwise would have put in a main program, inside
a function:

def application():
from math import exp
v = lambda t: 3*(t**2)*exp(t**3)
n = input(n: )
numerical = trapezoidal(v, 0, 1, n)

# Compare with exact result


V = lambda t: exp(t**3)
exact = V(1) - V(0)
error = exact - numerical
print n=%d: %.16f, error: %g % (n, numerical, error)

Now we compute our special problem by calling application() as the only state-
ment in the main program. Both the trapezoidal and application functions
reside in the file [Link], which can be run as

Terminal

Terminal> python [Link]


n: 4
n=4: 1.9227167504675762, error: -0.204435

3.2.3 Making a Module

When we have the different pieces of our program as a collection of functions, it


is very straightforward to create a module that can be imported in other programs.
That is, having our code as a module, means that the trapezoidal function can
easily be reused by other programs to solve other problems. The requirements of
a module are simple: put everything inside functions and let function calls in the
main program be in the so-called test block:

if __name__ == __main__:
application()

The if test is true if the module file, [Link], is run as a program


and false if the module is imported in another program. Consequently, when we
do from trapezoidal import trapezoidal in some file, the test fails and
application() is not called, i.e., our special problem is not solved and will not
print anything on the screen. On the other hand, if we run [Link] in the
terminal window, the test condition is positive, application() is called, and we
get output in the window:

Terminal

Terminal> python [Link]


n: 400
n=400: 1.7183030649495579, error: -2.12365e-05
3.2 The Composite Trapezoidal Rule 63

3.2.4 Alternative Flat Special-Purpose Implementation

Let us illustrate the implementation implied by alternative 1 in the Programmers


dilemma box in Sect. 3.2.2. That is, we make a special-purpose code where we
R1 3
adapt the general formula (3.17) to the specific problem 0 3t 2 e t dt.
Basically, we use a for loop to compute the sum. Each term with f .x/ in the
3
formula (3.17) is replaced by 3t 2 e t , x by t, and h by t 1 . A first try at writing
a plain, flat program doing the special calculation is

from math import exp

a = 0.0; b = 1.0
n = input(n: )
dt = float(b - a)/n

# Integral by the trapezoidal method


numerical = 0.5*3*(a**2)*exp(a**3) + 0.5*3*(b**2)*exp(b**3)
for i in range(1, n):
numerical += 3*((a + i*dt)**2)*exp((a + i*dt)**3)
numerical *= dt

exact_value = exp(1**3) - exp(0**3)


error = abs(exact_value - numerical)
rel_error = (error/exact_value)*100
print n=%d: %.16f, error: %g % (n, numerical, error)

The problem with the above code is at least three-fold:

1. We need to reformulate (3.17) for our special problem with a different notation.
3
2. The integrand 3t 2 e t is inserted many times in the code, which quickly leads to
errors.
3. A lot of edits are necessary to use the code to compute a different integral
these edits are likely to introduce errors.

The potential errors involved in point 2 serve to illustrate how important it is to


use Python functions as mathematical functions. Here we have chosen to use the
lambda function to define the integrand as the variable v:

from math import exp

v = lambda t: 3*(t**2)*exp(t**3) # Function to be integrated


a = 0.0; b = 1.0
n = input(n: )
dt = float(b - a)/n

1
Replacing h by t is not strictly required as many use h as interval also along the time axis.
Nevertheless, t is an even more popular notation for a small time interval, so we adopt that
common notation.
64 3 Computing Integrals

# Integral by the trapezoidal method


numerical = 0.5*v(a) + 0.5*v(b)
for i in range(1, n):
numerical += v(a + i*dt)
numerical *= dt

F = lambda t: exp(t**3)
exact_value = F(b) - F(a)
error = abs(exact_value - numerical)
rel_error = (error/exact_value)*100
print n=%d: %.16f, error: %g % (n, numerical, error)

Unfortunately, the two other problems remain and they are fundamental.
R 1:1
Suppose you want to compute another integral, say 1 e x dx. How much do
2

we need to change in the previous code to compute the new integral? Not so much:

 the formula for v must be replaced by a new formula


 the limits a and b
 the anti-derivative V is not easily known2 and can be omitted, and therefore we
cannot write out the error
 the notation should be changed to be aligned with the new problem, i.e., t and
dt changed to x and h

These changes are straightforward to implement, but they are scattered around in
the program, a fact that requires us to be very careful so we do not introduce new
programming errors while we modify the code. It is also very easy to forget to make
a required change.
With the previous code in [Link], we can compute the new integral
R 1:1 x 2
1 e dx without touching the mathematical algorithm. In an interactive session
(or in a program) we can just do

>>> from trapezoidal import trapezoidal


>>> from math import exp
>>> trapezoidal(lambda x: exp(-x**2), -1, 1.1, 400)
1.5268823686123285

When you now look back at the two solutions, the flat special-purpose program
and the function-based program with the general-purpose function trapezoidal,
you hopefully realize that implementing a general mathematical algorithm in a gen-
eral function requires somewhat more abstract thinking, but the resulting code can
be used over and over again. Essentially, if you apply the flat special-purpose style,
you have to retest the implementation of the algorithm after every change of the
program.

You cannot integrate e x by hand, but this particular integral is appearing so often in so many
2 2

contexts that the integral is a special function, called the Error function ([Link]
wiki/Error_function) and written erf.x/. In a code, you can call erf(x). The erf function is
found in the math module.
3.3 The Composite Midpoint Method 65

The present integral problems result in short code. In more challenging engineer-
ing problems the code quickly grows to hundreds and thousands of lines. Without
abstractions in terms of general algorithms in general reusable functions, the com-
plexity of the program grows so fast that it will be extremely difficult to make sure
that the program works properly.
Another advantage of packaging mathematical algorithms in functions is that
a function can be reused by anyone to solve a problem by just calling the function
with a proper set of arguments. Understanding the functions inner details is not
necessary to compute a new integral. Similarly, you can find libraries of functions
on the Internet and use these functions to solve your problems without specific
knowledge of every mathematical detail in the functions.
This desirable feature has its downside, of course: the user of a function may
misuse it, and the function may contain programming errors and lead to wrong an-
swers. Testing the output of downloaded functions is therefore extremely important
before relying on the results.

3.3 The Composite Midpoint Method

The idea Rather than approximating the area under a curve by trapezoids, we can
use plain rectangles (Fig. 3.3). It may sound less accurate to use horizontal lines
and not skew lines following the function to be integrated, but an integration method
based on rectangles (the midpoint method) is in fact slightly more accurate than the
one based on trapezoids!

Fig. 3.3 Computing approximately the integral of a function as the sum of the areas of the rect-
angles
66 3 Computing Integrals

In the midpoint method, we construct a rectangle for every sub-interval where


the height equals f at the midpoint of the sub-interval. Let us do this for four
rectangles, using the same sub-intervals as we had for hand calculations with the
trapezoidal method: 0; 0:2/, 0:2; 0:6/, 0:6; 0:8/, and 0:8; 1:0. We get

Z1   
0 C 0:2 0:2 C 0:6
f .t/dt  h1 f C h2 f
2 2
0 (3.18)
   
0:6 C 0:8 0:8 C 1:0
C h3 f C h4 f ;
2 2

where h1 , h2 , h3 , and h4 are the widths of the sub-intervals, used previously with
the trapezoidal method and defined in (3.10)(3.13).
3
With f .t/ D 3t 2 e t , the approximation becomes 1.632. Compared with the true
answer (1.718), this is about 5 % too small, but it is better than what we got with
the trapezoidal method (10 %) with the same sub-intervals. More rectangles give
a better approximation.

3.3.1 The General Formula

Let us derive a formula for the midpoint method based on n rectangles of equal
width:

Zb Zx1 Zx2 Zxn


f .x/ dx D f .x/dx C f .x/dx C : : : C f .x/dx;
a x0 x1 xn1
     
x0 C x1 x1 C x2xn1 C xn
 hf C hf C : : : C hf ;
2 2 2
(3.19)
      
x0 C x1 x1 C x2 xn1 C xn
h f Cf [Link] f :
2 2 2
(3.20)

This sum may be written more compactly as

Zb X
n1
f .x/dx  h f .xi /; (3.21)
a i D0

 
where xi D a C h2 C ih.
3.3 The Composite Midpoint Method 67

3.3.2 Implementation

We follow the advice and lessons learned from the implementation of the trape-
zoidal method and make a function midpoint(f, a, b, n) (in a file midpoint.
py) for implementing the general formula (3.21):

def midpoint(f, a, b, n):


h = float(b-a)/n
result = 0
for i in range(n):
result += f((a + h/2.0) + i*h)
result *= h
return result

We can test the function as we explained for the similar trapezoidal method.
R1 3
The error in our particular problem 0 3t 2 e t dt with four intervals is now about 0.1
in contrast to 0.2 for the trapezoidal rule. This is in fact not accidental: one can
show mathematically that the error of the midpoint method is a bit smaller than for
the trapezoidal method. The differences are seldom of any practical importance,
and on a laptop we can easily use n D 106 and get the answer with an error of about
1012 in a couple of seconds.

3.3.3 Comparing the Trapezoidal and the Midpoint Methods

The next example shows how easy we can combine the trapezoidal and
midpoint functions to make a comparison of the two methods in the file compare_
integration_methods.py:

from trapezoidal import trapezoidal


from midpoint import midpoint
from math import exp

g = lambda y: exp(-y**2)
a = 0
b = 2
print n midpoint trapezoidal
for i in range(1, 21):
n = 2**i
m = midpoint(g, a, b, n)
t = trapezoidal(g, a, b, n)
print %7d %.16f %.16f % (n, m, t)

Note the efforts put into nice formatting the output becomes

n midpoint trapezoidal
2 0.8842000076332692 0.8770372606158094
4 0.8827889485397279 0.8806186341245393
8 0.8822686991994210 0.8817037913321336
16 0.8821288703366458 0.8819862452657772
68 3 Computing Integrals

32 0.8820933014203766 0.8820575578012112
64 0.8820843709743319 0.8820754296107942
128 0.8820821359746071 0.8820799002925637
256 0.8820815770754198 0.8820810181335849
512 0.8820814373412922 0.8820812976045025
1024 0.8820814024071774 0.8820813674728968
2048 0.8820813936736116 0.8820813849400392
4096 0.8820813914902204 0.8820813893068272
8192 0.8820813909443684 0.8820813903985197
16384 0.8820813908079066 0.8820813906714446
32768 0.8820813907737911 0.8820813907396778
65536 0.8820813907652575 0.8820813907567422
131072 0.8820813907631487 0.8820813907610036
262144 0.8820813907625702 0.8820813907620528
524288 0.8820813907624605 0.8820813907623183
1048576 0.8820813907624268 0.8820813907623890

A visual inspection of the numbers shows how fast the digits stabilize in both meth-
ods. It appears that 13 digits have stabilized in the last two rows.

Remark
The trapezoidal and midpoint methods are just two examples in a jungle of nu-
merical integration rules. Other famous methods are Simpsons rule and Gauss
quadrature. They all work in the same way:

Zb X
n1
f .x/dx  wi f .xi / :
a i D0

That is, the integral is approximated by a sum of function evaluations, where


each evaluation f .xi / is given a weight wi . The different methods differ in the
way they construct the evaluation points xi and the weights wi . We have used
equally spaced points xi , but higher accuracy can be obtained by optimizing the
location of xi .

3.4 Testing

3.4.1 Problems with Brief Testing Procedures

Testing of the programs for numerical integration has so far employed two strate-
gies. If we have an exact answer, we compute the error and see that increasing
n decreases the error. When the exact answer is not available, we can (as in the
comparison example in the previous section) look at the integral values and see that
they stabilize as n grows. Unfortunately, these are very weak test procedures and
not at all satisfactory for claiming that the software we have produced is correctly
implemented.
To see this, we can introduce a bug in the application function that calls
3 3
trapezoidal: instead of integrating 3t 2 e t , we write accidentally 3t 3 e t , but
3
keep the same anti-derivative V .t/e t for computing the error. With the bug and
3.4 Testing 69

n D 4, the error is 0.1, but without the bug the error is 0.2! It is of course com-
pletely impossible to tell if 0.1 is the right value of the error. Fortunately, increasing
n shows that the error stays about 0.3 in the program with the bug, so the test pro-
cedure with increasing n and checking that the error decreases points to a problem
in the code.
Let us look at another bug, this time in the mathematical algorithm: instead
of computing 12 .f .a/ C f .b// as we should, we forget the second 12 and write
R 1:9 3
0.5*f(a) + f(b). The error for n D 4; 40; 400 when computing 1:1 3t 2 e t dt
goes like 1400, 107, 10, respectively, which looks promising. The problem is that
the right errors should be 369, 4.08, and 0.04. That is, the error should be reduced
faster in the correct than in the buggy code. The problem, however, is that it is
reduced in both codes, and we may stop further testing and believe everything is
correctly implemented.

Unit testing
A good habit is to test small pieces of a larger code individually, one at a time.
This is known as unit testing. One identifies a (small) unit of the code, and then
one makes a separate test for this unit. The unit test should be stand-alone in
the sense that it can be run without the outcome of other tests. Typically, one
algorithm in scientific programs is considered as a unit. The challenge with unit
tests in numerical computing is to deal with numerical approximation errors.
A fortunate side effect of unit testing is that the programmer is forced to use
functions to modularize the code into smaller, logical pieces.

3.4.2 Proper Test Procedures

There are three serious ways to test the implementation of numerical methods via
unit tests:

1. Comparing with hand-computed results in a problem with few arithmetic oper-


ations, i.e., small n.
2. Solving a problem without numerical errors. We know that the trapezoidal rule
must be exact for linear functions. The error produced by the program must then
be zero (to machine precision).
3. Demonstrating correct convergence rates. A strong test when we can compute
exact errors, is to see how fast the error goes to zero as n grows. In the trape-
zoidal and midpoint rules it is known that the error depends on n as n2 as
n ! 1.

Hand-computed results Let us use two trapezoids and compute the integral
R1 2 t3
0 v.t/, v.t/ D 3t e :

1 1
h.v.0/ C v.0:5// C h.v.0:5/ C v.1// D 2:463642041244344;
2 2
when h D 0:5 is the width of the two trapezoids. Running the program gives exactly
the same result.
70 3 Computing Integrals

Solving a problem without numerical errors The best unit tests for numerical
algorithms involve mathematical problems where we know the numerical result be-
forehand. Usually, numerical results contain unknown approximation errors, so
knowing the numerical result implies that we have a problem where the approx-
imation errors vanish. This feature may be present in very simple mathematical
problems. For example, the trapezoidal method is exact for integration of linear
functions f .x/ D ax C b. We can therefore pick some linear function and con-
struct a test function that checks equality between the exact analytical expression
for the integral and the number computed by the implementation of the trapezoidal
method. R 4:4
A specific test case can be 1:2 .6x  4/dx. This integral involves an arbitrary
interval 1:2; 4:4 and an arbitrary linear function f .x/ D 6x  4. By arbitrary
we mean expressions where we avoid the special numbers 0 and 1 since these have
special properties in arithmetic operations (e.g., forgetting to multiply is equivalent
to multiplying by 1, and forgetting to add is equivalent to adding 0).

Demonstrating correct convergence rates Normally, unit tests must be based on


problems where the numerical approximation errors in our implementation remain
unknown. However, we often know or may assume a certain asymptotic behavior
R1 3
of the error. We can do some experimental runs with the test problem 0 3t 2 e t dt
where n is doubled in each run: n D 4; 8; 16. The corresponding errors are then
12 %, 3 % and 0.77 %, respectively. These numbers indicate that the error is roughly
reduced by a factor of 4 when doubling n. Thus, the error converges to zero as n2
and we say that the convergence rate is 2. In fact, this result can also be shown
mathematically for the trapezoidal and midpoint method. Numerical integration
methods usually have an error that converge to zero as np for some p that depends
on the method. With such a result, it does not matter if we do not know what
the actual approximation error is: we know at what rate it is reduced, so running
the implementation for two or more different n values will put us in a position to
measure the expected rate and see if it is achieved.
The idea of a corresponding unit test is then to run the algorithm for some n
values, compute the error (the absolute value of the difference between the exact
analytical result and the one produced by the numerical method), and check that the
error has approximately correct asymptotic behavior, i.e., that the error is propor-
tional to n2 in case of the trapezoidal and midpoint method.
Let us develop a more precise method for such unit tests based on convergence
rates. We assume that the error E depends on n according to

E D C nr ;

where C is an unknown constant and r is the convergence rate. Consider a set


of experiments with various n: n0 ; n1 ; n2 ; : : : ; nq . We compute the corresponding
errors E0 ; : : : ; Eq . For two consecutive experiments, number i and i  1, we have
the error model

Ei D C nri ; (3.22)
Ei 1 D C nri1 : (3.23)
3.4 Testing 71

These are two equations for two unknowns C and r. We can easily eliminate C by
dividing the equations by each other. Then solving for r gives

[Link] =Ei 1 /
ri 1 D : (3.24)
[Link] =ni 1 /

We have introduced a subscript i  1 in r since the estimated value for r varies


with i. Hopefully, ri 1 approaches the correct convergence rate as the number of
intervals increases and i ! q.

3.4.3 Finite Precision of Floating-Point Numbers

The test procedures above lead to comparison of numbers for checking that calcu-
lations were correct. Such comparison is more complicated than what a newcomer
might think. Suppose we have a calculation a + b and want to check that the result
is what we expect. We start with 1 + 2:

>>> a = 1; b = 2; expected = 3
>>> a + b == expected
True

Then we proceed with 0.1 + 0.2:

>>> a = 0.1; b = 0.2; expected = 0.3


>>> a + b == expected
False

So why is 0:1 C 0:2 0:3? The reason is that real numbers cannot in general be
exactly represented on a computer. They must instead be approximated by a float-
ing-point number3 that can only store a finite amount of information, usually about
17 digits of a real number. Let us print 0.1, 0.2, 0.1 + 0.2, and 0.3 with 17 decimals:

>>> print %.17f\n%.17f\n%.17f\n%.17f % (0.1, 0.2, 0.1 + 0.2, 0.3)


0.10000000000000001
0.20000000000000001
0.30000000000000004
0.29999999999999999

We see that all of the numbers have an inaccurate digit in the 17th decimal place.
Because 0.1 C 0.2 evaluates to 0.30000000000000004 and 0.3 is represented as
0.29999999999999999, these two numbers are not equal. In general, real numbers
in Python have (at most) 16 correct decimals.
When we compute with real numbers, these numbers are inaccurately repre-
sented on the computer, and arithmetic operations with inaccurate numbers lead
to small rounding errors in the final results. Depending on the type of numerical
algorithm, the rounding errors may or may not accumulate.

3
[Link]
72 3 Computing Integrals

If we cannot make tests like 0.1 + 0.2 == 0.3, what should we then do? The
answer is that we must accept some small inaccuracy and make a test with a toler-
ance. Here is the recipe:

>>> a = 0.1; b = 0.2; expected = 0.3


>>> computed = a + b
>>> diff = abs(expected - computed)
>>> tol = 1E-15
>>> diff < tol
True

Here we have set the tolerance for comparison to 1015 , but calculating 0.3 -
(0.1 + 0.2) shows that it equals -5.55e-17, so a lower tolerance could be used
in this particular example. However, in other calculations we have little idea about
how accurate the answer is (there could be accumulation of rounding errors in more
complicated algorithms), so 1015 or 1014 are robust values. As we demonstrate
below, these tolerances depend on the magnitude of the numbers in the calculations.
Doing an experiment with 10k C 0:3  .10k C 0:1 C 0:2/ for k D 1; : : : ; 10
shows that the answer (which should be zero) is around 1016k . This means that
the tolerance must be larger if we compute with larger numbers. Setting a proper
tolerance therefore requires some experiments to see what level of accuracy one
can expect. A way out of this difficulty is to work with relative instead of absolute
differences. In a relative difference we divide by one of the operands, e.g.,

ab
a D 10k C 0:3; b D .10k C 0:1 C 0:2/; cD :
a

Computing this c for various k shows a value around 1016 . A safer procedure is
thus to use relative differences.

3.4.4 Constructing Unit Tests and Writing Test Functions

Python has several frameworks for automatically running and checking a potentially
very large number of tests for parts of your software by one command. This is an
extremely useful feature during program development: whenever you have done
some changes to one or more files, launch the test command and make sure nothing
is broken because of your edits.
The test frameworks nose and [Link] are particularly attractive as they are
very easy to use. Tests are placed in special test functions that the frameworks can
recognize and run for you. The requirements to a test function are simple:

 the name must start with test_


 the test function cannot have any arguments
 the tests inside test functions must be boolean expressions
 a boolean expression b must be tested with assert b, msg, where msg is an
optional object (string or number) to be written out when b is false
3.4 Testing 73

Suppose we have written a function

def add(a, b):


return a + b

A corresponding test function can then be

def test_add()
expected = 1 + 1
computed = add(1, 1)
assert computed == expected, 1+1=%g % computed

Test functions can be in any program file or in separate files, typically with names
starting with test. You can also collect tests in subdirectories: running [Link]
-s -v will actually run all tests in all test*.py files in all subdirectories, while
nosetests -s -v restricts the attention to subdirectories whose names start with
test or end with _test or _tests.
As long as we add integers, the equality test in the test_add function is appro-
priate, but if we try to call add(0.1, 0.2) instead, we will face the rounding error
problems explained in Sect. 3.4.3, and we must use a test with tolerance instead:

def test_add()
expected = 0.3
computed = add(0.1, 0.2)
tol = 1E-14
diff = abs(expected - computed)
assert diff < tol, diff=%g % diff

Below we shall write test functions for each of the three test procedures we
suggested: comparison with hand calculations, checking problems that can be ex-
actly solved, and checking convergence rates. We stick to testing the trapezoidal
integration code and collect all test functions in one common file by the name
test_trapezoidal.py.

Hand-computed numerical results Our previous hand calculations for two trape-
zoids can be checked against the trapezoidal function inside a test function (in
a file test_trapezoidal.py):

from trapezoidal import trapezoidal

def test_trapezoidal_one_exact_result():
"""Compare one hand-computed result."""
from math import exp
v = lambda t: 3*(t**2)*exp(t**3)
n = 2
computed = trapezoidal(v, 0, 1, n)
expected = 2.463642041244344
error = abs(expected - computed)
tol = 1E-14
success = error < tol
msg = error=%g > tol=%g % (errror, tol)
assert success, msg
74 3 Computing Integrals

Note the importance of checking err against exact with a tolerance: rounding
errors from the arithmetics inside trapezoidal will not make the result exactly
like the hand-computed one. The size of the tolerance is here set to 1014 , which is
a kind of all-round value for computations with numbers not deviating much from
unity.

Solving a problem without numerical errors We know that the trapezoidal rule
R 4:4
is exact for linear integrands. Choosing the integral 1:2 .6x  4/dx as test case, the
corresponding test function for this unit test may look like

def test_trapezoidal_linear():
"""Check that linear functions are integrated exactly."""
f = lambda x: 6*x - 4
F = lambda x: 3*x**2 - 4*x # Anti-derivative
a = 1.2; b = 4.4
expected = F(b) - F(a)
tol = 1E-14
for n in 2, 20, 21:
computed = trapezoidal(f, a, b, n)
error = abs(expected - computed)
success = error < tol
msg = n=%d, err=%g % (n, error)
assert success, msg

Demonstrating correct convergence rates In the present example with integra-


tion, it is known that the approximation errors in the trapezoidal rule are propor-
tional to n2 , n being the number of subintervals used in the composite rule.
Computing convergence rates requires somewhat more tedious programming
than the previous tests, but can be applied to more general integrands. The al-
gorithm typically goes like

 for i D 0; 1; 2; : : : ; q
ni D 2i C1
Compute integral with ni intervals
Compute the error Ei
Estimate ri from (3.24) if i > 0

The corresponding code may look like

def convergence_rates(f, F, a, b, num_experiments=14):


from math import log
from numpy import zeros
expected = F(b) - F(a)
n = zeros(num_experiments, dtype=int)
E = zeros(num_experiments)
r = zeros(num_experiments-1)
for i in range(num_experiments):
n[i] = 2**(i+1)
computed = trapezoidal(f, a, b, n[i])
E[i] = abs(expected - computed)
if i > 0:
r_im1 = log(E[i]/E[i-1])/log(float(n[i])/n[i-1])
r[i-1] = float(%.2f % r_im1) # Truncate to two decimals
return r
3.4 Testing 75

Making a test function is a matter of choosing f, F, a, and b, and then checking


the value of ri for the largest i:

def test_trapezoidal_conv_rate():
"""Check empirical convergence rates against the expected -2."""
from math import exp
v = lambda t: 3*(t**2)*exp(t**3)
V = lambda t: exp(t**3)
a = 1.1; b = 1.9
r = convergence_rates(v, V, a, b, 14)
print r
tol = 0.01
msg = str(r[-4:]) # show last 4 estimated rates
assert (abs(r[-1]) - 2) < tol, msg

Running the test shows that all ri , except the first one, equal the target limit 2
within two decimals. This observation suggest a tolerance of 102 .

Remark about version control of files


Having a suite of test functions for automatically checking that your soft-
ware works is considered as a fundamental requirement for reliable computing.
Equally important is a system that can keep track of different versions of the files
and the tests, known as a version control system. Todays most popular version
control system is Git4 , which the authors strongly recommend the reader to use
for programming and writing reports. The combination of Git and cloud storage
such as GitHub is a very common way of organizing scientific or engineering
work. We have a quick intro5 to Git and GitHub that gets you up and running
within minutes.
The typical workflow with Git goes as follows.

1. Before you start working with files, make sure you have the latest version of
them by running git pull.
2. Edit files, remove or create files (new files must be registered by git add).
3. When a natural piece of work is done, commit your changes by the git
commit command.
4. Implement your changes also in the cloud by doing git push.

A nice feature of Git is that people can edit the same file at the same time and
very often Git will be able to automatically merge the changes (!). Therefore,
version control is crucial when you work with others or when you do your work
on different types of computers. Another key feature is that anyone can at any
time view the history of a file, see who did what when, and roll back the entire
file collection to a previous commit. This feature is, of course, fundamental for
reliable work.

4
[Link]
5
[Link]
76 3 Computing Integrals

3.5 Vectorization

The functions midpoint and trapezoid usually run fast in Python and compute
an integral to a satisfactory precision within a fraction of a second. However, long
loops in Python may run slowly in more complicated implementations. To increase
the speed, the loops can be replaced by vectorized code. The integration functions
constitute a simple and good example to illustrate how to vectorize loops.
We have already seen simple examples on vectorization in Sect. 1.4 when we
could evaluate a mathematical function f .x/ for a large number of x values stored
in an array. Basically, we can write

def f(x):
return exp(-x)*sin(x) + 5*x

from numpy import exp, sin, linspace


x = linspace(0, 4, 101) # coordinates from 100 intervals on [0, 4]
y = f(x) # all points evaluated at once

The result y is the array that would be computed if we ran a for loop over the
individual x values and called f for each value. Vectorization essentially eliminates
this loop in Python (i.e., the looping over x and application of f to each x value are
instead performed in a library with fast, compiled code).

Vectorizing the midpoint rule The aim of vectorizing the midpoint and
trapezoidal functions is also to remove the explicit loop in Python. We start
with vectorizing the midpoint function since trapezoid is not equally straight-
forward. The fundamental ideas of the vectorized algorithm are to

1. compute all the evaluation points in one array x


2. call f(x) to produce an array of corresponding function values
3. use the sum function to sum the f(x) values

The evaluation points in the midpoint method are xi D a C.i C 12 /h, i D 0; : : : ; n


1. That is, n uniformly distributed coordinates between a C h=2 and b  h=2. Such
coordinates can be calculated by x = linspace(a+h/2, b-h/2, n). Given that
the Python implementation f of the mathematical function f works with an array
argument, which is very often the case in Python, f(x) will produce all the function
values in an array. The array elements are then summed up by sum: sum(f(x)).
This sum is to be multiplied by the rectangle width h to produce the integral value.
The complete function is listed below.

from numpy import linspace, sum

def midpoint(f, a, b, n):


h = float(b-a)/n
x = linspace(a + h/2, b - h/2, n)
return h*sum(f(x))

The code is found in the file integration_methods_vec.py.


3.6 Measuring Computational Speed 77

R1
Let us test the code interactively in a Python shell to compute 0 3t 2 dt. The file
with the code above has the name integration_methods_vec.py and is a valid
module from which we can import the vectorized function:

>>> from integration_methods_vec import midpoint


>>> from numpy import exp
>>> v = lambda t: 3*t**2*exp(t**3)
>>> midpoint(v, 0, 1, 10)
1.7014827690091872

Note the necessity to use exp from numpy: our v function will be called with x as
an array, and the exp function must be capable of working with an array.
The vectorized code performs all loops very efficiently in compiled code, result-
ing in much faster execution. Moreover, many readers of the code will also say that
the algorithm looks clearer than in the loop-based implementation.

Vectorizing the trapezoidal rule We can use the same approach to vectorize the
trapezoid function. However, the trapezoidal rule performs a sum where the end
points have different weight. If we do sum(f(x)), we get the end points f(a) and
f(b) with weight unity instead of one half. A remedy is to subtract the error from
sum(f(x)): sum(f(x)) - 0.5*f(a) - 0.5*f(b). The vectorized version of
the trapezoidal method then becomes

def trapezoidal(f, a, b, n):


h = float(b-a)/n
x = linspace(a, b, n+1)
s = sum(f(x)) - 0.5*f(a) - 0.5*f(b)
return h*s

3.6 Measuring Computational Speed

Now that we have created faster, vectorized versions of functions in the previous
section, it is interesting to measure how much faster they are. The purpose of the
present section is therefore to explain how we can record the CPU time consumed
by a function so we can answer this question. There are many techniques for mea-
suring the CPU time in Python, and here we shall just explain the simplest and most
convenient one: the %timeit command in IPython. The following interactive ses-
sion should illustrate a competition where the vectorized versions of the functions
are supposed to win:

In [1]: from integration_methods_vec import midpoint as midpoint_vec

In [3]: from midpoint import midpoint

In [4]: from numpy import exp

In [5]: v = lambda t: 3*t**2*exp(t**3)


78 3 Computing Integrals

In [6]: %timeit midpoint_vec(v, 0, 1, 1000000)


1 loops, best of 3: 379 ms per loop

In [7]: %timeit midpoint(v, 0, 1, 1000000)


1 loops, best of 3: 8.17 s per loop

In [8]: 8.17/(379*0.001) # efficiency factor


Out[8]: 21.556728232189972

We see that the vectorized version is about 20 times faster: 379 ms versus 8.17 s.
The results for the trapezoidal method are very similar, and the factor of about 20 is
independent of the number of intervals.

3.7 Double and Triple Integrals

3.7.1 The Midpoint Rule for a Double Integral

Given a double integral over a rectangular domain a; b  c; d ,

Zb Zd
f .x; y/dydx;
a c

how can we approximate this integral by numerical methods?

Derivation via one-dimensional integrals Since we know how to deal with in-
tegrals in one variable, a fruitful approach is to view the double integral as two
integrals, each in one variable, which can be approximated numerically by previous
one-dimensional formulas. To this end, we introduce a help function g.x/ and write

Zb Zd Zb Zd
f .x; y/dydx D g.x/dx; g.x/ D f .x; y/dy :
a c a c

Each of the integrals

Zb Zd
g.x/dx; g.x/ D f .x; y/dy
a c

can be discretized by any numerical integration rule for an integral in one variable.
Rd
Let us use the midpoint method (3.21) and start with g.x/ D c f .x; y/dy. We
introduce ny intervals on c; d  with length hy . The midpoint rule for this integral
then becomes

Zd ny 1
X 1
g.x/ D f .x; y/dy  hy f .x; yj /; yj D c C hy C j hy :
j D0
2
c
3.7 Double and Triple Integrals 79

The expression looks somewhat different from (3.21), but that is because of the
notation: since we integrate in the y direction and will have to work with both x
and y as coordinates, we must use ny for n, hy for h, and the counter i is more
naturally called j when integrating in y. Integrals in the x direction will use hx and
nx for h and n, and i as counter.
Rb
The double integral is a g.x/dx, which can be approximated by the midpoint
method:
Zb nXx 1
1
g.x/dx  hx [Link] /; xi D a C hx C ihx :
i D0
2
a
Putting the formulas together, we arrive at the composite midpoint method for a dou-
ble integral:
Zb Zd x 1
nX ny 1
X
f .x; y/dydx  hx hy f .xi ; yj /
a c i D0 j D0

x 1 n
nX Xy 1  
hx hy
D hx hy f aC C ihx ; c C C j hy :
i D0 j D0
2 2
(3.25)

Direct derivation The formula (3.25) can also be derived directly in the two-
dimensional case by applying the idea of the midpoint method. We divide the
rectangle a; b  c; d  into nx  ny equal-sized cells. The idea of the midpoint
method is to approximate f by a constant over each cell, and evaluate the constant
at the midpoint. Cell .i; j / occupies the area

a C ihx ; a C .i C 1/hx   c C j hy ; c C .j C 1/hy ;

and the midpoint is .xi ; yj / with


1 1
xi D a C ihx C hx ; yj D c C j hy C hy :
2 2
The integral over the cell is therefore hx hy f .xi ; yj /, and the total double integral
is the sum over all cells, which is nothing but formula (3.25).

Programming a double sum The formula (3.25) involves a double sum, which
is normally implemented as a double for loop. A Python function implementing
(3.25) may look like

def midpoint_double1(f, a, b, c, d, nx, ny):


hx = (b - a)/float(nx)
hy = (d - c)/float(ny)
I = 0
for i in range(nx):
for j in range(ny):
xi = a + hx/2 + i*hx
yj = c + hy/2 + j*hy
I += hx*hy*f(xi, yj)
return I
80 3 Computing Integrals

If this function is stored in a module file midpoint_double.py, we can compute


R3R2
some integral, e.g., 2 0 .2x Cy/dxdy D 9 in an interactive shell and demonstrate
that the function computes the right number:

>>> from midpoint_double import midpoint_double1


>>> def f(x, y):
... return 2*x + y
...
>>> midpoint_double1(f, 0, 2, 2, 3, 5, 5)
9.0

Reusing code for one-dimensional integrals It is very natural to write a two-


dimensional midpoint method as we did in function midpoint_double1 when we
have the formula (3.25). However, we could alternatively ask, much as we did in
the mathematics, can we reuse a well-tested implementation for one-dimensional
integrals to compute double integrals? That is, can we use function midpoint

def midpoint(f, a, b, n):


h = float(b-a)/n
result = 0
for i in range(n):
result += f((a + h/2.0) + i*h)
result *= h
return result

from Sect. 3.3.2 twice? The answer is yes, if we think as we did in the mathemat-
ics: compute the double integral as a midpoint rule for integrating g.x/ and define
[Link] / in terms of a midpoint rule over f in the y coordinate. The corresponding
function has very short code:

def midpoint_double2(f, a, b, c, d, nx, ny):


def g(x):
return midpoint(lambda y: f(x, y), c, d, ny)

return midpoint(g, a, b, nx)

The important advantage of this implementation is that we reuse a well-tested func-


tion for the standard one-dimensional midpoint rule and that we apply the one-
dimensional rule exactly as in the mathematics.

Verification via test functions How can we test that our functions for the dou-
ble integral work? The best unit test is to find a problem where the numerical
approximation error vanishes because then we know exactly what the numerical
answer should be. The midpoint rule is exact for linear functions, regardless of how
many subinterval we use. Also, any linear two-dimensional function f .x; y/ D
px C qy C r will be integrated exactly by the two-dimensional midpoint rule. We
may pick f .x; y/ D 2x C y and create a proper test function that can automatically
verify our two alternative implementations of the two-dimensional midpoint rule.
To compute the integral of f .x; y/ we take advantage of SymPy to eliminate the
possibility of errors in hand calculations. The test function becomes
3.7 Double and Triple Integrals 81

def test_midpoint_double():
"""Test that a linear function is integrated exactly."""
def f(x, y):
return 2*x + y

a = 0; b = 2; c = 2; d = 3
import sympy
x, y = [Link](x y)
I_expected = [Link](f(x, y), (x, a, b), (y, c, d))
# Test three cases: nx < ny, nx = ny, nx > ny
for nx, ny in (3, 5), (4, 4), (5, 3):
I_computed1 = midpoint_double1(f, a, b, c, d, nx, ny)
I_computed2 = midpoint_double2(f, a, b, c, d, nx, ny)
tol = 1E-14
#print I_expected, I_computed1, I_computed2
assert abs(I_computed1 - I_expected) < tol
assert abs(I_computed2 - I_expected) < tol

Let test functions speak up?


If we call the above test_midpoint_double function and nothing happens, our
implementations are correct. However, it is somewhat annoying to have a func-
tion that is completely silent when it works are we sure all things are properly
computed? During development it is therefore highly recommended to insert
a print statement such that we can monitor the calculations and be convinced
that the test function does what we want. Since a test function should not have
any print statement, we simply comment it out as we have done in the function
listed above.

The trapezoidal method can be used as alternative for the midpoint method. The
derivation of a formula for the double integral and the implementations follow ex-
actly the same ideas as we explained with the midpoint method, but there are more
terms to write in the formulas. Exercise 3.13 asks you to carry out the details.
That exercise is a very good test on your understanding of the mathematical and
programming ideas in the present section.

3.7.2 The Midpoint Rule for a Triple Integral

Theory Once a method that works for a one-dimensional problem is generalized


to two dimensions, it is usually quite straightforward to extend the method to three
dimensions. This will now be demonstrated for integrals. We have the triple integral

Zb Zd Zf
g.x; y; z/dzdydx
a c e
82 3 Computing Integrals

and want to approximate the integral by a midpoint rule. Following the ideas for
the double integral, we split this integral into one-dimensional integrals:

Zf
p.x; y/ D g.x; y; z/dz
e
Zd
q.x/ D p.x; y/dy
c
Zb Zd Zf Zb
g.x; y; z/dzdydx D q.x/dx
a c e a

For each of these one-dimensional integrals we apply the midpoint rule:

Zf z 1
nX
p.x; y/ D g.x; y; z/dz  g.x; y; zk /;
e kD0

Zd ny 1
X
q.x/ D p.x; y/dy  p.x; yj /;
c j D0

Zb Zd Zf Zb x 1
nX
g.x; y; z/dzdydx D q.x/dx  [Link] /;
a c e a i D0

where
1 1 1
zk D e C hz C khz ; yj D c C hy C j hy xi D a C hx C ihx :
2 2 2
Rb Rd Rf
Starting with the formula for a c e g.x; y; z/dzdydx and inserting the two
previous formulas gives

Zb Zd Zf
g.x; y; z/ dzdydx
a c e
x 1 n
nX Xy 1 nz 1
X  
1 1 1
 hx hy hz g a C hx C ihx ; c C hy C j hy ; e C hz C khz :
i D0 j D0 kD0
2 2 2
(3.26)
Note that we may apply the ideas under Direct derivation at the end of Sect. 3.7.1
to arrive at (3.26) directly: divide the domain into nx  ny  nz cells of volumes
hx hy hz ; approximate g by a constant, evaluated at the midpoint .xi ; yj ; zk /, in each
cell; and sum the cell integrals hx hy hz [Link] ; yj ; zk /.
3.7 Double and Triple Integrals 83

Implementation We follow the ideas for the implementations of the midpoint rule
for a double integral. The corresponding functions are shown below and found in
the file midpoint_triple.py.

def midpoint_triple1(g, a, b, c, d, e, f, nx, ny, nz):


hx = (b - a)/float(nx)
hy = (d - c)/float(ny)
hz = (f - e)/float(nz)
I = 0
for i in range(nx):
for j in range(ny):
for k in range(nz):
xi = a + hx/2 + i*hx
yj = c + hy/2 + j*hy
zk = e + hz/2 + k*hz
I += hx*hy*hz*g(xi, yj, zk)
return I

def midpoint(f, a, b, n):


h = float(b-a)/n
result = 0
for i in range(n):
result += f((a + h/2.0) + i*h)
result *= h
return result

def midpoint_triple2(g, a, b, c, d, e, f, nx, ny, nz):


def p(x, y):
return midpoint(lambda z: g(x, y, z), e, f, nz)

def q(x):
return midpoint(lambda y: p(x, y), c, d, ny)

return midpoint(q, a, b, nx)

def test_midpoint_triple():
"""Test that a linear function is integrated exactly."""
def g(x, y, z):
return 2*x + y - 4*z

a = 0; b = 2; c = 2; d = 3; e = -1; f = 2
import sympy
x, y, z = [Link](x y z)
I_expected = [Link](
g(x, y, z), (x, a, b), (y, c, d), (z, e, f))
for nx, ny, nz in (3, 5, 2), (4, 4, 4), (5, 3, 6):
I_computed1 = midpoint_triple1(
g, a, b, c, d, e, f, nx, ny, nz)
I_computed2 = midpoint_triple2(
g, a, b, c, d, e, f, nx, ny, nz)
tol = 1E-14
print I_expected, I_computed1, I_computed2
assert abs(I_computed1 - I_expected) < tol
assert abs(I_computed2 - I_expected) < tol

if __name__ == __main__:
test_midpoint_triple()
84 3 Computing Integrals

3.7.3 Monte Carlo Integration for Complex-Shaped Domains

Repeated use of one-dimensional integration rules to handle double and triple inte-
grals constitute a working strategy only if the integration domain is a rectangle or
box. For any other shape of domain, completely different methods must be used.
A common approach for two- and three-dimensional domains is to divide the do-
main into many small triangles or tetrahedra and use numerical integration methods
for each triangle or tetrahedron. The overall algorithm and implementation is too
complicated to be addressed in this book. Instead, we shall employ an alternative,
very simple and general method, called Monte Carlo integration. It can be im-
plemented in half a page of code, but requires orders of magnitude more function
evaluations in double integrals compared to the midpoint rule.
However, Monte Carlo integration is much more computationally efficient than
the midpoint rule when computing higher-dimensional integrals in more than three
variables over hypercube domains. Our ideas for double and triple integrals can
easily be generalized to handle an integral in m variables. A midpoint formula then
involves m sums. With n cells in each coordinate direction, the formula requires
nm function evaluations. That is, the computational work explodes as an exponen-
tial function of the number of space dimensions. Monte Carlo integration, on the
other hand, does not suffer from this explosion of computational work and is the
preferred method for computing higher-dimensional integrals. So, it makes sense
in a chapter on numerical integration to address Monte Carlo methods, both for
handling complex domains and for handling integrals with many variables.

The Monte Carlo integration algorithm The idea of Monte Carlo integration of
Rb
a f .x/dx
Rb
is to use the mean-value theorem from calculus, which states that the
integral a f .x/dx equals the length of the integration domain, here ba, times the
average value of f , fN, in a; b. The average value can be computed by sampling
f at a set of random points inside the domain and take the mean of the function
values. In higher dimensions, an integral is estimated as the area/volume of the
domain times the average value, and again one can evaluate the integrand at a set of
random points in the domain and compute the mean value of those evaluations.
Let us introduce some quantities to help us make the specification of the integra-
tion algorithm more precise. Suppose we have some two-dimensional integral
Z
f .x; y/dxdx;

where is a two-dimensional domain defined via a help function g.x; y/:

D f.x; y/ j g.x; y/  0g

That is, points .x; y/ for which g.x; y/  0 lie inside , and points for which
g.x; y/ < are outside . The boundary of the domain @ is given by the im-
plicit curve g.x; y/ D 0. Such formulations of geometries have been very common
during the last couple of decades, and one refers to g as a level-set function and the
3.7 Double and Triple Integrals 85

boundary g D 0 as the zero-level contour of the level-set function. For simple ge-
ometries one can easily construct g by hand, while in more complicated industrial
applications one must resort to mathematical models for constructing g.
Let A./ be the area of a domain . We can estimate the integral by this Monte
Carlo integration method:

1. embed the geometry in a rectangular area R


2. draw a large number of random points .x; y/ in R
3. count the fraction q of points that are inside
4. approximate A./=A.R/ by q, i.e., set A./ D qA.R/
5. evaluate the mean of f , fN, at the points inside
6. estimate the integral as A./fN

Note that A.R/ is trivial to compute since R is a rectangle, while A./ is unknown.
However, if we assume that the fraction of A.R/ occupied by A./ is the same as
the fraction of random points inside , we get a simple estimate for A./.
To get an idea of the method, consider a circular domain embedded in a rect-
angle as shown below. A collection of random points is illustrated by black dots.

R
Implementation A Python function implementing f .x; y/dxdy can be written
like this:

import numpy as np

def MonteCarlo_double(f, g, x0, x1, y0, y1, n):


"""
Monte Carlo integration of f over a domain g>=0, embedded
in a rectangle [x0,x1]x[y0,y1]. n^2 is the number of
random points.
"""
86 3 Computing Integrals

# Draw n**2 random points in the rectangle


x = [Link](x0, x1, n)
y = [Link](y0, y1, n)
# Compute sum of f values inside the integration domain
f_mean = 0
num_inside = 0 # number of x,y points inside domain (g>=0)
for i in range(len(x)):
for j in range(len(y)):
if g(x[i], y[j]) >= 0:
num_inside += 1
f_mean += f(x[i], y[j])
f_mean = f_mean/float(num_inside)
area = num_inside/float(n**2)*(x1 - x0)*(y1 - y0)
return area*f_mean

(See the file MC_double.py.)

Verification A simple test case is to check the area of a rectangle 0; 2  3; 4:5


embedded in a rectangle 0; 3  2; 5. The right answer is 3, but Monte Carlo
integration is, unfortunately, never exact so it is impossible to predict the output of
the algorithm. All we know is that the estimated integral should approach 3 as the
number of random points goes to infinity. Also, for a fixed number of points, we
can run the algorithm several times and get different numbers that fluctuate around
the exact value, since different sample points are used in different calls to the Monte
Carlo integration algorithm.
R 2 R 4:5
The area of the rectangle can be computed by the integral 0 3 dydx, so in
this case we identify f .x; y/ D 1, and the g function can be specified as (e.g.) 1
if .x; y/ is inside 0; 2  3; 4:5 and 1 otherwise. Here is an example on how
we can utilize the MonteCarlo_double function to compute the area for different
number of samples:

>>> from MC_double import MonteCarlo_double


>>> def g(x, y):
... return (1 if (0 <= x <= 2 and 3 <= y <= 4.5) else -1)
...
>>> MonteCarlo_double(lambda x, y: 1, g, 0, 3, 2, 5, 100)
2.9484
>>> MonteCarlo_double(lambda x, y: 1, g, 0, 3, 2, 5, 1000)
2.947032
>>> MonteCarlo_double(lambda x, y: 1, g, 0, 3, 2, 5, 1000)
3.0234600000000005
>>> MonteCarlo_double(lambda x, y: 1, g, 0, 3, 2, 5, 2000)
2.9984580000000003
>>> MonteCarlo_double(lambda x, y: 1, g, 0, 3, 2, 5, 2000)
3.1903469999999996
>>> MonteCarlo_double(lambda x, y: 1, g, 0, 3, 2, 5, 5000)
2.986515

We see that the values fluctuate around 3, a fact that supports a correct implemen-
tation, but in principle, bugs could be hidden behind the inaccurate answers.
It is mathematically known that the standard deviation of the Monte Carlo es-
timate of an integral converges as n1=2 , where n is the number of samples. This
3.7 Double and Triple Integrals 87

kind of convergence rate estimate could be used to verify the implementation, but
this topic is beyond the scope of this book.

Test function for function with random numbers To make a test function, we
need a unit test that has identical behavior each time we run the test. This seems
difficult when random numbers are involved, because these numbers are different
every time we run the algorithm, and each run hence produces a (slightly) different
result. A standard way to test algorithms involving random numbers is to fix the
seed of the random number generator. Then the sequence of numbers is the same
every time we run the algorithm. Assuming that the MonteCarlo_double function
works, we fix the seed, observe a certain result, and take this result as the correct
result. Provided the test function always uses this seed, we should get exactly this
result every time the MonteCarlo_double function is called. Our test function can
then be written as shown below.

def test_MonteCarlo_double_rectangle_area():
"""Check the area of a rectangle."""
def g(x, y):
return (1 if (0 <= x <= 2 and 3 <= y <= 4.5) else -1)

x0 = 0; x1 = 3; y0 = 2; y1 = 5 # embedded rectangle
n = 1000
[Link](8) # must fix the seed!
I_expected = 3.121092 # computed with this seed
I_computed = MonteCarlo_double(
lambda x, y: 1, g, x0, x1, y0, y1, n)
assert abs(I_expected - I_computed) < 1E-14

(See the file MC_double.py.)

Integral over a circle The test above involves a trivial function f .x; y/ D 1. We
should also test a non-constant f function and a more p complicated domain. Let
be a circle at the origin with radius 2, and let f D x 2 C Ry 2 . This choice makes it
possible to compute an exact result: in polar coordinates, f .x; y/dxdy simpli-
R2
fies to 2 0 r 2 dr D 16=3. We must be prepared for quite crude approximations
that fluctuate around this exact result. As in the test case above, we experience bet-
ter results with larger number of points. When we have such evidence for a working
implementation, we can turn the test into a proper test function. Here is an example:

def test_MonteCarlo_double_circle_r():
"""Check the integral of r over a circle with radius 2."""
def g(x, y):
xc, yc = 0, 0 # center
R = 2 # radius
return R**2 - ((x-xc)**2 + (y-yc)**2)

# Exact: integral of r*r*dr over circle with radius R becomes


# 2*pi*1/3*R**3
import sympy
r = [Link](r)
I_exact = [Link](2*[Link]*r*r, (r, 0, 2))
88 3 Computing Integrals

print Exact integral:, I_exact.evalf()


x0 = -2; x1 = 2; y0 = -2; y1 = 2
n = 1000
[Link](6)
I_expected = 16.7970837117376384 # Computed with this seed
I_computed = MonteCarlo_double(
lambda x, y: [Link](x**2 + y**2),
g, x0, x1, y0, y1, n)
print MC approximation %d samples): %.16f % (n**2, I_computed)
assert abs(I_expected - I_computed) < 1E-15

(See the file MC_double.py.)

3.8 Exercises

Exercise 3.1: Hand calculations for the trapezoidal method


Compute by hand the area composed of two trapezoids (of equal width) that ap-
R3
proximates the integral 1 2x 3 dx. Make a test function that calls the trapezoidal
function in [Link] and compares the return value with the hand-
calculated value.
Filename: trapezoidal_test_func.py.

Exercise 3.2: Hand calculations for the midpoint method


Compute by hand the area composed of two rectangles (of equal width) that ap-
R3
proximates the integral 1 2x 3 dx. Make a test function that calls the midpoint
function in [Link] and compares the return value with the hand-calculated
value.
Filename: midpoint_test_func.py.

Exercise 3.3: Compute a simple integral


R6
Apply the trapezoidal and midpoint functions to compute the integral 2 x.x 
1/dx with 2 and 100 subintervals. Compute the error too.
Filename: integrate_parabola.py.

Exercise 3.4: Hand-calculations with sine integrals


Rb
We consider integrating the sine function: 0 sin.x/dx.

a) Let b D  and use two intervals in the trapezoidal and midpoint method.
Compute the integral by hand and illustrate how the two numerical methods
approximates the integral. Compare with the exact value.
b) Do a) when b D 2.

Filename: integrate_sine.pdf.

Exercise 3.5: Make test functions for the midpoint method


Modify the file test_trapezoidal.py such that the three tests are applied to the
function midpoint implementing the midpoint method for integration.
Filename: test_midpoint.py.
3.8 Exercises 89

Exercise 3.6: Explore rounding errors with large numbers


The trapezoidal method integrates linear functions exactly, and this property
was used in the test function test_trapezoidal_linear in the file test_
[Link]. Change the function used in Sect. 3.4.2 to f .x/ D 6  108 x 
4  106 and rerun the test. What happens? How must you change the test to make it
useful? How does the convergence rate test behave? Any need for adjustment?
Filename: test_trapezoidal2.py.
R4p
Exercise 3.7: Write test functions for 0 xdx
R4p
We want to test how the trapezoidal function works for the integral 0 xdx.
Two of the tests in test_trapezoidal.py are meaningful for this integral.
Compute by hand the result of using 2 or 3 trapezoids and modify the test_
trapezoidal_one_exact_result function accordingly. Then modify test_
trapezoidal_conv_rate to handle the square root integral.
Filename: test_trapezoidal3.py.

Remarks The convergence rate test fails. Printing out r shows that the actual con-
vergence rate for this integral is 1:5 and not 2. The reason is that the error in the
trapezoidal
p method
6
is .b  a/3 n2 f 00 ./ for some (unknown)  2 a; b. With
00
f .x/ D x, f ./ ! 1 as  ! 0, pointing to a potential problem in the size
R4 p
of the error. Running a test with a > 0, say 0:1 xdx shows that the convergence
rate is indeed restored to 2.

Exercise 3.8: Rectangle methods


The midpoint method divides the interval of integration into equal-sized subinter-
vals and approximates the integral in each subinterval by a rectangle whose height
equals the function value at the midpoint of the subinterval. Instead, one might use
either the left or right end of the subinterval as illustrated in Fig. 3.4. This defines
a rectangle method of integration. The height of the rectangle can be based on the
left or right end or the midpoint.

Fig. 3.4 Illustration of the rectangle method with evaluating the rectangle height by either the left
or right point

6
[Link]
90 3 Computing Integrals

a) Write a function rectangle(f, a, b, n, height=left) for computing


Rb
an integral a f .x/dx by the rectangle method with height computed based on
the value of height, which is either left, right, or mid.
b) Write three test functions for the three unit test procedures described in
Sect. 3.4.2. Make sure you test for height equal to left, right, and mid. You
may call the midpoint function for checking the result when height=mid.

Hint Edit test_trapezoidal.py.


Filename: rectangle_methods.py.

Exercise 3.9: Adaptive integration


Suppose we want to use the trapezoidal or midpoint method to compute an integral
Rb
a f .x/dx with an error less than a prescribed tolerance . What is the appropriate
size of n?
To answer this question, we may enter an iterative procedure where we compare
the results produced by n and 2n intervals, and if the difference is smaller than ,
the value corresponding to 2n is returned. Otherwise, we halve n and repeat the
procedure.

Hint It may be a good idea to organize your code so that the function adaptive_
integration can be used easily in future programs you write.

a) Write a function

adaptive_integration(f, a, b, eps, method=midpoint)

that implements the idea above (eps corresponds to the tolerance , and method
can be midpoint or trapezoidal).
R2 R2p
b) Test the method on 0 x 2 dx and 0 xdx for  D 101 ; 1010 and write out
the exact error. R2p
c) Make a plot of n versus  2 101 ; 1010  for 0 xdx. Use logarithmic scale
for .

Filename: adaptive_integration.py.

Remarks The type of method explored in this exercise is called adaptive, because
it tries to adapt the value of n to meet a given error criterion. The true error can very
seldom be computed (since we do not know the exact answer to the computational
problem), so one has to find other indicators of the error, such as the one here where
the changes in the integral value, as the number of intervals is doubled, is taken to
reflect the error.

Exercise 3.10: Integrating x raised to x


Consider the integral
Z4
I D x x dx :
0
3.8 Exercises 91

The integrand x x does not have an anti-derivative that can be expressed in terms of
standard functions (visit [Link] and type integral(x**x,x) to
convince yourself that our claim is right. Note that Wolfram alpha does give you
an answer, but that answer is an approximation, it is not exact. This is because
Wolfram alpha too uses numerical methods to arrive at the answer, just as you will
in this exercise). Therefore, we are forced to compute the integral by numerical
methods. Compute a result that is right to four digits.

Hint Use ideas from Exercise 3.9.


Filename: integrate_x2x.py.

Exercise 3.11: Integrate products of sine functions


In this exercise we shall integrate

Z
Ij;k D [Link]/ [Link]/dx;


where j and k are integers.

R sin.2x/ sin.3x/ for x 2 R;


a) Plot sin.x/ sin.2x/ and

 in separate plots. Ex-
plain why you expect  sin x sin 2x dx D 0 and  sin 2x sin 3x dx D 0.
b) Use the trapezoidal rule to compute Ij;k for j D 1; : : : ; 10 and k D 1; : : : ; 10.

Filename: products_sines.py.

Exercise 3.12: Revisit fit of sines to a function


This is a continuation of Exercise 2.18. The task is to approximate a given function
f .t/ on ;  by a sum of sines,

X
N
SN .t/ D bn [Link]/ : (3.27)
nD1

We are now interested in computing the unknown coefficients bn such that SN .t/
is in some sense the best approximation to f .t/. One common way of doing this
is to first set up a general expression for the approximation error, measured by
summing up the squared deviation of SN from f :

Z
ED .SN .t/  f .t//2 dt :


We may view E as a function of b1 ; : : : ; bN . Minimizing E with respect to


b1 ; : : : ; bN will give us a best approximation, in the sense that we adjust b1 ; : : : ; bN
such that SN deviates as little as possible from f .
92 3 Computing Integrals

Minimization of a function of N variables, E.b1 ; : : : ; bN / is mathematically per-


formed by requiring all the partial derivatives to be zero:

@E
D 0;
@b1
@E
D 0;
@b2
::
:
@E
D 0:
@bN

a) Compute the partial derivative @E=@b1 and generalize to the arbitrary case
@E=@bn , 1  n  N .
b) Show that
Z
1
bn D f .t/ [Link]/ dt :



c) Write a function integrate_coeffs(f, N, M) that computes b1 ; : : : ; bN by


numerical integration, using M intervals in the trapezoidal rule.
d) A
R remarkable property of the trapezoidal rule is that it is exact for integrals
 sin nt dt (when subintervals are of equal size). Use this property to
create a function test_integrate_coeff to verify the implementation of
integrate_coeffs.
e) Implement the choice f .t/ D 1 t as a Python function f(t) and call inte-
grate_coeffs(f, 3, 100) to see what the optimal choice of b1 ; b2 ; b3 is.
f) Make a function plot_approx(f, N, M, filename) where you plot f(t)
together with the best approximation SN as computed above, using M intervals
for numerical integration. Save the plot to a file with name filename.
g) Run plot_approx(f, N, M, filename) for f .t/ D 1 t for N D 3; 6; 12; 24.
Observe how the approximation improves.
h) Run plot_approx for f .t/ D e .t / and N D 100. Observe a fundamental
problem: regardless of N , SN ./ D 0, not e 2  535. (There are ways to fix
this issue.)

Filename: autofit_sines.py.

Exercise 3.13: Derive the trapezoidal rule for a double integral


Use ideas in Sect. 3.7.1 to derive a formula for computing a double integral
Rb Rd
a c f .x; y/dydx by the trapezoidal rule. Implement and test this rule.
Filename: trapezoidal_double.py.

Exercise 3.14: Compute the area of a triangle by Monte Carlo integration


Use the Monte Carlo method from Sect. 3.7.3 to compute the area of a triangle with
vertices at .1; 0/, .1; 0/, and .3; 0/.
Filename: MC_triangle.py.
3.8 Exercises 93

Open Access This chapter is distributed under the terms of the Creative Commons Attribution-
NonCommercial 4.0 International License ([Link]
which permits any noncommercial use, duplication, adaptation, distribution and reproduction
in any medium or format, as long as you give appropriate credit to the original author(s) and the
source, a link is provided to the Creative Commons license and any changes made are indicated.
The images or other third party material in this chapter are included in the works Creative
Commons license, unless indicated otherwise in the credit line; if such material is not included
in the works Creative Commons license and the respective action is not permitted by statutory
regulation, users will need to obtain permission from the license holder to duplicate, adapt or
reproduce the material.
Solving Ordinary Differential Equations
4

Differential equations constitute one of the most powerful mathematical tools to


understand and predict the behavior of dynamical systems in nature, engineering,
and society. A dynamical system is some system with some state, usually expressed
by a set of variables, that evolves in time. For example, an oscillating pendulum,
the spreading of a disease, and the weather are examples of dynamical systems. We
can use basic laws of physics, or plain intuition, to express mathematical rules that
govern the evolution of the system in time. These rules take the form of differential
equations. You are probably well experienced with equations, at least equations like
ax Cb D 0 or ax 2 Cbx Cc D 0. Such equations are known as algebraic equations,
and the unknown is a number. The unknown in a differential equation is a function,
and a differential equation will almost always involve this function and one or more
derivatives of the function. For example, f 0 .x/ D f .x/ is a simple differential
equation (asking if there is any function f such that it equals its derivative you
might remember that e x is a candidate).
The present chapter starts with explaining how easy it is to solve both single
(scalar) first-order ordinary differential equations and systems of first-order differ-
ential equations by the Forward Euler method. We demonstrate all the mathematical
and programming details through two specific applications: population growth and
spreading of diseases.
Then we turn to a physical application: oscillating mechanical systems, which
arise in a wide range of engineering situations. The differential equation is now of
second order, and the Forward Euler method does not perform well. This observa-

The Author(s) 2016 95


S. Linge, H.P. Langtangen, Programming for Computations Python,
Texts in Computational Science and Engineering 15, DOI 10.1007/978-3-319-32428-9_4
96 4 Solving Ordinary Differential Equations

tion motivates the need for other solution methods, and we derive the Euler-Cromer
scheme1 , the 2nd- and 4th-order Runge-Kutta schemes, as well as a finite difference
scheme (the latter to handle the second-order differential equation directly without
reformulating it as a first-order system). The presentation starts with undamped
free oscillations and then treats general oscillatory systems with possibly nonlinear
damping, nonlinear spring forces, and arbitrary external excitation. Besides de-
veloping programs from scratch, we also demonstrate how to access ready-made
implementations of more advanced differential equation solvers in Python.
As we progress with more advanced methods, we develop more sophisticated
and reusable programs, and in particular, we incorporate good testing strategies so
that we bring solid evidence to correct computations. Consequently, the beginning
with population growth and disease modeling examples has a very gentle learning
curve, while that curve gets significantly steeper towards the end of the treatment
of differential equations for oscillatory systems.

4.1 Population Growth

Our first taste of differential equations regards modeling the growth of some pop-
ulation, such as a cell culture, an animal population, or a human population. The
ideas even extend trivially to growth of money in a bank. Let N.t/ be the number
of individuals in the population at time t. How can we predict the evolution of N.t/
in time? Below we shall derive a differential equation whose solution is N.t/. The
equation reads
N 0 .t/ D rN.t/; (4.1)
where r is a number. Note that although N is an integer in real life, we model N as
a real-valued function. We are forced to do this because the solution of differential
equations are (normally continuous) real-valued functions. An integer-valued N.t/
in the model would lead to a lot of mathematical difficulties.
With a bit of guessing, you may realize that N.t/ D C e rt , where C is any
number. To make this solution unique, we need to fix C , done by prescribing the
value of N at some time, usually t D 0. Say N.0/ is given as N0 . Then N.t/ D
N0 e rt .
In general, a differential equation model consists of a differential equation, such
as (4.1) and an initial condition, such as N.0/ D N0 . With a known initial con-
dition, the differential equation can be solved for the unknown function and the
solution is unique.
It is, of course, very seldom that we can find the solution of a differential equa-
tion as easy as in this example. Normally, one has to apply certain mathematical
methods, but these can only handle some of the simplest differential equations.
However, we can easily deal with almost any differential equation by applying nu-
merical methods and a bit of programming. This is exactly the topic of the present
chapter.

1
The term scheme is used as synonym for method or computational recipe, especially in the con-
text of numerical methods for differential equations.
4.1 Population Growth 97

4.1.1 Derivation of the Model

It can be instructive to show how an equation like (4.1) arises. Consider some
population of (say) an animal species and let N.t/ be the number of individuals
in a certain spatial region, e.g. an island. We are not concerned with the spatial
distribution of the animals, just the number of them in some spatial area where
there is no exchange of individuals with other spatial areas. During a time interval
t, some animals will die and some new will be born. The number of deaths and
births are expected to be proportional to N . For example, if there are twice as many
individuals, we expect them to get twice as many newborns. In a time interval t,
the net growth of the population will be

N
N.t C t/  N.t/ D bN.t/  dN N.t/;

N
where bN.t/ is the number of newborns and dN N.t/ is the number of deaths. If
we double t, we expect the proportionality constants bN and dN to double too, so it
makes sense to think of bN and dN as proportional to t and factor out t. That
is, we introduce b D b=tN and d D dN =t to be proportionality constants for
newborns and deaths independent of t. Also, we introduce r D b  d , which is
the net rate of growth of the population per time unit. Our model then becomes

N.t C t/  N.t/ D t rN.t/ : (4.2)

Equation (4.2) is actually a computational model. Given N.t/, we can advance


the population size by

N.t C t/ D N.t/ C t rN.t/ :

This is called a difference equation. If we know N.t/ for some t, e.g., N.0/ D N0 ,
we can compute

N.t/ D N0 C t rN0 ;
N.2t/ D N.t/ C t rN.t/;
N.3t/ D N.2t/ C t rN.2t/;
::
:
N..k C 1/t/ D N.kt/ C t rN.kt/;

where k is some arbitrary integer. A computer program can easily compute N..k C
1/t/ for us with the aid of a little loop.

Warning
Observe that the computational formula cannot be started unless we have an
initial condition!
The solution of N 0 D rN is N D C e rt for any constant C , and the initial
condition is needed to fix C so the solution becomes unique. However, from
a mathematical point of view, knowing N.t/ at any point t is sufficient as initial
98 4 Solving Ordinary Differential Equations

condition. Numerically, we more literally need an initial condition: we need to


know a starting value at the left end of the interval in order to get the computa-
tional formula going.

In fact, we do not need a computer since we see a repetitive pattern when doing
hand calculations, which leads us to a mathematical formula for N..k C 1/t/, :

N..k C 1/t/ D N.kt/ C t rN.kt/ D N.kt/.1 C t r/


D N..k  1/t/.1 C t r/2
::
:
D N0 .1 C t r/kC1 :

Rather than using (4.2) as a computational model directly, there is a strong tra-
dition for deriving a differential equation from this difference equation. The idea is
to consider a very small time interval t and look at the instantaneous growth as
this time interval is shrunk to an infinitesimally small size. In mathematical terms,
it means that we let t ! 0. As (4.2) stands, letting t ! 0 will just produce an
equation 0 D 0, so we have to divide by t and then take the limit:

N.t C t/  N.t/


lim D rN.t/ :
t !0 t

The term on the left-hand side is actually the definition of the derivative N 0 .t/, so
we have
N 0 .t/ D rN.t/;
which is the corresponding differential equation.
There is nothing in our derivation that forces the parameter r to be constant
it can change with time due to, e.g., seasonal changes or more permanent environ-
mental changes.

Detour: Exact mathematical solution


If you have taken a course on mathematical solution methods for differential
equations, you may want to recap how an equation like N 0 D rN or N 0 D r.t/N
is solved. The method of separation of variables is the most convenient solution
strategy in this case:

N 0 D rN
dN
D rN
dt
dN
D rdt
N
ZN Zt
dN
D rdt
N
N0 0
4.1 Population Growth 99

Zt
ln N  ln N0 D r.t/dt
0
0 1
Zt
N D N0 exp @ r.t/dt A;
0

which for constant r results in N D N0 e rt . Note that exp .t/ is the same as e t .
As will be described later, r must in more realistic models depend on N . The
RN
method of separation of variables then requires to integrate N0 N=r.N /dN ,
which quickly becomes non-trivial for many choices of r.N /. The only gener-
ally applicable solution approach is therefore a numerical method.

4.1.2 Numerical Solution

There is a huge collection of numerical methods for problems like (4.2), and in
general any equation of the form u0 D f .u; t/, where u.t/ is the unknown function
in the problem, and f is some known formula of u and optionally t. For example,
f .u; t/ D ru in (4.2). We will first present a simple finite difference method solving
u0 D f .u; t/. The idea is four-fold:

1. Introduce a mesh in time with N t C1 points t0 ; t1 ; : : : ; tN t . We seek the unknown


u at the mesh points tn , and introduce un as the numerical approximation to
[Link] /, see Fig. 4.1.
2. Assume that the differential equation is valid at the mesh points.
3. Approximate derivatives by finite differences, see Fig. 4.2.
4. Formulate a computational algorithm that can compute a new value un based on
previously computed values ui , i < n.

An example will illustrate the steps. First, we introduce the mesh, and very
often the mesh is uniform, meaning that the spacing between points tn and tnC1 is
constant. This property implies that

tn D nt; n D 0; 1; : : : ; N t :

Second, the differential equation is supposed to hold at the mesh points. Note that
this is an approximation, because the differential equation is originally valid at all
real values of t. We can express this property mathematically as

u0 .tn / D f .un ; tn /; n D 0; 1; : : : ; N t :

For example, with our model equation u0 D ru, we have the special case

u0 .tn / D run ; n D 0; 1; : : : ; N t ;

or
u0 .tn / D [Link] /un ; n D 0; 1; : : : ; N t ;
if r depends explicitly on t.
100 4 Solving Ordinary Differential Equations

Fig. 4.1 Mesh in time with corresponding discrete values (unknowns)

Fig. 4.2 Illustration of a forward difference approximation to the derivative

Third, derivatives are to be replaced by finite differences. To this end, we need


to know specific formulas for how derivatives can be approximated by finite dif-
ferences. One simple possibility is to use the definition of the derivative from any
calculus book,
u.t C t/  u.t/
u0 .t/ D lim :
t !0 t
At an arbitrary mesh point tn this definition can be written as

unC1  un
u0 .tn / D lim :
t !0 t
4.1 Population Growth 101

Instead of going to the limit t ! 0 we can use a small t, which yields a com-
putable approximation to u0 .tn /:

unC1  un
u0 .tn /  :
t

This is known as a forward difference since we go forward in time (unC1 ) to collect


information in u to estimate the derivative. Figure 4.2 illustrates the idea. The error
of the forward difference is proportional to t (often written as O.t/, but we will
not use this notation in the present book).
We can now plug in the forward difference in our differential equation sampled
at the arbitrary mesh point tn :

unC1  un
D f .un ; tn /; (4.3)
t
or with f .u; t/ D ru in our special model problem for population growth,

unC1  un
D run : (4.4)
t
If r depends on time, we insert [Link] / D r n for r in this latter equation.
The fourth step is to derive a computational algorithm. Looking at (4.3), we
realize that if un should be known, we can easily solve with respect to unC1 to get
a formula for u at the next time level tnC1 :

unC1 D un C tf .un ; tn / : (4.5)

Provided we have a known starting value, u0 D U0 , we can use (4.5) to advance the
solution by first computing u1 from u0 , then u2 from u1 , u3 from u2 , and so forth.
Such an algorithm is called a numerical scheme for the differential equation and
often written compactly as

unC1 D un C tf .un ; tn /; u 0 D U0 ; n D 0; 1; : : : ; N t  1 : (4.6)

This scheme is known as the Forward Euler scheme, also called Eulers method.
In our special population growth model, we have

unC1 D un C t run ; u 0 D U0 ; n D 0; 1; : : : ; N t  1 : (4.7)

We may also write this model using the problem-specific symbol N instead of the
generic u function:

N nC1 D N n C t rN n; N 0 D N0 ; n D 0; 1; : : : ; N t  1 : (4.8)

The observant reader will realize that (4.8) is nothing but the computational
model (4.2) arising directly in the model derivation. The formula (4.8) arises,
however, from a detour via a differential equation and a numerical method for the
differential equation. This looks rather unnecessary! The reason why we bother to
102 4 Solving Ordinary Differential Equations

Fig. 4.3 The numerical solution at points can be extended by linear segments between the mesh
points

derive the differential equation model and then discretize it by a numerical method
is simply that the discretization can be done in many ways, and we can create
(much) more accurate and more computationally efficient methods than (4.8) or
(4.6). This can be useful in many problems! Nevertheless, the Forward Euler
scheme is intuitive and widely applicable, at least when t is chosen to be small.

The numerical solution between the mesh points


Our numerical method computes the unknown function u at discrete mesh points
t1 ; t2 ; : : : ; tN t . What if we want to evaluate the numerical solution between the
mesh points? The most natural choice is to assume a linear variation between
the mesh points, see Fig. 4.3. This is compatible with the fact that when we plot
the array u0 ; u1 ; : : : versus t0 ; t1 ; : : :, a straight line is drawn between the discrete
points.

4.1.3 Programming the Forward Euler Scheme; the Special Case

Let us compute (4.8) in a program. The input variables are N0 , t, r, and N t . Note
that we need to compute N t C 1 new values N 1 ; : : : ; N N t C1 . A total of N t C 2
values are needed in an array representation of N n , n D 0; : : : ; N t C 1.
Our first version of this program is as simple as possible:

N_0 = input(Give initial population size N_0: )


r = input(Give net growth rate r: )
dt = input(Give time step size: )
N_t = input(Give number of steps: )
from numpy import linspace, zeros
t = linspace(0, (N_t+1)*dt, N_t+2)
N = zeros(N_t+2)
4.1 Population Growth 103

N[0] = N_0
for n in range(N_t+1):
N[n+1] = N[n] + r*dt*N[n]

import [Link] as plt


numerical_sol = bo if N_t < 70 else b-
[Link](t, N, numerical_sol, t, N_0*exp(r*t), r-)
[Link]([numerical, exact], loc=upper left)
[Link](t); [Link](N(t))
filestem = growth1_%dsteps % N_t
[Link](%[Link] % filestem); [Link](%[Link] % filestem)

The complete code above resides in the file [Link].


Let us demonstrate a simulation where we start with 100 animals, a net growth
rate of 10 percent (0.1) per time unit, which can be one month, and t 2 0; 20
months. We may first try t of half a month (0.5), which implies N t D 40 (or to
be absolutely precise, the last time point to be computed according to our set-up
above is tN t C1 D 20:5). Figure 4.4 shows the results. The solid line is the exact
solution, while the circles are the computed numerical solution. The discrepancy is
clearly visible. What if we make t 10 times smaller? The result is displayed in
Fig. 4.5, where we now use a solid line also for the numerical solution (otherwise,
400 circles would look very cluttered, so the program has a test on how to display
the numerical solution, either as circles or a solid line). We can hardly distinguish
the exact and the numerical solution. The computing time is also a fraction of
a second on a laptop, so it appears that the Forward Euler method is sufficiently
accurate for practical purposes. (This is not always true for large, complicated
simulation models in engineering, so more sophisticated methods may be needed.)

Fig. 4.4 Evolution of a population computed with time step 0.5 month
104 4 Solving Ordinary Differential Equations

Fig. 4.5 Evolution of a population computed with time step 0.05 month

It is also of interest to see what happens if we increase t to 2 months. The


results in Fig. 4.6 indicate that this is an inaccurate computation.

Fig. 4.6 Evolution of a population computed with time step 2 months


4.1 Population Growth 105

4.1.4 Understanding the Forward Euler Method

The good thing about the Forward Euler method is that it gives an understanding
of what a differential equation is and a geometrical picture of how to construct the
solution. The first idea is that we have already computed the solution up to some
time point tn . The second idea is that we want to progress the solution from tn to
tnC1 as a straight line.
We know that the line must go through the solution at tn , i.e., the point .tn ; un /.
The differential equation tells us the slope of the line: u0 .tn / D f .un ; tn / D run .
That is, the differential equation gives a direct formula for the further direction of
the solution curve. We can say that the differential equation expresses how the
system (u) undergoes changes at a point.
There is a general formula for a straight line y D ax C b with slope a that goes
through the point .x0 ; y0 /: y D a.x  x0 / C y0 . Using this formula adapted to the
present case, and evaluating the formula for tnC1 , results in

unC1 D run .tnC1  tn / C un D un C t run ;

which is nothing but the Forward Euler formula. You are now encouraged to do Ex-
ercise 4.1 to become more familiar with the geometric interpretation of the Forward
Euler method.

4.1.5 Programming the Forward Euler Scheme; the General Case

Our previous program was just a flat main program tailored to a special differential
equation. When programming mathematics, it is always good to consider a (large)
class of problems and making a Python function to solve any problem that fits into
the class. More specifically, we will make software for the class of differential
equation problems of the form

u0 .t/ D f .u; t/; u D U0 ; t 2 0; T ;

for some given function f , and numbers U0 and T . We also take the opportunity
to illustrate what is commonly called a demo function. As the name implies, the
purpose of such a function is solely to demonstrate how the function works (not
to be confused with a test function, which does verification by use of assert).
The Python function calculating the solution must take f , U0 , t, and T as in-
put, find the corresponding N t , compute the solution, and return an array with
u0 ; u1 ; : : : ; uN t and an array with t0 ; t1 ; : : : ; tN t . The Forward Euler scheme reads

unC1 D un C tf .un ; tn /; n D 0; : : : ; N t  1 :

The corresponding program may now take the form (file ode_FE.py):
106 4 Solving Ordinary Differential Equations

from numpy import linspace, zeros, exp


import [Link] as plt

def ode_FE(f, U_0, dt, T):


N_t = int(round(float(T)/dt))
u = zeros(N_t+1)
t = linspace(0, N_t*dt, len(u))
u[0] = U_0
for n in range(N_t):
u[n+1] = u[n] + dt*f(u[n], t[n])
return u, t

def demo_population_growth():
"""Test case: u=r*u, u(0)=100."""
def f(u, t):
return 0.1*u

u, t = ode_FE(f=f, U_0=100, dt=0.5, T=20)


[Link](t, u, t, 100*exp(0.1*t))
[Link]()

if __name__ == __main__:
demo_population_growth()

This program file, called ode_FE.py, is a reusable piece of code with a general
ode_FE function that can solve any differential equation u0 D f .u; t/ and a demo
function for the special case u0 D 0:1u, u.0/ D 100. Observe that the call to the
demo function is placed in a test block. This implies that the call is not active if
ode_FE is imported as a module in another program, but active if ode_FE.py is run
as a program.
The solution should be identical to what the [Link] program produces with
the same parameter settings (r D 0:1, N0 D 100). This feature can easily be tested
by inserting a print statement, but a much better, automated verification is suggested
in Exercise 4.1. You are strongly encouraged to take a break and do that exercise
now.

Remark on the use of u as variable


In the ode_FE program, the variable u is used in different contexts. Inside the
ode_FE function, u is an array, but in the f(u,t) function, as exemplified in the
demo_population_growth function, the argument u is a number. Typically,
we call f (in ode_FE) with the u argument as one element of the array u in the
ode_FE function: u[n].

4.1.6 Making the Population Growth Model More Realistic

Exponential growth of a population according the model N 0 D rN , with exponen-


tial solution N D N0 e rt , is unrealistic in the long run because the resources needed
to feed the population are finite. At some point there will not be enough resources
and the growth will decline. A common model taking this effect into account as-
4.1 Population Growth 107

sumes that r depends on the size of the population, N :

N.t C t/  N.t/ D r.N.t//N.t/ :

The corresponding differential equation becomes

N 0 D r.N /N :

The reader is strongly encouraged to repeat the steps in the derivation of the Forward
Euler scheme and establish that we get

N nC1 D N n C t r.N n /N n ;

which computes as easy as for a constant r, since r.N n/ is known when computing
N nC1 . Alternatively, one can use the Forward Euler formula for the general problem
u0 D f .u; t/ and use f .u; t/ D r.u/u and replace u by N .
The simplest choice of r.N / is a linear function, starting with some growth value
rN and declining until the population has reached its maximum, M , according to the
available resources:
r.N / D rN .1  N=M / :
In the beginning, N M and we will have exponential growth e rtN , but as N
increases, r.N / decreases, and when N reaches M , r.N / D 0 so there is now
more growth and the population remains at N.t/ D M . This linear choice of r.N /
gives rise to a model that is called the logistic model. The parameter M is known
as the carrying capacity of the population.
Let us run the logistic model with aid of the ode_FE function in the ode_FE
module. We choose N.0/ D 100, t D 0:5 month, T D 60 months, r D 0:1,
and M D 500. The complete program, called [Link], is basically a call to
ode_FE:

from ode_FE import ode_FE


import [Link] as plt

for dt, T in zip((0.5, 20), (60, 100)):


u, t = ode_FE(f=lambda u, t: 0.1*(1 - u/500.)*u, \
U_0=100, dt=dt, T=T)
[Link]() # Make separate figures for each pass in the loop
[Link](t, u, b-)
[Link](t); [Link](N(t))
[Link](tmp_%[Link] % dt); [Link](tmp_%[Link] % dt)

Figure 4.7 shows the resulting curve. We see that the population stabilizes
around M D 500 individuals. A corresponding exponential growth would reach
N0 e rt D 100e 0:160  40;300 individuals!
It is always interesting to see what happens with large t values. We may set
t D 20 and T D 100. Now the solution, seen in Fig. 4.8, oscillates and is
hence qualitatively wrong, because one can prove that the exact solution of the
differential equation is monotone. (However, there is a corresponding difference
108 4 Solving Ordinary Differential Equations

Fig. 4.7 Logistic growth of a population

Fig. 4.8 Logistic growth with large time step

equation model, NnC1 D rNn .1  Nn =M /, which allows oscillatory solutions and


those are observed in animal populations. The problem with large t is that it
just leads to wrong mathematics and two wrongs dont make a right in terms of
a relevant model.)
4.1 Population Growth 109

Remark on the world population


The number of people on the planet2 follows the model N 0 D r.t/N , where the
net reproduction r.t/ varies with time and has decreased since its top in 1990.
The current world value of r is 1.2%, and it is difficult to predict future values3 .
At the moment, the predictions of the world population point to a growth to 9.6
billion before declining.
This example shows the limitation of a differential equation model: we need
to know all input parameters, including r.t/, in order to predict the future. It is
seldom the case that we know all input parameters. Sometimes knowledge of the
solution from measurements can help estimate missing input parameters.

4.1.7 Verification: Exact Linear Solution of the Discrete Equations

How can we verify that the programming of an ODE model is correct? The best
method is to find a problem where there are no unknown numerical approximation
errors, because we can then compare the exact solution of the problem with the re-
sult produced by our implementation and expect the difference to be within a very
small tolerance. We shall base a unit test on this idea and implement a correspond-
ing test function (see Sect. 3.4.4) for automatic verification of our implementation.
It appears that most numerical methods for ODEs will exactly reproduce a solu-
tion u that is linear in t. We may therefore set u D at C b and choose any f whose
derivative is a. The choice f .u; t/ D a is very simple, but we may add anything
that is zero, e.g.,
f .u; t/ D a C .u  .at C b//m :
This is a valid f .u; t/ for any a, b, and m. The corresponding ODE looks highly
non-trivial, however:
u0 D a C .u  .at C b//m :
Using the general ode_FE function in ode_FE.py, we may write a proper test
function as follows (in file test_ode_FE_exact_linear.py):

def test_ode_FE():
"""Test that a linear u(t)=a*t+b is exactly reproduced."""

def exact_solution(t):
return a*t + b

def f(u, t): # ODE


return a + (u - exact_solution(t))**m

a = 4
b = -1
m = 6

2
[Link]
3
[Link]
110 4 Solving Ordinary Differential Equations

dt = 0.5
T = 20.0

u, t = ode_FE(f, exact_solution(0), dt, T)


diff = abs(exact_solution(t) - u).max()
tol = 1E-15 # Tolerance for float comparison
success = diff < tol
assert success

Recall that test functions should start with the name test_, have no arguments, and
formulate the test as a boolean expression success that is True if the test passes
and False if it fails. Test functions should make the test as assert success (here
success can also be a boolean expression as in assert diff < tol).
Observe that we cannot compare diff to zero, which is what we mathematically
expect, because diff is a floating-point variable that most likely contains small
rounding errors. Therefore, we must compare diff to zero with a tolerance, here
1015 .
You are encouraged to do Exercise 4.2 where the goal is to make a test function
for a verification based on comparison with hand-calculated results for a few time
steps.

4.2 Spreading of Diseases

Our aim with this section is to show in detail how one can apply mathematics and
programming to investigate spreading of diseases. The mathematical model is now
a system of three differential equations with three unknown functions. To derive
such a model, we can use mainly intuition, so no specific background knowledge of
diseases is required.

4.2.1 Spreading of a Flu

Imagine a boarding school out in the country side. This school is a small and closed
society. Suddenly, one or more of the pupils get a flu. We expect that the flu may
spread quite effectively or die out. The question is how many of the pupils and
the schools staff will be affected. Some quite simple mathematics can help us to
achieve insight into the dynamics of how the disease spreads.
Let the mathematical function S.t/ count how many individuals, at time t, that
have the possibility to get infected. Here, t may count hours or days, for instance.
These individuals make up a category called susceptibles, labeled as S. Another
category, I, consists of the individuals that are infected. Let I.t/ count how many
there are in category I at time t. An individual having recovered from the disease
is assumed to gain immunity. There is also a small possibility that an infected will
die. In either case, the individual is moved from the I category to a category we call
the removed category, labeled with R. We let R.t/ count the number of individuals
in the R category at time t. Those who enter the R category, cannot leave this
category.
4.2 Spreading of Diseases 111

To summarize, the spreading of this disease is essentially the dynamics of mov-


ing individuals from the S to the I and then to the R category:

We can use mathematics to more precisely describe the exchange between the
categories. The fundamental idea is to describe the changes that take place during
a small time interval, denoted by t.
Our disease model is often referred to as a compartment model, where quantities
are shuffled between compartments (here a synonym for categories) according to
some rules. The rules express changes in a small time interval t, and from these
changes we can let t go to zero and obtain derivatives. The resulting equations
then go from difference equations (with finite t) to differential equations (t !
0).
We introduce a uniform mesh in time, tn D nt, n D 0; : : : ; N t , and seek S
at the mesh points. The numerical approximation to S at time tn is denoted by S n .
Similarly, we seek the unknown values of I.t/ and R.t/ at the mesh points and
introduce a similar notation I n and Rn for the approximations to the exact values
[Link] / and [Link] /.
In the time interval t we know that some people will be infected, so S will de-
crease. We shall soon argue by mathematics that there will be tSI new infected
individuals in this time interval, where is a parameter reflecting how easy people
get infected during a time interval of unit length. If the loss in S is tSI , we have
that the change in S is
S nC1  S n D tS n I n : (4.9)
Dividing by t and letting t ! 0, makes the left-hand side approach S 0 .tn / such
that we obtain a differential equation

S 0 D SI : (4.10)

The reasoning in going from the difference equation (4.9) to the differential equa-
tion (4.10) follows exactly the steps explained in Sect. 4.1.1.
Before proceeding with how I and R develops in time, let us explain the formula
tSI . We have S susceptibles and I infected people. These can make up SI
pairs. Now, suppose that during a time interval T we measure that m actual pairwise
meetings do occur among n theoretically possible pairings of people from the S
and I categories. The probability that people meet in pairs during a time T is (by
the empirical frequency definition of probability) equal to m=n, i.e., the number
of successes divided by the number of possible outcomes. From such statistics we
normally derive quantities expressed per unit time, i.e., here we want the probability
per unit time, , which is found from dividing by T :  D m=.nT /.
Given the probability , the expected number of meetings per time interval of
SI possible pairs of people is (from basic statistics) SI . During a time interval
t, there will be SIt expected number of meetings between susceptibles and
infected people such that the virus may spread. Only a fraction of the tSI
112 4 Solving Ordinary Differential Equations

meetings are effective in the sense that the susceptible actually becomes infected.
Counting that m people get infected in n such pairwise meetings (say 5 are infected
from 1000 meetings), we can estimate the probability of being infected as p D
m=n. The expected number of individuals in the S category that in a time interval
t catch the virus and get infected is then ptSI . Introducing a new constant
D p to save some writing, we arrive at the formula tSI .
The value of must be known in order to predict the future with the disease
model. One possibility is to estimate p and  from their meanings in the derivation
above. Alternatively, we can observe an experiment where there are S0 suscepti-
bles and I0 infected at some point in time. During a time interval T we count that N
susceptibles have become infected. Using (4.9) as a rough approximation of how S
has developed during time T (and now T is not necessarily small, but we use (4.9)
anyway), we get
N
N D T S0 I0 ) D : (4.11)
T S0 I0
We need an additional equation to describe the evolution of I.t/. Such an equa-
tion is easy to establish by noting that the loss in the S category is a corresponding
gain in the I category. More precisely,

I nC1  I n D tS n I n : (4.12)

However, there is also a loss in the I category because people recover from the
disease. Suppose that we can measure that m out of n individuals recover in a time
period T (say 10 of 40 sick people recover during a day: m D 10, n D 40, T D
24 h). Now, D m=.nT / is the probability that one individual recovers in a unit
time interval. Then (on average) tI infected will recover in a time interval t.
This quantity represents a loss in the I category and a gain in the R category. We
can therefore write the total change in the I category as

I nC1  I n D tS n I n  tI n : (4.13)

The change in the R category is simple: there is always an increase from the I
category:
RnC1  Rn D tI n : (4.14)
Since there is no loss in the R category (people are either recovered and immune,
or dead), we are done with the modeling of this category. In fact, we do not strictly
need the equation (4.14) for R, but extensions of the model later will need an equa-
tion for R.
Dividing by t in (4.13) and (4.14) and letting t ! 0, results in the corre-
sponding differential equations

I 0 D SI  I; (4.15)

and
R0 D I : (4.16)
To summarize, we have derived difference equations (4.9)(4.14), and alternative
differential equations (4.15)(4.16). For reference, we list the complete set of the
4.2 Spreading of Diseases 113

three difference equations:

S nC1 D S n  tS n I n ; (4.17)


I nC1
D I C tS I  tI ;
n n n n
(4.18)
R nC1
D R C tI :
n n
(4.19)

Note that we have isolated the new unknown quantities S nC1 , I nC1 , and RnC1 on
the left-hand side, such that these can readily be computed if S n , I n , and Rn are
known. To get such a procedure started, we need to know S 0 , I 0 , R0 . Obviously,
we also need to have values for the parameters and .
We also list the system of three differential equations:

S 0 D SI; (4.20)
I 0 D SI  I; (4.21)
R0 D I : (4.22)

This differential equation model (and also its discrete counterpart above) is known
as an SIR model. The input data to the differential equation model consist of the
parameters and as well as the initial conditions S.0/ D S0 , I.0/ D I0 , and
R.0/ D R0 .

4.2.2 A Forward Euler Method for the Differential Equation System

Let us apply the same principles as we did in Sect. 4.1.2 to discretize the differential
equation system by the Forward Euler method. We already have a time mesh and
time-discrete quantities S n , I n , Rn , n D 0; : : : ; N t . The three differential equations
are assumed to be valid at the mesh points. At the point tn we then have

S 0 .tn / D [Link] /[Link] /; (4.23)


I 0 .tn / D [Link] /[Link] /  [Link] /; (4.24)
R0 .tn / D [Link] /; (4.25)

for n D 0; 1; : : : ; N t . This is an approximation since the differential equations are


originally valid at all times t (usually in some finite interval 0; T ). Using forward
finite differences for the derivatives results in an additional approximation,

S nC1  S n
D S n I n ; (4.26)
t
I nC1  I n
D S n I n  I n ; (4.27)
t
RnC1  Rn
D I n : (4.28)
t
As we see, these equations are identical to the difference equations that naturally
arise in the derivation of the model. However, other numerical methods than the
Forward Euler scheme will result in slightly different difference equations.
114 4 Solving Ordinary Differential Equations

4.2.3 Programming the Numerical Method; the Special Case

The computation of (4.26)(4.28) can be readily made in a computer program


[Link]:

from numpy import zeros, linspace


import [Link] as plt

# Time unit: 1 h
beta = 10./(40*8*24)
gamma = 3./(15*24)
dt = 0.1 # 6 min
D = 30 # Simulate for D days
N_t = int(D*24/dt) # Corresponding no of hours

t = linspace(0, N_t*dt, N_t+1)


S = zeros(N_t+1)
I = zeros(N_t+1)
R = zeros(N_t+1)

# Initial condition
S[0] = 50
I[0] = 1
R[0] = 0

# Step equations forward in time


for n in range(N_t):
S[n+1] = S[n] - dt*beta*S[n]*I[n]
I[n+1] = I[n] + dt*beta*S[n]*I[n] - dt*gamma*I[n]
R[n+1] = R[n] + dt*gamma*I[n]

fig = [Link]()
l1, l2, l3 = [Link](t, S, t, I, t, R)
[Link]((l1, l2, l3), (S, I, R), upper left)
[Link](hours)
[Link]()
[Link]([Link]); [Link]([Link])

This program was written to investigate the spreading of a flu at the mentioned
boarding school, and the reasoning for the specific choices and goes as follows.
At some other school where the disease has already spread, it was observed that in
the beginning of a day there were 40 susceptibles and 8 infected, while the numbers
were 30 and 18, respectively, 24 hours later. Using 1 h as time unit, we then have
from (4.11) that D 10=.40  8  24/. Among 15 infected, it was observed that
3 recovered during a day, giving D 3=.15  24/. Applying these parameters to
a new case where there is one infected initially and 50 susceptibles, gives the graphs
in Fig. 4.9. These graphs are just straight lines between the values at times ti D it
as computed by the program. We observe that S reduces as I and R grows. After
about 30 days everyone has become ill and recovered again.
We can experiment with and to see whether we get an outbreak of the disease
or not. Imagine that a wash your hands campaign was successful and that the
other school in this case experienced a reduction of by a factor of 5. With this
4.2 Spreading of Diseases 115

Fig. 4.9 Natural evolution of a flu at a boarding school

lower the disease spreads very slowly so we simulate for 60 days. The curves
appear in Fig. 4.10.

Fig. 4.10 Small outbreak of a flu at a boarding school ( is much smaller than in Fig. 4.9)
116 4 Solving Ordinary Differential Equations

4.2.4 Outbreak or Not

Looking at the equation for I , it is clear that we must have SI  I > 0 for I to
increase. When we start the simulation it means that

S.0/I.0/  I.0/ > 0;

or simpler
S.0/
>1 (4.29)

to increase the number of infected people and accelerate the spreading of the dis-
ease. You can run the [Link] program with a smaller such that (4.29) is violated
and observe that there is no outbreak.

The power of mathematical modeling


The reader should notice our careful use of words in the previous paragraphs.
We started out with modeling a very specific case, namely the spreading of a flu
among pupils and staff at a boarding school. With purpose we exchanged words
like pupils and flu with more neutral and general words like individuals and
disease, respectively. Phrased equivalently, we raised the abstraction level by
moving from a specific case (flu at a boarding school) to a more general case
(disease in a closed society). Very often, when developing mathematical mod-
els, we start with a specific example and see, through the modeling, that what is
going on of essence in this example also will take place in many similar prob-
lem settings. We try to incorporate this generalization in the model so that the
model has a much wider application area than what we aimed at in the begin-
ning. This is the very power of mathematical modeling: by solving one specific
case we have often developed more generic tools that can readily be applied to
solve seemingly different problems. The next sections will give substance to this
assertion.

4.2.5 Abstract Problem and Notation

When we had a specific differential equation with one unknown, we quickly turned
to an abstract differential equation written in the generic form u0 D f .u; t/. We re-
fer to such a problem as a scalar ODE. A specific equation corresponds to a specific
choice of the formula f .u; t/ involving u and (optionally) t.
It is advantageous to also write a system of differential equations in the same
abstract notation,
u0 D f .u; t/;
but this time it is understood that u is a vector of functions and f is also vector. We
say that u0 D f .u; t/ is a vector ODE or system of ODEs in this case. For the SIR
model we introduce the two 3-vectors, one for the unknowns,

u D .S.t/; I.t/; R.t//;


4.2 Spreading of Diseases 117

and one for the right-hand side functions,

f .u; t/ D .SI; SI  I; I / :

The equation u0 D f .u; t/ means setting the two vectors equal, i.e., the components
must be pairwise equal. Since u0 D .S 0 ; I 0 ; R0 /, we get that u0 D f implies

S 0 D SI;
I 0 D SI  I;
R0 D I :

The generalized short notation u0 D f .u; t/ is very handy since we can derive
numerical methods and implement software for this abstract system and in a par-
ticular application just identify the formulas in the f vector, implement these, and
call functionality that solves the differential equation system.

4.2.6 Programming the Numerical Method; the General Case

In Python code, the Forward Euler step

unC1 D un C tf .un ; tn /;

being a scalar or a vector equation, can be coded as

u[n+1] = u[n] + dt*f(u[n], t[n])

both in the scalar and vector case. In the vector case, u[n] is a one-dimensional
numpy array of length m C 1 holding the mathematical quantity un , and the Python
function f must return a numpy array of length m C 1. Then the expression u[n] +
dt*f(u[n], t[n]) is an array plus a scalar times an array.
For all this to work, the complete numerical solution must be represented by
a two-dimensional array, created by u = zeros((N_t+1, m+1)). The first index
counts the time points and the second the components of the solution vector at one
time point. That is, u[n,i] corresponds to the mathematical quantity uni . When we
use only one index, as in u[n], this is the same as u[n,:] and picks out all the com-
ponents in the solution at the time point with index n. Then the assignment u[n+1]
= ... becomes correct because it is actually an in-place assignment u[n+1, :]
= .... The nice feature of these facts is that the same piece of Python code works
for both a scalar ODE and a system of ODEs!
The ode_FE function for the vector ODE is placed in the file ode_system_FE.
py and was written as follows:

from numpy import linspace, zeros, asarray


import [Link] as plt

def ode_FE(f, U_0, dt, T):


N_t = int(round(float(T)/dt))
118 4 Solving Ordinary Differential Equations

# Ensure that any list/tuple returned from f_ is wrapped as array


f_ = lambda u, t: asarray(f(u, t))
u = zeros((N_t+1, len(U_0)))
t = linspace(0, N_t*dt, len(u))
u[0] = U_0
for n in range(N_t):
u[n+1] = u[n] + dt*f_(u[n], t[n])
return u, t

The line f_ = lambda ... needs an explanation. For a user, who just needs to
define the f in the ODE system, it is convenient to insert the various mathematical
expressions on the right-hand sides in a list and return that list. Obviously, we
could demand the user to convert the list to a numpy array, but it is so easy to do
a general such conversion in the ode_FE function as well. To make sure that the
result from f is indeed an array that can be used for array computing in the formula
u[n] + dt*f(u[n], t[n]), we introduce a new function f_ that calls the users
f and sends the results through the numpy function asarray, which ensures that its
argument is converted to a numpy array (if it is not already an array).
Note also the extra parenthesis required when calling zeros with two indices.
Let us show how the previous SIR model can be solved using the new general
ode_FE that can solve any vector ODE. The users f(u, t) function takes a vector
u, with three components corresponding to S, I , and R as argument, along with the
current time point t[n], and must return the values of the formulas of the right-hand
sides in the vector ODE. An appropriate implementation is

def f(u, t):


S, I, R = u
return [-beta*S*I, beta*S*I - gamma*I, gamma*I]

Note that the S, I, and R values correspond to S n , I n , and Rn . These values are then
just inserted in the various formulas in the vector ODE. Here we collect the values
in a list since the ode_FE function will anyway wrap this list in an array. We could,
of course, returned an array instead:

def f(u, t):


S, I, R = u
return array([-beta*S*I, beta*S*I - gamma*I, gamma*I])

The list version looks a bit nicer, so that is why we prefer a list and rather introduce
f_ = lambda u, t: asarray(f(u,t)) in the general ode_FE function.
We can now show a function that runs the previous SIR example, while using
the generic ode_FE function:

def demo_SIR():
"""Test case using a SIR model."""
def f(u, t):
S, I, R = u
return [-beta*S*I, beta*S*I - gamma*I, gamma*I]
4.2 Spreading of Diseases 119

beta = 10./(40*8*24)
gamma = 3./(15*24)
dt = 0.1 # 6 min
D = 30 # Simulate for D days
N_t = int(D*24/dt) # Corresponding no of hours
T = dt*N_t # End time
U_0 = [50, 1, 0]

u, t = ode_FE(f, U_0, dt, T)

S = u[:,0]
I = u[:,1]
R = u[:,2]
fig = [Link]()
l1, l2, l3 = [Link](t, S, t, I, t, R)
[Link]((l1, l2, l3), (S, I, R), lower right)
[Link](hours)
[Link]()

# Consistency check:
N = S[0] + I[0] + R[0]
eps = 1E-12 # Tolerance for comparing real numbers
for n in range(len(S)):
SIR_sum = S[n] + I[n] + R[n]
if abs(SIR_sum - N) > eps:
print *** consistency check failed: S+I+R=%g != %g %\
(SIR_sum, N)

if __name__ == __main__:
demo_SIR()

Recall that the u returned from ode_FE contains all components (S, I , R) in the
solution vector at all time points. We therefore need to extract the S, I , and R
values in separate arrays for further analysis and easy plotting.
Another key feature of this higher-quality code is the consistency check. By
adding the three differential equations in the SIR model, we realize that S 0 C I 0 C
R0 D 0, which means that S CI CR D const. We can check that this relation holds
by comparing S n C I n C Rn to the sum of the initial conditions. The check is not
a full-fledged verification, but it is a much better than doing nothing and hoping that
the computation is correct. Exercise 4.5 suggests another method for controlling the
quality of the numerical solution.

4.2.7 Time-Restricted Immunity

Let us now assume that immunity after the disease only lasts for some certain time
period. This means that there is transport from the R state to the S state:
120 4 Solving Ordinary Differential Equations

Modeling the loss of immunity is very similar to modeling recovery from the
disease: the amount of people losing immunity is proportional to the amount of
recovered patients and the length of the time interval t. We can therefore write
the loss in the R category as 
tR in time t, where
1 is the typical time it
takes to lose immunity. The loss in R.t/ is a gain in S.t/. The budgets for the
categories therefore become

S nC1 D S n  tS n I n C
tRn ; (4.30)
I nC1
D I C tS I  tI ;
n n n n
(4.31)
R nC1
D R C tI 
tR :
n n n
(4.32)

Dividing by t and letting t ! 0 gives the differential equation system

S 0 D SI C
R; (4.33)
I 0 D SI  I; (4.34)
R0 D I 
R : (4.35)

This system can be solved by the same methods as we demonstrated for the original
SIR model. Only one modification in the program is necessary: adding nu*R[n] to
the S[n+1] update and subtracting the same quantity in the R[n+1] update:

for n in range(N_t):
S[n+1] = S[n] - dt*beta*S[n]*I[n] + dt*nu*R[n]
I[n+1] = I[n] + dt*beta*S[n]*I[n] - dt*gamma*I[n]
R[n+1] = R[n] + dt*gamma*I[n] - dt*nu*R[n]

The modified code is found in the file [Link].


Setting
1 to 50 days, reducing by a factor of 4 compared to the previous
example ( D 0:00033), and simulating for 300 days gives an oscillatory behavior
in the categories, as depicted in Fig. 4.11. It is easy now to play around and study
how the parameters affect the spreading of the disease. For example, making the
disease slightly more effective (increase to 0.00043) and increasing the average
time to loss of immunity to 90 days lead to other oscillations, see Fig. 4.12.

4.2.8 Incorporating Vaccination

We can extend the model to also include vaccination. To this end, it can be useful
to track those who are vaccinated and those who are not. So, we introduce a fourth
category, V, for those who have taken a successful vaccination. Furthermore, we
assume that in a time interval t, a fraction pt of the S category is subject to
a successful vaccination. This means that in the time t, ptS people leave from
the S to the V category. Since the vaccinated ones cannot get the disease, there is no
impact on the I or R categories. We can visualize the categories, and the movement
between them, as
4.2 Spreading of Diseases 121

Fig. 4.11 Including loss of immunity

Fig. 4.12 Increasing and reducing


compared to Fig. 4.11
122 4 Solving Ordinary Differential Equations

The new, extended differential equations with the V quantity become

S0 D SI C
R  pS; (4.36)
V0 D pS; (4.37)
I0 D SI  I; (4.38)
R0 D I 
R : (4.39)

We shall refer to this model as the SIRV model.


The new equation for V 0 poses no difficulties when it comes to the numerical
method. In a Forward Euler scheme we simply add an update

V nC1 D V n C ptS n :

The program needs to store V .t/ in an additional array V, and the plotting command
must be extended with more arguments to plot V versus t as well. The complete
code is found in the file [Link].
Using p D 0:0005 and p D 0:0001 as values for the vaccine efficiency pa-
rameter, the effect of vaccination is seen in Fig. 4.13 (other parameters are as in
Fig. 4.11).

Fig. 4.13 The effect of vaccination: p D 0:0005 (left) and p D 0:0001 (right)
4.2 Spreading of Diseases 123

4.2.9 Discontinuous Coefficients: A Vaccination Campaign

What about modeling a vaccination campaign? Imagine that six days after the out-
break of the disease, the local health station launches a vaccination campaign. They
reach out to many people, say 10 times as efficiently as in the previous (constant
vaccination) case. If the campaign lasts for 10 days we can write
(
0:005; 6  24  t  15  24;
p.t/ D
0; otherwise

Note that we must multiply the t value by 24 because t is measured in hours, not
days. In the differential equation system, pS.t/ must be replaced by p.t/S.t/, and
in this case we get a differential equation system with a term that is discontinu-
ous. This is usually quite a challenge in mathematics, but as long as we solve the
equations numerically in a program, a discontinuous coefficient is easy to treat.
There are two ways to implement the discontinuous coefficient p.t/: through
a function and through an array. The function approach is perhaps the easiest:

def p(t):
return 0.005 if (6*24 <= t <= 15*24) else 0

In the code for updating the arrays S and V we get a term p(t[n])*S[n].
We can also let p.t/ be an array filled with correct values prior to the simulation.
Then we need to allocate an array p of length N_t+1 and find the indices corre-
sponding to the time period between 6 and 15 days. These indices are found from
the time point divided by t. That is,

p = zeros(N_t+1)
start_index = 6*24/dt
stop_index = 15*24/dt
p[start_index:stop_index] = 0.005

The p.t/S.t/ term in the updating formulas for S and V simply becomes
p[n]*S[n]. The file [Link] contains a program based on filling an array p.
The effect of a vaccination campaign is illustrated in Fig. 4.14. All the data are
as in Fig. 4.13 (left), except that p is ten times stronger for a period of 10 days and
p D 0 elsewhere.
124 4 Solving Ordinary Differential Equations

Fig. 4.14 The effect of a vaccination campaign

4.3 Oscillating One-Dimensional Systems

Numerous engineering constructions and devices contain materials that act like
springs. Such springs give rise to oscillations, and controlling oscillations is a key
engineering task. We shall now learn to simulate oscillating systems.
As always, we start with the simplest meaningful mathematical model, which
for oscillations is a second-order differential equation:

u00 .t/ C ! 2 u.t/ D 0; (4.40)

where ! is a given physical parameter. Equation (4.40) models a one-dimensional


system oscillating without damping (i.e., with negligible damping). One-dimen-
sional here means that some motion takes place along one dimension only in some
coordinate system. Along with (4.40) we need the two initial conditions u.0/ and
u0 .0/.

4.3.1 Derivation of a Simple Model

Many engineering systems undergo oscillations, and differential equations consti-


tute the key tool to understand, predict, and control the oscillations. We start with
the simplest possible model that captures the essential dynamics of an oscillating
system. Some body with mass m is attached to a spring and moves along a line
without friction, see Fig. 4.15 for a sketch (rolling wheels indicate no friction).
When the spring is stretched (or compressed), the spring force pulls (or pushes) the
body back and work against the motion. More precisely, let x.t/ be the position
4.3 Oscillating One-Dimensional Systems 125

Fig. 4.15 Sketch of a one-dimensional, oscillating dynamic system (without friction)

of the body on the x axis, along which the body moves. The spring is not stretched
when x D 0, so the force is zero, and x D 0 is hence the equilibrium position of
the body. The spring force is kx, where k is a constant to be measured. We as-
sume that there are no other forces (e.g., no friction). Newtons 2nd law of motion
F D ma then has F D kx and a D x, R

 kx D mx;
R (4.41)

which can be rewritten as


xR C ! 2 x D 0; (4.42)
p
by introducing ! D k=m (which is very common).
Equation (4.42) is a second-order differential equation, and therefore we need
two initial conditions, one on the position x.0/ and one on the velocity x 0 .0/. Here
we choose the body to be at rest, but moved away from its equilibrium position:

x.0/ D X0 ; x 0 .0/ D 0 :

The exact solution of (4.42) with these initial conditions is x.t/ D X0 cos !t. This
can easily be verified by substituting into (4.42) and checking the initial conditions.
The solution tells that such a spring-mass system oscillates back and forth as de-
scribed by a cosine curve.
The differential equation (4.42) appears in numerous other contexts. A classical
example is a simple pendulum that oscillates back and forth. Physics books derive,
from Newtons second law of motion, that

mL 00 C mg sin  D 0;

where m is the mass of the body at the end of a pendulum with length L, g is the
acceleration of gravity, and  is the angle the pendulum makes with the vertical.
p
Considering small angles , sin   , and we get (4.42) with x D , ! D g=L,
x.0/ D , and x 0 .0/ D 0, if is the initial angle and the pendulum is at rest at
t D 0.
126 4 Solving Ordinary Differential Equations

4.3.2 Numerical Solution

We have not looked at numerical methods for handling second-order derivatives,


and such methods are an option, but we know how to solve first-order differential
equations and even systems of first-order equations. With a little, yet very common,
trick we can rewrite (4.42) as a first-order system of two differential equations. We
introduce u D x and v D x 0 D u0 as two new unknown functions. The two
corresponding equations arise from the definition v D u0 and the original equation
(4.42):

u0 D v; (4.43)
0
v D ! u :2
(4.44)

(Notice that we can use u00 D v 0 to remove the second-order derivative from New-
tons 2nd law.)
We can now apply the Forward Euler method to (4.43)(4.44), exactly as we did
in Sect. 4.2.2:

unC1  un
D vn ; (4.45)
t
v nC1  v n
D ! 2 un ; (4.46)
t
resulting in the computational scheme

unC1 D un C t v n ; (4.47)
v nC1
D v  t ! u :
n 2 n
(4.48)

4.3.3 Programming the Numerical Method; the Special Case

A simple program for (4.47)(4.48) follows the same ideas as in Sect. 4.2.3:

from numpy import zeros, linspace, pi, cos, array


import [Link] as plt

omega = 2
P = 2*pi/omega
dt = P/20
T = 3*P
N_t = int(round(T/dt))
t = linspace(0, N_t*dt, N_t+1)

u = zeros(N_t+1)
v = zeros(N_t+1)

# Initial condition
X_0 = 2
u[0] = X_0
v[0] = 0
4.3 Oscillating One-Dimensional Systems 127

# Step equations forward in time


for n in range(N_t):
u[n+1] = u[n] + dt*v[n]
v[n+1] = v[n] - dt*omega**2*u[n]

fig = [Link]()
l1, l2 = [Link](t, u, b-, t, X_0*cos(omega*t), r--)
[Link]((l1, l2), (numerical, exact), upper left)
[Link](t)
[Link]()
[Link]([Link]); [Link]([Link])

(See file osc_FE.py.)


Since we already know the exact solution as u.t/ D X0 cos !t, we have reasoned
as follows to find an appropriate simulation interval 0; T  and also how many points
we should choose. The solution has a period P D 2=!. (The period P is the time
difference between two peaks of the u.t/
cos !t curve.) Simulating for three
periods of the cosine function, T D 3P , and choosing t such that there are 20
intervals per period gives t D P =20 and a total of N t D T =t intervals. The rest
of the program is a straightforward coding of the Forward Euler scheme.
Figure 4.16 shows a comparison between the numerical solution and the exact
solution of the differential equation. To our surprise, the numerical solution looks
wrong. Is this discrepancy due to a programming error or a problem with the For-
ward Euler method?
First of all, even before trying to run the program, you should sit down and
compute two steps in the time loop with a calculator so you have some intermediate
results to compare with. Using X0 D 2, dt D 0:157079632679, and ! D 2, we

Fig. 4.16 Simulation of an oscillating system


128 4 Solving Ordinary Differential Equations

get u1 D 2, v 1 D 1:25663706, u2 D 1:80260791, and v 2 D 2:51327412. Such


calculations show that the program is seemingly correct. (Later, we can use such
values to construct a unit test and a corresponding test function.)
The next step is to reduce the discretization parameter t and see if the results
become more accurate. Figure 4.17 shows the numerical and exact solution for
the cases t D P =40; P =160; P =2000. The results clearly become better, and
the finest resolution gives graphs that cannot be visually distinguished. Neverthe-
less, the finest resolution involves 6000 computational intervals in total, which is
considered quite much. This is no problem on a modern laptop, however, as the
computations take just a fraction of a second.
Although 2000 intervals per oscillation period seem sufficient for an accurate
numerical solution, the lower right graph in Fig. 4.17 shows that if we increase the
simulation time, here to 20 periods, there is a little growth of the amplitude, which
becomes significant over time. The conclusion is that the Forward Euler method
has a fundamental problem with its growing amplitudes, and that a very small t
is required to achieve satisfactory results. The longer the simulation is, the smaller
t has to be. It is certainly time to look for more effective numerical methods!

Fig. 4.17 Simulation of an oscillating system with different time steps. Upper left: 40 steps per
oscillation period. Upper right: 160 steps per period. Lower left: 2000 steps per period. Lower
right: 2000 steps per period, but longer simulation
4.3 Oscillating One-Dimensional Systems 129

4.3.4 A Magic Fix of the Numerical Method

In the Forward Euler scheme,

unC1 D un C t v n ;
v nC1 D v n  t ! 2 un ;

we can replace un in the last equation by the recently computed value unC1 from
the first equation:

unC1 D un C t v n ; (4.49)
v nC1
D v  t ! u
n 2 nC1
: (4.50)

Before justifying this fix more mathematically, let us try it on the previous exam-
ple. The results appear in Fig. 4.18. We see that the amplitude does not grow, but the
phase is not entirely correct. After 40 periods (Fig. 4.18 right) we see a significant
difference between the numerical and the exact solution. Decreasing t decreases
the error. For example, with 2000 intervals per period, we only see a small phase
error even after 50,000 periods (!). We can safely conclude that the fix results in an
excellent numerical method!
Let us interpret the adjusted scheme mathematically. First we order (4.49)(4.50)
such that the difference approximations to derivatives become transparent:

unC1  un
D vn ; (4.51)
t
v nC1  v n
D ! 2 unC1 : (4.52)
t
We interpret (4.51) as the differential equation sampled at mesh point tn , because
we have v n on the right-hand side. The left-hand side is then a forward difference or
Forward Euler approximation to the derivative u0 , see Fig. 4.2. On the other hand,
we interpret (4.52) as the differential equation sampled at mesh point tnC1 , since we

Fig. 4.18 Adjusted method: first three periods (left) and period 3640 (right)
130 4 Solving Ordinary Differential Equations

have unC1 on the right-hand side. In this case, the difference approximation on the
left-hand side is a backward difference,
v nC1  v n v n  v n1
v 0 .tnC1 /  or v 0 .tn /  :
t t
Figure 4.19 illustrates the backward difference. The error in the backward differ-
ence is proportional to t, the same as for the forward difference (but the propor-
tionality constant in the error term has different sign). The resulting discretization
method for (4.52) is often referred to as a Backward Euler scheme.
To summarize, using a forward difference for the first equation and a backward
difference for the second equation results in a much better method than just using
forward differences in both equations.
The standard way of expressing this scheme in physics is to change the order of
the equations,
v 0 D ! 2 u; (4.53)
u0 D v; (4.54)
and apply a forward difference to (4.53) and a backward difference to (4.54):
v nC1 D v n  t ! 2 un ; (4.55)
u nC1
D u C t v
n nC1
: (4.56)
That is, first the velocity v is updated and then the position u, using the most re-
cently computed velocity. There is no difference between (4.55)(4.56) and (4.49)
(4.50) with respect to accuracy, so the order of the original differential equations
does not matter. The scheme (4.55)(4.56) goes under the names Semi-implicit
Euler4 or Euler-Cromer. The implementation of (4.55)(4.56) is found in the file
osc_EC.py. The core of the code goes like

Fig. 4.19 Illustration of a backward difference approximation to the derivative

4
[Link]
4.3 Oscillating One-Dimensional Systems 131

u = zeros(N_t+1)
v = zeros(N_t+1)

# Initial condition
u[0] = 2
v[0] = 0

# Step equations forward in time


for n in range(N_t):
v[n+1] = v[n] - dt*omega**2*u[n]
u[n+1] = u[n] + dt*v[n+1]

4.3.5 The 2nd-Order Runge-Kutta Method (or Heuns Method)

A very popular method for solving scalar and vector ODEs of first order is the
2nd-order Runge-Kutta method (RK2), also known as Heuns method. The idea,
first thinking of a scalar ODE, is to form a centered difference approximation to the
derivative between two time points:
1 unC1  un
u0 .tn C t/  :
2 t
The centered difference formula is visualized in Fig. 4.20. The error in the centered
difference is proportional to t 2 , one order higher than the forward and backward
differences, which means that if we halve t, the error is more effectively reduced
in the centered difference since it is reduced by a factor of four rather than two.
The problem with such a centered scheme for the general ODE u0 D f .u; t/ is
that we get
unC1  un 1
D f .unC 2 ; tnC 1 /;
t 2

1
which leads to difficulties since we do not know what unC 2 is. However, we can
approximate the value of f between two time levels by the arithmetic average of

Fig. 4.20 Illustration of a centered difference approximation to the derivative


132 4 Solving Ordinary Differential Equations

the values at tn and tnC1 :

1 1
f .unC 2 ; tnC 1 /  .f .un ; tn / C f .unC1 ; tnC1 // :
2 2
This results in

unC1  un 1
D .f .un ; tn / C f .unC1 ; tnC1 //;
t 2

which in general is a nonlinear algebraic equation for unC1 if f .u; t/ is not a lin-
ear function of u. To deal with the unknown term f .unC1 ; tnC1 /, without solving
nonlinear equations, we can approximate or predict unC1 using a Forward Euler
step:
unC1 D un C tf .un ; tn / :
This reasoning gives rise to the method

u D un C tf .un ; tn /; (4.57)


t
unC1 D un C .f .un ; tn / C f .u ; tnC1 // : (4.58)
2
The scheme applies to both scalar and vector ODEs.
For an oscillating system with f D .v; ! 2 u/ the file osc_Heun.py imple-
ments this method. The demo function in that file runs the simulation for 10 periods
with 20 time steps per period. The corresponding numerical and exact solutions are
shown in Fig. 4.21. We see that the amplitude grows, but not as much as for the
Forward Euler method. However, the Euler-Cromer method is much better!
We should add that in problems where the Forward Euler method gives sat-
isfactory approximations, such as growth/decay problems or the SIR model, the
2nd-order Runge-Kutta method or Heuns method, usually works considerably bet-
ter and produces greater accuracy for the same computational cost. It is therefore
a very valuable method to be aware of, although it cannot compete with the Euler-
Cromer scheme for oscillation problems. The derivation of the RK2/Heun scheme
is also good general training in numerical thinking.

4.3.6 Software for Solving ODEs

There is a jungle of methods for solving ODEs, and it would be nice to have
easy access to implementations of a wide range of methods, especially the sophis-
ticated and complicated adaptive methods that adjust t automatically to obtain
a prescribed accuracy. The Python package Odespy5 gives easy access to a lot of
numerical methods for ODEs.
The simplest possible example on using Odespy is to solve u0 D u, u.0/ D 2,
for 100 time steps until t D 4:

5
[Link]
4.3 Oscillating One-Dimensional Systems 133

Fig. 4.21 Simulation of 10 periods of oscillations by Heuns method

import odespy

def f(u, t):


return u

method = [Link] # or, e.g., [Link]


solver = method(f)
solver.set_initial_condition(2)
time_points = [Link](0, 4, 101)
u, t = [Link](time_points)

In other words, you define your right-hand side function f(u, t), initialize an
Odespy solver object, set the initial condition, compute a collection of time points
where you want the solution, and ask for the solution. The returned arrays u and t
can be plotted directly: plot(t, u).
A nice feature of Odespy is that problem parameters can be arguments to the
users f(u, t) function. For example, if our ODE problem is u0 D au C b, with
two problem parameters a and b, we may write our f function as

def f(u, t, a, b):


return -a*u + b

The extra, problem-dependent arguments a and b can be transferred to this function


if we collect their values in a list or tuple when creating the Odespy solver and use
the f_args argument:
134 4 Solving Ordinary Differential Equations

a = 2
b = 1
solver = method(f, f_args=[a, b])

This is a good feature because problem parameters must otherwise be global vari-
ables now they can be arguments in our right-hand side function in a natural way.
Exercise 4.16 asks you to make a complete implementation of this problem and plot
the solution.
Using Odespy to solve oscillation ODEs like u00 C ! 2 u D 0, reformulated as
a system u0 D v and v 0 D ! 2 u, is done as follows. We specify a given number
of time steps per period and compute the associated time steps and end time of the
simulation (T), given a number of periods to simulate:

import odespy

# Define the ODE system


# u = v
# v = -omega**2*u

def f(sol, t, omega=2):


u, v = sol
return [v, -omega**2*u]

# Set and compute problem dependent parameters


omega = 2
X_0 = 1
number_of_periods = 40
time_intervals_per_period = 20
from numpy import pi, linspace, cos
P = 2*pi/omega # length of one period
dt = P/time_intervals_per_period # time step
T = number_of_periods*P # final simulation time

# Create Odespy solver object


odespy_method = odespy.RK2
solver = odespy_method(f, f_args=[omega])

# The initial condition for the system is collected in a list


solver.set_initial_condition([X_0, 0])

# Compute the desired time points where we want the solution


N_t = int(round(T/dt)) # no of time intervals
time_points = linspace(0, T, N_t+1)

# Solve the ODE problem


sol, t = [Link](time_points)

# Note: sol contains both displacement and velocity


# Extract original variables
u = sol[:,0]
v = sol[:,1]

The last two statements are important since our two functions u and v in the ODE
system are packed together in one array inside the Odespy solver. The solution
4.3 Oscillating One-Dimensional Systems 135

of the ODE system is returned as a two-dimensional array where the first column
(sol[:,0]) stores u and the second (sol[:,1]) stores v. Plotting u and v is
a matter of running plot(t, u, t, v).

Remark
In the right-hand side function we write f(sol, t, omega) instead of f(u,
t, omega) to indicate that the solution sent to f is a solution at time t where
the values of u and v are packed together: sol = [u, v]. We might well use u
as argument:

def f(u, t, omega=2):


u, v = u
return [v, -omega**2*u]

This just means that we redefine the name u inside the function to mean the
solution at time t for the first component of the ODE system.

To switch to another numerical method, just substitute RK2 by the proper name
of the desired method. Typing pydoc odespy in the terminal window brings up
a list of all the implemented methods. This very simple way of choosing a method
suggests an obvious extension of the code above: we can define a list of methods,
run all methods, and compare their u curves in a plot. As Odespy also contains
the Euler-Cromer scheme, we rewrite the system with v 0 D ! 2 u as the first ODE
and u0 D v as the second ODE, because this is the standard choice when using the
Euler-Cromer method (also in Odespy):

def f(u, t, omega=2):


v, u = u
return [-omega**2*u, v]

This change of equations also affects the initial condition: the first component is
zero and second is X_0 so we need to pass the list [0, X_0] to solver.set_
initial_condition.
The code osc_odespy.py contains the details:

def compare(odespy_methods,
omega,
X_0,
number_of_periods,
time_intervals_per_period=20):

from numpy import pi, linspace, cos


P = 2*pi/omega # length of one period
dt = P/time_intervals_per_period
T = number_of_periods*P
136 4 Solving Ordinary Differential Equations

# If odespy_methods is not a list, but just the name of


# a single Odespy solver, we wrap that name in a list
# so we always have odespy_methods as a list
if type(odespy_methods) != type([]):
odespy_methods = [odespy_methods]

# Make a list of solver objects


solvers = [method(f, f_args=[omega]) for method in
odespy_methods]
for solver in solvers:
solver.set_initial_condition([0, X_0])

# Compute the time points where we want the solution


dt = float(dt) # avoid integer division
N_t = int(round(T/dt))
time_points = linspace(0, N_t*dt, N_t+1)

legends = []
for solver in solvers:
sol, t = [Link](time_points)
v = sol[:,0]
u = sol[:,1]

# Plot only the last p periods


p = 6
m = p*time_intervals_per_period # no time steps to plot
plot(t[-m:], u[-m:])
hold(on)
[Link]([Link]())
xlabel(t)
# Plot exact solution too
plot(t[-m:], X_0*cos(omega*t)[-m:], k--)
[Link](exact)
legend(legends, loc=lower left)
axis([t[-m], t[-1], -2*X_0, 2*X_0])
title(Simulation of %d periods with %d intervals per period
% (number_of_periods, time_intervals_per_period))
savefig([Link]); savefig([Link])
show()

A new feature in this code is the ability to plot only the last p periods, which allows
us to perform long time simulations and watch the end results without a cluttered
plot with too many periods. The syntax t[-m:] plots the last m elements in t
(a negative index in Python arrays/lists counts from the end).
We may compare Heuns method (or equivalently the RK2 method) with the
Euler-Cromer scheme:

compare(odespy_methods=[[Link], [Link]],
omega=2, X_0=2, number_of_periods=20,
time_intervals_per_period=20)

Figure 4.22 shows how Heuns method (the blue line with small disks) has consid-
erable error in both amplitude and phase already after 1420 periods (upper left),
but using three times as many time steps makes the curves almost equal (upper
4.3 Oscillating One-Dimensional Systems 137

Fig. 4.22 Illustration of the impact of resolution (time steps per period) and length of simulation

right). However, after 194200 periods the errors have grown (lower left), but can
be sufficiently reduced by halving the time step (lower right).
With all the methods in Odespy at hand, it is now easy to start exploring other
methods, such as backward differences instead of the forward differences used in
the Forward Euler scheme. Exercise 4.17 addresses that problem.
Odespy contains quite sophisticated adaptive methods where the user is guar-
anteed to get a solution with prescribed accuracy. There is no mathematical guar-
antee, but the error will for most cases not deviate significantly from the users
tolerance that reflects the accuracy. A very popular method of this type is the
Runge-Kutta-Fehlberg method, which runs a 4th-order Runge-Kutta method and
uses a 5th-order Runge-Kutta method to estimate the error so that t can be ad-
justed to keep the error below a tolerance. This method is also widely known as
ode45, because that is the name of the function implementing the method in Mat-
lab. We can easily test the Runge-Kutta-Fehlberg method as soon as we know the
corresponding Odespy name, which is RKFehlberg:

compare(odespy_methods=[[Link], [Link]],
omega=2, X_0=2, number_of_periods=200,
time_intervals_per_period=40)
138 4 Solving Ordinary Differential Equations

Fig. 4.23 Comparison of the Runge-Kutta-Fehlberg adaptive method against the Euler-Cromer
scheme for a long time simulation (200 periods)

Note that the time_intervals_per_period argument refers to the time points


where we want the solution. These points are also the ones used for numerical
computations in the [Link] solver, while the [Link]
solver will use an unknown set of time points since the time intervals are adjusted
as the method runs. One can easily look at the points actually used by the method as
these are available as an array solver.t_all (but plotting or examining the points
requires modifications inside the compare method).
Figure 4.23 shows a computational example where the Runge-Kutta-Fehlberg
method is clearly superior to the Euler-Cromer scheme in long time simulations, but
the comparison is not really fair because the Runge-Kutta-Fehlberg method applies
about twice as many time steps in this computation and performs much more work
per time step. It is quite a complicated task to compare two so different methods
in a fair way so that the computational work versus accuracy is scientifically well
reported.

4.3.7 The 4th-Order Runge-Kutta Method

The 4th-order Runge-Kutta method (RK4) is clearly the most widely used method
to solve ODEs. Its power comes from high accuracy even with not so small time
steps.
4.3 Oscillating One-Dimensional Systems 139

Fig. 4.24 The last 10 of 40 periods of oscillations by the 4th-order Runge-Kutta method

The algorithm We first just state the four-stage algorithm:

t  n 
f C 2fOnC 2 C 2fQnC 2 C fNnC1 ;
1 1
unC1 D un C (4.59)
6
where
 
1
fOnC 2 D f
1
u C t f ; tnC 1 ;
n n
(4.60)
2 2
 
1
fQnC 2 O
1
nC 12
D f u C t f
n
; tnC 1 ; (4.61)
2 2
 
fNnC1 D f un C t fQnC 2 ; tnC1 :
1
(4.62)

Application We can run the same simulation as in Figs. 4.16, 4.18, and 4.21, for 40
periods. The 10 last periods are shown in Fig. 4.24. The results look as impressive
as those of the Euler-Cromer method.

Implementation The stages in the 4th-order Runge-Kutta method can easily be


implemented as a modification of the osc_Heun.py code. Alternatively, one can
use the osc_odespy.py code by just providing the argument odespy_methods=
[odespy.RK4] to the compare function.

Derivation The derivation of the 4th-order Runge-Kutta method can be presented


in a pedagogical way that brings many fundamental elements of numerical dis-
cretization techniques together and that illustrates many aspects of numerical
thinking when constructing approximate solution methods.
140 4 Solving Ordinary Differential Equations

We start with integrating the general ODE u0 D f .u; t/ over a time step, from tn
to tnC1 ,
ZtnC1
u.tnC1 /  [Link] / D f .u.t/; t/dt :
tn

The goal of the computation is u.tnC1 / (u ), while [Link] / (un ) is the most recently
nC1

known value of u. The challenge with the integral is that the integrand involves the
unknown u between tn and tnC1 .
The integral can be approximated by the famous Simpsons rule6 :

ZtnC1
t  n 1

f .u.t/; t/dt  f C 4f nC 2 C f nC1 :
6
tn

1 1
The problem with this formula is that we do not know f nC 2 D f .unC 2 ; tnC 1 /
2
and f nC1 D .unC1 ; tnC1 / as only un is available and only f n can then readily be
computed.
1
To proceed, the idea is to use various approximations for f nC 2 and f nC1 based
on using well-known schemes for the ODE in the intervals tn ; tnC 1  and tn ; tnC1 .
2
Let us split the integral into four terms:

ZtnC1
t  n 
f C 2fOnC 2 C 2fQnC 2 C fNnC1 ;
1 1
f .u.t/; t/dt 
6
tn

where fOnC 2 , fQnC 2 , and fNnC1 are approximations to f nC 2 and f nC1 that can uti-
1 1 1

lize already computed quantities. For fOnC 2 we can simply apply an approximation
1

1
to unC 2 based on a Forward Euler step of size 12 t:
 
1
fOnC 2 D f un C t f n ; tnC 1
1
(4.63)
2 2

This formula provides a prediction of f nC 2 , so we can for fQnC 2 try a Backward


1 1

1
Euler method to approximate unC 2 :
 
1
fQnC 2 D f un C t fOnC 2 ; tnC 1 :
1 1
(4.64)
2 2

With fQnC 2 as an approximation to f nC 2 , we can for the final term fNnC1 use
1 1

a midpoint method (or central difference, also called a Crank-Nicolson method) to


approximate unC1 :
fNnC1 D f .un C t fOnC 2 ; tnC1 / :
1
(4.65)
We have now used the Forward and Backward Euler methods as well as the cen-
tered difference approximation in the context of Simpsons rule. The hope is that

6
[Link]
4.3 Oscillating One-Dimensional Systems 141

the combination of these methods yields an overall time-stepping scheme from tn


to tn C1 that is much more accurate than the individual steps which have errors pro-
portional to t and t 2 . This is indeed true: the numerical error goes in fact like
Ct 4 for a constant C , which means that the error approaches zero very quickly as
we reduce the time step size, compared to the Forward Euler method (error
t),
the Euler-Cromer method (error
t) or the 2nd-order Runge-Kutta, or Heuns,
method (error
t 2 ).
Note that the 4th-order Runge-Kutta method is fully explicit so there is never
any need to solve linear or nonlinear algebraic equations, regardless of what f
looks like. However, the stability is conditional and depends on f . There is a large
family of implicit Runge-Kutta methods that are unconditionally stable, but require
solution of algebraic equations involving f at each time step. The Odespy package
has support for a lot of sophisticated explicit Runge-Kutta methods, but not yet
implicit Runge-Kutta methods.

4.3.8 More Effects: Damping, Nonlinearity, and External Forces

Our model problem u00 C ! 2 u D 0 is the simplest possible mathematical model for
oscillating systems. Nevertheless, this model makes strong demands to numerical
methods, as we have seen, and is very useful as a benchmark for evaluating the
performance of numerical methods.
Real-life applications involve more physical effects, which lead to a differential
equation with more terms and also more complicated terms. Typically, one has
a damping force f .u0 / and a spring force s.u/. Both these forces may depend non-
linearly on their argument, u0 or u. In addition, environmental forces F .t/ may act
on the system. For example, the classical pendulum has a nonlinear spring or
restoring force s.u/
sin.u/, and air resistance on the pendulum leads to a damp-
ing force f .u0 /
ju0 ju0 . Examples on environmental forces include shaking of the
ground (e.g., due to an earthquake) as well as forces from waves and wind.
With three types of forces on the system: F , f , and s, the sum of forces is written
F .t/  f .u0 /  s.u/. Note the minus sign in front of f and s, which indicates
that these functions are defined such that they represent forces acting against the
motion. For example, springs attached to the wheels in a car are combined with
effective dampers, each providing a damping force f .u0 / D bu0 that acts against
the spring velocity u0 . The corresponding physical force is then f : bu0 , which
points downwards when the spring is being stretched (and u0 points upwards), while
f acts upwards when the spring is being compressed (and u0 points downwards).
Figure 4.25 shows an example of a mass m attached to a potentially nonlinear
spring and dashpot, and subject to an environmental force F .t/. Nevertheless, our
general model can equally well be a pendulum as in Fig. 4.26 with s.u/ D mg sin 
and f .u/P D 12 CD A%j P j
P (where CD D 0:4, A is the cross sectional area of the
body, and % is the density of air).
Newtons second law for the system can be written with the mass times acceler-
ation on the left-hand side and the forces on the right-hand side:

mu00 D F .t/  f .u0 /  s.u/ :


142 4 Solving Ordinary Differential Equations

Fig. 4.25 General oscillating system

Fig. 4.26 A pendulum with


forces

This equation is, however, more commonly reordered to

mu00 C f .u0 / C s.u/ D F .t/ : (4.66)

Because the differential equation is of second order, due to the term u00 , we need
two initial conditions:
u.0/ D U0 ; u0 .0/ D V0 : (4.67)
Note that with the choices f .u0 / D 0, p
s.u/ D ku, and F .t/ D 0 we recover the
original ODE u00 C ! 2 u D 0 with ! D k=m.
How can we solve (4.66)? As for the simple ODE u00 C ! 2 u D 0, we start by
rewriting the second-order ODE as a system of two first-order ODEs:
1
v0 D .F .t/  s.u/  f .v// ; (4.68)
m
u0 D v : (4.69)

The initial conditions become u.0/ D U0 and v.0/ D V0 .


4.3 Oscillating One-Dimensional Systems 143

Any method for a system of first-order ODEs can be used to solve for u.t/ and
v.t/.

The Euler-Cromer scheme An attractive choice from an implementational, ac-


curacy, and efficiency point of view is the Euler-Cromer scheme where we take
a forward difference in (4.68) and a backward difference in (4.69):

v nC1  v n 1
D .F .tn /  [Link] /  f .v n // ; (4.70)
t m
unC1  un
D v nC1 ; (4.71)
t

We can easily solve for the new unknowns v nC1 and unC1 :

t
v nC1 D v n C .F .tn /  [Link] /  f .v n // ; (4.72)
m
unC1 D un C tv nC1 : (4.73)

Remark on the ordering of the ODEs


The ordering of the ODEs in the ODE system is important for the extended
model (4.68)(4.69). Imagine that we write the equation for u0 first and then the
one for v 0 . The Euler-Cromer method would then first use a forward difference
for unC1 and then a backward difference for v nC1 . The latter would lead to
a nonlinear algebraic equation for v nC1 ,

t t  
v nC1 C f .v nC1 / D v n C F .tnC1 /  s.unC1 / ;
m m

if f .v/ is a nonlinear function of v. This would require a numerical method for


nonlinear algebraic equations to find v nC1 , while updating v nC1 through a for-
ward difference gives an equation for v nC1 that is linear and trivial to solve by
hand.

The file osc_EC_general.py has a function EulerCromer that implements this


method:

def EulerCromer(f, s, F, m, T, U_0, V_0, dt):


from numpy import zeros, linspace
N_t = int(round(T/dt))
print N_t:, N_t
t = linspace(0, N_t*dt, N_t+1)

u = zeros(N_t+1)
v = zeros(N_t+1)

# Initial condition
u[0] = U_0
v[0] = V_0
144 4 Solving Ordinary Differential Equations

# Step equations forward in time


for n in range(N_t):
v[n+1] = v[n] + dt*(1./m)*(F(t[n]) - f(v[n]) - s(u[n]))
u[n+1] = u[n] + dt*v[n+1]
return u, v, t

The 4-th order Runge-Kutta method The RK4 method just evaluates the right-
hand side of the ODE system,
1
. .F .t/  s.u/  f .v// ; v/
m
for known values of u, v, and t, so the method is very simple to use regardless of
how the functions s.u/ and f .v/ are chosen.

4.3.9 Illustration of Linear Damping

We consider an engineering system with a linear spring, s.u/ D kx, and a viscous
damper, where the damping force is proportional to u0 , f .u0 / D bu0 , for some
constant b > 0. This choice may model the vertical spring system in a car (but
engineers often like to illustrate such a system by a horizontal moving mass like
the one depicted in Fig. 4.25). We may choose simple values for the constants to
illustrate basic effects of damping (and later excitations). Choosing the oscillations
to be the simple u.t/ D cos t function in the undamped case, we may set m D 1,
k D 1, b D 0:3, U0 D 1, V0 D 0. The following function implements this case:

def linear_damping():
b = 0.3
f = lambda v: b*v
s = lambda u: k*u
F = lambda t: 0

m = 1
k = 1
U_0 = 1
V_0 = 0

T = 12*pi
dt = T/5000.

u, v, t = EulerCromer(f=f, s=s, F=F, m=m, T=T,


U_0=U_0, V_0=V_0, dt=dt)
plot_u(u, t)

The plot_u function is a collection of plot statements for plotting u.t/, or a part
of it. Figure 4.27 shows the effect of the bu0 term: we have oscillations with (an
approximate) period 2, as expected, but the amplitude is efficiently damped.

Remark about working with a scaled problem


Instead of setting b D 0:3 and m D k D U0 D 1 as fairly unlikely physical
values, it would be better to scale the equation mu00 Cbu0 Cku D 0. This means
4.3 Oscillating One-Dimensional Systems 145

Fig. 4.27 Effect of linear damping

that we introduce dimensionless independent and dependent variables:

t u
tN D ; uN D ;
tc uc

where tc and uc are characteristic sizes of time and displacement, respectively,


such that tN and uN have their typicalpsize around unity. In the present problem,
we can choose uc D U0 and tc D m=k. This gives the following scaled (or
dimensionless) problem for the dimensionless quantity u. N tN/:

d 2 uN d uN b
C C uN D 0; N
u.0/ D 1; uN 0 .0/ D 0; Dp :
d tN2 d tN mk

The striking fact is that there is only one physical parameter in this problem:
the dimensionless number . Solving this problem corresponds to solving the
original problem (with dimensions) with the parameters m D k D U0 D 1 and
b D . However, solving the dimensionless problem is more general: if we have
N tNI /, we can find the physical solution of a range of problems since
a solution u.
p 
u.t/ D U0 uN t k=mI :

As long as is fixed, we can find u for any U0 , k, and m from the above for-
mula! In this way, a time consuming simulation can be done only once, but still
provide many solutions. This demonstrates the power of working with scaled or
dimensionless problems.
146 4 Solving Ordinary Differential Equations

4.3.10 Illustration of Linear Damping with Sinusoidal Excitation

We now extend the previous example to also involve some external oscillating force
on the system: F .t/ D A [Link]/. Driving a car on a road with sinusoidal bumps
might give such an external excitation on the spring system in the car (w is related
to the velocity of the car).
With A D 0:5 and w D 3,

from math import pi, sin


w = 3
A = 0.5
F = lambda t: A*sin(w*t)

we get the graph in Fig. 4.28. The striking difference from Fig. 4.27 is that the
oscillations start out as a damped cos t signal without much influence of the external
force, but then the free oscillations of the undamped system (cos t) u00 C u D 0
die out and the external force 0:5 sin.3t/ induces oscillations with a shorter period
2=3. You are encouraged to play around with a larger A and switch from a sine to
a cosine in F and observe the effects. If you look this up in a physics book, you can
find exact analytical solutions to the differential equation problem in these cases.
A particularly interesting case arises when the excitation force has the same fre-
quency as the free oscillations of the undamped system, i.e., F .t/ D A sin t. With
the same amplitude A D 0:5, but a smaller damping b D 0:1, the oscillations in
Fig. 4.28 becomes qualitatively very different as the amplitude grows significantly
larger over some periods. This phenomenon is called resonance and is exemplified
in Fig. 4.29. Removing the damping results in an amplitude that grows linearly in
time.

Fig. 4.28 Effect of linear damping in combination with a sinusoidal external force
4.3 Oscillating One-Dimensional Systems 147

Fig. 4.29 Excitation force that causes resonance

4.3.11 Spring-Mass System with Sliding Friction

A body with mass m is attached to a spring with stiffness k while sliding on a plane
surface. The body is also subject to a friction force f .u0 / due to the contact between
the body and the plane. Figure 4.30 depicts the situation. The friction force f .u0 /
can be modeled by Coulomb friction:
8
0
< mg; u < 0;
0
f .u / D mg; u0 > 0;

:
0; u0 D 0

where  is the friction coefficient, and mg is the normal force on the surface where
the body slides. This formula can also be written as f .u0 / D mg sign.u0 /, pro-

Fig. 4.30 Sketch of a one-dimensional, oscillating dynamic system subject to sliding friction and
a spring force
148 4 Solving Ordinary Differential Equations

vided the signum function sign.x/ is defined to be zero for x D 0 ([Link] has
this property). To check that the signs in the definition of f are right, recall that the
actual physical force is f and this is positive (i.e., f < 0) when it works against
the body moving with velocity u0 < 0.
The nonlinear spring force is taken as

s.u/ D k 1 tanh.u/;

which is approximately ku for small u, but stabilizes at k= for large u.


Here is a plot with k D 1000 and u 2 0:1; 0:1 for three values:

If there is no external excitation force acting on the body, we have the equation
of motion
mu00 C mg sign.u0 / C k 1 tanh.u/ D 0 :
Let us simulate a situation where a body of mass 1 kg slides on a surface with
 D 0:4, while attached to a spring with stiffness k D 1000 kg=s2 . The initial
displacement of the body is 10 cm, and the parameter in s.u/ is set to 60 1/m.
Using the EulerCromer function from the osc_EC_general code, we can write
a function sliding_friction for solving this problem:

def sliding_friction():
from numpy import tanh, sign

f = lambda v: mu*m*g*sign(v)
alpha = 60.0
s = lambda u: k/alpha*tanh(alpha*u)
F = lambda t: 0

g = 9.81
mu = 0.4
m = 1
k = 1000
4.3 Oscillating One-Dimensional Systems 149

Fig. 4.31 Effect of nonlinear (left) and linear (right) spring on sliding friction

U_0 = 0.1
V_0 = 0

T = 2
dt = T/5000.

u, v, t = EulerCromer(f=f, s=s, F=F, m=m, T=T,


U_0=U_0, V_0=V_0, dt=dt)
plot_u(u, t)

Running the sliding_friction function gives us the results in Fig. 4.31 with
s.u/ D k 1 tanh.u/ (left) and the linearized version s.u/ D ku (right).

4.3.12 A finite Difference Method; Undamped, Linear Case

We shall now address numerical methods for the second-order ODE

u00 C ! 2 u D 0; u.0/ D U0 ; u0 .0/ D 0; t 2 .0; T ;

without rewriting the ODE as a system of first-order ODEs. The primary motivation
for yet another solution method is that the discretization principles result in a very
good scheme, and more importantly, the thinking around the discretization can be
reused when solving partial differential equations.
The main idea of this numerical method is to approximate the second-order
derivative u00 by a finite difference. While there are several choices of difference
approximations to first-order derivatives, there is one dominating formula for the
second-order derivative:

unC1  2un C un1


u00 .tn /  : (4.74)
t 2
The error in this approximation is proportional to t 2 . Letting the ODE be valid at
some arbitrary time point tn ,

u00 .tn / C ! 2 [Link] / D 0;


150 4 Solving Ordinary Differential Equations

we just insert the approximation (4.74) to get

unC1  2un C un1


D ! 2 un : (4.75)
t 2

We now assume that un1 and un are already computed and that unC1 is the new
unknown. Solving with respect to unC1 gives

unC1 D 2un  un1  t 2 ! 2 un : (4.76)

A major problem arises when we want to start the scheme. We know that u0 D
U0 , but applying (4.76) for n D 0 to compute u1 leads to

u1 D 2u0  u1  t 2 ! 2 u0 ; (4.77)

where we do not know u1 . The initial condition u0 .0/ D 0 can help us to eliminate
u1 - and this condition must anyway be incorporated in some way. To this end, we
discretize u0 .0/ D 0 by a centered difference,

u1  u1
u0 .0/  D 0:
2t

It follows that u1 D u1 , and we can use this relation to eliminate u1 in (4.77):

1
u1 D u0  t 2 ! 2 u0 : (4.78)
2

With u0 D U0 and u1 computed from (4.78), we can compute u2 , u3 , and so forth


from (4.76). Exercise 4.19 asks you to explore how the steps above are modified in
case we have a nonzero initial condition u0 .0/ D V0 .

Remark on a simpler method for computing u1


We could approximate the initial condition u0 .0/ by a forward difference:

u1  u0
u0 .0/  D 0;
t

leading to u1 D u0 . Then we can use (4.76) for the coming time steps. How-
ever, this forward difference has an error proportional to t, while the centered
difference we used has an error proportional to t 2 , which is compatible with
the accuracy (error goes like t 2 ) used in the discretization of the differential
equation.

The method for the second-order ODE described above goes under the name
Strmers method or Verlet integration7 . It turns out that this method is mathemat-
ically equivalent with the Euler-Cromer scheme (!). Or more precisely, the general
formula (4.76) is equivalent with the Euler-Cromer formula, but the scheme for the
7
[Link]
4.3 Oscillating One-Dimensional Systems 151

first time level (4.78) implements the initial condition u0 .0/ slightly more accurately
than what is naturally done in the Euler-Cromer scheme. The latter will do

v 1 D v 0  t! 2 u0 ; u1 D u0 C tv 1 D u0  t 2 ! 2 u0 ;

which differs from u1 in (4.78) by an amount 12 t 2 ! 2 u0 .


Because of the equivalence of (4.76) with the Euler-Cromer scheme, the numer-
ical results will have the same nice properties such as a constant amplitude. There
will be a phase error as in the Euler-Cromer scheme, but this error is effectively
reduced by reducing t, as already demonstrated.
The implementation of (4.78) and (4.76) is straightforward in a function (file
osc_2nd_order.py):

from numpy import zeros, linspace

def osc_2nd_order(U_0, omega, dt, T):


"""
Solve u + omega**2*u = 0 for t in (0,T], u(0)=U_0 and u(0)=0,
by a central finite difference method with time step dt.
"""
dt = float(dt)
Nt = int(round(T/dt))
u = zeros(Nt+1)
t = linspace(0, Nt*dt, Nt+1)

u[0] = U_0
u[1] = u[0] - 0.5*dt**2*omega**2*u[0]
for n in range(1, Nt):
u[n+1] = 2*u[n] - u[n-1] - dt**2*omega**2*u[n]
return u, t

4.3.13 A Finite Difference Method; Linear Damping

A key issue is how to generalize the scheme from Sect. 4.3.12 to a differential
equation with more terms. We start with the case of a linear damping term f .u0 / D
bu0 , a possibly nonlinear spring force s.u/, and an excitation force F .t/:

mu00 C bu0 C s.u/ D F .t/; u.0/ D U0 ; u0 .0/ D 0; t 2 .0; T  : (4.79)

We need to find the appropriate difference approximation to u0 in the bu0 term.


A good choice is the centered difference

unC1  un1
u0 .tn /  : (4.80)
2t
Sampling the equation at a time point tn ,

mu00 .tn / C bu0 .tn / C [Link] / D F .tn /;


152 4 Solving Ordinary Differential Equations

and inserting the finite difference approximations to u00 and u0 results in

unC1  2un C un1 unC1  un1


m 2
Cb C [Link] / D F n ; (4.81)
t 2t

where F n is a short notation for F .tn /. Equation (4.81) is linear in the unknown
unC1 , so we can easily solve for this quantity:
    1
b b
unC1 D 2mun C t  m un1 C t 2 .F n  [Link] // m C t :
2 2
(4.82)
As in the case without damping, we need to derive a special formula for u1 . The
initial condition u0 .0/ D 0 implies also now that u1 D u1 , and with (4.82) for
n D 0, we get
t 2 0
u1 D u0 C .F  s.u0 // : (4.83)
2m
In the more general case with a nonlinear damping term f .u0 /,

mu00 C f .u0 / C s.u/ D F .t/;

we get
 
unC1  2un C un1 unC1  un1
m Cf C [Link] / D F n ;
t 2 2t

which is a nonlinear algebraic equation for unC1 that must be solved by numerical
methods. A much more convenient scheme arises from using a backward difference
for u0 ,
un  un1
u0 .tn /  ;
t
because the damping term will then be known, involving only un and un1 , and we
can easily solve for unC1 .
The downside of the backward difference compared to the centered difference
(4.80) is that it reduces the order of the accuracy in the overall scheme from t 2
to t. In fact, the Euler-Cromer scheme evaluates a nonlinear damping term as
f .v n / when computing v nC1 , and this is equivalent to using the backward difference
above. Consequently, the convenience of the Euler-Cromer scheme for nonlinear
damping comes at a cost of lowering the overall accuracy of the scheme from sec-
ond to first order in t. Using the same trick in the finite difference scheme for
the second-order differential equation, i.e., using the backward difference in f .u0 /,
makes this scheme equally convenient and accurate as the Euler-Cromer scheme in
the general nonlinear case mu00 C f .u0 / C s.u/ D F .
4.4 Exercises 153

4.4 Exercises

Exercise 4.1: Geometric construction of the Forward Euler method


Section 4.1.4 describes a geometric interpretation of the Forward Euler method.
This exercise will demonstrate the geometric construction of the solution in detail.
Consider the differential equation u0 D u with u.0/ D 1. We use time steps t D
1.

a) Start at t D 0 and draw a straight line with slope u0 .0/ D u.0/ D 1. Go one
time step forward to t D t and mark the solution point on the line.
b) Draw a straight line through the solution point .t; u1 / with slope u0 .t/ D u1 .
Go one time step forward to t D 2t and mark the solution point on the line.
c) Draw a straight line through the solution point .2t; u2 / with slope u0 .2t/ D
u2 . Go one time step forward to t D 3t and mark the solution point on the
line.
d) Set up the Forward Euler scheme for the problem u0 D u. Calculate u1 , u2 , and
u3 . Check that the numbers are the same as obtained in a)-c).

Filename: ForwardEuler_geometric_solution.py.

Exercise 4.2: Make test functions for the Forward Euler method
The purpose of this exercise is to make a file test_ode_FE.py that makes use of
the ode_FE function in the file ode_FE.py and automatically verifies the imple-
mentation of ode_FE.

a) The solution computed by hand in Exercise 4.1 can be used as a reference so-
lution. Make a function test_ode_FE_1() that calls ode_FE to compute three
time steps in the problem u0 D u, u.0/ D 1, and compare the three values u1 ,
u2 , and u3 with the values obtained in Exercise 4.1.
b) The test in a) can be made more general using the fact that if f is linear in u and
does not depend on t, i.e., we have u0 D ru, for some constant r, the Forward
Euler method has a closed form solution as outlined in Sect. 4.1.1: un D U0 .1C
rt/n . Use this result to construct a test function test_ode_FE_2() that runs
a number of steps in ode_FE and compares the computed solution with the listed
formula for un .

Filename: test_ode_FE.py.

Exercise 4.3: Implement and evaluate Heuns method

a) A 2nd-order Runge-Kutta method, also known has Heuns method, is derived in


Sect. 4.3.5. Make a function ode_Heun(f, U_0, dt, T) (as a counterpart to
ode_FE(f, U_0, dt, T) in ode_FE.py) for solving a scalar ODE problem
u0 D f .u; t/, u.0/ D U0 , t 2 .0; T , with this method using a time step size
t.
b) Solve the simple ODE problem u0 D u, u.0/ D 1, by the ode_Heun and the
ode_FE function. Make a plot that compares Heuns method and the Forward
Euler method with the exact solution u.t/ D e t for t 2 0; 6. Use a time step
t D 0:5.
154 4 Solving Ordinary Differential Equations

c) For the case in b), find through experimentation the largest value of t where
the exact solution and the numerical solution by Heuns method cannot be dis-
tinguished visually. It is of interest to see how far off the curve the Forward
Euler method is when Heuns method can be regarded as exact (for visual
purposes).

Filename: ode_Heun.py.

Exercise 4.4: Find an appropriate time step; logistic model


Compute the numerical solution of the logistic equation for a set of repeatedly
halved time steps: tk D 2k t, k D 0; 1; : : :. Plot the solutions correspond-
ing to the last two time steps tk and tk1 in the same plot. Continue doing this
until you cannot visually distinguish the two curves in the plot. Then one has found
a sufficiently small time step.

Hint Extend the [Link] file. Introduce a loop over k, write out tk , and
ask the user if the loop is to be continued.
Filename: logistic_dt.py.

Exercise 4.5: Find an appropriate time step; SIR model


Repeat Exercise 4.4 for the SIR model.

Hint Import the ode_FE function from the ode_system_FE module and make
a modified demo_SIR function that has a loop over repeatedly halved time steps.
Plot S, I , and R versus time for the two last time step sizes in the same plot.
Filename: SIR_dt.py.

Exercise 4.6: Model an adaptive vaccination campaign


In the SIRV model with time-dependent vaccination from Sect. 4.2.9, we want to
test the effect of an adaptive vaccination campaign where vaccination is offered as
long as half of the population is not vaccinated. The campaign starts after  days.
That is, p D p0 if V < 12 .S 0 C I 0 / and t >  days, otherwise p D 0.
Demonstrate the effect of this vaccination policy: choose , , and
as in
Sect. 4.2.9, set p D 0:001,  D 10 days, and simulate for 200 days.

Hint This discontinuous p.t/ function is easiest implemented as a Python function


containing the indicated if test. You may use the file [Link] as starting point,
but note that it implements a time-dependent p.t/ via an array.
Filename: SIRV_p_adapt.py.

Exercise 4.7: Make a SIRV model with time-limited effect of vaccination


We consider the SIRV model from Sect. 4.2.8, but now the effect of vaccination is
time-limited. After a characteristic period of time, , the vaccination is no more
effective and individuals are consequently moved from the V to the S category and
can be infected again. Mathematically, this can be modeled as an average leakage
 1 V from the V category to the S category (i.e., a gain  1 V in the latter).
4.4 Exercises 155

Write up the complete model, implement it, and rerun the case from Sect. 4.2.8
with various choices of parameters to illustrate various effects.
Filename: SIRV1_V2S.py.

Exercise 4.8: Refactor a flat program


Consider the file osc_FE.py implementing the Forward Euler method for the os-
cillating system model (4.43)(4.44). The osc_FE.py is what we often refer to as
a flat program, meaning that it is just one main program with no functions. To eas-
ily reuse the numerical computations in other contexts, place the part that produces
the numerical solution (allocation of arrays, initializing the arrays at time zero, and
the time loop) in a function osc_FE(X_0, omega, dt, T), which returns u, v,
t. Place the particular computational example in osc_FE.py in a function demo().
Construct the file osc_FE_func.py such that the osc_FE function can easily be
reused in other programs. In Python, this means that osc_FE_func.py is a module
that can be imported in other programs. The requirement of a module is that there
should be no main program, except in the test block. You must therefore call demo
from a test block (i.e., the block after if __name__ == __main__).
Filename: osc_FE_func.py.

Exercise 4.9: Simulate oscillations by a general ODE solver


Solve the system (4.43)(4.44) using the general solver ode_FE in the file ode_
system_FE.py described in Sect. 4.2.6. Program the ODE system and the call to
the ode_FE function in a separate file osc_ode_FE.py.
Equip this file with a test function that reads a file with correct u values and
compares these with those computed by the ode_FE function. To find correct u
values, modify the program osc_FE.py to dump the u array to file, run osc_FE.py,
and let the test function read the reference results from that file.
Filename: osc_ode_FE.py.

Exercise 4.10: Compute the energy in oscillations

a) Make a function osc_energy(u, v, omega) for returning the potential and


kinetic energy of an oscillating system described by (4.43)(4.44). The potential
energy is taken as 12 ! 2 u2 while the kinetic energy is 12 v 2 . (Note that these
expressions are not exactly the physical potential and kinetic energy, since these
would be 12 mv 2 and 12 ku2 for a model mx 00 C kx D 0.)
Place the osc_energy in a separate file osc_energy.py such that the function
can be called from other functions.
b) Add a call to osc_energy in the programs osc_FE.py and osc_EC.py and plot
the sum of the kinetic and potential energy. How does the total energy develop
for the Forward Euler and the Euler-Cromer schemes?

Filenames: osc_energy.py, osc_FE_energy.py, osc_EC_energy.py.


156 4 Solving Ordinary Differential Equations

Exercise 4.11: Use a Backward Euler scheme for population growth


We consider the ODE problem N 0 .t/ D rN.t/, N.0/ D N0 . At some time,
tn D nt, we can approximate the derivative N 0 .tn / by a backward difference,
see Fig. 4.19:

[Link] /  [Link]  t/ N n  N n1


N 0 .tn /  D ;
t t
which leads to
N n  N n1
D rN n ;
t
called the Backward Euler scheme.

a) Find an expression for the N n in terms of N n1 and formulate an algorithm for
computing N n , n D 1; 2; : : : ; N t .
b) Implement the algorithm in a) in a function growth_BE(N_0, dt, T) for solv-
ing N 0 D rN , N.0/ D N0 , t 2 .0; T , with time step t (dt).
c) Implement the Forward Euler scheme in a function growth_FE(N_0, dt, T)
as described in b).
d) Compare visually the solution produced by the Forward and Backward Euler
schemes with the exact solution when r D 1 and T D 6. Make two plots, one
with t D 0:5 and one with t D 0:05.

Filename: growth_BE.py.

Exercise 4.12: Use a Crank-Nicolson scheme for population growth


It is recommended to do Exercise 4.11 prior to the present one. Here we look at the
same population growth model N 0 .t/ D rN.t/, N.0/ D N0 . The time derivative
N 0 .t/ can be approximated by various types of finite differences. Exercise 4.11
considers a backward difference (Fig. 4.19), while Sect. 4.1.2 explained the forward
difference (Fig. 4.2). A centered difference is more accurate than a backward or
forward difference:

1 [Link] C t/  [Link] / N nC1  N n


N 0 .tn C t/  D :
2 t t

This type of difference, applied at the point tnC 1 D tn C 12 t, is illustrated geomet-
2
rically in Fig. 4.20.

a) Insert the finite difference approximation in the ODE N 0 D rN and solve for
the unknown N nC1 , assuming N n is already computed and hence known. The
resulting computational scheme is often referred to as a Crank-Nicolson scheme.
b) Implement the algorithm in a) in a function growth_CN(N_0, dt, T) for solv-
ing N 0 D rN , N.0/ D N0 , t 2 .0; T , with time step t (dt).
4.4 Exercises 157

c) Make plots for comparing the Crank-Nicolson scheme with the Forward and
Backward Euler schemes in the same test problem as in Exercise 4.11.

Filename: growth_CN.py.

Exercise 4.13: Understand finite differences via Taylor series


The Taylor series around a point x D a can for a function f .x/ be written

d 1 d2
f .x/ D f .a/ C f .a/.x  a/ C f .a/.x  a/2
dx 2 dx 2
1 d3
C f .a/.x  a/3 C : : :
3 dx 3
X 1
1 di
D i
f .a/.x  a/i :
i D0
i dx

For a function of time, as addressed in our ODE problems, we would use u instead
of f , t instead of x, and a time point tn instead of a:

d 1 d2
u.t/ D [Link] / C [Link] /.t  tn / C [Link] /.t  tn /2
dt 2 dt 2
1 d3
C [Link] /.t  tn /3 C : : :
3 dt 3
X 1
1 di
D i
[Link] /.t  tn /i :
i D0
i dt

a) A forward finite difference approximation to the derivative f 0 .a/ reads


[Link] C t/  [Link] /
u0 .tn /  :
t
We can justify this formula mathematically through Taylor series. Write up the
Taylor series for [Link] C t/ (around t D tn , as given above), and then solve
the expression with respect to u0 .tn /. Identify, on the right-hand side, the finite
difference approximation and an infinite series. This series is then the error in
the finite difference approximation. If t is assumed small (i.e. t << 1), t
will be much larger than t 2 , which will be much larger than t 3 , and so on.
The leading order term in the series for the error, i.e., the error with the least
power of t is a good approximation of the error. Identify this term.
b) Repeat a) for a backward difference:
[Link] /  [Link]  t/
u0 .tn /  :
t
This time, write up the Taylor series for [Link] t/ around tn . Solve with respect
to u0 .tn /, and identify the leading order term in the error. How is the error
compared to the forward difference?
158 4 Solving Ordinary Differential Equations

c) A centered difference approximation to the derivative, as explored in Exer-


cise 4.12, can be written

1 [Link] C t/  [Link] /


u0 .tn C t/  :
2 t

Write up the Taylor series for [Link] / around tn C 12 t and the Taylor series for
[Link] C t/ around tn C 12 t. Subtract the two series, solve with respect to
u0 .tn C 12 t/, identify the finite difference approximation and the error terms on
the right-hand side, and write up the leading order error term. How is this term
compared to the ones for the forward and backward differences?
d) Can you use the leading order error terms in a)-c) to explain the visual observa-
tions in the numerical experiment in Exercise 4.12?
e) Find the leading order error term in the following standard finite difference ap-
proximation to the second-order derivative:

[Link] C t/  [Link] / C [Link]  t/


u00 .tn /  :
t
Hint Express [Link] t/ via Taylor series and insert them in the difference formula.
Filename: Taylor_differences.pdf.

Exercise 4.14: Use a Backward Euler scheme for oscillations


Consider (4.43)(4.44) modeling an oscillating engineering system. This 22 ODE
system can be solved by the Backward Euler scheme, which is based on discretizing
derivatives by collecting information backward in time. More specifically, u0 .t/ is
approximated as
u.t/  u.t  t/
u0 .t/  :
t
A general vector ODE u0 D f .u; t/, where u and f are vectors, can use this
approximation as follows:

un  un1
D f .un ; tn /;
t
which leads to an equation for the new value un :

un  tf .un ; tn / D un1 :

For a general f , this is a system of nonlinear algebraic equations.


However, the ODE (4.43)(4.44) is linear, so a Backward Euler scheme leads to
a system of two algebraic equations for two unknowns:

un  tv n D un1 ; (4.84)


v C t! u D v
n 2 n n1
: (4.85)
4.4 Exercises 159

a) Solve the system for un and v n .


b) Implement the found formulas for un and v n in a program for computing the
entire numerical solution of (4.43)(4.44).
c) Run the program with a t corresponding to 20 time steps per period of the
oscillations (see Sect. 4.3.3 for how to find such a t). What do you observe?
Increase to 2000 time steps per period. How much does this improve the solu-
tion?

Filename: osc_BE.py.

Remarks While the Forward Euler method applied to oscillation problems u00 C
! 2 u D 0 gives growing amplitudes, the Backward Euler method leads to signifi-
cantly damped amplitudes.

Exercise 4.15: Use Heuns method for the SIR model


Make a program that computes the solution of the SIR model from Sect. 4.2.1 both
by the Forward Euler method and by Heuns method (or equivalently: the 2nd-order
Runge-Kutta method) from Sect. 4.3.5. Compare the two methods in the simulation
case from Sect. 4.2.3. Make two comparison plots, one for a large and one for
a small time step. Experiment to find what large and small should be: the large
one gives significant differences, while the small one lead to very similar curves.
Filename: SIR_Heun.py.

Exercise 4.16: Use Odespy to solve a simple ODE


Solve
u0 D au C b; u.0/ D U0 ; t 2 .0; T 
by the Odespy software. Let the problem parameters a and b be arguments to the
right-hand side function that specifies the ODE to be solved. Plot the solution for
the case when a D 2, b D 1, T D 6=a, and we use 100 time intervals in 0; T .
Filename: odespy_demo.py.

Exercise 4.17: Set up a Backward Euler scheme for oscillations


Write the ODE u00 C ! 2 u D 0 as a system of two first-order ODEs and discretize
these with backward differences as illustrated in Fig. 4.19. The resulting method is
referred to as a Backward Euler scheme. Identify the matrix and right-hand side of
the linear system that has to be solved at each time level. Implement the method, ei-
ther from scratch yourself or using Odespy (the name is [Link]).
Demonstrate that contrary to a Forward Euler scheme, the Backward Euler scheme
leads to significant non-physical damping. The figure below shows that even with
60 time steps per period, the results after a few periods are useless:
160 4 Solving Ordinary Differential Equations

Filename: osc_BE.py.

Exercise 4.18: Set up a Forward Euler scheme for nonlinear and damped
oscillations
Derive a Forward Euler method for the ODE system (4.68)(4.69). Compare
the method with the Euler-Cromer scheme for the sliding friction problem from
Sect. 4.3.11:

1. Does the Forward Euler scheme give growing amplitudes?


2. Is the period of oscillation accurate?
3. What is the required time step size for the two methods to have visually coin-
ciding curves?

Filename: osc_FE_general.py.

Exercise 4.19: Discretize an initial condition


Assume that the initial condition on u0 is nonzero in the finite difference method
from Sect. 4.3.12: u0 .0/ D V0 . Derive the special formula for u1 in this case.
Filename: ic_with_V_0.pdf.

Open Access This chapter is distributed under the terms of the Creative Commons Attribution-
NonCommercial 4.0 International License ([Link]
which permits any noncommercial use, duplication, adaptation, distribution and reproduction
in any medium or format, as long as you give appropriate credit to the original author(s) and the
source, a link is provided to the Creative Commons license and any changes made are indicated.
The images or other third party material in this chapter are included in the works Creative
Commons license, unless indicated otherwise in the credit line; if such material is not included
in the works Creative Commons license and the respective action is not permitted by statutory
regulation, users will need to obtain permission from the license holder to duplicate, adapt or
reproduce the material.
Solving Partial Differential Equations
5

The subject of partial differential equations (PDEs) is enormous. At the same time,
it is very important, since so many phenomena in nature and technology find their
mathematical formulation through such equations. Knowing how to solve at least
some PDEs is therefore of great importance to engineers. In an introductory book
like this, nowhere near full justice to the subject can be made. However, we still
find it valuable to give the reader a glimpse of the topic by presenting a few basic
and general methods that we will apply to a very common type of PDE.
We shall focus on one of the most widely encountered partial differential equa-
tions: the diffusion equation, which in one dimension looks like
@u @2 u
D 2 Cg:
@t @x
The multi-dimensional counterpart is often written as
@u
D r 2 u C g :
@t
We shall restrict the attention here to the one-dimensional case.
The unknown in the diffusion equation is a function u.x; t/ of space and time.
The physical significance of u depends on what type of process that is described
by the diffusion equation. For example, u is the concentration of a substance if the
diffusion equation models transport of this substance by diffusion. Diffusion pro-
cesses are of particular relevance at the microscopic level in biology, e.g., diffusive
transport of certain ion types in a cell caused by molecular collisions. There is also
diffusion of atoms in a solid, for instance, and diffusion of ink in a glass of water.
One very popular application of the diffusion equation is for heat transport in
solid bodies. Then u is the temperature, and the equation predicts how the temper-
ature evolves in space and time within the solid body. For such applications, the
equation is known as the heat equation. We remark that the temperature in a fluid
is influenced not only by diffusion, but also by the flow of the liquid. If present,
the latter effect requires an extra term in the equation (known as an advection or
convection term).
The term g is known as the source term and represents generation, or loss, of heat
(by some mechanism) within the body. For diffusive transport, g models injection
or extraction of the substance.
The Author(s) 2016 161
S. Linge, H.P. Langtangen, Programming for Computations Python,
Texts in Computational Science and Engineering 15, DOI 10.1007/978-3-319-32428-9_5
162 5 Solving Partial Differential Equations

We should also mention that the diffusion equation may appear after simplifying
more complicated partial differential equations. For example, flow of a viscous fluid
between two flat and parallel plates is described by a one-dimensional diffusion
equation, where u then is the fluid velocity.
A partial differential equation is solved in some domain in space and for
a time interval 0; T . The solution of the equation is not unique unless we also
prescribe initial and boundary conditions. The type and number of such conditions
depend on the type of equation. For the diffusion equation, we need one initial con-
dition, u.x; 0/, stating what u is when the process starts. In addition, the diffusion
equation needs one boundary condition at each point of the boundary @ of .
This condition can either be that u is known or that we know the normal derivative,
ru  n D @u=@n (n denotes an outward unit normal to @).
Let us look at a specific application and how the diffusion equation with initial
and boundary conditions then appears. We consider the evolution of temperature in
a one-dimensional medium, more precisely a long rod, where the surface of the rod
is covered by an insulating material. The heat can then not escape from the surface,
which means that the temperature distribution will only depend on a coordinate
along the rod, x, and time t. At one end of the rod, x D L, we also assume that the
surface is insulated, but at the other end, x D 0, we assume that we have some de-
vice for controlling the temperature of the medium. Here, a function s.t/ tells what
the temperature is in time. We therefore have a boundary condition u.0; t/ D s.t/.
At the other insulated end, x D L, heat cannot escape, which is expressed by the
boundary condition @u.L; t/=@x D 0. The surface along the rod is also insulated
and hence subject to the same boundary condition (here generalized to @u=@n D 0
at the curved surface). However, since we have reduced the problem to one dimen-
sion, we do not need this physical boundary condition in our mathematical model.
In one dimension, we can set D 0; L.
To summarize, the partial differential equation with initial and boundary condi-
tions reads
@u.x; t/ @2 u.x; t/
D C g.x; t/; x 2 .0; L/ ;t 2 .0; T ; (5.1)
@t @x 2
u.0; t/ D s.t/; t 2 .0; T ; (5.2)
@
u.L; t/ D 0; t 2 .0; T ; (5.3)
@x
u.x; 0/ D I.x/; x 2 0; L : (5.4)

Mathematically, we assume that at t D 0, the initial condition (5.4) holds and that
the partial differential equation (5.1) comes into play for t > 0. Similarly, at the end
points, the boundary conditions (5.2) and (5.3) govern u and the equation therefore
is valid for x 2 .0; L/.

Boundary and initial conditions are needed!


The initial and boundary conditions are extremely important. Without them,
the solution is not unique, and no numerical method will work. Unfortunately,
many physical applications have one or more initial or boundary conditions as
unknowns. Such situations can be dealt with if we have measurements of u, but
the mathematical framework is much more complicated.
5.1 Finite Difference Methods 163

What about the source term g in our example with temperature distribution in
a rod? g.x; t/ models heat generation inside the rod. One could think of chemical
reactions at a microscopic level in some materials as a reason to include g. How-
ever, in most applications with temperature evolution, g is zero and heat generation
usually takes place at the boundary (as in our example with u.0; t/ D s.t/).
Before continuing, we may consider an example of how the temperature distri-
bution evolves in the rod. At time t D 0, we assume that the temperature is 10 C.
Then we suddenly apply a device at x D 0 that keeps the temperature at 50 C at
this end. What happens inside the rod? Intuitively, you think that the heat genera-
tion at the end will warm up the material in the vicinity of x D 0, and as time goes
by, more and more of the rod will be heated, before the entire rod has a temperature
of 50 C (recall that no heat escapes from the surface of the rod).
Mathematically, (with the temperature in Kelvin) this example has I.x/ D 283
K, except at the end point: I.0/ D 323 K, s.t/ D 323 K, and g D 0. The figure
below shows snapshots from four different times in the evolution of the temperature.

5.1 Finite Difference Methods

We shall now construct a numerical method for the diffusion equation. We know
how to solve ordinary differential equations, so in a way we are able to deal with
the time derivative. Very often in mathematics, a new problem can be solved by
reducing it to a series of problems we know how to solve. In the present case,
it means that we must do something with the spatial derivative @2 =@x 2 in order
164 5 Solving Partial Differential Equations

to reduce the partial differential equation to ordinary differential equations. One


important technique for achieving this, is based on finite difference discretization
of spatial derivatives.

5.1.1 Reduction of a PDE to a System of ODEs

Introduce a spatial mesh in with mesh points

x0 D 0 < x1 < x2 <    < xN D L :

The space between two mesh points xi and xi C1 , i.e. the interval xi ; xi C1 , is call
a cell. We shall here, for simplicity, assume that each cell has the same length
x D xi C1  xi , i D 0; : : : ; N  1.
The partial differential equation is valid at all spatial points x 2 , but we may
relax this condition and demand that it is fulfilled at the internal mesh points only,
x1 ; : : : ; xN 1 :

@[Link] ; t/ @2 [Link] ; t/
D C [Link] ; t/; i D 1; : : : ; N  1 : (5.5)
@t @x 2
Now, at any point xi we can approximate the second-order derivative by a finite
difference:
@2 [Link] ; t/ [Link] C1 ; t/  [Link] ; t/ C [Link] 1 ; t/
2
 : (5.6)
@x x 2
It is common to introduce a short notation ui .t/ for [Link] ; t/, i.e., u approximated at
some mesh point xi in space. With this new notation we can, after inserting (5.6)
in (5.5), write an approximation to the partial differential equation at mesh point
.xi ; t) as

dui .t/ ui C1 .t/  2ui .t/ C ui 1 .t/


D C gi .t/; i D 1; : : : ; N  1 : (5.7)
dt x 2
Note that we have adopted the notation gi .t/ for [Link] ; t/ too.
What is (5.7)? This is nothing but a system of ordinary differential equations in
N  1 unknowns u1 .t/; : : : ; uN 1 .t/! In other words, with aid of the finite differ-
ence approximation (5.6), we have reduced the single partial differential equation
to a system of ODEs, which we know how to solve. In the literature, this strategy is
called the method of lines.
We need to look into the initial and boundary conditions as well. The initial con-
dition u.x; 0/ D I.x/ translates to an initial condition for every unknown function
ui .t/: ui .0/ D [Link] /, i D 0; : : : ; N . At the boundary x D 0 we need an ODE in
our ODE system, which must come from the boundary condition at this point. The
boundary condition reads u.0; t/ D s.t/. We can derive an ODE from this equation
by differentiating both sides: u00 .t/ D s 0 .t/. The ODE system above cannot be used
for u00 since that equation involves some quantity u01 outside the domain. Instead,
we use the equation u00 .t/ D s 0 .t/ derived from the boundary condition. For this
particular equation we also need to make sure the initial condition is u0 .0/ D s.0/
(otherwise nothing will happen: we get u D 283 K forever).
5.1 Finite Difference Methods 165

We remark that a separate ODE for the (known) boundary condition u0 D s.t/
is not strictly needed. We can just work with the ODE system for u1 ; : : : ; uN , and
in the ODE for u0 , replace u0 .t/ by s.t/. However, these authors prefer to have an
ODE for every point value ui , i D 0; : : : ; N , which requires formulating the known
boundary at x D 0 as an ODE. The reason for including the boundary values in the
ODE system is that the solution of the system is then the complete solution at all
mesh points, which is convenient, since special treatment of the boundary values is
then avoided.
The condition @u=@x D 0 at x D L is a bit more complicated, but we can
approximate the spatial derivative by a centered finite difference:

@u uN C1  uN 1
 D 0:
@x i DN 2x

This approximation involves a fictitious point xN C1 outside the domain. A common


trick is to use (5.7) for i D N and eliminate uN C1 by use of the discrete boundary
condition (uN C1 D uN 1 ):

duN .t/ 2uN 1 .t/  2uN .t/


D C gN .t/ : (5.8)
dt x 2
That is, we have a special version of (5.7) at the boundary i D N .

What about simpler finite differences at the boundary?


Some reader may think that a smarter trick is to approximate the boundary con-
dition @u=@x at x D L by a one-sided difference:

@u uN  uN 1
 D 0:
@x i DN x

This gives a simple equation uN D uN 1 for the boundary value, and a corre-
sponding ODE u0N D u0N 1 . However, this approximation has an error of order
x, while the centered approximation we used above has an error of order x 2 .
The finite difference approximation we used for the second-order derivative in
the diffusion equation also has an error of order x 2 . Thus, if we use the sim-
pler one-sided difference above, it turns out that we reduce the overall accuracy
of the method.

We are now in a position to summarize how we can approximate the partial


differential equation problem (5.1)(5.4) by a system of ordinary differential equa-
tions:

du0
D s 0 .t/; (5.9)
dt
dui
D .ui C1 .t/  2ui .t/ C ui 1 .t// C gi .t/; i D 1; : : : ; N  1; (5.10)
dt x 2
duN 2
D .uN 1 .t/  uN .t// C gN .t/ : (5.11)
dt x 2
166 5 Solving Partial Differential Equations

The initial conditions are

u0 .0/ D s.0/; (5.12)


ui .0/ D [Link] /; i D 1; : : : ; N : (5.13)

We can apply any method for systems of ODEs to solve (5.9)(5.11).

5.1.2 Construction of a Test Problem with Known Discrete Solution

At this point, it is tempting to implement a real physical case and run it. However,
partial differential equations constitute a non-trivial topic where mathematical and
programming mistakes come easy. A better start is therefore to address a carefully
designed test example where we can check that the method works. The most attrac-
tive examples for testing implementations are those without approximation errors,
because we know exactly what numbers the program should produce. It turns out
that solutions u.x; t/ that are linear in time and in space can be exactly reproduced
by most numerical methods for partial differential equations. A candidate solution
might be
u.x; t/ D .3t C 2/.x  L/ :
Inserting this u in the governing equation gives

3.x  L/ D 0 C g.x; t/ ) g.x; t/ D 3.x  L/ :

What about the boundary conditions? We realize that @u=@x D 3t C 2 for x D L,


which breaks the assumption of @u=@x D 0 at x D L in the formulation of the
numerical method above. Moreover, u.0; t/ D L.3t C 2/, so we must set s.t/ D
L.3tC2/ and s 0 .t/ D 3L. Finally, the initial condition dictates I.x/ D 2.xL/,
but recall that we must have u0 D s.0/, and ui D [Link] /, i D 1; : : : ; N : it is
important that u0 starts out at the right value dictated by s.t/ in case I.0/ is not
equal this value.
First we need to generalize our method to handle @u=@x D 0 at x D L. We
then have

uN C1 .t/  uN 1 .t/
D ) uN C1 D uN 1 C 2 x;
2x
which inserted in (5.7) gives

duN .t/ 2uN 1 .t/ C 2 x  2uN .t/


D C gN .t/ : (5.14)
dt x 2

5.1.3 Implementation: Forward Euler Method

In particular, we may use the Forward Euler method as implemented in the


general function ode_FE in the module ode_system_FE from Sect. 4.2.6. The
ode_FE function needs a specification of the right-hand side of the ODE system.
5.1 Finite Difference Methods 167

This is a matter of translating (5.9), (5.10), and (5.14) to Python code (in file
test_diffusion_pde_exact_linear.py):

def rhs(u, t):


N = len(u) - 1
rhs = zeros(N+1)
rhs[0] = dsdt(t)
for i in range(1, N):
rhs[i] = (beta/dx**2)*(u[i+1] - 2*u[i] + u[i-1]) + \
g(x[i], t)
rhs[N] = (beta/dx**2)*(2*u[N-1] + 2*dx*dudx(t) -
2*u[N]) + g(x[N], t)
return rhs

def u_exact(x, t):


return (3*t + 2)*(x - L)

def dudx(t):
return (3*t + 2)

def s(t):
return u_exact(0, t)

def dsdt(t):
return 3*(-L)

def g(x, t):


return 3*(x-L)

Note that dudx(t) is the function representing the parameter in (5.14). Also note
that the rhs function relies on access to global variables beta, dx, L, and x, and
global functions dsdt, g, and dudx.
We expect the solution to be correct regardless of N and t, so we can choose
a small N , N D 4, and t D 0:1. A test function with N D 4 goes like

def test_diffusion_exact_linear():
global beta, dx, L, x # needed in rhs
L = 1.5
beta = 0.5
N = 4
x = linspace(0, L, N+1)
dx = x[1] - x[0]
u = zeros(N+1)

U_0 = zeros(N+1)
U_0[0] = s(0)
U_0[1:] = u_exact(x[1:], 0)
dt = 0.1
print dt

u, t = ode_FE(rhs, U_0, dt, T=1.2)


168 5 Solving Partial Differential Equations

tol = 1E-12
for i in range(0, [Link][0]):
diff = abs(u_exact(x, t[i]) - u[i,:]).max()
assert diff < tol, diff=%.16g % diff
print diff=%g at t=%g % (diff, t[i])

With N D 4 we reproduce the linear solution exactly. This brings confidence to the
implementation, which is just what we need for attacking a real physical problem
next.

Problems with reusing the rhs function


The rhs function must take u and t as arguments, because that is required by the
ode_FE function. What about the variables beta, dx, L, x, dsdt, g, and dudx
that the rhs function needs? These are global in the solution we have presented
so far. Unfortunately, this has an undesired side effect: we cannot import the rhs
function in a new file, define dudx and dsdt in this new file and get the imported
rhs to use these functions. The imported rhs will use the global variables,
including functions, in its own module.
How can we find solutions to this problem? Technically, we must pack the ex-
tra data beta, dx, L, x, dsdt, g, and dudx with the rhs function, which requires
more advanced programming considered beyond the scope of this text.
A class is the simplest construction for packing a function together with data,
see the beginning of Chapter 7 in [13] for a detailed example on how classes
can be used in such a context. Another solution in Python, and especially in
computer languages supporting functional programming, is so called closures.
They are also covered in Chapter 7 in the mentioned reference and behave in
a magic way. The third solution is to allow an arbitrary set of arguments for rhs
in a list to be transferred to ode_FE and then back to rhs. Appendix H.4 in [13]
explains the technical details.

5.1.4 Application: Heat Conduction in a Rod

Let us return to the case with heat conduction in a rod (5.1)(5.4). Assume that
the rod is 50 cm long and made of aluminum alloy 6082. The parameter equals
=.%c/, where is the heat conduction coefficient, % is the density, and c is the
heat capacity. We can find proper values for these physical quantities in the case of
aluminum alloy 6082: % D 2:7  103 kg/m3 , D 200 mK W , c D 900 J . This
Kkg
results in D =.%c/ D 8:2  105 m2 =s. Preliminary simulations show that we are
close to a constant steady state temperature after 1 h, i.e., T D 3600 s.
The rhs function from the previous section can be reused, only the functions s,
dsdt, g, and dudx must be changed (see file rod_FE.py):

def dudx(t):
return 0

def s(t):
return 323
5.1 Finite Difference Methods 169

def dsdt(t):
return 0

def g(x, t):


return 0

Parameters can be set as

L = 0.5
beta = 8.2E-5
N = 40
x = linspace(0, L, N+1)
dx = x[1] - x[0]
u = zeros(N+1)

U_0 = zeros(N+1)
U_0[0] = s(0)
U_0[1:] = 283

Let us use t D 0:00034375. We can now call ode_FE and then make an animation
on the screen to see how u.x; t/ develops in time:

t0 = [Link]()
from ode_system_FE import ode_FE
u, t = ode_FE(rhs, U_0, dt, T=1*60*60)
t1 = [Link]()
print CPU time: %.1fs % (t1 - t0)

# Make movie
import os
[Link](rm tmp_*.png)
import [Link] as plt
[Link]()
y = u[0,:]
lines = [Link](x, y)
[Link]([x[0], x[-1], 273, s(0)+10])
[Link](x)
[Link](u(x,t))
counter = 0
# Plot each of the first 100 frames, then increase speed by 10x
change_speed = 100
for i in range(0, [Link][0]):
print t[i]
plot = True if i <= change_speed else i % 10 == 0
lines[0].set_ydata(u[i,:])
if i > change_speed:
[Link]([t=%.0f 10x % t[i]])
else:
[Link]([t=%.0f % t[i]])
[Link]()
if plot:
[Link](tmp_%[Link] % counter)
counter += 1
#[Link](0.2)
170 5 Solving Partial Differential Equations

The plotting statements update the u.x; t/ curve on the screen. In addi-
tion, we save a fraction of the plots to files tmp_0000.png, tmp_0001.png,
tmp_0002.png, and so on. These plots can be combined to ordinary video files.
A common tool is ffmpeg or its sister avconv.
These programs take the same type of command-line options. To make a Flash
video [Link], run

Terminal

Terminal> ffmpeg -i tmp_%[Link] -r 4 -vcodec flv [Link]

The -i option specifies the naming of the plot files in printf syntax, and -r specifies
the number of frames per second in the movie. On Mac, run ffmpeg instead of
avconv with the same options. Other video formats, such as MP4, WebM, and Ogg
can also be produced:

Terminal

Terminal> ffmpeg -i tmp_%[Link] -r 4 -vcodec libx264 movie.mp4


Terminal> ffmpeg -i tmp_%[Link] -r 4 -vcodec libvpx [Link]
Terminal> ffmpeg -i tmp_%[Link] -r 4 -vcodec libtheora [Link]

The results of a simulation start out as in Figs. 5.1 and 5.2. We see that the solu-
tion definitely looks wrong. The temperature is expected to be smooth, not having
such a saw-tooth shape. Also, after some time (Fig. 5.2), the temperature starts to
increase much more than expected. We say that this solution is unstable, meaning
that it does not display the same characteristics as the true, physical solution. Even
though we tested the code carefully in the previous section, it does not seem to work
for a physical application! How can that be?
The problem is that t is too large, making the solution unstable. It turns out
that the Forward Euler time integration method puts a restriction on the size of t.
For the heat equation and the way we have discretized it, this restriction can be
shown to be [15]
x 2
t  : (5.15)
2
This is called a stability criterion. With the chosen parameters, (5.15) tells us that
the upper limit is t D 0:0003125, which is smaller than our choice above. Re-
running the case with a t equal to x 2 =.2/, indeed shows a smooth evolution of
u.x; t/. Find the program rod_FE.py and run it to see an animation of the u.x; t/
function on the screen.

Scaling and dimensionless quantities


Our setting of parameters required finding three physical properties of a certain
material. The time interval for simulation and the time step depend crucially on
the values for and L, which can vary significantly from case to case. Often, we
are more interested in how the shape of u.x; t/ develops, than in the actual u, x,
and t values for a specific material. We can then simplify the setting of physical
parameters by scaling the problem.
5.1 Finite Difference Methods 171

Fig. 5.1 Unstable simulation of the temperature in a rod

Fig. 5.2 Unstable simulation of the temperature in a rod


172 5 Solving Partial Differential Equations

Scaling means that we introduce dimensionless independent and dependent


variables, here denoted by a bar:
u  u x t
uN D ; xN D ; tN D ;
uc  u xc tc
where uc is a characteristic size of the temperature, u is some reference temper-
ature, while xc and tc are characteristic time and space scales. Here, it is natural
to choose u as the initial condition, and set uc to the stationary (end) temper-
ature. Then uN 2 0; 1, starting at 0 and ending at 1 as t ! 1. The length L
is xc , while choosing tc is more challenging, but one can argue for tc D L2 =.
The resulting equation for uN reads

@uN @2 uN
D ; xN 2 .0; 1/ :
@tN @xN 2
Note that in this equation, there are no physical parameters! In other words, we
have found a model that is independent of the length of the rod and the material
it is made of (!).
We can easily solve this equation with our program by setting D 1, L D 1,
I.x/ D 0, and s.t/ D 1. It turns out that the total simulation time (to infin-
ity) can be taken as 1.2. When we have the solution u. N tN/, the solution with
N x;
dimension Kelvin, reflecting the true temperature in our medium, is given by

u.x; t/ D u C .uc  u /u.x=L;


N t=L2/ :

Through this formula we can quickly generate the solutions for a rod made of
aluminum, wood, or rubber - it is just a matter of plugging in the right value.
Figure 5.3 shows four snapshots of the scaled (dimensionless) solution .Nx;
N tN/.
The power of scaling is to reduce the number of physical parameters in a prob-
lem, and in the present case, we found one single problem that is independent of
the material () and the geometry (L).

5.1.5 Vectorization

Occasionally in this book, we show how to speed up code by replacing loops over
arrays by vectorized expressions. The present problem involves a loop for comput-
ing the right-hand side:

for i in range(1, N):


rhs[i] = (beta/dx**2)*(u[i+1] - 2*u[i] + u[i-1]) + g(x[i], t)

This loop can be replaced by a vectorized expression with the following reasoning.
We want to set all the inner points at once: rhs[1:N-1] (this goes from index 1
up to, but not including, N). As the loop index i runs from 1 to N-1, the u[i+1]
term will cover all the inner u values displaced one index to the right (compared
to 1:N-1), i.e., u[2:N]. Similarly, u[i-1] corresponds to all inner u values dis-
placed one index to the left: u[0:N-2]. Finally, u[i] has the same indices as rhs:
u[1:N-1]. The vectorized loop can therefore be written in terms of slices:
5.1 Finite Difference Methods 173

Fig. 5.3 Snapshots of the dimensionless solution of a scaled problem

rhs[1:N-1] = (beta/dx**2)*(u[2:N+1] - 2*u[1:N] + u[0:N-1]) +


g(x[1:N], t)

This rewrite speeds up the code by about a factor of 10. A complete code is found
in the file rod_FE_vec.py.

5.1.6 Using Odespy to Solve the System of ODEs

Let us now show how to apply a general ODE package like Odespy (see Sect. 4.3.6)
to solve our diffusion problem. As long as we have defined a right-hand side func-
tion rhs this is very straightforward:

import odespy
solver = [Link](rhs)
solver.set_initial_condition(U_0)
T = 1.2
N_t = int(round(T/float(dt)))
time_points = linspace(0, T, N_t+1)
u, t = [Link](time_points)
174 5 Solving Partial Differential Equations

Fig. 5.4 Time steps used by the Runge-Kutta-Fehlberg method: error tolerance 103 (left) and
106 (right)

# Check how many time steps are required by adaptive vs


# fixed-step methods
if hasattr(solver, t_all):
print # time steps:, len(solver.t_all)
else:
print # time steps:, len(t)

The very nice thing is that we can now easily experiment with many different
integration methods. Trying out some simple ones first, like RK2 and RK4, quickly
reveals that the time step limitation of the Forward Euler scheme also applies to
these more sophisticated Runge-Kutta methods, but their accuracy is better. How-
ever, the Odespy package offers also adaptive methods. We can then specify a much
larger time step in time_points, and the solver will figure out the appropriate
step. Above we indicated how to use the adaptive Runge-Kutta-Fehlberg 45 solver.
While the t corresponding to the Forward Euler method requires over 8000 steps
for a simulation, we started the RKFehlberg method with 100 times this time step
and in the end it required just slightly more than 2500 steps, using the default tol-
erance parameters. Lowering the tolerance did not save any significant amount of
computational work. Figure 5.4 shows a comparison of the length of all the time
steps for two values of the tolerance. We see that the influence of the tolerance is mi-
nor in this computational example, so it seems that the blow-up due to instability is
what governs the time step size. The nice feature of this adaptive method is that we
can just specify when we want the solution to be computed, and the method figures
out on its own what time step that has to be used because of stability restrictions.
We have seen how easy it is to apply sophisticated methods for ODEs to this
PDE example. We shall take the use of Odespy one step further in the next section.

5.1.7 Implicit Methods

A major problem with the stability criterion (5.15) is that the time step becomes
very small if x is small. For example, halving x requires four times as many
time steps and eight times the work. Now, with N D 40, which is a reasonable
resolution for the test problem above, the computations are very fast. What takes
5.1 Finite Difference Methods 175

time, is the visualization on the screen, but for that purpose one can visualize only
a subset of the time steps. However, there are occasions when you need to take
larger time steps with the diffusion equation, especially if interest is in the long-
term behavior as t ! 1. You must then turn to implicit methods for ODEs. These
methods require the solutions of linear systems, if the underlying PDE is linear, and
systems of nonlinear algebraic equations if the underlying PDE is non-linear.
The simplest implicit method is the Backward Euler scheme, which puts no re-
strictions on t for stability, but obviously, a large t leads to inaccurate results.
The Backward Euler scheme for a scalar ODE u0 D f .u; t/ reads

unC1  un
D f .unC1 ; tnC1 / :
t

This equation is to be solved for unC1 . If f is linear in u, it is a linear equation,


but if f is nonlinear in u, one needs approximate methods for nonlinear equations
(Chap. 6).
In our case, we have a system of linear ODEs (5.9)(5.11). The Backward Euler
scheme applied to each equation leads to

unC1  un0
0
D s 0 .tnC1 /; (5.16)
t
unC1  uni
i
D .unC1  2unC1 C unC1
i 1 / C gi .tnC1 /; (5.17)
t x 2 i C1 i

i D 1; : : : ; N  1;
unC1  unN 2 nC1
N
D .u  unC1
N / C gi .tnC1 / : (5.18)
t x 2 N 1

This is a system of linear equations in the unknowns unC1i , i D 0; : : : ; N , which


is easy to realize by writing out the equations for the case N D 3, collecting all
the unknown terms on the left-hand side and all the known terms on the right-hand
side:

unC1
0 D un0 C t s 0 .tnC1 /; (5.19)

unC1
1  t .unC1  2unC1 C unC1
0 / D u1 C t g1 .tnC1 /;
n
(5.20)
x 2 2 1

2 nC1
unC1
2  t .u  unC1
2 / D u2 C t g2 .tnC1 / :
n
(5.21)
x 2 1

A system of linear equations like this, is usually written on matrix form Au D b,


where A is a coefficient matrix, u D .unC1 nC1
0 ; : : : ; nN / is the vector of unknowns,
and b is a vector of known values. The coefficient matrix for the case (5.19)(5.21)
becomes 0 1
1 0 0
B C
A D @ t x
2 1 C 2t x
2 t x
2 A
2 2
0 t x 2 1 C t x 2
176 5 Solving Partial Differential Equations

In the general case (5.16)(5.18), the coefficient matrix is an .N C 1/  .N C 1/


matrix with zero entries, except for

A1;1 D 1 (5.22)

Ai;i 1 D t ; i D 2; : : : ; N  1 (5.23)
x 2

Ai;i C1 D t ; i D 2; : : : ; N  1 (5.24)
x 2

Ai;i D 1 C 2t ; i D 2; : : : ; N  1 (5.25)
x 2
2
AN;N 1 D t (5.26)
x 2
2
AN;N D 1 C t (5.27)
x 2
If we want to apply general methods for systems of ODEs on the form u0 D
f .u; t/, we can assume a linear f .u; t/ D Ku. The coefficient matrix K is found
from the right-hand side of (5.16)(5.18) to be

K1;1 D 0 (5.28)

Ki;i 1 D ; i D 2; : : : ; N  1 (5.29)
x 2

Ki;i C1 D ; i D 2; : : : ; N  1 (5.30)
x 2
2
Ki;i D ; i D 2; : : : ; N  1 (5.31)
x 2
2
KN;N 1 D (5.32)
x 2
2
KN;N D (5.33)
x 2
We see that A D I  t K.
To implement the Backward Euler scheme, we can either fill a matrix and call
a linear solver, or we can apply Odespy. We follow the latter strategy. Implicit
methods in Odespy need the K matrix above, given as an argument jac (Jacobian
of f ) in the call to [Link]. Here is the Python code for the
right-hand side of the ODE system (rhs) and the K matrix (K) as well as state-
ments for initializing and running the Odespy solver BackwardEuler (in the file
rod_BE.py):

def rhs(u, t):


N = len(u) - 1
rhs = zeros(N+1)
rhs[0] = dsdt(t)
for i in range(1, N):
rhs[i] = (beta/dx**2)*(u[i+1] - 2*u[i] + u[i-1]) + \
g(x[i], t)
rhs[N] = (beta/dx**2)*(2*u[i-1] + 2*dx*dudx(t) -
2*u[i]) + g(x[N], t)
return rhs
5.2 Exercises 177

def K(u, t):


N = len(u) - 1
K = zeros((N+1,N+1))
K[0,0] = 0
for i in range(1, N):
K[i,i-1] = beta/dx**2
K[i,i] = -2*beta/dx**2
K[i,i+1] = beta/dx**2
K[N,N-1] = (beta/dx**2)*2
K[N,N] = (beta/dx**2)*(-2)
return K

import odespy
solver = [Link](rhs, f_is_linear=True, jac=K)
solver = [Link](rhs, f_is_linear=True, jac=K, theta=0.5)
solver.set_initial_condition(U_0)
T = 1*60*60
N_t = int(round(T/float(dt)))
time_points = linspace(0, T, N_t+1)
u, t = [Link](time_points)

The file rod_BE.py has all the details and shows a movie of the solution. We can
run it with any t we want, its size just impacts the accuracy of the first steps.

Odespy solvers apply dense matrices!


Looking at the entries of the K matrix, we realize that there are at maximum
three entries different from zero in each row. Therefore, most of the entries
are zeroes. The Odespy solvers expect dense square matrices as input, here
with .N C 1/  .N C 1/ elements. When solving the linear systems, a lot of
storage and work are spent on the zero entries in the matrix. It would be much
more efficient to store the matrix as a tridiagonal matrix and apply a specialized
Gaussian elimination solver for tridiagonal systems. Actually, this reduces the
work from the order N 3 to the order N .
In one-dimensional diffusion problems, the savings of using a tridiagonal ma-
trix are modest in practice, since the matrices are very small anyway. In two- and
three-dimensional PDE problems, however, one cannot afford dense square ma-
trices. Rather, one must resort to more efficient storage formats and algorithms
tailored to such formats, but this is beyond the scope of the present text.

5.2 Exercises

Exercise 5.1: Simulate a diffusion equation by hand


Consider the problem given by (5.9), (5.10) and (5.14). Set N D 2 and com-
pute u0i , u1i and u2i by hand for i D 0; 1; 2. Use these values to construct a test
function for checking that the implementation is correct. Copy useful functions
from test_diffusion_pde_exact_linear.py and make a new test function
test_diffusion_hand_calculation.
Filename: test_rod_hand_calculations.py.
178 5 Solving Partial Differential Equations

Exercise 5.2: Compute temperature variations in the ground


The surface temperature at the ground shows daily and seasonal oscillations. When
the temperature rises at the surface, heat is propagated into the ground, and the
coefficient in the diffusion equation determines how fast this propagation is. It
takes some time before the temperature rises down in the ground. At the surface,
the temperature has then fallen. We are interested in how the temperature varies
down in the ground because of temperature oscillations on the surface.
Assuming homogeneous horizontal properties of the ground, at least locally, and
no variations of the temperature at the surface at a fixed point of time, we can ne-
glect the horizontal variations of the temperature. Then a one-dimensional diffusion
equation governs the heat propagation along a vertical axis called x. The surface
corresponds to x D 0 and the x axis point downwards into the ground. There is
no source term in the equation (actually, if rocks in the ground are radioactive, they
emit heat and that can be modeled by a source term, but this effect is neglected
here).
At some depth x D L we assume that the heat changes in x vanish, so @u=@x D
0 is an appropriate boundary condition at x D L. We assume a simple sinusoidal
temperature variation at the surface:
 
2
u.0; t/ D T0 C Ta sin t ;
P

where P is the period, taken here as 24 hours (24  60  60 s). The coefficient may
be set to 106 m2 =s. Time is then measured in seconds. Set appropriate values for
T0 and Ta .

a) Show that the present problem has an analytical solution of the form

u.x; t/ D A C Be rx sin.!t  rx/;

for appropriate values of A, B, r, and !.


b) Solve this heat propagation problem numerically for some days and animate the
temperature. You may use the Forward Euler method in time. Plot both the
numerical and analytical solution. As initial condition for the numerical solu-
tion, use the exact solution during program development, and when the curves
coincide in the animation for all times, your implementation works, and you can
then switch to a constant initial condition: u.x; 0/ D T0 . For this latter initial
condition, how many periods of oscillations are necessary before there is a good
(visual) match between the numerical and exact solution (despite differences at
t D 0)?

Filename: ground_temp.py.

Exercise 5.3: Compare implicit methods


An equally stable, but more accurate method than the Backward Euler scheme, is
the so-called 2-step backward scheme, which for an ODE u0 D f .u; t/ can be
expressed by
3unC1  4un C un1
D f .unC1 ; tnC1 / :
2t
5.2 Exercises 179

The Odespy package offers this method as odespy.Backward2Step. The purpose


of this exercise is to compare three methods and animate the three solutions:

1. The Backward Euler method with t D 0:001


2. The backward 2-step method with t D 0:001
3. The backward 2-step method with t D 0:01

Choose the model problem from Sect. 5.1.4.


Filename: rod_BE_vs_B2Step.py.

Exercise 5.4: Explore adaptive and implicit methods


We consider the same problem as in Exercise 5.2. Now we want to explore the use
of adaptive and implicit methods from Odespy to see if they are more efficient than
the Forward Euler method. Assume that you want the accuracy provided by the
Forward Euler method with its maximum t value. Since there exists an analytical
solution, you can compute an error measure that summarizes the error in space and
time over the whole simulation:
s XX
E D xt .Uin  uni /2 :
i n

Here, Uin is the exact solution. Use the Odespy package to run the following implicit
and adaptive solvers:

1. BackwardEuler
2. Backward2Step
3. RKFehlberg

Experiment to see if you can use larger time steps than what is required by the
Forward Euler method and get solutions with the same order of accuracy.

Hint To avoid oscillations in the solutions when using the RKFehlberg method, the
rtol and atol parameters to RKFFehlberg must be set no larger than 0.001 and
0.0001, respectively. You can print out solver_RKF.t_all to see all the time steps
used by the RKFehlberg solver (if solver is the RKFehlberg object). You can then
compare the number of time steps with what is required by the other methods.
Filename: ground_temp_adaptive.py.

Exercise 5.5: Investigate the  rule

a) The Crank-Nicolson method for ODEs is very popular when combined with
diffusion equations. For a linear ODE u0 D au it reads

unC1  un 1
D .aun C aunC1 / :
t 2
Apply the Crank-Nicolson method in time to the ODE system for a one-
dimensional diffusion equation. Identify the linear system to be solved.
180 5 Solving Partial Differential Equations

b) The Backward Euler, Forward Euler, and Crank-Nicolson methods can be given
a unified implementation. For a linear ODE u0 D au this formulation is known
as the  rule:
unC1  un
D .1  /aun C aunC1 :
t
For  D 0 we recover the Forward Euler method,  D 1 gives the Backward
Euler scheme, and  D 1=2 corresponds to the Crank-Nicolson method. The
approximation error in the  rule is proportional to t, except for  D 1=2
where it is proportional to t 2 . For   1=2 the method is stable for all t.
Apply the  rule to the ODE system for a one-dimensional diffusion equation.
Identify the linear system to be solved.
c) Implement the  rule with aid of the Odespy package. The relevant object name
is ThetaRule:
solver = [Link](rhs, f_is_linear=True, jac=K, theta=0.5)

d) Consider the physical application from Sect. 5.1.4. Run this case with the  rule
and  D 1=2 for the following values of t: 0.001, 0.01, 0.05. Report what you
see.

Filename: rod_ThetaRule.py.

Remarks Despite the fact that the Crank-Nicolson method, or the  rule with  D
1=2, is theoretically more accurate than the Backward Euler and Forward Euler
schemes, it may exhibit non-physical oscillations as in the present example if the
solution is very steep. The oscillations are damped in time, and decreases with de-
creasing t. To avoid oscillations one must have t at maximum twice the stability
limit of the Forward Euler method. This is one reason why the Backward Euler
method (or a 2-step backward scheme, see Exercise 5.3) are popular for diffusion
equations with abrupt initial conditions.

Exercise 5.6: Compute the diffusion of a Gaussian peak


Solve the following diffusion problem:

@u @2 u
D 2; x 2 .1; 1/; t 2 .0; T  (5.34)
@t @x
 
1 x2
u.x; 0/ D p exp  2 ; x 2 1; 1; (5.35)
2 2
@
u.1; t/ D 0 t 2 .0; T ; (5.36)
@x
@
u.1; t/ D 0 t 2 .0; T  : (5.37)
@x
The initial condition is the famous and widely used Gaussian function with standard
deviation (or width) , which is here taken to be small, D 0:01, such that the
initial condition is a peak. This peak will then diffuse and become lower and wider.
Compute u.x; t/ until u becomes approximately constant over the domain.
Filename: gaussian_diffusion.py.
5.2 Exercises 181

Remarks Running the simulation with D 0:2 results in a constant solution u  1


as t ! 1, while one might expect from physics of diffusion that the solution
should approach zero. The reason is that we apply Neumann conditions as bound-
ary conditions. One can then easily show that the area under the u curve remains
constant. Integrating the PDE gives

Z1 Z1
@u @d 2 u
dx D dx :
@t @x 2
1 1

Using the Gauss divergence theorem on the integral on the right-hand and moving
the time-derivative outside the integral on the left-hand side results in

Z1  1
@ @du
u.x; t/dx D D 0:
@t @x 1
1

R1
(Recall that @u=@x D 0 at the end points.) The result means that 1 udx remains
constant during the simulation. Giving the PDE an interpretation in terms of heat
conduction can easily explain the result: with Neumann conditions no heat can
escape from the domain so the initial heat will just be evenly distributed, but not leak
out, so the temperature cannot go to zero (or the scaled and translated temperature
u, to be precise). The area under the initial condition is 1, so with a sufficiently fine
mesh, u ! 1, regardless of .

Exercise 5.7: Vectorize a function for computing the area of a polygon


Vectorize the implementation of the function for computing the area of a polygon
in Exercise 2.5. Make a test function that compares the scalar implementation in
Exercise 2.5 and the new vectorized implementation for the test cases used in Exer-
cise 2.5.
Pn1
Hint Notice that the formula x1 y2 C x2 y3 C    C xn1 yn D i D0 xi yi C1 is
the dot product of two vectors, x[:-1] and y[1:], which can be computed as
[Link](x[:-1], y[1:]), or more explicitly as [Link](x[:-1]*y[1:]).
Filename: polyarea_vec.py.

Exercise 5.8: Explore symmetry


One can observe (and also mathematically prove) that the solution u.x; t/ of the
problem in Exercise 5.6 is symmetric around x D 0: u.x; t/ D u.x; t/. In such
a case, we can split the domain in two and compute u in only one half, 1; 0
or 0; 1. At the symmetry line x D 0 we have the symmetry boundary condition
@u=@x D 0. Reformulate the problem in Exercise 5.6 such that we compute only
for x 2 0; 1. Display the solution and observe that it equals the right part of the
solution in Exercise 5.6.
Filename: symmetric_gaussian_diffusion.py.
182 5 Solving Partial Differential Equations

Remarks In 2D and 3D problems, where the CPU time to compute a solution of


PDE can be hours and days, it is very important to utilize symmetry as we do above
to reduce the size of the problem.
Also note the remarks in Exercise 5.6 about the constant area under the u.x; t/
curve: here, the area is 0.5 and u ! 0:5 as t ! 0:5 (if the mesh is sufficiently
fine - one will get convergence to smaller values for small if the mesh is not fine
enough to properly resolve a thin-shaped initial condition).

Exercise 5.9: Compute solutions as t ! 1


Many diffusion problems reach a stationary time-independent solution as t ! 1.
The model problem from Sect. 5.1.4 is one example where u.x; t/ D s.t/ D const
for t ! 1. When u does not depend on time, the diffusion equation reduces to

u00 .x/ D f .x/;

in one dimension, and


r 2 u D f .x/;
in 2D and 3D. This is the famous Poisson equation, or if f D 0, it is known as the
Laplace equation. In this limit t ! 1, there is no need for an initial condition, but
the boundary conditions are the same as for the diffusion equation.
We now consider a one-dimensional problem

 u00 .x/ D 0; x 2 .0; L/; u.0/ D C; u0 .L/ D 0; (5.38)

which is known as a two-point boundary value problem. This is nothing but the
stationary limit of the diffusion problem in Sect. 5.1.4. How can we solve such
a stationary problem (5.38)? The simplest strategy, when we already have a solver
for the corresponding time-dependent problem, is to use that solver and simulate
until t ! 1, which in practice means that u.x; t/ no longer changes in time (within
some tolerance).
A nice feature of implicit methods like the Backward Euler scheme is that one
can take one very long time step to infinity and produce the solution of (5.38).

a) Let (5.38) be valid at mesh points xi in space, discretize u00 by a finite difference,
and set up a system of equations for the point values ui ,i D 0; : : : ; N , where ui
is the approximation at mesh point xi .
b) Show that if t ! 1 in (5.16) - (5.18), it leads to the same equations as in a).
c) Demonstrate, by running a program, that you can take one large time step with
the Backward Euler scheme and compute the solution of (5.38). The solution is
very boring since it is constant: u.x/ D C .

Filename: rod_stationary.py.

Remarks If the interest is in the stationary limit of a diffusion equation, one can
either solve the associated Laplace or Poisson equation directly, or use a Backward
Euler scheme for the time-dependent diffusion equation with a very long time step.
Using a Forward Euler scheme with small time steps is typically inappropriate in
5.2 Exercises 183

such situations because the solution changes more and more slowly, but the time
step must still be kept small, and it takes forever to approach the stationary state.
This is yet another example why one needs implicit methods like the Backward
Euler scheme.

Exercise 5.10: Solve a two-point boundary value problem


Solve the following two-point boundary-value problem

u00 .x/ D 2; x 2 .0; 1/; u.0/ D 0; u.1/ D 1 :

Hint Do Exercise 5.9. Modify the boundary condition in the code so it incorporates
a known value for u.1/.
Filename: [Link].

Open Access This chapter is distributed under the terms of the Creative Commons Attribution-
NonCommercial 4.0 International License ([Link]
which permits any noncommercial use, duplication, adaptation, distribution and reproduction
in any medium or format, as long as you give appropriate credit to the original author(s) and the
source, a link is provided to the Creative Commons license and any changes made are indicated.
The images or other third party material in this chapter are included in the works Creative
Commons license, unless indicated otherwise in the credit line; if such material is not included
in the works Creative Commons license and the respective action is not permitted by statutory
regulation, users will need to obtain permission from the license holder to duplicate, adapt or
reproduce the material.
Solving Nonlinear Algebraic Equations
6

As a reader of this book you are probably well into mathematics and often ac-
cused of being particularly good at solving equations (a typical comment at
family dinners!). However, is it really true that you, with pen and paper, can solve
many types of equations? Restricting our attention to algebraic equations in one
unknown x, you can certainly do linear equations: ax C b D 0, and quadratic ones:
ax 2 C bx C c D 0. You may also know that there are formulas for the roots of cu-
bic and quartic equations too. Maybe you can do the special trigonometric equation
sin x C cos x D 1 as well, but there it (probably) stops. Equations that are not re-
ducible to one of the mentioned cannot be solved by general analytical techniques,
which means that most algebraic equations arising in applications cannot be treated
with pen and paper!
If we exchange the traditional idea of finding exact solutions to equations with
the idea of rather finding approximate solutions, a whole new world of possibilities
opens up. With such an approach, we can in principle solve any algebraic equation.
Let us start by introducing a common generic form for any algebraic equation:

f .x/ D 0 :

Here, f .x/ is some prescribed formula involving x. For example, the equation

e x sin x D cos x

The Author(s) 2016 185


S. Linge, H.P. Langtangen, Programming for Computations Python,
Texts in Computational Science and Engineering 15, DOI 10.1007/978-3-319-32428-9_6
186 6 Solving Nonlinear Algebraic Equations

has
f .x/ D e x sin x  cos x :
Just move all terms to the left-hand side and then the formula to the left of the
equality sign is f .x/.
So, when do we really need to solve algebraic equations beyond the simplest
types we can treat with pen and paper? There are two major application areas. One
is when using implicit numerical methods for ordinary differential equations. These
give rise to one or a system of algebraic equations. The other major application type
is optimization, i.e., finding the maxima or minima of a function. These maxima and
minima are normally found by solving the algebraic equation F 0 .x/ D 0 if F .x/ is
the function to be optimized. Differential equations are very much used throughout
science and engineering, and actually most engineering problems are optimization
problems in the end, because one wants a design that maximizes performance and
minimizes cost.
We first consider one algebraic equation in one variable, with our usual emphasis
on how to program the algorithms. Systems of nonlinear algebraic equations with
many variables arise from implicit methods for ordinary and partial differential
equations as well as in multivariate optimization. Our attention will be restricted to
Newtons method for such systems of nonlinear algebraic equations.

Terminology
When solving algebraic equations f .x/ D 0, we often say that the solution x
is a root of the equation. The solution process itself is thus often called root
finding.

6.1 Brute Force Methods

The representation of a mathematical function f .x/ on a computer takes two forms.


One is a Python function returning the function value given the argument, while the
other is a collection of points .x; f .x// along the function curve. The latter is the
representation we use for plotting, together with an assumption of linear variation
between the points. This representation is also very suited for equation solving
and optimization: we simply go through all points and see if the function crosses
the x axis, or for optimization, test for a local maximum or minimum point. Be-
cause there is a lot of work to examine a huge number of points, and also because
the idea is extremely simple, such approaches are often referred to as brute force
methods. However, we are not embarrassed of explaining the methods in detail and
implementing them.
6.1 Brute Force Methods 187

6.1.1 Brute Force Root Finding

Assume that we have a set of points along the curve of a function f .x/:

We want to solve f .x/ D 0, i.e., find the points x where f crosses the x axis.
A brute force algorithm is to run through all points on the curve and check if one
point is below the x axis and if the next point is above the x axis, or the other way
around. If this is found to be the case, we know that f must be zero in between
these two x points.

Numerical algorithm More precisely, we have a set of n C 1 points .xi ; yi /, yi D


f .xi /, i D 0; : : : ; n, where x0 < : : : < xn . We check if yi < 0 and yi C1 > 0 (or
the other way around). A compact expression for this check is to perform the test
yi yi C1 < 0. If so, the root of f .x/ D 0 is in xi ; xi C1 . Assuming a linear variation
of f between xi and xi C1 , we have the approximation

f .xi C1 /  f .xi / yi C1  yi
f .x/  .x  xi / C f .xi / D .x  xi / C yi ;
xi C1  xi xi C1  xi

which, when set equal to zero, gives the root


xi C1  xi
x D xi  yi :
yi C1  yi

Implementation Given some Python implementation f(x) of our mathematical


function, a straightforward implementation of the above numerical algorithm looks
like
188 6 Solving Nonlinear Algebraic Equations

x = linspace(0, 4, 10001)
y = f(x)

root = None # Initialization


for i in range(len(x)-1):
if y[i]*y[i+1] < 0:
root = x[i] - (x[i+1] - x[i])/(y[i+1] - y[i])*y[i]
break # Jump out of loop

if root is None:
print Could not find any root in [%g, %g] % (x[0], x[-1])
else:
print Find (the first) root as x=%g % root

(See the file brute_force_root_finder_flat.py.)


Note the nice use of setting root to None: we can simply test if root is
None to see if we found a root and overwrote the None value, or if we did not find
any root among the tested points.
Running this program with some function, say f .x/ D e x cos.4x/ (which has
2

a solution at x D 8 ), gives the root 0.392701, which has an error of 1:9  106 .


Increasing the number of points with a factor of ten gives a root with an error of
2:4  108 .
After such a quick flat implementation of an algorithm, we should always try
to offer the algorithm as a Python function, applicable to as wide a problem domain
as possible. The function should take f and an associated interval a; b as input, as
well as a number of points (n), and return a list of all the roots in a; b. Here is our
candidate for a good implementation of the brute force rooting finding algorithm:

def brute_force_root_finder(f, a, b, n):


from numpy import linspace
x = linspace(a, b, n)
y = f(x)
roots = []
for i in range(n-1):
if y[i]*y[i+1] < 0:
root = x[i] - (x[i+1] - x[i])/(y[i+1] - y[i])*y[i]
[Link](root)
return roots

(See the file brute_force_root_finder_function.py.)


This time we use another elegant technique to indicate if roots were found or not:
roots is an empty list if the root finding was unsuccessful, otherwise it contains all
the roots. Application of the function to the previous example can be coded as

def demo():
from numpy import exp, cos
roots = brute_force_root_finder(
lambda x: exp(-x**2)*cos(4*x), 0, 4, 1001)
if roots:
print roots
else:
print Could not find any roots
6.1 Brute Force Methods 189

Note that if roots evaluates to True if roots is non-empty. This is a general


test in Python: if X evaluates to True if X is non-empty or has a nonzero value.

6.1.2 Brute Force Optimization

Numerical algorithm We realize that xi corresponds to a maximum point if


yi 1 < yi > yi C1 . Similarly, xi corresponds to a minimum if yi 1 > yi < yi C1 .
We can do this test for all inner points i D 1; : : : ; n  1 to find all local minima
and maxima. In addition, we need to add an end point, i D 0 or i D n, if the
corresponding yi is a global maximum or minimum.

Implementation The algorithm above can be translated to the following Python


function (file brute_force_optimizer.py):

def brute_force_optimizer(f, a, b, n):


from numpy import linspace
x = linspace(a, b, n)
y = f(x)
# Let maxima and minima hold the indices corresponding
# to (local) maxima and minima points
minima = []
maxima = []
for i in range(n-1):
if y[i-1] < y[i] > y[i+1]:
[Link](i)
if y[i-1] > y[i] < y[i+1]:
[Link](i)

# What about the end points?


y_max_inner = max([y[i] for i in maxima])
y_min_inner = min([y[i] for i in minima])
if y[0] > y_max_inner:
[Link](0)
if y[len(x)-1] > y_max_inner:
[Link](len(x)-1)
if y[0] < y_min_inner:
[Link](0)
if y[len(x)-1] < y_min_inner:
[Link](len(x)-1)

# Return x and y values


return [(x[i], y[i]) for i in minima], \
[(x[i], y[i]) for i in maxima]

The max and min functions are standard Python functions for finding the maxi-
mum and minimum element of a list or an object that one can iterate over with a for
loop.
190 6 Solving Nonlinear Algebraic Equations

An application to f .x/ D e x cos.4x/ looks like


2

def demo():
from numpy import exp, cos
minima, maxima = brute_force_optimizer(
lambda x: exp(-x**2)*cos(4*x), 0, 4, 1001)
print Minima:, minima
print Maxima:, maxima

6.1.3 Model Problem for Algebraic Equations

We shall consider the very simple problem of finding the square root of 9, which
is the positive solution of x 2 D 9. The nice feature of solving an equation whose
solution is known beforehand is that we can easily investigate how the numerical
method and the implementation perform in the search for the solution. The f .x/
function corresponding to the equation x 2 D 9 is

f .x/ D x 2  9 :

Our interval of interest for solutions will be 0; 1000 (the upper limit here is chosen
somewhat arbitrarily).
In the following, we will present several efficient and accurate methods for solv-
ing nonlinear algebraic equations, both single equation and systems of equations.
The methods all have in common that they search for approximate solutions. The
methods differ, however, in the way they perform the search for solutions. The idea
for the search influences the efficiency of the search and the reliability of actually
finding a solution. For example, Newtons method is very fast, but not reliable,
while the bisection method is the slowest, but absolutely reliable. No method is
best at all problems, so we need different methods for different problems.

What is the difference between linear and nonlinear equations?


You know how to solve linear equations ax C b D 0: x D b=a. All other
types of equations f .x/ D 0, i.e., when f .x/ is not a linear function of x, are
called nonlinear. A typical way of recognizing a nonlinear equation is to observe
that x is not alone as in ax, but involved in a product with itself, such as in
x 3 C 2x 2  9 D 0. We say that x 3 and 2x 2 are nonlinear terms. An equation like
sin x C e x cos x D 0 is also nonlinear although x is not explicitly multiplied by
itself, but the Taylor series of sin x, e x , and cos x all involve polynomials of x
where x is multiplied by itself.

6.2 Newtons Method

Newtons method, also known as Newton-Raphsons method, is a very famous and


widely used method for solving nonlinear algebraic equations. Compared to the
other methods we will consider, it is generally the fastest one (usually by far). It
does not guarantee that an existing solution will be found, however.
6.2 Newtons Method 191

A fundamental idea of numerical methods for nonlinear equations is to construct


a series of linear equations (since we know how to solve linear equations) and hope
that the solutions of these linear equations bring us closer and closer to the solution
of the nonlinear equation. The idea will be clearer when we present Newtons
method and the secant method.

6.2.1 Deriving and Implementing Newtons Method

Figure 6.1 shows the f .x/ function in our model equation x 2  9 D 0. Numer-
ical methods for algebraic equations require us to guess at a solution first. Here,
this guess is called x0 . The fundamental idea of Newtons method is to approxi-
mate the original function f .x/ by a straight line, i.e., a linear function, since it
is straightforward to solve linear equations. There are infinitely many choices of
how to approximate f .x/ by a straight line. Newtons method applies the tangent
of f .x/ at x0 , see the rightmost tangent in Fig. 6.1. This linear tangent function
crosses the x axis at a point we call x1 . This is (hopefully) a better approximation
to the solution of f .x/ D 0 than x0 . The next fundamental idea is to repeat this
process. We find the tangent of f at x1 , compute where it crosses the x axis, at
a point called x2 , and repeat the process again. Figure 6.1 shows that the process
brings us closer and closer to the left. It remains, however, to see if we hit x D 3 or
come sufficiently close to this solution.
How do we compute the tangent of a function f .x/ at a point x0 ? The tangent
function, here called fQ.x/, is linear and has two properties:

Fig. 6.1 Illustrates the idea of Newtons method with f .x/ D x 2  9, repeatedly solving for
crossing of tangent lines with the x axis
192 6 Solving Nonlinear Algebraic Equations

1. the slope equals to f 0 .x0 /


2. the tangent touches the f .x/ curve at x0

So, if we write the tangent function as fQ.x/ D ax C b, we must require fQ0 .x0 / D
f 0 .x0 / and fQ.x0 / D f .x0 /, resulting in
fQ.x/ D f .x0 / C f 0 .x0 /.x  x0 / :
The key step in Newtons method is to find where the tangent crosses the x axis,
which means solving fQ.x/ D 0:
f .x0 /
fQ.x/ D 0 ) x D x0  :
f 0 .x0 /
This is our new candidate point, which we call x1 :
f .x0 /
x1 D x0  :
f 0 .x0 /
With x0 D 1000, we get x1  500, which is in accordance with the graph in
Fig. 6.1. Repeating the process, we get
f .x1 /
x2 D x1   250 :
f 0 .x1 /
The general scheme of Newtons method may be written as
f .xn /
xnC1 D xn  ; n D 0; 1; 2; : : : (6.1)
f 0 .xn /
The computation in (6.1) is repeated until f .xn / is close enough to zero. More
precisely, we test if jf .xn /j < , with  being a small number.
We moved from 1000 to 250 in two iterations, so it is exciting to see how
fast we can approach the solution x D 3. A computer program can automate
the calculations. Our first try at implementing Newtons method is in a function
naive_Newton:
def naive_Newton(f, dfdx, x, eps):
while abs(f(x)) > eps:
x = x - float(f(x))/dfdx(x)
return x

The argument x is the starting value, called x0 in our previous mathematical de-
scription. We use float(f(x)) to ensure that an integer division does not happen
by accident if f(x) and dfdx(x) both are integers for some x.
To solve the problem x 2 D 9 we also need to implement

def f(x):
return x**2 - 9

def dfdx(x):
return 2*x

print naive_Newton(f, dfdx, 1000, 0.001)


6.2 Newtons Method 193

Why not use an array for the x approximations?


Newtons method is normally formulated with an iteration index n,

f .xn /
xnC1 D xn  :
f 0 .xn /
Seeing such an index, many would implement this as

x[n+1] = x[n] - f(x[n])/dfdx(x[n])

Such an array is fine, but requires storage of all the approximations. In large
industrial applications, where Newtons method solves millions of equations at
once, one cannot afford to store all the intermediate approximations in memory,
so then it is important to understand that the algorithm in Newtons method has
no more need for xn when xnC1 is computed. Therefore, we can work with one
variable x and overwrite the previous value:

x = x - f(x)/dfdx(x)

Running naive_Newton(f, dfdx, 1000, eps=0.001) results in the ap-


proximate solution 3.000027639. A smaller value of eps will produce a more
accurate solution. Unfortunately, the plain naive_Newton function does not re-
turn how many iterations it used, nor does it print out all the approximations
x0 ; x1 ; x2 ; : : :, which would indeed be a nice feature. If we insert such a printout,
a rerun results in
500.0045
250.011249919
125.02362415
62.5478052723
31.3458476066
15.816483488
8.1927550496
4.64564330569
3.2914711388
3.01290538807
3.00002763928

We clearly see that the iterations approach the solution quickly. This speed of
the search for the solution is the primary strength of Newtons method compared to
other methods.

6.2.2 Making a More Efficient and Robust Implementation

The naive_Newton function works fine for the example we are considering here.
However, for more general use, there are some pitfalls that should be fixed in an
improved version of the code. An example may illustrate what the problem is: let
us solve tanh.x/ D 0, which has solution x D 0. With jx0 j  1:08 everything
works fine. For example, x0 leads to six iterations if  D [Link]
194 6 Solving Nonlinear Algebraic Equations

-1.05895313436
0.989404207298
-0.784566773086
0.36399816111
-0.0330146961372
2.3995252668e-05

Adjusting x0 slightly to 1.09 gives division by zero! The approximations com-


puted by Newtons method become

-1.09331618202
1.10490354324
-1.14615550788
1.30303261823
-2.06492300238
13.4731428006
-1.26055913647e+11

The division by zero is caused by x7 D 1:260559136471011, because tanh.x7 /


is 1.0 to machine precision, and then f 0 .x/ D 1  tanh.x/2 becomes zero in the
denominator in Newtons method.
The underlying problem, leading to the division by zero in the above example,
is that Newtons method diverges: the approximations move further and further
away from x D 0. If it had not been for the division by zero, the condition in
the while loop would always be true and the loop would run forever. Divergence
of Newtons method occasionally happens, and the remedy is to abort the method
when a maximum number of iterations is reached.
Another disadvantage of the naive_Newton function is that it calls the f .x/
function twice as many times as necessary. This extra work is of no concern when
f .x/ is fast to evaluate, but in large-scale industrial software, one call to f .x/ might
take hours or days, and then removing unnecessary calls is important. The solution
in our function is to store the call f(x) in a variable (f_value) and reuse the value
instead of making a new call f(x).
To summarize, we want to write an improved function for implementing New-
tons method where we

 avoid division by zero


 allow a maximum number of iterations
 avoid the extra evaluation of f .x/

A more robust and efficient version of the function, inserted in a complete program
Newtons_method.py for solving x 2  9 D 0, is listed below.

def Newton(f, dfdx, x, eps):


f_value = f(x)
iteration_counter = 0
while abs(f_value) > eps and iteration_counter < 100:
try:
x = x - float(f_value)/dfdx(x)
6.2 Newtons Method 195

except ZeroDivisionError:
print "Error! - derivative zero for x = ", x
[Link](1) # Abort with error

f_value = f(x)
iteration_counter += 1

# Here, either a solution is found, or too many iterations


if abs(f_value) > eps:
iteration_counter = -1
return x, iteration_counter

def f(x):
return x**2 - 9

def dfdx(x):
return 2*x

solution, no_iterations = Newton(f, dfdx, x=1000, eps=1.0e-6)

if no_iterations > 0: # Solution found


print "Number of function calls: %d" % (1 + 2*no_iterations)
print "A solution is: %f" % (solution)
else:
print "Solution not found!"

Handling of the potential division by zero is done by a try-except construction.


Python tries to run the code in the try block. If anything goes wrong here, or more
precisely, if Python raises an exception caused by a problem (such as division by
zero, array index out of bounds, use of undefined variable, etc.), the execution jumps
immediately to the except block. Here, the programmer can take appropriate ac-
tions. In the present case, we simply stop the program. (Professional programmers
would avoid calling [Link] inside a function. Instead, they would raise a new
exception with an informative error message, and let the calling code have another
try-except construction to stop the program.)
The division by zero will always be detected and the program will be stopped.
The main purpose of our way of treating the division by zero is to give the user
a more informative error message and stop the program in a gentler way.
Calling [Link] with an argument different from zero (here 1) signifies that
the program stopped because of an error. It is a good habit to supply the value 1,
because tools in the operating system can then be used by other programs to detect
that our program failed.
To prevent an infinite loop because of divergent iterations, we have introduced
the integer variable iteration_counter to count the number of iterations in New-
tons method. With iteration_counter we can easily extend the condition in the
while such that no more iterations take place when the number of iterations reaches
100. We could easily let this limit be an argument to the function rather than a fixed
constant.
The Newton function returns the approximate solution and the number of itera-
tions. The latter equals 1 if the convergence criterion jf .x/j <  was not reached
within the maximum number of iterations. In the calling code, we print out the
196 6 Solving Nonlinear Algebraic Equations

solution and the number of function calls. The main cost of a method for solving
f .x/ D 0 equations is usually the evaluation of f .x/ and f 0 .x/, so the total num-
ber of calls to these functions is an interesting measure of the computational work.
Note that in function Newton there is an initial call to f .x/ and then one call to f
and one to f 0 in each iteration.
Running Newtons_method.py, we get the following printout on the screen:

Number of function calls: 25


A solution is: 3.000000

As we did with the integration methods in Chapter 3, we will collect our solvers
for nonlinear algebraic equations in a separate file named nonlinear_solvers.py
for easy import and use. The first function placed in this file is then Newton.
The Newton scheme will work better if the starting value is close to the solution.
A good starting value may often make the difference as to whether the code actually
finds a solution or not. Because of its speed, Newtons method is often the method
of first choice for solving nonlinear algebraic equations, even if the scheme is not
guaranteed to work. In cases where the initial guess may be far from the solution,
a good strategy is to run a few iterations with the bisection method (see Chapter 6.4)
to narrow down the region where f is close to zero and then switch to Newtons
method for fast convergence to the solution.
Newtons method requires the analytical expression for the derivative f 0 .x/.
Derivation of f 0 .x/ is not always a reliable process by hand if f .x/ is a com-
plicated function. However, Python has the symbolic package SymPy, which we
may use to create the required dfdx function. In our sample problem, the recipe
goes as follows:

from sympy import *


x = symbols(x) # define x as a mathematical symbol
f_expr = x**2 - 9 # symbolic expression for f(x)
dfdx_expr = diff(f_expr, x) # compute f(x) symbolically
# Turn f_expr and dfdx_expr into plain Python functions
f = lambdify([x], # argument to f
f_expr) # symbolic expression to be evaluated
dfdx = lambdify([x], dfdx_expr)
print dfdx(5) # will print 10

The nice feature of this code snippet is that dfdx_expr is the exact analytical
expression for the derivative, 2*x, if you print it out. This is a symbolic expression
so we cannot do numerical computing with it, but the lambdify constructions turn
symbolic expressions into callable Python functions.
The next method is the secant method, which is usually slower than Newtons
method, but it does not require an expression for f 0 .x/, and it has only one function
call per iteration.
6.3 The Secant Method 197

6.3 The Secant Method

When finding the derivative f 0 .x/ in Newtons method is problematic, or when


function evaluations take too long; we may adjust the method slightly. Instead of
using tangent lines to the graph we may use secants1 . The approach is referred to as
the secant method, and the idea is illustrated graphically in Fig. 6.2 for our example
problem x 2  9 D 0.
The idea of the secant method is to think as in Newtons method, but instead
of using f 0 .xn /, we approximate this derivative by a finite difference or the se-
cant, i.e., the slope of the straight line that goes through the points .xn ; f .xn // and
.xn1 ; f .xn1 // on the graph, given by the two most recent approximations xn and
xn1 . This slope reads
f .xn /  f .xn1 /
: (6.2)
xn  xn1
Inserting this expression for f 0 .xn / in Newtons method simply gives us the secant
method:
f .xn /
xnC1 D xn  f .x /f .x / ;
n n1
xn xn1
or
xn  xn1
xnC1 D xn  f .xn / : (6.3)
f .xn /  f .xn1 /

Fig. 6.2 Illustrates the use of secants in the secant method when solving x 2 9 D 0; x 2 0; 1000.
From two chosen starting values, x0 D 1000 and x1 D 700 the crossing x2 of the corresponding
secant with the x axis is computed, followed by a similar computation of x3 from x1 and x2

1
[Link]
198 6 Solving Nonlinear Algebraic Equations

Comparing (6.3) to the graph in Fig. 6.2, we see how two chosen starting points
(x0 D 1000, x1 D 700, and corresponding function values) are used to compute
x2 . Once we have x2 , we similarly use x1 and x2 to compute x3 . As with Newtons
method, the procedure is repeated until f .xn / is below some chosen limit value,
or some limit on the number of iterations has been reached. We use an iteration
counter here too, based on the same thinking as in the implementation of Newtons
method.
We can store the approximations xn in an array, but as in Newtons method,
we notice that the computation of xnC1 only needs knowledge of xn and xn1 , not
older approximations. Therefore, we can make use of only three variables: x for
xnC1 , x1 for xn , and x0 for xn1 . Note that x0 and x1 must be given (guessed) for
the algorithm to start.
A program secant_method.py that solves our example problem may be written
as:

def secant(f, x0, x1, eps):


f_x0 = f(x0)
f_x1 = f(x1)
iteration_counter = 0
while abs(f_x1) > eps and iteration_counter < 100:
try:
denominator = float(f_x1 - f_x0)/(x1 - x0)
x = x1 - float(f_x1)/denominator
except ZeroDivisionError:
print "Error! - denominator zero for x = ", x
[Link](1) # Abort with error
x0 = x1
x1 = x
f_x0 = f_x1
f_x1 = f(x1)
iteration_counter += 1
# Here, either a solution is found, or too many iterations
if abs(f_x1) > eps:
iteration_counter = -1
return x, iteration_counter

def f(x):
return x**2 - 9

x0 = 1000; x1 = x0 - 1

solution, no_iterations = secant(f, x0, x1, eps=1.0e-6)

if no_iterations > 0: # Solution found


print "Number of function calls: %d" % (2 + no_iterations)
print "A solution is: %f" % (solution)
else:
print "Solution not found!"

The number of function calls is now related to no_iterations, i.e., the number
of iterations, as 2 + no_iterations, since we need two function calls before en-
tering the while loop, and then one function call per loop iteration. Note that, even
though we need two points on the graph to compute each updated estimate, only
6.4 The Bisection Method 199

a single function call (f(x1)) is required in each iteration since f(x0) becomes the
old f(x1) and may simply be copied as f_x0 = f_x1 (the exception is the very
first iteration where two function evaluations are needed).
Running secant_method.py, gives the following printout on the screen:

Number of function calls: 19


A solution is: 3.000000

As with the function Newton, we place secant in the file nonlinear_solvers.


py for easy import and use later.

6.4 The Bisection Method

Neither Newtons method nor the secant method can guarantee that an existing so-
lution will be found (see Exercises 6.1 and 6.2). The bisection method, however,
does that. However, if there are several solutions present, it finds only one of them,
just as Newtons method and the secant method. The bisection method is slower
than the other two methods, so reliability comes with a cost of speed.
To solve x 2  9 D 0, x 2 0; 1000, with the bisection method, we reason as
follows. The first key idea is that if f .x/ D x 2  9 is continuous on the interval and
the function values for the interval endpoints (xL D 0, xR D 1000) have opposite
signs, f .x/ must cross the x axis at least once on the interval. That is, we know
there is at least one solution.
The second key idea comes from dividing the interval in two equal parts, one
to the left and one to the right of the midpoint xM D 500. By evaluating the sign
of f .xM /, we will immediately know whether a solution must exist to the left or
right of xM . This is so, since if f .xM /  0, we know that f .x/ has to cross the x
axis between xL and xM at least once (using the same argument as for the original
interval). Likewise, if instead f .xM /  0, we know that f .x/ has to cross the x
axis between xM and xR at least once.
In any case, we may proceed with half the interval only. The exception is if
f .xM /  0, in which case a solution is found. Such interval halving can be
continued until a solution is found. A solution in this case, is when jf .xM /j
is sufficiently close to zero, more precisely (as before): jf .xM /j < , where  is
a small number specified by the user.
The sketched strategy seems reasonable, so let us write a reusable function that
can solve a general algebraic equation f .x/ D 0 (bisection_method.py):

def bisection(f, x_L, x_R, eps, return_x_list=False):


f_L = f(x_L)
if f_L*f(x_R) > 0:
print "Error! Function does not have opposite \
signs at interval endpoints!"
[Link](1)
x_M = float(x_L + x_R)/2.0
f_M = f(x_M)
iteration_counter = 1
200 6 Solving Nonlinear Algebraic Equations

if return_x_list:
x_list = []

while abs(f_M) > eps:


if f_L*f_M > 0: # i.e. same sign
x_L = x_M
f_L = f_M
else:
x_R = x_M
x_M = float(x_L + x_R)/2
f_M = f(x_M)
iteration_counter += 1
if return_x_list:
x_list.append(x_M)
if return_x_list:
return x_list, iteration_counter
else:
return x_M, iteration_counter

def f(x):
return x**2 - 9

a = 0; b = 1000

solution, no_iterations = bisection(f, a, b, eps=1.0e-6)

print "Number of function calls: %d" % (1 + 2*no_iterations)


print "A solution is: %f" % (solution)

Note that we first check if f changes sign in a; b, because that is a requirement
for the algorithm to work. The algorithm also relies on a continuous f .x/ function,
but this is very challenging for a computer code to check.
We get the following printout to the screen when bisection_method.py is run:

Number of function calls: 61


A solution is: 3.000000

We notice that the number of function calls is much higher than with the previous
methods.

Required work in the bisection method


If the starting interval of the bisection method is bounded by a and b, and the
solution at step n is taken to be the middle value, the error is bounded as

jb  aj
; (6.4)
2n
because the initial interval has been halved n times. Therefore, to meet a toler-
ance , we need n iterations such that the length of the current interval equals
:
jb  aj ln..b  a/=/
D ) nD :
2n ln 2
6.5 Rate of Convergence 201

This is a great advantage of the bisection method: we know beforehand how


many iterations n it takes to meet a certain accuracy  in the solution.

As with the two previous methods, the function bisection is placed in the file
nonlinear_solvers.py for easy import and use.

6.5 Rate of Convergence

With the methods above, we noticed that the number of iterations or function calls
could differ quite substantially. The number of iterations needed to find a solution
is closely related to the rate of convergence, which dictates the speed of error re-
duction as we approach the root. More precisely, we introduce the error in iteration
n as en D jx  xn j, and define the convergence rate q as

enC1 D C enq ; (6.5)

where C is a constant. The exponent q measures how fast the error is reduced from
one iteration to the next. The larger q is, the faster the error goes to zero, and the
fewer iterations we need to meet the stopping criterion jf .x/j < .
A single q in (6.5) is defined in the limit n ! 1. For finite n, and especially
smaller n, q will vary with n. To estimate q, we can compute all the errors en and
set up (6.5) for three consecutive experiments n  1, n, and n C 1:
q
en D C en1 ;
enC1 D C enq :

Dividing these two equations by each other and solving with respect to q gives

ln.enC1 =en /
qD :
[Link] =en1 /
Since this q will vary somewhat with n, we call it qn . As n grows, we expect qn
to approach a limit (qn ! q). To compute all the qn values, we need all the xn
approximations. However, our previous implementations of Newtons method, the
secant method, and the bisection method returned just the final approximation.
Therefore, we have extended the implementations in the module file
nonlinear_solvers.py such that the user can choose whether the final value
or the whole history of solutions is to be returned. Each of the extended im-
plementations now takes an extra parameter return_x_list. This parameter is
a boolean, set to True if the function is supposed to return all the root approxima-
tions, or False, if the function should only return the final approximation. As an
example, let us take a closer look at Newton:

def Newton(f, dfdx, x, eps, return_x_list=False):


f_value = f(x)
iteration_counter = 0
if return_x_list:
x_list = []
202 6 Solving Nonlinear Algebraic Equations

while abs(f_value) > eps and iteration_counter < 100:


try:
x = x - float(f_value)/dfdx(x)
except ZeroDivisionError:
print "Error! - derivative zero for x = ", x
[Link](1) # Abort with error

f_value = f(x)
iteration_counter += 1
if return_x_list:
x_list.append(x)

# Here, either a solution is found, or too many iterations


if abs(f_value) > eps:
iteration_counter = -1 # i.e., lack of convergence

if return_x_list:
return x_list, iteration_counter
else:
return x, iteration_counter

The function is found in the file nonlinear_solvers.py.


We can now make a call

x, iter = Newton(f, dfdx, x=1000, eps=1e-6, return_x_list=True)

and get a list x returned. With knowledge of the exact solution x of f .x/ D 0
we can compute all the errors en and all the associated qn values with the compact
function

def rate(x, x_exact):


e = [abs(x_ - x_exact) for x_ in x]
q = [log(e[n+1]/e[n])/log(e[n]/e[n-1])
for n in range(1, len(e)-1, 1)]
return q

The error model (6.5) works well for Newtons method and the secant method.
For the bisection method, however, it works well in the beginning, but not when the
solution is approached.
We can compute the rates qn and print them nicely,

def print_rates(method, x, x_exact):


q = [%.2f % q_ for q_ in rate(x, x_exact)]
print method + :
for q_ in q:
print q_,
print

The result for print_rates(Newton, x, 3) is

Newton:
1.01 1.02 1.03 1.07 1.14 1.27 1.51 1.80 1.97 2.00
6.6 Solving Multiple Nonlinear Algebraic Equations 203

indicating that q D 2 is the rate for Newtons method. A similar computation


using the secant method, gives the rates

secant:
1.26 0.93 1.05 1.01 1.04 1.05 1.08 1.13 1.20 1.30 1.43
1.54 1.60 1.62 1.62

Here it seems that q  1:6 is the limit.

Remark If we in the bisection method think of the length of the current interval
containing the solution as the error en , then (6.5) works perfectly since enC1 D
1
e , i.e., q D 1 and C D 12 , but if en is the true error jx  xn j, it is easily seen
2 n
from a sketch that this error can oscillate between the current interval length and
a potentially very small value as we approach the exact solution. The corresponding
rates qn fluctuate widely and are of no interest.

6.6 Solving Multiple Nonlinear Algebraic Equations

So far in this chapter, we have considered a single nonlinear algebraic equation.


However, systems of such equations arise in a number of applications, foremost
nonlinear ordinary and partial differential equations. Of the previous algorithms,
only Newtons method is suitable for extension to systems of nonlinear equations.

6.6.1 Abstract Notation

Suppose we have n nonlinear equations, written in the following abstract form:

F0 .x0 ; x1 ; : : : ; xn / D 0; (6.6)
F1 .x0 ; x1 ; : : : ; xn / D 0; (6.7)
:: ::
:D: (6.8)
Fn .x0 ; x1 ; : : : ; xn / D 0 : (6.9)
(6.10)

It will be convenient to introduce a vector notation

F D .F0 ; : : : ; F1 /; x D .x0 ; : : : ; xn / :

The system can now be written as F .x/ D 0.


As a specific example on the notation above, the system

x 2 D y  x cos.x/ (6.11)
y 1
yx C e Dx (6.12)
204 6 Solving Nonlinear Algebraic Equations

can be written in our abstract form by introducing x0 D x and x1 D y. Then

F0 .x0 ; x1 / D x 2  y C x cos.x/ D 0;
F1 .x0 ; x1 / D yx C e y  x 1 D 0 :

6.6.2 Taylor Expansions for Multi-Variable Functions

We follow the ideas of Newtons method for one equation in one variable: approxi-
mate the nonlinear f by a linear function and find the root of that function. When
n variables are involved, we need to approximate a vector function F .x/ by some
linear function FQ D J x C c, where J is an n  n matrix and c is some vector of
length n.
The technique for approximating F by a linear function is to use the first two
terms in a Taylor series expansion. Given the value of F and its partial derivatives
with respect to x at some point x i , we can approximate the value at some point
x i C1 by the two first term in a Taylor series expansion around x i :

F .x i C1 /  F .x i / C rF .x i /.x i C1  x i / :

The next terms in the expansions are omitted here and of size jjx i C1  x i jj2 , which
are assumed to be small compared with the two terms above.
The expression rF is the matrix of all the partial derivatives of F . Component
.i; j / in rF is
@Fi
:
@xj
For example, in our 2  2 system (6.11)-(6.12) we can use SymPy to compute the
Jacobian:

>>> from sympy import *


>>> x0, x1 = symbols(x0 x1)
>>> F0 = x0**2 - x1 + x0*cos(pi*x0)
>>> F1 = x0*x1 + exp(-x1) - x0**(-1)
>>> diff(F0, x0)
-pi*x0*sin(pi*x0) + 2*x0 + cos(pi*x0)
>>> diff(F0, x1)
-1
>>> diff(F1, x0)
x1 + x0**(-2)
>>> diff(F1, x1)
x0 - exp(-x1)

We can then write


! !
@F0 @F0
2x0 C cos.x0 /  x0 sin.x0 / 1
rF D @x0 @x1
D
@F1
@x0
@F1
@x1
x1 C x02 x0  e x1

The matrix rF is called the Jacobian of F and often denoted by J .


6.6 Solving Multiple Nonlinear Algebraic Equations 205

6.6.3 Newtons Method

The idea of Newtons method is that we have some approximation x i to the root and
seek a new (and hopefully better) approximation x i C1 by approximating F .x i C1 /
by a linear function and solve the corresponding linear system of algebraic equa-
tions. We approximate the nonlinear problem F .x i C1 / D 0 by the linear problem

F .x i / C J .x i /.x i C1  x i / D 0; (6.13)

where J .x i / is just another notation for rF .x i /. The equation (6.13) is a linear


system with coefficient matrix J and right-hand side vector F .x i /. We therefore
write this system in the more familiar form

J .x i / D F .x i /;

where we have introduce a symbol for the unknown vector x i C1  x i that multi-
plies the Jacobian J .
The i-th iteration of Newtons method for systems of algebraic equations con-
sists of two steps:

1. Solve the linear system J .x i / D F .x i / with respect to .


2. Set x i C1 D x i C .

Solving systems of linear equations must make use of appropriate software. Gaus-
sian elimination is the most common, and in general the most robust, method for
this purpose. Pythons numpy package has a module linalg that interfaces the
well-known LAPACK package with high-quality and very well tested subroutines
for linear algebra. The statement x = [Link](A, b) solves a sys-
tem Ax D b with a LAPACK method based on Gaussian elimination.
When nonlinear systems of algebraic equations arise from discretization of par-
tial differential equations, the Jacobian is very often sparse, i.e., most of its elements
are zero. In such cases it is important to use algorithms that can take advantage of
the many zeros. Gaussian elimination is then a slow method, and (much) faster
methods are based on iterative techniques.

6.6.4 Implementation

Here is a very simple implementation of Newtons method for systems of nonlinear


algebraic equations:

import numpy as np

def Newton_system(F, J, x, eps):


"""
Solve nonlinear system F=0 by Newtons method.
J is the Jacobian of F. Both F and J must be functions of x.
At input, x holds the start value. The iteration continues
until ||F|| < eps.
"""
206 6 Solving Nonlinear Algebraic Equations

F_value = F(x)
F_norm = [Link](F_value, ord=2) # l2 norm of vector
iteration_counter = 0
while abs(F_norm) > eps and iteration_counter < 100:
delta = [Link](J(x), -F_value)
x = x + delta
F_value = F(x)
F_norm = [Link](F_value, ord=2)
iteration_counter += 1

# Here, either a solution is found, or too many iterations


if abs(F_norm) > eps:
iteration_counter = -1
return x, iteration_counter

We can test the function Newton_system with the 2  2 system (6.11)-(6.12):

def test_Newton_system1():
from numpy import cos, sin, pi, exp

def F(x):
return [Link](
[x[0]**2 - x[1] + x[0]*cos(pi*x[0]),
x[0]*x[1] + exp(-x[1]) - x[0]**(-1)])

def J(x):
return [Link](
[[2*x[0] + cos(pi*x[0]) - pi*x[0]*sin(pi*x[0]), -1],
[x[1] + x[0]**(-2), x[0] - exp(-x[1])]])

expected = [Link]([1, 0])


tol = 1e-4
x, n = Newton_system(F, J, x=[Link]([2, -1]), eps=0.0001)
print n, x
error_norm = [Link](expected - x, ord=2)
assert error_norm < tol, norm of error =%g % error_norm
print norm of error =%g % error_norm

Here, the testing is based on the L2 norm of the error vector. Alternatively, we
could test against the values of x that the algorithm finds, with appropriate toler-
ances. For example, as chosen for the error norm, if eps=0.0001, a tolerance of
104 can be used for x[0] and x[1].

6.7 Exercises

Exercise 6.1: Understand why Newtons method can fail


The purpose of this exercise is to understand when Newtons method works and
fails. To this end, solve tanh x D 0 by Newtons method and study the intermediate
details of the algorithm. Start with x0 D 1:08. Plot the tangent in each iteration of
Newtons method. Then repeat the calculations and the plotting when x0 D 1:09.
Explain what you observe.
Filename: Newton_failure.*.
6.7 Exercises 207

Exercise 6.2: See if the secant method fails


Does the secant method behave better than Newtons method in the problem de-
scribed in Exercise 6.1? Try the initial guesses

1. x0 D 1:08 and x1 D 1:09


2. x0 D 1:09 and x1 D 1:1
3. x0 D 1 and x1 D 2:3
4. x0 D 1 and x1 D 2:4

Filename: secant_failure.*.

Exercise 6.3: Understand why the bisection method cannot fail


Solve the same problem as in Exercise 6.1, using the bisection method, but let the
initial interval be 5; 3. Report how the interval containing the solution evolves
during the iterations.
Filename: bisection_nonfailure.*.

Exercise 6.4: Combine the bisection method with Newtons method


An attractive idea is to combine the reliability of the bisection method with the
speed of Newtons method. Such a combination is implemented by running the
bisection method until we have a narrow interval, and then switch to Newtons
method for speed.
Write a function that implements this idea. Start with an interval a; b and
switch to Newtons method when the current interval in the bisection method is
a fraction s of the initial interval (i.e., when the interval has length s.b  a/). Po-
tential divergence of Newtons method is still an issue, so if the approximate root
jumps out of the narrowed interval (where the solution is known to lie), one can
switch back to the bisection method. The value of s must be given as an argument
to the function, but it may have a default value of 0.1.
Try the new method on tanh.x/ D 0 with an initial interval 10; 15.
Filename: bisection_Newton.py.

Exercise 6.5: Write a test function for Newtons method


The purpose of this function is to verify the implementation of Newtons method in
the Newton function in the file nonlinear_solvers.py. Construct an algebraic
equation and perform two iterations of Newtons method by hand or with the aid of
SymPy. Find the corresponding size of jf .x/j and use this as value for eps when
calling Newton. The function should then also perform two iterations and return the
same approximation to the root as you calculated manually. Implement this idea for
a unit test as a test function test_Newton().
Filename: test_Newton.py.

Exercise 6.6: Solve nonlinear equation for a vibrating beam


An important engineering problem that arises in a lot of applications is the vibra-
tions of a clamped beam where the other end is free. This problem can be analyzed
analytically, but the calculations boil down to solving the following nonlinear alge-
braic equation:
cosh cos D 1;
208 6 Solving Nonlinear Algebraic Equations

where is related to important beam parameters through

%A
4 D ! 2 ;
EI
where % is the density of the beam, A is the area of the cross section, E is Youngs
modulus, and I is the moment of the inertia of the cross section. The most important
parameter of interest is !, which is the frequency of the beam. We want to compute
the frequencies of a vibrating steel beam with a rectangular cross section having
width b D 25 mm and height h D 8 mm. The density of steel is 7850 kg/m3 , and
E D 21011 Pa. The moment of inertia of a rectangular cross section is I D bh3 =12.

a) Plot the equation to be solved so that one can inspect where the zero crossings
occur.

Hint When writing the equation as f ./ D 0, the f function increases its ampli-
tude dramatically with . It is therefore wise to look at an equation with damped
amplitude, g./ D e  f ./ D 0. Plot g instead.

b) Compute the first three frequencies.

Filename: beam_vib.py.

Open Access This chapter is distributed under the terms of the Creative Commons Attribution-
NonCommercial 4.0 International License ([Link]
which permits any noncommercial use, duplication, adaptation, distribution and reproduction
in any medium or format, as long as you give appropriate credit to the original author(s) and the
source, a link is provided to the Creative Commons license and any changes made are indicated.
The images or other third party material in this chapter are included in the works Creative
Commons license, unless indicated otherwise in the credit line; if such material is not included
in the works Creative Commons license and the respective action is not permitted by statutory
regulation, users will need to obtain permission from the license holder to duplicate, adapt or
reproduce the material.
Getting Access to Python
A

This appendix describes different technologies for either installing Python on your
own computer or accessing Python in the cloud. Plain Python is very easy to install
and use in cloud services, but for this book we need many add-on packages for doing
scientific computations. Python together with these packages constitute a complex
software eco system that is non-trivial to build, so we strongly recommend to use
one of the techniques described next1 .

A.1 Required Software

The strictly required software packages for working with this book are

 Python2 version 2.7 [25]


 Numerical Python3 (NumPy) [19, 20] for array computing
 Matplotlib4 [8, 9] for plotting
Desired add-on packages are

 IPython5 [22, 23] for interactive computing


 SciTools6 [14] for add-ons to NumPy
 ScientificPython7 [7] for add-ons to NumPy
 pytest8 or nose9 for testing programs
 pip10 for installing Python packages
 Cython11 for compiling Python to C

1
Some of the text is taken from the 4th edition of the book A Primer on Scientifi Programming
with Python, by H. P. Langtangen, published by Springer, 2014.
2
[Link]
3
[Link]
4
[Link]
5
[Link]
6
[Link]
7
[Link]
8
[Link]
9
[Link]
10
[Link]
11
[Link]
The Author(s) 2016 209
S. Linge, H.P. Langtangen, Programming for Computations Python,
Texts in Computational Science and Engineering 15, DOI 10.1007/978-3-319-32428-9_A
210 A Getting Access to Python

 SymPy12 [2] for symbolic mathematics


 SciPy13 [10] for advanced scientific computing

Python 2 or 3?
Python comes in two versions, version 2 and 3, and these are not fully compati-
ble. However, for the programs in this book, the differences are very small, the
major one being print, which in Python 2 is a statement like

print a:, a, b:, b

while in Python 3 it is a function call

print( a:, a, b:, b)

The authors have written Python v2.7 code in this book in a way that makes
porting to version 3.4 or later trivial: most programs will just need a fix of the
print statement. This can be automatically done by running 2to3 [Link] to
transform a Python 2 program [Link] to its Python 3 counterpart. One can
also use tools like future or six to easily write programs that run under both
versions 2 and 3, or the futurize program can automatically do this for you
based on v2.7 code.
Since many tools for doing scientific computing in Python are still only avail-
able for Python version 2, we use this version in the present book, but emphasize
that it has to be v2.7 and not older versions.

There are different ways to get access to Python with the required packages:

1. Use a computer system at an institution where the software is installed. Such


a system can also be used from your local laptop through remote login over
a network.
2. Install the software on your own laptop.
3. Use a web service.

A system administrator can take the list of software packages and install the missing
ones on a computer system. For the two other options, detailed descriptions are
given below.
Using a web service is very straightforward, but has the disadvantage that you
are constrained by the packages that are allowed to install on the service. There are
services at the time of this writing that suffice for working with most of this book,
but if you are going to solve more complicated mathematical problems, you will
need more sophisticated mathematical Python packages, more storage and more
computer resources, and then you will benefit greatly from having Python installed
on your own computer.

12
[Link]
13
[Link]
A.2 Anaconda and Spyder 211

A.2 Anaconda and Spyder

Anaconda14 is a free Python distribution produced by Continuum Analytics and


contains about 200 Python packages, as well as Python itself, for doing a wide range
of scientific computations. Anaconda can be downloaded from [Link]
downloads. Choose Python version 2.7.
The Integrated Development Environment (IDE) Spyder is included with Ana-
conda and is our recommended tool for writing and running Python programs on
Mac and Windows, unless you have preference for a plain text editor for writing
programs and a terminal window for running them.

A.2.1 Spyder on Mac

Spyder is started by typing spyder in a (new) Terminal application. If you get an


error message unknown locale, you need to type the following line in the Terminal
application, or preferably put the line in your $HOME/.bashrc Unix initialization
file:

export LANG=en_US.UTF-8; export LC_ALL=en_US.UTF-8

A.2.2 Installation of Additional Packages

Anaconda installs the pip tool that is handy to install additional packages. In a Ter-
minal application on Mac or in a PowerShell terminal on Windows, write

Terminal

pip install --user packagename

A.3 How to Write and Run a Python Program

You have basically three choices to develop and test a Python program:

1. use a text editor and a terminal window


2. use an Integrated Development Environment (IDE), like Spyder, which offers
a window with a text editor and functionality to run programs and observe the
output
3. use the IPython notebook

The IPython notebook is briefly descried in Sect. A.5, while the other two options
are outlined below.

14
[Link]
212 A Getting Access to Python

A.3.1 The Need for a Text Editor

Since programs consist of plain text, we need to write this text with the help of
another program that can store the text in a file. You have most likely extensive
experience with writing text on a computer, but for writing your own programs you
need special programs, called editors, which preserve exactly the characters you
type. The widespread word processors, Microsoft Word being a primary example,
are aimed at producing nice-looking reports. These programs format the text and
are not acceptable tools for writing your own programs, even though they can save
the document in a pure text format. Spaces are often important in Python programs,
and editors for plain text give you complete control of the spaces and all other
characters in the program file.

A.3.2 Text Editors

The most widely used editors for writing programs are Emacs and Vim, which are
available on all major platforms. Some simpler alternatives for beginners are

 Linux: Gedit
 Mac OS X: TextWrangler
 Windows: Notepad++

We may mention that Python comes with an editor called Idle, which can be used
to write programs on all three platforms, but running the program with command-
line arguments is a bit complicated for beginners in Idle so Idle is not my favorite
recommendation.
Gedit is a standard program on Linux platforms, but all other editors must be
installed in your system. This is easy: just google the name, download the file, and
follow the standard procedure for installation. All of the mentioned editors come
with a graphical user interface that is intuitive to use, but the major popularity of
Emacs and Vim is due to their rich set of short-keys so that you can avoid using the
mouse and consequently edit at higher speed.

A.3.3 Terminal Windows

To run the Python program, you need a terminal window. This is a window where
you can issue Unix commands in Linux and Mac OS X systems and DOS com-
mands in Windows. On a Linux computer, gnome-terminal is my favorite, but
other choices work equally well, such as xterm and konsole. On a Mac computer,
launch the application Utilities - Terminal. On Windows, launch PowerShell.
You must first move to the right folder using the cd foldername command.
Then running a python program [Link] is a matter of writing python [Link].
Whatever the program prints can be seen in the terminal window.
A.3 How to Write and Run a Python Program 213

A.3.4 Using a Plain Text Editor and a Terminal Window

1. Create a folder where your Python programs can be located, say with name
mytest under your home folder. This is most conveniently done in the terminal
window since you need to use this window anyway to run the program. The
command for creating a new folder is mkdir mytest.
2. Move to the new folder: cd mytest.
3. Start the editor of your choice.
4. Write a program in the editor, e.g., just the line print Hello!. Save the
program under the name [Link] in the mytest folder.
5. Move to the terminal window and write python [Link]. You should see
the word Hello! being printed in the window.

A.3.5 Spyder

Spyder is a graphical application for developing and running Python programs,


available on all major platforms. Spyder comes with Anaconda and some other
pre-built environments for scientific computing with Python. On Ubuntu it is con-
veniently installed by sudo apt-get install spyder.
The left part of the Spyder window contains a plain text editor. Click in this
window and write print Hello! and return. Choose Run from the Run pull-
down menu, and observe the output Hello! in the lower right window where the
output from programs is visible.
You may continue with more advanced statements involving graphics:

import [Link] as plt


import numpy as np
x = [Link](0, 4, 101)
y = [Link](-x)*[Link]([Link]*x)
[Link](x,y)
[Link](First test of Spyder)
[Link]([Link])
[Link]()

Choosing Run Run now leads to a separate window with a plot of the function
e x sin.x/. Figure A.1 shows how the Spyder application may look like.
The plot file we generate in the above program, [Link], is by default found
in the Spyder folder listed in the default text in the top of the program. You can
choose Run Configure . . . to change this folder as desired. The program you
write is written to a file .[Link] in the same default folder, but any name and
folder can be specified in the standard File Save as. . . menu.
A convenient feature of Spyder is that the upper right window continuously dis-
plays documentation of the statements you write in the editor to the left.
214 A Getting Access to Python

Fig. A.1 The Spyder Integrated Development Environment

A.4 The SageMathCloud and Wakari Web Services

You can avoid installing Python on your machine completely by using a web service
that allows you to write and run Python programs. Computational science projects
will normally require some kind of visualization and associated graphics packages,
which is not possible unless the service offers IPython notebooks. There are two
excellent web services with notebooks: SageMathCloud at [Link]
com/ and Wakari at [Link] At both sites you must create an
account before you can write notebooks in the web browser and download them to
your own computer.

A.4.1 Basic Intro to SageMathCloud

Sign in, click on New Project, give a title to your project and decide whether it
should be private or public, click on the project when it appears in the browser,
and click on Create or Import a File, Worksheet, Terminal or Directory. . . . If your
Python program needs graphics, you need to choose IPython Notebook, otherwise
you can choose File. Write the name of the file above the row of buttons. As-
suming we do not need any graphics, we create a plain Python file, say with name
[Link]. By clicking File you are brought to a browser window with a text editor
where you can write Python code. Write some code and click Save. To run the
program, click on the plus icon (New), choose Terminal, and you have a plain Unix
terminal window where you can write python [Link] to run the program. Tabs
over the terminal (or editor) window make it easy to jump between the editor and
the terminal. To download the file, click on Files, point on the relevant line with the
file, and a download icon appears to the very right. The IPython notebook option
works much in the same way, see Sect. A.5.
A.5 Writing IPython Notebooks 215

A.4.2 Basic Intro to Wakari

After having logged in at the [Link] site, you automatically enter an IPython
notebook with a short introduction to how the notebook can be used. Click on
the New Notebook button to start a new notebook. Wakari enables creating and
editing plain Python files too: click on the Add file icon in pane to the left, fill in the
program name, and you enter an editor where you can write a program. Pressing
Execute launches an IPython session in a terminal window, where you can run the
program by run [Link] if [Link] is the name of the program. To download
the file, select [Link] in the left pane and click on the Download file icon.
There is a pull-down menu where you can choose what type of terminal window
you want: a plain Unix shell, an IPython shell, or an IPython shell with Matplotlib
for plotting. Using the latter, you can run plain Python programs or commands with
graphics. Just choose the type of terminal and click on +Tab to make a new terminal
window of the chosen type.

A.4.3 Installing Your Own Python Packages

Both SageMathCloud and Wakari let you install your own Python packages. To
install any package packagename available at PyPi15 , run

Terminal

pip install --user packagename

To install the SciTools package, which is useful when working with this book, run
the command
Terminal

pip install --user -e \


git+[Link]

A.5 Writing IPython Notebooks

The IPython notebook is a splendid interactive tool for doing science, but it can
also be used as a platform for developing Python code. You can either run it
locally on your computer or in a web service like SageMathCloud or Wakari. In-
stallation on your computer is trivial on Ubuntu, just sudo apt-get install
ipython-notebook, and also on Windows and Mac16 by using Anaconda or En-
thought Canopy for the Python installation.
The interface to the notebook is a web browser: you write all the code and see
all the results in the browser window. There are excellent YouTube videos on how
to use the IPython notebook, so here we provide a very quick step zero to get
anyone started.

15
[Link]
16
[Link]
216 A Getting Access to Python

A.5.1 A Simple Program in the Notebook

Start the IPython notebook locally by the command ipython notebook or go to


SageMathCloud or Wakari as described above. The default input area is a cell for
Python code. Type

g = 9.81
v0 = 5
t = 0.6
y = v0*t - 0.5*g*t**2

in a cell and run the cell by clicking on Run Selected (notebook running locally on
your machine) or on the play button (notebook running in the cloud). This action
will execute the Python code and initialize the variables g, v0, t, and y. You can
then write print y in a new cell, execute that cell, and see the output of this state-
ment in the browser. It is easy to go back to a cell, edit the code, and re-execute it.
To download the notebook to your computer, choose the File Download as
menu and select the type of file to be downloaded: the original notebook format
(.ipynb file extension) or a plain Python program version of the notebook (.py file
extension).

A.5.2 Mixing Text, Mathematics, Code, and Graphics

The real strength of IPython notebooks arises when you want to write a report to
document how a problem can be explored and solved. As a teaser, open a new
notebook, click in the first cell, and choose Markdown as format (notebook running
locally) or switch from Code to Markdown in the pull-down menu (notebook in
the cloud). The cell is now a text field where you can write text with Markdown17
syntax. Mathematics can be entered as LATEX code. Try some text with inline math-
ematics and an equation on a separate line:

Plot the curve $y=f(x)$, where

$$
f(x) = e^{-x}\sin (2\pi x),\quad x\in [0, 4]
$$

Execute the cell and you will see nicely typeset mathematics in the browser. In the
new cell, add some code to plot f .x/:

import numpy as np
import [Link] as plt
%matplotlib inline # make plots inline in the notebook

x = [Link](0, 4, 101)
y = [Link](-x)*[Link](2*pi*x)
[Link](x, y, b-)
[Link](x); [Link](y)

17
[Link]
A.5 Writing IPython Notebooks 217

Executing these statements results in a plot in the browser, see Fig. A.2. It was
popular to start the notebook by ipython notebook pylab to import everything
from numpy and [Link] and make all plots inline, but the pylab
option is now officially discouraged18 . If you want the notebook to behave more as
MATLAB and not use the np and plt prefix, you can instead of the first three lines
above write %pylab.

Fig. A.2 Example on an IPython notebook

18
[Link]
References

1. L. Baochuan. Introduction to Numerical Methods. 2015. [Link]


Introduction_to_Numerical_Methods.
2. O. Certik et al. SymPy: Python library for symbolic mathematics. [Link]
3. S. D. Conte and C. de Boor. Elementary Numerical Analysis - An Algorithmic Approach.
McGraw-Hill, third edition, 1980.
4. I. Danaila, P. Joly, S. M. Kaber, and M. Postel. An Introduction to Scientific Computing.
Springer, 2007.
5. C. Greif and U. M. Ascher. A First Course in Numerical Methods. Computational Science
and Engineering. SIAM, 2011.
6. D. W. Harder and R. Numerical Analysis for Engineering. 2015. [Link]
~dwharder/NumericalAnalysis/.
7. ScientificPython software package. [Link]
8. J. D. Hunter. Matplotlib: a 2D graphics environment. Computing in Science & Engineering,
9, 2007.
9. J. D. Hunter et al. Matplotlib: Software package for 2D graphics. [Link]
10. E. Jones, T. E. Oliphant, P. Peterson, et al. SciPy scientific computing library for Python.
[Link]
11. J. Kiusalaas. Numerical Methods in Engineering with Python. Cambridge, second edition,
2014.
12. H. P. Langtangen. DocOnce publishing platform. [Link]
13. H. P. Langtangen. A Primer on Scientific Programming with Python. Texts in Computational
Science and Engineering. Springer, fifth edition, 2016.
14. H. P. Langtangen and J. H. Ring. SciTools: Software tools for scientific computing. https://
[Link]/hplgit/scitools.
15. R. LeVeque. Finite Difference Methods for Ordinary and Partial Differential Equations:
Steady-State and Time-Dependent Problems. SIAM, 2007.
16. T. Lyche and J.-L. Merrien. Exercises in Computational Mathematics with MATLAB. Springer,
2014.
17. C. Moler. Numerical Computing with MATLAB. SIAM, 2004. [Link]
moler/[Link].
18. S. Nakamura. Numerical Analysis and Graphic Visualization with Matlab. Prentice Hall,
second edition, 2002.
19. T. E. Oliphant. Python for scientific computing. Computing in Science & Engineering, 9,
2007.

219
220 7 References

20. T. E. Oliphant et al. NumPy array processing package for Python. [Link]
21. S. Otto and J. P. Denier. An Introduction to Programming and Numerical Methods in MATLAB.
Springer, 2005.
22. F. Perez and B. E. Granger. IPython: a system for interactive scientific computing. Computing
in Science & Engineering, 9, 2007.
23. F. Perez, B. E. Granger, et al. IPython software package for interactive scientific computing.
[Link]
24. W. H. Press, S. A. Teukolsky, W. T. Vetterling, and B. P. Flannery. Numerical Recipes. Cam-
bridge, 1992. [Link]
25. Python programming language. [Link]
26. G. Recktenwald. Numerical Methods with MATLAB: Implementations and Applications.
Prentice-Hall, 2000. [Link]
27. G. Sewell. The Numerical Solution of Ordinary and Partial Differential Equations. Wiley,
2005.
28. T. Siauw and A. Bayen. An Introduction to MATLAB Programming and Numerical Meth-
ods for Engineers. Academic Press, 2014. [Link]
9780124202283.
29. L. N. Trefethen. Spectral Methods in MATLAB. SIAM, 2000.
30. L. N. Trefethen. Approximation Theory and Approximation Practice. SIAM, 2012.
31. T. Young and M. J. Mohlenkamp. Introduction to Numerical Methods and MATLAB Program-
ming for Engineers. 2015. [Link]
Index

2nd-order Runge-Kutta method, 131 robust, 193


try-except, 195
A colon, 29
algorithm, 3 comment, 4
allocate, 17 commenting code, 25
argument, 31 compartment model, 111
keyword, 34 composite midpoint method, 65
named, 34 composite trapezoidal rule, 57
ordinary, 34 computational speed (measuring), 77
positional, 34 computer program, 1
array, 11, 17 convergence rate, 70
element, 17 copy, 18
index, 17 Crank-Nicolson method, 140, 156
slice of, 18
sorting, 47 D
asarray (function), 118 debugger, 22
assert (function), 72 debugging, 2, 3, 22
assignment, 5 def, 31
atan, 7 default, 15
axis (plot), 20 demo function, 105
difference
B absolute, 72
boolean, 29 backward, 130
expression, 29 centered, 131
False, 29 forward, 99, 130
True, 29 relative, 72
boundary conditions, 162 differential equation
brute force method, 186 first-order, 96
bug, 2, 3, 68 second-order, 125
diffusion equation, 161
C discontinuous coefficient, 123
C, 2 divergence, 194
C++, 2 doc string, 35
calculator, 5 DocOnce, ix
cell, 164 domain, 78, 82, 84, 162
class, 168 complex, 84
closure, 168 double integral
code, 4 midpoint, 78
exception, 195 double sum, 79
re-use, 63, 80 dynamical system, 95

221
222 7 Index

E Heuns method, 131


elif, 29 hold (on/off), 19
else, 29
Emacs, 6, 212 I
error Idle, 212
asymptotic, 70 if, 29
function (erf), 64 implement (a program), 3
message, 21 implementation
rounding, 71 general, 60
tolerance, 71 specific, 60
Euler import, 12
pi, 48 math, 8
Eulers method, 101 [Link], 10
exception handling, 22 module, 62
execute (a program), 3 numpy, 10
exit (sys), 200 random (function), 30
exp math notation, 98 indent, 29
indexing
F one based, 17
False, 29 zero based, 17
fast code, 25 initial conditions, 162
finite difference method, 99 input, 23
finite precision (of float), 71 instability, 170
flat program, 63 instruction, 4
float, 13 int, 13
floating point number (float), 71 integer division, 14
for loop, 37 integral
format analytically, 55
png, 20 approximately, 55
Fortran, 2 exact, 55
forward difference approximation, 99 numerically, 55
Forward Euler scheme, 101 integration
Fourier series, 51 points, 57
from, 8 interactive use (of Python), 12
function, 7, 31 IPython, 6, 12
asarray, 118
assert, 72 K
call, 7 keyboard
definition, 31 arrow up/down, 12
global, 36
handle, 35 L
input parameter, 7 lambda function, 36
local, 36 language
nested, 36 computer, 2
output parameter, 7 programming, 2
return, 7 Laplace equation, 182
take a parameter, 7 least squares method, 50
legend (plot), 20
G Leibniz
garbage collection, 25 pi, 48
Gauss quadrature, 68 library, 8
Gedit, 6, 212 function, 8
graph, 18 SymPy, 23
linear algebra, 21, 39
H linear interpolation, 49
hardcopy (plot), 20 linspace, 10
heat equation, 161 list, 23, 41
7 Index 223

append, 41 Octave, 2
comprehension, 42 ODE
convert to array, 41 scalar, 116
create, 41 vector, 116
delete, 41 operator
loadtxt, 44 Arithmetic, 13
logistic model Logical, 30
carrying capacity, 107
long lines (splitting of), 25 P
loop package, 8
double, 39 parameter
for, 37 input, 31
index, 37, 40 output, 31
infinite, 40 parentheses, 13
iteration, 37, 40 PDE, 161
multiple, 39 plot, 9, 11
nested, 39 figure, 20
while, 40 Poisson equation, 182
print, 4
M printf formatting, 15
main program, 33 printing
Maple, 2 formatted, 15
math, 8 program
Mathematica, 2, 24 crash, 22
mathematical modeling, 116 execute, 4, 6
MATLAB, 2 flat, 63
[Link], 10 input, 23
matrix, 21 output, 23
mat, 21 run, 4, 6
tridiagonal, 177 statement, 4
vector product, 21 testing, 22
mesh, 99 typing, 6
points, 99, 164 verification, 22
uniform, 99 programming, 2
method of lines, 163, 164 game, 49
Midpoint method, 65 prompt, 6, 12
model pseudo code, 29
computational, 97 [Link], 72
differential equation, 96 Python, 2
mathematical, 3, 96 documentation, 25
module, 8, 62 installation, 6
MOL, 163 shell, 12
forward Euler, 163 zero-based indexing, 18
Monte Carlo integration, 84
R
N random (function), 30
NameError, 8 random walk, 29
Newton range, 37
starting value, 196 rate of convergence, 70, 201
nonlinear algebraic equation, 132 raw input, 23
nose (testing), 72 read (from file), 43
Notepad++, 6, 212 reserved words, 13
numerical scheme, 101 resonance, 146
numpy, 10 return, 31
None, 200
O value, 33
object, 13 RK2, 131
224 7 Index

root finding, 186 transpose (of matrix), 21


rounding error, 13, 14 Trapezoidal rule, 57
Runge-Kutta, 2nd-order method, 131 tridiagonal matrix, 177
Runge-Kutta-Fehlberg, 137 triple integral
midpoint, 81
S True, 29
Sage (symbolic package), 25 try-exception, 22
savetxt, 44 tuple, 23, 41
scalar ODE, 116 type conversion, 13
scaling, 144, 170 automatic, 14
scheme, 96
script (and scripting), 3 U
second-order ODE rewritten as two first-order unit tests, 69
ODEs, 126 unstable solutions, 170
seed (random generators), 87
simple pendulum, 125 V
Simpsons rule, 68 validation, 22
simulation, 3 variable, 5
SIR model, 110 assignment, 13
source term, 161 delete, 25
spring float, 13
damping of, 124, 141 global, 34
linear, 144 int, 13
nonlinear, 141 local, 34
oscillations, 124 name, 13
Spyder, 6 str, 13
stability criterion, 170 type, 13
stop program (Ctrl+c), 41 vector, 21
str, 13 vector ODE, 116
symbolic vectorization, 76, 172
computations, 23 verification, 22
operations, 23 Verlet integration, 150
simplifications, 23 Vim, 6, 212
SymPy, 23
syntax, 2 W
[Link], 200 WARNING, 8
system of ODEs, 116 while loop, 40
WolframAlpha, 24
T write (to file), 43
Taylor series, 157
test block, 62 X
test function, 72 xlabel, 11
testing, 22
testing procedures, 69 Y
text editor, 6 ylabel, 11
TextWrangler, 6, 212
theta rule, 179 Z
title (plot), 20 zeros, 17
Editorial Policy

1. Textbooks on topics in the field of computational science and engineering will


be considered. They should be written for courses in CSE education. Both graduate
and undergraduate textbooks will be published in TCSE. Multidisciplinary topics
and multidisciplinary teams of authors are especially welcome.
2. Format: Only works in English will be considered. For evaluation pur-
poses, manuscripts may be submitted in print or electronic form, in the latter case,
preferably as pdf- or zipped ps-files. Authors are requested to use the LaTeX style
files available from Springer at: [Link]
authors-editors/manuscript-preparation/5636 (Click on ! Templates ! LaTeX
! monographs)
Electronic material can be included if appropriate. Please contact the publisher.
3. Those considering a book which might be suitable for the series are strongly
advised to contact the publisher or the series editors at an early stage.

General Remarks

Careful preparation of manuscripts will help keep production time short and ensure
a satisfactory appearance of the finished book.
The following terms and conditions hold:
Regarding free copies and royalties, the standard terms for Springer mathematics
textbooks hold. Please write to [Link]@[Link] for details.
Authors are entitled to purchase further copies of their book and other Springer
books for their personal use, at a discount of 33.3% directly from Springer-Verlag.
Series Editors

Timothy J. Barth Risto M. Nieminen


NASA Ames Research Center Department of Applied Physics
NAS Division Aalto University School of Science
Moffett Field, CA 94035, USA and Technology
barth@[Link] 00076 Aalto, Finland
[Link]@[Link]
Michael Griebel
Institut fr Numerische Simulation Dirk Roose
der Universitt Bonn Department of Computer Science
Wegelerstr. 6 Katholieke Universiteit Leuven
53115 Bonn, Germany Celestijnenlaan 200A
griebel@[Link] 3001 Leuven-Heverlee, Belgium
[Link]@[Link]
David E. Keyes Tamar Schlick
Mathematical and Computer Sciences Department of Chemistry
and Engineering and Courant Institute
King Abdullah University of Science of Mathematical Sciences
and Technology New York University
P.O. Box 55455 251 Mercer Street
Jeddah 21534, Saudi Arabia New York, NY 10012, USA
[Link]@[Link] schlick@[Link]

and Editor for Computational Science


and Engineering at Springer:
Department of Applied Physics Martin Peters
and Applied Mathematics Springer-Verlag
Columbia University Mathematics Editorial IV
500 W. 120 th Street Tiergartenstrasse 17
New York, NY 10027, USA 69121 Heidelberg, Germany
kd2112@[Link] [Link]@[Link]
Texts in Computational Science
and Engineering

1. H. P. Langtangen, Computational Partial Differential Equations. Numerical Methods and Diffpack


Programming. 2nd Edition

2. A. Quarteroni, F. Saleri, P. Gervasio, Scientific Computing with MATLAB and Octave. 4th Edition

3. H. P. Langtangen, Python Scripting for Computational Science. 3rd Edition


4. H. Gardner, G. Manduchi, Design Patterns for e-Science.

5. M. Griebel, S. Knapek, G. Zumbusch, Numerical Simulation in Molecular Dynamics.

6. H. P. Langtangen, A Primer on Scientific Programming with Python. 5th Edition

7. A. Tveito, H. P. Langtangen, B. F. Nielsen, X. Cai, Elements of Scientific Computing.

8. B. Gustafsson, Fundamentals of Scientific Computing.

9. M. Bader, Space-Filling Curves.


10. M. Larson, F. Bengzon, The Finite Element Method: Theory, Implementation and Applications.

11. W. Gander, M. Gander, F. Kwok, Scientific Computing: An Introduction using Maple and MATLAB.

12. P. Deuflhard, S. Rblitz, A Guide to Numerical Modelling in Systems Biology.

13. M. H. Holmes, Introduction to Scientific Computing and Data Analysis.

14. S. Linge, H. P. Langtangen, Programming for Computations A Gentle Introduction to Numerical


Simulations with MATLAB/Octave.

15. S. Linge, H. P. Langtangen, Programming for Computations A Gentle Introduction to Numerical


Simulations with Python.

For further information on these books please have a look at our mathematics catalogue at the following
URL: [Link]/series/5151

Monographs in Computational Science


and Engineering

1. J. Sundnes, G.T. Lines, X. Cai, B.F. Nielsen, K.-A. Mardal, A. Tveito, Computing the Electrical
Activity in the Heart.

For further information on this book, please have a look at our mathematics catalogue at the following
URL: [Link]/series/7417
Lecture Notes
in Computational Science
and Engineering

1. D. Funaro, Spectral Elements for Transport-Dominated Equations.


2. H.P. Langtangen, Computational Partial Differential Equations. Numerical Methods and Diffpack
Programming.
3. W. Hackbusch, G. Wittum (eds.), Multigrid Methods V.
4. P. Deuflhard, J. Hermans, B. Leimkuhler, A.E. Mark, S. Reich, R.D. Skeel (eds.), Computational
Molecular Dynamics: Challenges, Methods, Ideas.
5. D. Krner, M. Ohlberger, C. Rohde (eds.), An Introduction to Recent Developments in Theory and
Numerics for Conservation Laws.
6. S. Turek, Efficient Solvers for Incompressible Flow Problems. An Algorithmic and Computational
Approach.
7. R. von Schwerin, Multi Body System SIMulation. Numerical Methods, Algorithms, and Software.
8. H.-J. Bungartz, F. Durst, C. Zenger (eds.), High Performance Scientific and Engineering Comput-
ing.
9. T.J. Barth, H. Deconinck (eds.), High-Order Methods for Computational Physics.
10. H.P. Langtangen, A.M. Bruaset, E. Quak (eds.), Advances in Software Tools for Scientific Comput-
ing.
11. B. Cockburn, G.E. Karniadakis, C.-W. Shu (eds.), Discontinuous Galerkin Methods. Theory, Com-
putation and Applications.
12. U. van Rienen, Numerical Methods in Computational Electrodynamics. Linear Systems in Practical
Applications.
13. B. Engquist, L. Johnsson, M. Hammill, F. Short (eds.), Simulation and Visualization on the Grid.
14. E. Dick, K. Riemslagh, J. Vierendeels (eds.), Multigrid Methods VI.
15. A. Frommer, T. Lippert, B. Medeke, K. Schilling (eds.), Numerical Challenges in Lattice Quantum
Chromodynamics.
16. J. Lang, Adaptive Multilevel Solution of Nonlinear Parabolic PDE Systems. Theory, Algorithm,
and Applications.
17. B.I. Wohlmuth, Discretization Methods and Iterative Solvers Based on Domain Decomposition.
18. U. van Rienen, M. Gnther, D. Hecht (eds.), Scientific Computing in Electrical Engineering.
19. I. Babuka, P.G. Ciarlet, T. Miyoshi (eds.), Mathematical Modeling and Numerical Simulation in
Continuum Mechanics.
20. T.J. Barth, T. Chan, R. Haimes (eds.), Multiscale and Multiresolution Methods. Theory and
Applications.
21. M. Breuer, F. Durst, C. Zenger (eds.), High Performance Scientific and Engineering Computing.
22. K. Urban, Wavelets in Numerical Simulation. Problem Adapted Construction and Applications.
23. L.F. Pavarino, A. Toselli (eds.), Recent Developments in Domain Decomposition Methods.
24. T. Schlick, H.H. Gan (eds.), Computational Methods for Macromolecules: Challenges and
Applications.
25. T.J. Barth, H. Deconinck (eds.), Error Estimation and Adaptive Discretization Methods in
Computational Fluid Dynamics.
26. M. Griebel, M.A. Schweitzer (eds.), Meshfree Methods for Partial Differential Equations.
27. S. Mller, Adaptive Multiscale Schemes for Conservation Laws.
28. C. Carstensen, S. Funken, W. Hackbusch, R.H.W. Hoppe, P. Monk (eds.), Computational
Electromagnetics.
29. M.A. Schweitzer, A Parallel Multilevel Partition of Unity Method for Elliptic Partial Differential
Equations.
30. T. Biegler, O. Ghattas, M. Heinkenschloss, B. van Bloemen Waanders (eds.), Large-Scale PDE-
Constrained Optimization.
31. M. Ainsworth, P. Davies, D. Duncan, P. Martin, B. Rynne (eds.), Topics in Computational Wave
Propagation. Direct and Inverse Problems.
32. H. Emmerich, B. Nestler, M. Schreckenberg (eds.), Interface and Transport Dynamics. Computa-
tional Modelling.
33. H.P. Langtangen, A. Tveito (eds.), Advanced Topics in Computational Partial Differential
Equations. Numerical Methods and Diffpack Programming.
34. V. John, Large Eddy Simulation of Turbulent Incompressible Flows. Analytical and Numerical
Results for a Class of LES Models.
35. E. Bnsch (ed.), Challenges in Scientific Computing CISC 2002.
36. B.N. Khoromskij, G. Wittum, Numerical Solution of Elliptic Differential Equations by Reduction
to the Interface.
37. A. Iske, Multiresolution Methods in Scattered Data Modelling.
38. S.-I. Niculescu, K. Gu (eds.), Advances in Time-Delay Systems.
39. S. Attinger, P. Koumoutsakos (eds.), Multiscale Modelling and Simulation.
40. R. Kornhuber, R. Hoppe, J. Priaux, O. Pironneau, O. Wildlund, J. Xu (eds.), Domain Decomposi-
tion Methods in Science and Engineering.
41. T. Plewa, T. Linde, V.G. Weirs (eds.), Adaptive Mesh Refinement Theory and Applications.
42. A. Schmidt, K.G. Siebert, Design of Adaptive Finite Element Software. The Finite Element Toolbox
ALBERTA.
43. M. Griebel, M.A. Schweitzer (eds.), Meshfree Methods for Partial Differential Equations II.
44. B. Engquist, P. Ltstedt, O. Runborg (eds.), Multiscale Methods in Science and Engineering.
45. P. Benner, V. Mehrmann, D.C. Sorensen (eds.), Dimension Reduction of Large-Scale Systems.
46. D. Kressner, Numerical Methods for General and Structured Eigenvalue Problems.
47. A. Borii, A. Frommer, B. Jo, A. Kennedy, B. Pendleton (eds.), QCD and Numerical Analysis III.
48. F. Graziani (ed.), Computational Methods in Transport.
49. B. Leimkuhler, C. Chipot, R. Elber, A. Laaksonen, A. Mark, T. Schlick, C. Schtte, R. Skeel (eds.),
New Algorithms for Macromolecular Simulation.
50. M. Bcker, G. Corliss, P. Hovland, U. Naumann, B. Norris (eds.), Automatic Differentiation: Ap-
plications, Theory, and Implementations.
51. A.M. Bruaset, A. Tveito (eds.), Numerical Solution of Partial Differential Equations on Parallel
Computers.
52. K.H. Hoffmann, A. Meyer (eds.), Parallel Algorithms and Cluster Computing.
53. H.-J. Bungartz, M. Schfer (eds.), Fluid-Structure Interaction.
54. J. Behrens, Adaptive Atmospheric Modeling.
55. O. Widlund, D. Keyes (eds.), Domain Decomposition Methods in Science and Engineering XVI.
56. S. Kassinos, C. Langer, G. Iaccarino, P. Moin (eds.), Complex Effects in Large Eddy Simulations.
57. M. Griebel, M.A Schweitzer (eds.), Meshfree Methods for Partial Differential Equations III.
58. A.N. Gorban, B. Kgl, D.C. Wunsch, A. Zinovyev (eds.), Principal Manifolds for Data Visualiza-
tion and Dimension Reduction.
59. H. Ammari (ed.), Modeling and Computations in Electromagnetics: A Volume Dedicated to Jean-
Claude Ndlec.
60. U. Langer, M. Discacciati, D. Keyes, O. Widlund, W. Zulehner (eds.), Domain Decomposition
Methods in Science and Engineering XVII.
61. T. Mathew, Domain Decomposition Methods for the Numerical Solution of Partial Differential
Equations.
62. F. Graziani (ed.), Computational Methods in Transport: Verification and Validation.
63. M. Bebendorf, Hierarchical Matrices. A Means to Efficiently Solve Elliptic Boundary Value
Problems.
64. C.H. Bischof, H.M. Bcker, P. Hovland, U. Naumann, J. Utke (eds.), Advances in Automatic
Differentiation.
65. M. Griebel, M.A. Schweitzer (eds.), Meshfree Methods for Partial Differential Equations IV.
66. B. Engquist, P. Ltstedt, O. Runborg (eds.), Multiscale Modeling and Simulation in Science.
67. I.H. Tuncer, . Glcat, D.R. Emerson, K. Matsuno (eds.), Parallel Computational Fluid Dynamics
2007.
68. S. Yip, T. Diaz de la Rubia (eds.), Scientific Modeling and Simulations.
69. A. Hegarty, N. Kopteva, E. ORiordan, M. Stynes (eds.), BAIL 2008 Boundary and Interior
Layers.
70. M. Bercovier, M.J. Gander, R. Kornhuber, O. Widlund (eds.), Domain Decomposition Methods in
Science and Engineering XVIII.
71. B. Koren, C. Vuik (eds.), Advanced Computational Methods in Science and Engineering.
72. M. Peters (ed.), Computational Fluid Dynamics for Sport Simulation.
73. H.-J. Bungartz, M. Mehl, M. Schfer (eds.), Fluid Structure Interaction II Modelling, Simulation,
Optimization.
74. D. Tromeur-Dervout, G. Brenner, D.R. Emerson, J. Erhel (eds.), Parallel Computational Fluid
Dynamics 2008.
75. A.N. Gorban, D. Roose (eds.), Coping with Complexity: Model Reduction and Data Analysis.
76. J.S. Hesthaven, E.M. Rnquist (eds.), Spectral and High Order Methods for Partial Differential
Equations.
77. M. Holtz, Sparse Grid Quadrature in High Dimensions with Applications in Finance and Insur-
ance.
78. Y. Huang, R. Kornhuber, [Link], J. Xu (eds.), Domain Decomposition Methods in Science and
Engineering XIX.
79. M. Griebel, M.A. Schweitzer (eds.), Meshfree Methods for Partial Differential Equations V.
80. P.H. Lauritzen, C. Jablonowski, M.A. Taylor, R.D. Nair (eds.), Numerical Techniques for Global
Atmospheric Models.
81. C. Clavero, J.L. Gracia, F.J. Lisbona (eds.), BAIL 2010 Boundary and Interior Layers, Computa-
tional and Asymptotic Methods.
82. B. Engquist, O. Runborg, Y.R. Tsai (eds.), Numerical Analysis and Multiscale Computations.
83. I.G. Graham, T.Y. Hou, O. Lakkis, R. Scheichl (eds.), Numerical Analysis of Multiscale Problems.
84. A. Logg, K.-A. Mardal, G. Wells (eds.), Automated Solution of Differential Equations by the Finite
Element Method.
85. J. Blowey, M. Jensen (eds.), Frontiers in Numerical Analysis Durham 2010.
86. O. Kolditz, U.-J. Gorke, H. Shao, W. Wang (eds.), Thermo-Hydro-Mechanical-Chemical Processes
in Fractured Porous Media Benchmarks and Examples.
87. S. Forth, P. Hovland, E. Phipps, J. Utke, A. Walther (eds.), Recent Advances in Algorithmic Differ-
entiation.
88. J. Garcke, M. Griebel (eds.), Sparse Grids and Applications.
89. M. Griebel, M.A. Schweitzer (eds.), Meshfree Methods for Partial Differential Equations VI.
90. C. Pechstein, Finite and Boundary Element Tearing and Interconnecting Solvers for Multiscale
Problems.
91. R. Bank, M. Holst, O. Widlund, J. Xu (eds.), Domain Decomposition Methods in Science and
Engineering XX.
92. H. Bijl, D. Lucor, S. Mishra, C. Schwab (eds.), Uncertainty Quantification in Computational Fluid
Dynamics.
93. M. Bader, H.-J. Bungartz, T. Weinzierl (eds.), Advanced Computing.
94. M. Ehrhardt, T. Koprucki (eds.), Advanced Mathematical Models and Numerical Techniques for
Multi-Band Effective Mass Approximations.
95. M. Azaez, H. El Fekih, J.S. Hesthaven (eds.), Spectral and High Order Methods for Partial Dif-
ferential Equations ICOSAHOM 2012.
96. F. Graziani, M.P. Desjarlais, R. Redmer, S.B. Trickey (eds.), Frontiers and Challenges in Warm
Dense Matter.
97. J. Garcke, D. Pflger (eds.), Sparse Grids and Applications Munich 2012.
98. J. Erhel, M. Gander, L. Halpern, G. Pichot, T. Sassi, O. Widlund (eds.), Domain Decomposition
Methods in Science and Engineering XXI.
99. R. Abgrall, H. Beaugendre, P.M. Congedo, C. Dobrzynski, V. Perrier, M. Ricchiuto (eds.), High
Order Nonlinear Numerical Methods for Evolutionary PDEs HONOM 2013.
100. M. Griebel, M.A. Schweitzer (eds.), Meshfree Methods for Partial Differential Equations VII.
101. R. Hoppe (ed.), Optimization with PDE Constraints OPTPDE 2014.
102. S. Dahlke, W. Dahmen, M. Griebel, W. Hackbusch, K. Ritter, R. Schneider, C. Schwab,
H. Yserentant (eds.), Extraction of Quantifiable Information from Complex Systems.
103. A. Abdulle, S. Deparis, D. Kressner, F. Nobile, M. Picasso (eds.), Numerical Mathematics and
Advanced Applications ENUMATH 2013.
104. T. Dickopf, M.J. Gander, L. Halpern, R. Krause, L.F. Pavarino (eds.), Domain Decomposition
Methods in Science and Engineering XXII.
105. M. Mehl, M. Bischoff, M. Schfer (eds.), Recent Trends in Computational Engineering CE2014.
Optimization, Uncertainty, Parallel Algorithms, Coupled and Complex Problems.
106. R.M. Kirby, M. Berzins, J.S. Hesthaven (eds.), Spectral and High Order Methods for Partial Dif-
ferential Equations ICOSAHOM14.
107. B. Jttler, B. Simeon (eds.), Isogeometric Analysis and Applications 2014.
108. P. Knobloch (ed.), Boundary and Interior Layers, Computational and Asymptotic Methods BAIL
2014.
109. J. Garcke, D. Pflger (eds.), Sparse Grids and Applications Stuttgart 2014.
110. H.P. Langtangen, Finite Difference Computing with Exponential Decay Models.
111. A. Tveito, G.T. Lines, Computing Characterizations of Drugs for Ion Channels and Receptors
Using Markov Models

For further information on these books please have a look at our mathematics catalogue at the following
URL: [Link]/series/3527

You might also like