Synthetic Protein Switches Methods and Protocols (Methods in Molecular Biology)
Synthetic Protein Switches Methods and Protocols (Methods in Molecular Biology)
Synthetic
Protein
Switches
Methods and Protocols
Methods in Molecular Biology
Series Editor
JohnM.Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB,UK
Edited by
Viktor Stein
Fachbereich Biologie, Technische Universitt Darmstadt, Darmstadt, Germany
Editor
Viktor Stein
Fachbereich Biologie
Technische Universitt Darmstadt
Darmstadt, Germany
Synthetic protein switches with custom response functions have become invaluable tools in
basic research and biotechnology for monitoring biomolecular analytes or actuating cellular
functions in a rapid, specific, integrated, and autonomous fashion. This book provides a
comprehensive summary of state-of-the-art protocols to facilitate the construction of syn-
thetic protein switches for a variety of applications in biotechnology and basic research.
Protocols are applicable to life scientists from diverse research fields that range from tradi-
tional, discovery-centered disciplines such as cancer research to newly emerging disciplines
such as synthetic biology.
Chapters are grouped into separate sections focusing on different types of switches,
sensors, and actuators. Starting with a general view, I first discuss the experimental chal-
lenges and theoretical considerations that underlie the construction of synthetic protein
switches, also highlighting an increasing number of computational approaches which aim
to render the design cycle more rational and therefore more efficient. In the second chap-
ter, Ha and Loh provide an overview on the construction of synthetic protein switches by
means of alternative frame folding and intermolecular fragment exchange which promises a
generic route to convert any conventional binding receptor or enzyme into an allosterically
regulated protein switch. This is followed up by a detailed protocol by Ribeiro, Ostermeier,
etal. on the construction of synthetic protein switches by means of domain insertion
describing the underlying non-homology-dependent DNA recombination process to build
DNA libraries.
Subsequent chapters become increasingly specific, providing case studies on how to
engineer synthetic protein switches for different types of applications. Starting with protocol
chapters that describe the construction of fluorescent and bioluminescent sensors, Mitchell,
Jackson, etal. and Clifton, Jackson, etal. demonstrate how computational strategies based
on molecular modeling and statistical sequence analysis can be applied to engineer small
molecule FRET sensors with enhanced biophysical properties. Farrants, Johnsson, etal. then
describe a general route toward small molecule sensors based on semisynthetic fluorescent
and bioluminescent sensors that are built with the SNAP-tag protein conjugation system.
Finally, Nyati etal. and Matysuma, Ueda, etal. illustrate the construction of bioluminescent
sensors based on proximity-dependent and allosterically regulated firefly luciferases.
Beyond fluorescent and bioluminescent sensors, three chapters by Iwai etal., Wouters
etal., and Nirantar etal. focus on the construction of synthetic protein switches based on
-lactamase, which has served as a model enzyme for pioneering a number of design strate-
gies, for instance, by means of domain insertion and competitive autoinhibition. This is
followed up by two chapters that describe the construction of protease-based switches as
Wintgens, Wehr, etal. and Stein and Alexandrov illustrate how viral proteases can be reen-
gineered into synthetic protease sensors with custom input-output functions based on split-
and competitively autoinhibited architectures.
The book concludes with chapters focusing on the construction of protein switches
that can actuate biological signaling functions in live cells. To this end, Muehlhaeuser,
v
vi Preface
Radzwilli, etal.; Stabel, Moeglich, etal.; Cosentino, Moroni, etal.; and Taxis provide pro-
tocols on how to regulate protein kinase function, ion channel permeability, and protein
degradation by means of light-regulated protein switches. This is followed up with protocol
chapters by Castillo, Ghosh, etal. and DiRoberto, Peisajovich, etal. who devise strategies
for regulating cellular signal transduction systems through biologically inert ligands and
rewiring key nodes of intracellular signaling systems.
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
vii
viii Contents
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 339
Contributors
ix
x Contributors
Abstract
Synthetic protein switches with tailored response functions are finding increasing applications as tools in
basic research and biotechnology. With a number of successful design strategies emerging, the construction
of synthetic protein switches still frequently necessitates an integrated approach that combines detailed bio-
chemical and biophysical characterization in combination with high-throughput screening to construct tai-
lored synthetic protein switches. This is increasingly complemented by computational strategies that aim to
reduce the need for costly empirical optimization and thus facilitate the protein design process. Successful
computational design approaches range from analyzing phylogenetic data to infer useful structural, bio-
physical, and biochemical information to modeling the structure and function of proteins ab initio. The
following chapter provides an overview over the theoretical considerations and experimental approaches that
have been successful applied in the construction of synthetic protein switches.
Key words Protein switches, Protein engineering, Synthetic biology, Protein signaling, Genetic
circuits
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_1, Springer Science+Business Media LLC 2017
3
4 Viktor Stein
2.1 Design The protein database (PDB) features over 120,000 solved protein
byMolecular Intuition structures that can be exploited for the structure-guided engineer-
ing of protein switches by (semi-)rationally recombining binding
receptors with enzymes, fluorescent, or bioluminescent proteins.
Protein structures are readily accessible through structural visual-
ization programs such as PyMol (DeLano WL, 2002 The PyMOL
Molecular Graphics System) that provide an indispensable design
aid. For instance, in domain insertion strategies, an allosteric
receptor is typically inserted into surface exposed loop regions
such that ligand-induced conformational changes are efficiently
transmitted to the actuator modulating its function. In this way,
synthetic protein switches and sensors have been engineered based
on GFP [2224], -lactamase [2527], tyrosine protein kinases
[2830], xylanase [31], and PQQ-dependent glucose dehydroge-
nase (GDH) [32]. Similarly, alternative frame folding relies on a
thorough structural analysis to identify, duplicate, and modify
structural elements that are important for the binding or catalytic
function of a synthetic protein switch [3335]. Structurally related
to synthetic protein switches engineered by domain insertion are
split protein complementation sensors that reassemble into a func-
tional protein upon induced localization of the two protein halves.
Here, structural intuition frequently guides the choice of the split
sites that separate a protein into two structurally well-defined
subdomains. In this way, it has been possible to reengineer a num-
ber of split luciferases to report on intracellular signaling events
[3639], split tobacco etch virus (TEV) proteases to sense and
actuate intracellular signaling function [4043], split tyrosine pro-
tein kinases to actuate cellular signaling functions and screen for
drugs [44, 45], and split PQQ-dependent GDH as a universal
biosensor platform [46]. In addition, the construction of modu-
larly organized protein switches based on structurally distinct allo-
steric receptors and actuators benefits from high-resolution
structural information as it provides clues about the position and
relative orientation of the N- and C-termini that assist in the
Engineering Synthetic Protein Switches 7
2.2 Design Toward this goal, a number of computational strategies have been
byMolecular Modeling pursued to analyze and engineer structural and functional proper-
ties of a protein a priori by means of computational design
[6870]. In its most elementary form, molecular dynamic simula-
tions compute the behavior of an ensemble of molecules based on
the physical forces that every single atom is subject to. Such high-
resolution models are however computationally expensive, and in
practice take prolonged periods of time to model the structure or
the conformational dynamics of proteins. As a result, molecular
dynamics simulations are primarily restricted to analytical studies
and thus not suited to iterate through large numbers of protein
mutants as necessitated in rational protein design.
Instead, increasing grades of abstraction and simplification are
introduced aiming to limit the conformational search space and
accelerate computation times [6870]. This usually requires iden-
tifying, approximating, and weighing the key parameters that
underlie a structural, biophysical, or functional property. Specific
simplifications include restricting the dihedral angles of the poly-
peptide backbone and amino acid sidechains to the most frequently
occurring rotamers (in the same way structural biologists match
the tertiary structure of a protein to its electron density map) or
approximating secondary structure propensities, solvation terms,
electrostatic energies, and hydrogen bond potentials. This is
increasingly complemented by bioinformatic approaches mining
protein structures for functional motifs that can be grafted onto a
desired binding or enzyme catalyzed reaction.
In this way, a number of new protein structures and functions
could be computationally engineered including new folds [71, 72],
new ligand and substrate specificities [73, 74], as well as new cata-
lytic functions [75, 76]. In contrast, predictably engineering the
conformational transitions that underlie the switch-like behavior of
synthetic protein switches has proven more difficult and primarily
relied on redesigning individual properties. In one recent example,
8 Viktor Stein
3.1 Non-Homology- Before the advent of highly affordable synthetic DNA, random
Dependent domain insertions were created following a limited endonuclease
Recombination digest of a circular DNA construct coding for an actuator and sub-
Strategies sequent fusion with a linear DNA construct coding for an allosteric
receptor. The latter may also be circularly permutated resulting in
a set of new N- and C-termini which potentially enhances the
transmission of conformational changes between the receptor and
the actuator; these are not necessarily confined to the original N-
and C-termini, but most pronounced at internal sites [96]. The
resulting libraries are then empirically screened for domain inser-
tion mutants that are functionally recombined in allosteric hotspots
(c.f. SCA that aims to predict allosteric hotspots as opposed to
experimentally screen for them). This strategy has, for instance,
been successfully applied to engineer a number of allosterically
regulated enzymes, including maltose regulated -lactamase [25,
97, 98], xylose regulated xylanase [99], and HIF1-binding domain
cytosine deaminase [100]. Considering only 1in 6 constructs are
in frame and the unpredictable effect of domain insertion of pro-
tein structure and function, a large number of domain insertion
mutants need to be screened using a suitable high-throughput
screening assay. These can either be directly screened for functional
protein switches, e.g., based on antibiotic resistance conferring
-lactamases [97] or in case of more technically challenging enzyme
assays fused with GFP to identify in frame, non-homologously
recombined genes before assaying for the relevant enzyme func-
tion in a multiwell plate assay format [99].
3.2 Homology- Alternatively, more focused DNA insertion libraries can be created
Dependent by means of homology-dependent DNA cloning methods over-
Recombination coming the limitations associated with out-of-frame insertions:
Strategies e.g., overlap extension PCR (OE-PCR) constitutes one of the
Engineering Synthetic Protein Switches 11
3.3 Ligation- While OE-PCR and Gibson assembly enable the seamless assembly
Dependent Assembly of DNA sequences independent of restriction sites, both methods
Strategies rely on homologous DNA sequences of 2050bp. This generally
restricts the reuse of DNA coding for common receptor, actuator,
and linker elements from existing, sequence verified DNA con-
structs and libraries. In addition, the longer the overhangs, the
more expensive the synthesis of tailored oligonucleotides becomes.
Alternatively, cloning strategies have been devised based on type
12 Viktor Stein
4.2 Assembling Arguably, the most technically challenging aspect in the construc-
Synthetic Protein tion of synthetic protein switches is to recombine individual sub-
Switches components (e.g., the binding receptor, the actuator, and
AI-domains) into fully functional protein switches with tailored
response functions. Depending on the type of switch, this requires
testing a varying number of designs over successive screening and
selection cycles while looking to optimize their input-dependent
switching behavior. Experimentally, this is the most labor-inten-
sive step and, apart from designing a particular synthetic protein
switch (see Subheading 2), the most creative one considering for
every different actuator a tailored screening assay needs to be
devised.
As a rule of thumb, the higher the throughput, the more tech-
nically challenging it becomes to establish a suitable screening
assay. This particularly applies to synthetic protein switches that are
ideally screened in positive and negative selection modes looking
to identify those switches that display the largest differential func-
tion in the presence and absence of a desired target analyte.
Considering the majority of synthetic protein switches actuate
Engineering Synthetic Protein Switches 15
[2527, 97, 98, 148], but also mutually exclusive binding interac-
tions [56, 117, 118]. Saccharomyces cerevisiae also provides a pow-
erful microorganism for devising high-throughput selection
procedures based on genetic complementation. In one recent
example, a light-regulated K+ channel was engineered by recom-
bining a photo-responsive LOV2-J domain with the small viral K+
channel Kcv [149]. To this end, synthetic K+ channels were screened
for light-responsiveness in positive and negative selection modes
following illumination with blue light or in the dark. The selection
strategy was based on a mutant strain of Saccharomyces cerevisiae
deficient in endogenous K+ channels. Similar genetic complemen-
tation strategies are conceivable to screen for metabolic functions
in high throughput through auxotrophic complementation of
metabolic enzymes in both Escherichia coli and Saccharomyces
cerevisiae.
Ultimately however, the key technical challenge with growth-
based selection assays is to control the reaction conditions, in par-
ticular, the reaction environment, the concentration of individual
components and the selective pressure. In addition, the growth of
a particular synthetic protein switch may not exclusively depend on
its function, but a cell can both adapt genetically and biochemically
to enhance growth irrespective of a given synthetic protein switch
mutant.
5 Outlook
Acknowledgments
References
1. Golynskiy MV, Koay MS, Vinkenborg JL, 12. Tischer D, Weiner OD (2014) Illuminating
Merkx M (2011) Engineering protein cell signalling with optogenetic tools. Nat
switches: sensors, regulators, and spare parts Rev Mol Cell Biol 15:551558. doi:10.1038/
for biology and biotechnology. Chembiochem nrm3837
12:353361. doi:10.1002/cbic.201000642 13. Ha JH, Loh SN (2012) Protein conforma-
2. Stein V, Alexandrov K (2015) Synthetic pro- tional switches: from nature to design.
tein switches: design principles and applica- Chemistry 18:79847999. doi:10.1002/
tions. Trends Biotechnol 33:101110. chem.201200348
doi:10.1016/j.tibtech.2014.11.010 14. Koide S (2009) Generation of new protein
3. Shekhawat SS, Ghosh I (2011) Split-protein functions by nonhomologous combinations
systems: beyond binary protein-protein inter- and rearrangements of domains and modules.
actions. Curr Opin Chem Biol 15:790797. Curr Opin Biotechnol 20:398404.
doi:10.1016/j.cbpa.2011.10.014 doi:10.1016/j.copbio.2009.07.007
4. Michnick SW, Ear PH, Manderson EN etal 15. Way JC, Collins JJ, Keasling JD, Silver PA
(2007) Universal strategies in research and (2014) Integrating biological redesign: where
drug discovery based on protein-fragment synthetic biology came from and where it
complementation assays. Nat Rev Drug needs to go. Cell 157:151161.
Discov 6:569582. doi:10.1038/nrd2311 doi:10.1016/j.cell.2014.02.039
5. Mehta S, Zhang J(2011) Reporting from 16. Cameron DE, Bashor CJ, Collins JJ (2014) A
thefield: genetically encoded fluorescent brief history of synthetic biology. Nat Rev
reporters uncover signaling dynamics in living Microbiol 12:381390. doi:10.1038/
biological systems. Annu Rev Biochem nrmicro3239
80:375401. doi:10.1146/annurev-biochem- 17. Feldmeier K, Hcker B (2013) Computational
060409-093259 protein design of ligand binding and catalysis.
6. Tamura T, Hamachi I (2014) Recent prog- Curr Opin Chem Biol 17:929933.
ress in design of protein-based fluorescent doi:10.1016/j.cbpa.2013.10.002
biosensors and their cellular applications. 18. Kiss G, elebi-lm N, Moretti R etal
ACS Chem Biol 9:27082717. doi:10.1021/ (2013) Computational enzyme design.
cb500661v Angew Chem Int Ed Engl 52:57005725.
7. Saito K, Nagai T (2015) Recent progress in doi:10.1002/anie.201204077
luminescent proteins development. Curr 19. Zhang J, Zheng F, Grigoryan G (2014)
Opin Chem Biol 27:4651. doi:10.1016/j. Design and designability of protein-based
cbpa.2015.05.029 assemblies. Curr Opin Struct Biol 27:7986.
8. Miyawaki A, Niino Y (2015) Molecular spies doi:10.1016/j.sbi.2014.05.009
for bioimaging-fluorescent protein-based 20. Mak WS, Siegel JB (2014) Computational
probes. Mol Cell 58:632643. doi:10.1016/j. enzyme design: transitioning from catalytic
molcel.2015.03.002 proteins to enzymes. Curr Opin Struct Biol
9. Zhang K, Cui B (2015) Optogenetic control 27:8794. doi:10.1016/j.sbi.2014.05.010
of intracellular signaling pathways. Trends 21. Schreiber G, Fleishman SJ (2013) Computa
Biotechnol 33:92100. doi:10.1016/j. tional design of protein-protein interactions.
tibtech.2014.11.007 Curr Opin Struct Biol 23:903910.
10. Beyer HM, Naumann S, Weber W, Radziwill doi:10.1016/j.sbi.2013.08.003
G (2015) Optogenetic control of signaling in 22. Miyawaki A, Llopis J, Heim R etal (1997)
mammalian cells. Biotechnol J10:273283. Fluorescent indicators for Ca2+ based on
doi:10.1002/biot.201400077 green fluorescent proteins and calmodulin.
11. Gautier A, Gauron C, Volovitch M etal Nature 388:882887. doi:10.1038/42264
(2014) How to control proteins with light in 23. Baird GS, Zacharias DA, Tsien RY (1999)
living systems. Nat Chem Biol 10:533541. Circular permutation and receptor insertion
doi:10.1038/nchembio.1534 within green fluorescent proteins. Proc Natl
20 Viktor Stein
48. Whitaker WR, Davis SA, Arkin AP, Dueber generated through directed domain-interface
JE(2012) Engineering robust control evolution. JMol Biol 392:12211231.
of two- component system phosphotransfer doi:10.1016/j.jmb.2009.07.067
using modular scaffolds. Proc Natl Acad 60. Stein V, Alexandrov K (2014) Protease-based
Sci 109:1809018095. doi:10.1073/pnas. synthetic sensing and signal amplification.
1209230109 Proc Natl Acad Sci U S A 111:1593415939.
49. Skerker JM, Perchuk BS, Siryaporn A etal doi:10.1073/pnas.1405220111
(2008) Rewiring the specificity of two- 61. Zhang L, Lee KC, Bhojani MS etal (2007)
component signal transduction systems. Cell Molecular imaging of Akt kinase activity. Nat
133:10431054. doi:10.1016/j. Med 13:11141119. doi:10.1038/nm1608
cell.2008.04.040 62. Brun MA, Tan KT, Nakata E etal (2009)
50. Gasser C, Taiber S, Yeh C-M etal (2014) Semisynthetic fluorescent sensor proteins
Engineering of a red-light-activated human based on self-labeling protein tags. JAm
cAMP/cGMP-specific phosphodiesterase. Chem Soc 131:58735884. doi:10.1021/
Proc Natl Acad Sci 111:88038808. ja900149e
doi:10.1073/pnas.1321600111 63. Schena A, Johnsson K (2014) Sensing acetyl-
51. Lai A, Sato PM, Peisajovich SG (2015) choline and anticholinesterase compounds.
Evolution of synthetic signaling scaffolds by Angew Chem Int Ed Engl 53:13021305.
recombination of modular protein domains. doi:10.1002/anie.201307754
ACS Synth Biol 4:714722. doi:10.1021/ 64. Brun MA, Griss R, Reymond L etal (2011)
sb5003482 Semisynthesis of fluorescent metabolite sen-
52. Peisajovich SG, Garbarino JE, Wei P, Lim WA sors on cell surfaces. JAm Chem Soc
(2010) Rapid diversification of cell signaling 133:1623516242. doi:10.1021/ja206915m
phenotypes by modular domain recombina- 65. Brun MA, Tan KT, Griss R etal (2012) A
tion. Science 328:368372. doi:10.1126/ semisynthetic fluorescent sensor protein for
science.1182376 glutamate. JAm Chem Soc 134:76767678.
53. Wend S, Wagner HJ, Mller K etal (2014) doi:10.1021/ja3002277
Optogenetic control of protein kinase activity 66. Griss R, Schena A, Reymond L etal (2014)
in mammalian cells. ACS Synth Biol 3:280 Bioluminescent sensor proteins for point-of-
285. doi:10.1021/sb400090s care therapeutic drug monitoring. Nat
54. Wu YI, Frey D, Lungu OI etal (2009) A Chem Biol 10:598603. doi:10.1038/
genetically encoded photoactivatable Rac nchembio.1554
controls the motility of living cells. Nature 67. Xue L, Karpenko IA, Hiblot J, Johnsson K
461:104108. doi:10.1038/nature08241 (2015) Imaging and manipulating proteins in
55. Levskaya A, Weiner OD, Lim WA, Voigt CA live cells through covalent labeling. Nat Chem
(2009) sup: spatiotemporal control of cell sig- Biol 11:17. doi:10.1038/nchembio.1959
nalling using a light-switchable protein inter- 68. Street AG, Mayo SL (1999) Computational
action. Nature 461:9971001. doi:10.1038/ protein design. Structure 7(5):R105R109.
nature08446 doi:10.1016/S0969-2126(99)80062-8
56. Nirantar SR, Yeo KS, Chee S etal (2013) A 69. Samish I, MacDermaid CM, Perez-Aguilar
generic scaffold for conversion of peptide JM, Saven JG (2011) Theoretical and compu-
ligands into homogenous biosensors. Biosens tational protein design. Annu Rev Phys Chem
Bioelectron 47:421428. doi:10.1016/j. 62:129149. doi:10.1146/
bios.2013.03.049 annurev-physchem-032210-103509
57. Huang J, Koide A, Makabe K, Koide S (2008) 70. Khoury GA, Smadbeck J, Kieslich CA,
Design of protein function leaps by directed Floudas CA (2014) Protein folding and de
domain interface evolution. Proc Natl Acad novo protein design for biotechnological
Sci U S A 105:65786583. doi:10.1073/ applications. Trends Biotechnol 32:99109.
pnas.0801097105 doi:10.1016/j.tibtech.2013.10.008
58. Huang J, Koide S (2010) Rational conversion 71. Kuhlman B, Dantas G, Ireton GC etal (2003)
of affinity reagents into label-free sensors for Design of a novel globular protein fold with
peptide motifs by designed allostery. ACS atomic-level accuracy. Science 302:1364
Chem Biol 5:273277. doi:10.1021/ 1368. doi:10.1126/science.1089427
cb900284c
72. Koga N, Tatsumi-Koga R, Liu G etal (2012)
59. Huang J, Makabe K, Biancalana M etal Principles for designing ideal protein struc-
(2009) Structural basis for exquisite specificity tures. Nature 491:222227. doi:10.1038/
of affinity clamps, synthetic binding proteins nature11600
22 Viktor Stein
73. Tinberg CE, Khare SD, Dou Jetal (2013) functionality: using protein sequence com-
Computational design of ligand-binding pro- parisons to rapidly design a thermostable con-
teins with high affinity and selectivity. Nature sensus phytase. Protein Eng Des Sel 13:4957.
501:212216. doi:10.1038/nature12443 doi:10.1093/protein/13.1.49
74. Schreier B, Stumpp C, Wiesner S, Hcker B 86. Starr T (2015) Epistasis in protein evolution.
(2009) Computational design of ligand bind- Protein Sci 00:18. doi:10.1002/pro
ing is not a solved problem. Proc Natl Acad 87. Harms MJ, Thornton JW (2010) Analyzing
Sci U S A 106:1849118496. doi:10.1073/ protein structure and function using ancestral
pnas.0907950106 gene reconstruction. Curr Opin Struct Biol
75. Rthlisberger D, Khersonsky O, Wollacott 20:360366. doi:10.1016/j.sbi.2010.03.005
AM etal (2008) Kemp elimination catalysts 88. Thornton JW (2004) Resurrecting ancient
by computational enzyme design. Nature genes: experimental analysis of extinct mole-
453:190195. doi:10.1038/nature06879 cules. Nat Rev Genet 5:366375.
76. Jiang L, Althoff EA, Clemente FR etal doi:10.1038/nrg1324
(2008) De novo computational design of 89. Risso VA, Gavira JA, Mejia-Carmona DF etal
retro-aldol enzymes. Science 319:1387 (2013) Hyperstability and substrate promis-
1391. doi:10.1126/science.1152692 cuity in laboratory resurrections of precam-
77. Korendovych IV, Kulp DW, Wu Y etal (2011) brian -lactamases. JAm Chem Soc
Design of a switchable eliminase. Proc Natl 135:28992902. doi:10.1021/ja311630a
Acad Sci U S A 108:68236827. 90. Whitfield JH, Zhang WH, Herde MK etal
doi:10.1073/pnas.1018191108 (2015) Construction of a robust and sensitive
78. Taylor ND, Garruss AS, Moretti R etal arginine biosensor through ancestral protein
(2016) Engineering an allosteric transcription reconstruction. Protein Sci 24:14121422.
factor to respond to new ligands. Nat doi:10.1002/pro.2721
Methods 111. doi: 10.1038/nmeth.3696 91. Gaucher EA, Thomson JM, Burgan MF,
79. Van Dongen EMWM, Evers TH, Dekkers Benner SA (2003) Inferring the palaeoenvi-
LM etal (2007) Variation of linker length in ronment of ancient bacteria on the basis of
ratiometric fluorescent sensor proteins allows resurrected proteins. Nature 425:285288.
rational tuning of Zn(II) affinity in the pico- doi:10.1038/nature01977
molar to femtomolar range. JAm Chem Soc 92. Clifton BE, Jackson CJ (2016) Ancestral pro-
129:34943495. doi:10.1021/ja069105d tein reconstruction yields insights into adaptive
80. Porebski BT, Buckle AM (2016) Consensus evolution of binding specificity in solute-bind-
protein design. 29:17. doi: 10.1093/pro- ing proteins. Cell Chem Biol 23:236245.
tein/gzw015 doi:10.1016/j.chembiol.2015.12.010
81. Steipe B, Schiller B, Plckthun A, Steinbacher 93. Sel GM, Lockless SW, Wall MA, Ranganathan
S (1994) Sequence statistics reliably predict R (2003) Evolutionarily conserved networks
stabilizing mutations in a protein domain. of residues mediate allosteric communication
JMol Biol 240:188192. doi:10.1006/ in proteins. Nat Struct Biol 10:5969.
jmbi.1994.1434 doi:10.1038/nsb881
82. Jacobs SA, Diem MD, Luo Jetal (2012) 94. Reynolds KA, McLaughlin RN, Ranganathan
Design of novel FN3 domains with high sta- R (2011) Hot spots for allosteric regulation
bility by a consensus sequence approach. on protein surfaces. Cell 147:15641575.
Protein Eng Des Sel 25:107117. doi:10.1016/j.cell.2011.10.049
doi:10.1093/protein/gzr064 95. Lee J, Natarajan M, Nashine VC etal (2008)
83. Binz HK, Stumpp MT, Forrer P etal (2003) Surface sites for engineering allosteric control
Designing repeat proteins: well-expressed, in proteins. Science 322:438442.
soluble and stable proteins from combinato- doi:10.1126/science.1159052
rial libraries of consensus ankyrin repeat pro- 96. Yu Y, Lutz S (2011) Circular permutation: a
teins. JMol Biol 332:489503. doi:10.1016/ different way to engineer enzyme structure
S0022-2836(03)00896-9 and function. Trends Biotechnol 29:1825.
84. Lehmann M, Pasamontes L, Lassen SF, Wyss doi:10.1016/j.tibtech.2010.10.004
M (2000) The consensus concept for thermo- 97. Guntas G, Mansell TJ, Kim JR, Ostermeier M
stability engineering of proteins. Biochim (2005) Directed evolution of protein
Biophys Acta 1543:408415. doi:10.1016/ switchesand their application to the creation
S0167-4838(00)00238-7 of ligand-binding proteins. Proc Natl Acad
85. Lehmann M, Kostrewa D, Wyss M etal Sci U S A 102:1122411229. doi:10.1073/
(2000) From DNA sequence to improved pnas.0502673102
Engineering Synthetic Protein Switches 23
98. Guntas G, Mitchell SF, Ostermeier M (2004) 111. Bitinaite J, Rubino M, Varma KH etal (2007)
A molecular switch created by invitro USER friendly DNA engineering and cloning
recombination of nonhomologous genes. method by uracil excision. Nucleic Acids Res
Chem Biol 11:14831487. doi:10.1016/j. 35:19922002. doi:10.1093/nar/gkm041
chembiol.2004.08.020 112. Nour-Eldin HH, Hansen BG, Nrholm
99. Ribeiro LF, Tullman J, Nicholes N etal (2016) MHH etal (2006) Advancing uracil-excision
A xylose-stimulated xylanasexylose binding based cloning towards an ideal technique for
protein chimera created by random nonhomol- cloning PCR fragments. Nucleic Acids Res
ogous recombination. Biotechnol Biofuels 34(18):e122. doi:10.1093/nar/gkl635
9:119. doi:10.1186/s13068-016-0529-7 113. Stein V, Hollfelder F (2009) An efficient
100. Wright CM, Wright RC, Eshleman JR,
method to assemble linear DNA templates for
Ostermeier M (2011) A protein therapeutic invitro screening and selection systems.
modality founded on molecular regulation. Nucleic Acids Res 37(18):e122. doi:10.1093/
Proc Natl Acad Sci 108:1620616211. nar/gkp589
doi:10.1073/pnas.1102803108 114. Villiers BRM, Stein V, Hollfelder F (2010)
101. Yon F, Fried M (1989) Precise gene fusion by USER friendly DNA recombination
PCR.Nucleic Acids Res 17:41454159 (USERec): a simple and flexible near
102. Yolov AA, Shabarova ZA (1990) Constructing homology- independent method for gene
DNA by polymerase recombination. Nucleic library construction. Protein Eng Des Sel
Acids Res 18:39833986. doi:10.1093/ 23:18. doi:10.1093/protein/gzp063
nar/18.13.3983 115. Vinkenborg JL, Evers TH, Reulen SWA etal
103. Ohlendorf R, Schumacher CH, Richter F,
(2007) Enhanced sensitivity of FRET-based
Mglich A (2016) Library-aided probing of protease sensors by redesign of the GFP
linker determinants in hybrid photoreceptors. dimerization interface. Chembiochem
ACS Synth Biol 5(10):11171126. 8:11191121. doi:10.1002/cbic.200700109
doi:10.1021/acssynbio.6b00028 116. Ohashi T, Galiacy SD, Briscoe G, Erickson
104. Gibson DG, Young L, Chuang R-Y etal HP (2007) An experimental study of GFP-
(2009) Enzymatic assembly of DNA molecules based FRET, with application to intrinsically
up to several hundred kilobases. Nat Methods unstructured proteins. Protein Sci 16:1429
6:343345. doi:10.1038/nmeth.1318 1438. doi:10.1110/ps.072845607
105. Li MZ, Elledge SJ (2007) Harnessing homol- 117. Janssen BMG, Engelen W, Merkx M (2015)
ogous recombination invitro to generate DNA-directed control of enzyme-inhibitor
recombinant DNA via SLIC.Nat Methods complex formation: a modular approach to
4:251256. doi:10.1038/nmeth1010 reversibly switch enzyme activity. ACS Synth
106. Quan J, Tian J(2009) Circular polymerase Biol 4:547553. doi:10.1021/sb500278z
extension cloning of complex gene libraries 118. Banala S, Aper SJA, Schalk W, Merkx M
and pathways. PLoS One 4:e6441. (2013) Switchable reporter enzymes based on
doi:10.1371/journal.pone.0006441 mutually exclusive domain interactions allow
107. Zhang Y, Werling U, Edelmann W (2012) antibody detection directly in solution. ACS
SLiCE: a novel bacterial cell extract-based Chem Biol 8:21272132. doi:10.1021/
DNA cloning method. Nucleic Acids Res cb400406x
40(8):e55. doi:10.1093/nar/gkr1288 119. Smith GP (1985) Filamentous fusion phage:
108. Beyer HM, Gonschorek P, Samodelov SL
novel expression vectors that display cloned anti-
etal (2015) AQUA cloning: a versatile and gens on the virion surface. Science 228:1315
simple enzyme-free cloning approach. PLoS 1317. doi:10.1126/science.4001944
One 10(9):e0137652. doi:10.1371/journal. 120. Boder ET, Wittrup KD (1997) Yeast surface
pone.0137652 display for screening combinatorial polypep-
109. Engler C, Kandzia R, Marillonnet S (2008) A tide libraries. Nat Biotechnol 15:553557.
one pot, one step, precision cloning doi:10.1038/nbt0697-553
methodwith high throughput capability. 121. Gai SA, Wittrup KD (2007) Yeast surface dis-
PLoS One 3(11):e3647. doi:10.1371/jour- play for protein engineering and characteriza-
nal.pone.0003647 tion. Curr Opin Struct Biol 17:467473.
110. Geu-Flores F, Nour-Eldin HH, Nielsen MT, doi:10.1016/j.sbi.2007.08.012
Halkier BA (2007) USER fusion: a rapid and 122. Wilson DS, Keefe AD, Szostak JW (2001)
efficient method for simultaneous fusion and The use of mRNA display to select high-
cloning of multiple PCR products. Nucleic affinity protein-binding peptides. Proc Natl
Acids Res 35(7):e55. doi:10.1093/nar/ Acad Sci U S A 98:37503755. doi:10.1073/
gkm106 pnas.061028198
24 Viktor Stein
123. Hanes J, Pluckthun A (1997) In vitro 135. Tian L, Hires SA, Mao T etal (2009) Imaging
selection and evolution of functional pro-
neural activity in worms, flies and mice with
teinsby using ribosome display. Proc Natl improved GCaMP calcium indicators. Nat
Acad Sci 94:49374942. doi:10.1073/ Methods 6:875881. doi:10.1038/nmeth.1398
pnas.94.10.4937 136. Wright RC, Khakhar A, Eshleman JR,
124. Zahnd C, Amstutz P, Plckthun A (2007)
Ostermeier M (2014) Advancements in the
Ribosome display: selecting and evolving pro- development of hif-1a-activated protein
teins invitro that specifically bind to a target. switches for use in enzyme prodrug therapy
Nat Methods 4:269279. doi:10.1038/ e114032. PLoS One 9:119. doi:10.1371/
nmeth1003 journal.pone.0114032
125. Odegrip R, Coomber D, Eldridge B etal 137. Nadler DC, Morgan S-A, Flamholz A etal
(2004) CIS display: invitro selection (2016) CIS display: invitro selection of pep-
of peptides from libraries of protein- tides from libraries of protein-DNA com-
DNA complexes. Proc Natl Acad Sci plexes. Nat Commun 7:12266. doi:10.1038/
U S A 101:28062810. doi:10.1073/pnas. ncomms12266
0400219101 138. Feng J, Jester BW, Tinberg CE etal (2015) A
126. Bertschinger J, Neri D (2004) Covalent DNA general strategy to construct small molecule
display as a novel tool for directed evolution biosensors in eukaryotes. Elife. doi:10.7554/
of proteins invitro. Protein Eng Des Sel eLife.10606
17:699707. doi:10.1093/protein/gzh082 139. Yi L, Gebhard MC, Li Q etal (2013)
127. Stein V, Sielaff I, Johnsson K, Hollfelder F Engineering of TEV protease variants by
(2007) A covalent chemical genotype- yeastER sequestration screening (YESS)
phenotype linkage for invitro protein evolu- ofcombinatorial libraries. Proc Natl Acad
tion. Chembiochem 8:21912194. SciU S A 110:72297234. doi:10.1073/
doi:10.1002/cbic.200700459 pnas.1215994110
128. Kaltenbach M, Stein V, Hollfelder F (2011) 140. Kaminski TS, Scheler O, Garstecki P (2016)
SNAP dendrimers: multivalent protein dis- Droplet microfluidics for microbiology: tech-
play on dendrimer-like DNA for directed evo- niques, applications and challenges. Lab Chip
lution. Chembiochem 12:22082216. 16:21682187. doi:10.1039/C6LC00367B
doi:10.1002/cbic.201100240 141. Colin P-Y, Zinchenko A, Hollfelder F (2015)
129. Diamante L, Gatti-Lafranconi P, Schaerli Y, Enzyme engineering in biomimetic compart-
Hollfelder F (2013) In vitro affinity screening ments. Curr Opin Struct Biol 33:4251.
of protein and peptide binders by megavalent doi:10.1016/j.sbi.2015.06.001
bead surface display. Protein Eng Des Sel 142. Vyawahare S, Griffiths AD, Merten CA
26:713724. doi:10.1093/protein/gzt039 (2010) Miniaturization and parallelization of
130. Gebauer M, Skerra A (2009) Engineered pro- biological and chemical assays in microfluidic
tein scaffolds as next-generation antibody devices. Chem Biol 17:10521065.
therapeutics. Curr Opin Chem Biol 13:245 doi:10.1016/j.chembiol.2010.09.007
255. doi:10.1016/j.cbpa.2009.04.627 143. Kintses B, Hein C, Mohamed MF etal (2012)
131. Binz HK, Amstutz P, Plckthun A (2005)
Picoliter cell lysate assays in microfluidic
Engineering novel binding proteins from droplet compartments for directed enzyme
nonimmunoglobulin domains. Nat evolution. Chem Biol 19:10011009.
Biotechnol 23:12571268. doi:10.1038/ doi:10.1016/j.chembiol.2012.06.009
nbt1127 144. Colin P-Y, Kintses B, Gielen F etal (2015)
132. Gilbreth RN, Koide S (2012) Structural
Ultrahigh-throughput discovery of promiscu-
insights for engineering binding proteins ous enzymes by picodroplet functional
based on non-antibody scaffolds. Curr Opin metagenomics. Nat Commun 6:10008.
Struct Biol 22:413420. doi:10.1016/j. doi:10.1038/ncomms10008
sbi.2012.06.001 145. Agresti JJ, Antipov E, Abate AR etal (2010)
133. Kalko EKV, Dukas R, Ratcliffe JM etal
Ultrahigh-throughput screening in drop-
(2011) An expanded palette of genetically based microfluidics for directed evolution.
encoded Ca2+ indicators. Science 333:1888 Proc Natl Acad Sci 107:40044009.
1891. doi:10.1126/science.1208592 doi:10.1073/pnas.0910781107
134. Litzlbauer J, Schifferer M, Ng D etal (2015) 146. Wang BL, Ghaderi A, Zhou H etal (2014)
Large Scale Bacterial Colony Screening Microfluidic high-throughput culturing of
ofDiversified FRET Biosensors. PLoS single cells for selection based on extracel-
One10:e0119860. doi:10.1371/journal. lular metabolite production or consump-
pone.0119860 tion. Nat Biotechnol 32:473478.
Engineering Synthetic Protein Switches 25
Abstract
Alternate frame folding (AFF) and protein/fragment exchange (FREX) are related technologies for
engineering allosteric conformational changes into proteins that have no pre-existing allosteric properties.
One of their chief purposes is to turn an ordinary protein into a biomolecular switch capable of transform-
ing an input event into an optical or functional readout. Here, we present a guide for converting an arbitrary
binding protein into a fluorescent biosensor with Frster resonance energy transfer output. Because the
AFF and FREX mechanisms are founded on general principles of protein structure and stability rather than
a property that is idiosyncratic to the target protein, the basic design stepschoice of permutation/cleavage
sites, molecular biology, and construct optimizationremain the same for any target protein. We highlight
effective strategies as well as common pitfalls based on our experience with multiple AFF and FREX
constructs.
Key words AFF, Biosensor, Fluorescence, FRET, FREX, Protein design, Protein engineering
Abbreviations
AFF Alternate frame folding
CP Circular permutant
Fn3 Fibronectin 3
FP Fluorescent protein
FRET Frster resonance energy transfer
FREX Protein/fragment exchange
N Normal fold of protein
N Alternate fold of protein
POI Protein of interest
RBP Ribose-binding protein
WT Wild-type
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_2, Springer Science+Business Media LLC 2017
27
28 Jeung-HoiHa andStewartN.Loh
1 Introduction
Fig. 1 Schematic of AFF (a) and FREX (b) switching mechanisms. Primary amino acid sequences are indicated
by horizontal bars with folded protein structures represented below the sequences. For the two sequences in
parentheses an N-terminal segment (containing a critical binding residue) is duplicated. The other two
sequences, and the structures that result from their folding, represent the analogous case in which a C-terminal
segment is duplicated. Wavy lines indicate the copy of the duplicate segment that is orphaned in N and N
conformations and is hence unfolded. The N-fold of POI-FREX is shown with a packing mutation in the green
arrow that is swapped out by the wild-type residue from the orange arrow in the N-fold
3.1 Identify The only absolute requirement for the duplicate segment is that it
aBinding Mutation contain at least one residue that, when mutated, greatly reduces
affinity of the POI for its target ligand. Binding knockout muta-
tions are often known from prior functional or genetic studies, and
they may also be deduced from an existing crystal structure of the
POI or homolog thereof. We have found that choosing a binding
mutation close to the beginning or end of the amino acid sequence
is advantageous, because this allows the duplicate segment to be
short in length. Since the duplicated amino acids extend from
POI-AFF as N- or C-terminal tails (Fig. 1a), shorter segments may
Engineering Allosteric Protein Switches 31
3.2 Identify For a binding mutation near the C-terminus, the duplicated seg-
aCircular Permutation ment ends at the C-terminus (Fig. 1a). It begins at a position
Site N-terminal to the binding mutation and this position is chosen to
be a surface loop or turn. The reason is that this loop becomes the
permutation site of the N-fold, i.e., the location at which the poly-
peptide chain is broken and new N- and C-termini are generated.
Interrupting an alpha helix, beta strand, or buried hydrophobic
region is expected to be more destabilizing than disrupting a sur-
face loop, although there are examples of successful permutation
sites at the former locations [510]. The same considerations apply
to the case where the binding mutation is near the N-terminus,
except the duplicated segment begins with the N-terminus and ends
at a surface loop C-terminal to the binding mutation (Fig. 1a).
Inability to find a stable circular permutant (CP) is the most
common failure point in the AFF protocol. Permutation almost
always destabilizes a protein, and there is no reliable method for
predicting the extent of destabilization for a given permutation site.
The CP needs to be at least marginally stable (Gunfold23kcal/mol),
with more stable CPs requiring less optimization (see Subheading 5).
Our approach for selecting permutation sites is to choose the first
three to four surface loops either N-terminal or C-terminal to the
binding mutation, depending on whether the binding mutation is
closer to the C-terminus or N-terminus, respectively. Loops that are
close to the binding/active site should be avoided for functional
reasons, although xylanase [9] and beta lactamase [11] were per-
muted at several loops proximal to their active sites without major
loss of activity. Fortunately, all but the smallest POIs will have many
loops from which to choose and at least one will usually be stable
and functional enough for the AFF design. For example, RBP (277
amino acids) has 13 surface loops (Fig. 2a). We created CPs at eight
of these loops and all were stable, soluble, and functional. All were
destabilized compared to wild-type (WT) RBP, however, and this
finding demonstrates the advantage of starting with the most stable
variant of the POI available.
3.3 Design The linker functions to physically bridge the original N- and
thePeptideLinker C-termini of the POI.It effectively becomes a new surface loop of
the CP.As such, the amino acid sequence should be hydrophilic
and flexible enough to not impose any new constraints on the
protein structure. We base our linkers on Gly/Ala/Ser repeats,
although more advanced design criteria have been discussed
[9, 1115]. With regard to linker length, a rule of thumb is to
measure the N-to-C distance (CC) from the structure as the
32 Jeung-HoiHa andStewartN.Loh
Fig. 2 Examples of viable circular permutants for AFF and fragments for FREX. (a) Stable and functional CPs were
generated by cleaving the RBP sequences at the eight surface loops centered around the positions indicated by
black spheres, and joining the original termini by a Gly/Ala/Ser-based linker of 30 amino acids. The ribose ligand
is shown as black sticks. (b) The Fn3-FREX sensor was created by duplicating residues 48 to the C-terminus
(black segment). The binding mutation site (Tyr87) contacts the target ligand (SH2 domain, sticks) and the tuning
mutation site (Ile75) packs against hydrophobic residues in the two gray beta strands shown
crow flies, and calculate length using ~2.5 per amino acid. For
POIs in which the line-of-sight between termini is blocked by
structure, we use a figure of <2.0 per amino acid to account for
the arc that the linker must take over the curved surface of the
protein. For example, RBP has an N-to-C distance of ~40 (Fig. 2a),
which we spanned with a linker consisting of 30 amino acids [4].
If the N-to-C distance is not known precisely, it is best to err on
the side of length, as we have found that using linkers longer than
necessary does not dramatically destabilize the CP, in contrast to
using linkers that are too short [16].
3.4 Characterize CPs At this stage it is important to express and purify candidate CPs.
CPs that exhibit degradation, aggregation, or loss of function
should be rejected. The CPs are purified and their relative thermo-
dynamic stabilities (as well as that of the POI containing binding
mutation) are determined using chemical or thermal denaturation
techniques [17] (see Subheadings 3.4.1 and 3.4.2). The most sta-
ble CP is then selected for AFF gene construction (Subheading 4).
As a final note, fluorophores are typically introduced into the AFF
protein by means of two Cys residues introduced at the N-terminus
and in the surface loop of the N-fold selected as the permutation
site. Although these Cys do not generally affect structure or stabil-
ity of WT or CP forms of the POI, it is prudent to incorporate
them into the constructs at this point to most accurately represent
the N and N folds of POI-AFF.
Engineering Allosteric Protein Switches 33
3.4.1 Obtaining Stability 1. Prepare solution A and solution B of the desired buffer, pH,
Parameters fromChemical salt, etc. The two solutions are made identically except solid,
Denaturation Curves ultrapure urea (final concentration of 8M) or GdnHCl
withUrea or Guanidine (final concentration of 6M) is added to solution B prior to the
Hydrochlorie (GdnHCl) aliquots of stock buffer, salt, etc.
2. Add identical aliquots of concentrated protein to solution A
and solution B.The final protein concentration depends on
the instrumentation used to monitor unfolding, but typical
concentrations for fluorescence and circular dichroism (CD)
are 120M.
3. Prepare at least 25 samples consisting of evenly spaced mix-
tures (in denaturant concentration) of solution A and solution
B.For example, sample #1 is 100% solution A, sample #25 is
100% solution B, and samples #224 contain linearly increas-
ing concentrations of denaturant. Use of a two-syringe
Hamilton dilutor or a manual repeating pipet is recommended
to minimize denaturant concentration error. Incubate samples
at the desired temperature until equilibrium is reached (typi-
cally 2h).
4. Scan samples using the instrument of choice (UV/Vis spectro-
photometer, fluorimeter, CD spectrophotometer) at the desired
wavelength. The observed signal (obs) follows a sigmoidal
curve, as shown in Fig. 3 (left). Fit obs to the linear extrapola-
tion equation (Eq. 1):
( ( (
qobs = qU + sU [ D] + ( qN + sN [ D]) exp DGunfold - m [ D] ))) / (1 + ( exp ( DG unfold ))
- m [ D] (1)
3.4.2 Obtaining Stability 1. Prepare a solution of protein in the desired buffer. For CD-
Parameters fromThermal monitored denaturation, one should generally use dilute pro-
DenaturationCurves tein solutions (15M) and a long path length cuvette (1cm)
to minimize aggregation at higher temperatures.
2. To establish native and unfolded baselines, start the melt at a
temperature at least 10C below the beginning of the unfold-
ing transition, and continue the melt at least 10C after the
transition is 90% complete. After the melt is finished, let the
34 Jeung-HoiHa andStewartN.Loh
Fig. 3 Simulated chemical (left) and thermal (right) denaturation curves illustrating how Cm and Tm values are
calculated and interpolated, respectively. Lines are best fits of the data to the linear extrapolation equation
(left) and to linear portions of the native and unfolded baselines (right)
3.5 Modifications The steps described in Subheadings 3.1 and 3.2 are identical in the
toStep 1 forFREX FREX protocol. Just as there is no method for predicting CP
stability as a function of permutation site, there is no means for
predicting the affinity of two complementary protein fragments
based on the location of the cleavage site. We therefore apply the
same criteria in choosing the binding mutation and duplicate seg-
ment for FREX.The steps described in Subheadings 3.3 and 3.4
do not apply to FREX.At this design stage, however, one should
identify a site in the POI for making tuning mutations. A tuning
mutation is often needed for AFF and will always be necessary for
FREX, since the duplicate fragment will not form a complex with
the POI (at reasonable fragment concentrations) unless a
Engineering Allosteric Protein Switches 35
4.1 N-frame Introduce binding, Cys, and tuning mutations into the WT POI
Half-Gene gene as dictated in Subheading 3. Amplify the N-frame half-gene
by annealing primer 1 (containing a stop codon) to the 3-end of
the above-modified POI gene, and primer 2 to the 5-end
(Fig. 4a). Primer 2 encodes for the C-terminal half of the desired
linker and bears a restriction site of choice at its 5-end. The restric-
tion site necessarily becomes incorporated into the linker and for
this reason we favor the Not I restriction site because it encodes for
Ala-Ala-Ala.
4.2 N-frame Introduce an N-frame tuning mutation into the WT POI gene if
Half-Gene necessary. Design primer 3 such that it binds the POI gene at a
position that defines the start of the duplicate polypeptide segment
(and the N-terminus of POI-AFF) (Fig. 4a). Primer 3 begins with
a codon for Cys. Primer 4 anneals to the 3-end of the POI gene,
36 Jeung-HoiHa andStewartN.Loh
encodes for the N-terminal half of the linker, and ends with the
same restriction site as in Subheading 4.1. PCR amplify to generate
the N-frame half-gene. Digest the two half-genes with the restric-
tion enzyme. The products are now ready to be ligated and sub-
cloned into an expression vector of choice (Fig. 4b).
4.3 Alternate The amino acids imposed by the restriction site usually have little
Method: FusionPCR effect on the properties of the linker, especially when the linker is
long. For short linkers or those that must be composed of a par-
ticular sequence (e.g., protease site), these leftover residues may be
undesirable. The alternate method allows one to eliminate the
restriction site signature altogether. Construct the N-frame PCR
template as in Subheading 4.1 except use primer 5 instead of
primer 2 (Fig. 4a). Primer 5 contains enough of the linker sequence
to overlap with primer 6 by at least 20 base pairs; this can corre-
spond to the full or partial linker sequence depending on linker
length. Primer 5 does not contain a restriction site. Create the N-
frame template as in Subheading 4.2 except use primer 6 instead of
primer 4. Primer 6 binds to the 3-end of the POI gene and ends
with a full or partial linker sequence, complementary to that in
primer 5 with at least a 20 base pair overlap, again without a restric-
tion site. PCR amplify the N-frame template by annealing primer
Fig. 4 Cloning strategy for constructing AFF genes. (a) Annealing sites and compositions of primers 16 are
indicated below the POI gene. The restriction enzyme digestion/ligation and fusion PCR methods for connect-
ing the N and N half-genes are shown in (b, c), respectively
Engineering Allosteric Protein Switches 37
3 and primer 6 to the POI gene. Mix the N-frame template, N-frame
template, primer 1, and primer 3, and generate the full-length AFF
gene using the overlap extension PCR method (Fig. 4c) [18].
Primer 1 and primer 3 will each anneal to a second, undesirable site
within the N-frame and N-frame template, respectively, and this
results in shorter PCR products. Purify the longest PCR product
by agarose gel and subclone into the expression vector.
4.4 Modifications The cloning steps for creating FREX constructs are simpler, since
toStep 2 forFREX the duplicated DNA sequences are never physically joined and no
linker is present. At this stage, we find it useful to fuse the gene
of a donor and acceptor FP to the either end of the POI and frag-
ment genes. In addition to providing a direct binding assay for
sensor tuning (Subheading 5), an FP serves as a carrier protein to
help the fragment express well, resist degradation, and stay solu-
ble in cells.
5.1 Binding Positive A common problem with POI-AFFs prior to their thermodynamic
Control balancing is that the N-fold is so much more stable than the N-
fold that the ligand binds weakly or not at all. This snag is likely to
be encountered if the POI was found in Subheading 3.4 to be
much more stable than the CP (e.g., Tm>10C or
Gunfold>3kcal/mol; see Subheadings 3.4.1 and 3.4.2). We
1
Because a portion of the binding energy is used to drive the NN conformational change, the observed
Kd will be greater than the intrinsic Kd of the POI by a factor of (1+KN+KN)/KN, where K=exp(Gunfold/
RT) for the respective N- and N-folds [3].
38 Jeung-HoiHa andStewartN.Loh
5.2 Stability Tuning Once a binding interaction has been established, the final step is to
optimize the sensor for maximum fluorescence response and bind-
ing affinity. Fluorescent donor and acceptor groups are attached to
POI-AFF at its N-terminus and in the permutation loop of the
N-frame. We favor attaching maleimide dyes to engineered Cys
residues, although there are a variety of alternate chemistries and
labeling strategies from which to choose2. The important consider-
ations are that one obtains close to a 1:1 donor:acceptor ratio and
that the chosen dyes are sensitive to short-range distance changes
(short Frster radii for FRET), as they will be close enough to be
in contact in the N-fold and of variable distance apart in the
N-fold, depending on the length and residual structure of the
duplicated segment. To achieve 1:1 donor:acceptor labeling one
may have to experiment with different ratios of dyes in the labeling
step. We have also obtained satisfactory results by labeling both
positions with a single fluorophore (pyrene excimer formation and
BODIPY-FL self-quenching).
To evaluate sensor performance, increasing amounts of ligand
are added to a fixed concentration of fluorescently labeled sensor.
Fitting the observed fluorescence (obs) to the one-site binding
equation (Eq. 2) yields the dissociation constant (Kd) and fluores-
cence change (=boundfree) as the parameters. LT and PT are
total concentrations of ligand and protein.
)( ( ))
1/ 2
(
qobs = qbound + qbound - q free ( LT + PT + K d ) - ( LT + PT + K d ) - 4PT K d
2
/ ( 2PT ) (2)
The three possible outcomes are that a binding curve: (i) is
obtained with a fitted Kd value close to that of WT POI; (ii) is
obtained with a fitted Kd significantly larger than that of WT POI;
and (iii) cannot be generated because no fluorescence change is
observed. Outcome (i) indicates that no further optimization is
2
Existing AFF sensors have thus far made exclusive use of chemical fluorophores rather than genetically
encoded FPs. The reason is that inserting an FP into the permutation loop of the N-frame would likely
destabilize the N-fold and necessitate extensive thermodynamic rebalancing. It may be possible, however,
to insert a CP form of the FP (in which the close proximity of its N- and C-termini would be less perturb-
ing to the POI), or to move the FP from the permutant loop to the C-terminus of POI-AFF.
Engineering Allosteric Protein Switches 39
necessary and the sensor is ready for use. Result (ii) suggests that the
N-fold is too stable and that a moderately destabilizing mutation
should be introduced into the N-frame. If is close to zero
(outcome (iii)) then one can conclude that POI-AFF either never
switched conformation (i.e., it was in the N-fold even in the
absence of ligand), or that it changed conformation and the fluo-
rophores did not report on the change. In the former scenario the
solution is to introduce tuning mutations into the N-frame
instead of the N-frame. The expectation is that will initially
increase and then approach a maximum value as the N-fold is
progressively destabilized by packing mutations of increasing
severity [3]. Any one of these variants can be used for sensing,
although for the typical case in which a balance between high
and low Kd is desired, the mutant that yields outcome (i) is selected
as the final optimized product.
5.3 Optional: The AFF sensing mechanism is reversible and the speed at which
KineticTuning the forward and reverse conformational changes occur determines
how rapidly the sensor can detect fluctuations in analyte concentra-
tion. It may be desirable in some applications to increase this
response rate. For calbindin D9k and RBP, the rate limiting step of
the NN and NN reactions appears to involve a local but not
global unfolding event, most likely unfolding/dissociation of the
copy of the duplicate segment that is docked to the shared segment
of the protein. If this result is general, any mutation that destabi-
lizes the interaction between the shared and duplicate regions has
the potential to accelerate the conformational switch. If one wishes
to attempt to engineer a faster AFF sensor, we recommend first
following all of the thermodynamic balancing procedures described
above, then introducing kinetic tuning mutation(s) in a manner
that does not perturb the existing N/N balance or ligand-binding
affinity. For example, consider a hypothetical 200-amino acid POI
from which residues 150200 were duplicated to generate POI-AFF.
Further suppose that residues Phe130 and Leu170 pack tightly
against each other. Kinetic tuning could consist of a single
Phe130Ala substitution in the shared region, or Leu170Ala
+Leu170Ala mutations in the respective duplicate segments.
In either case the N-fold and N-fold are in principle destabilized
equally but the kinetic barrier to their interconversion may be
lowered, depending on the extent to which the Phe130-Leu170/
Leu170 interaction is formed in the transition state ensemble.
5.4 Modifications As noted, it is simplest to fuse donor and acceptor FPs to the full-
toStep 3 forFREX length POI and duplicate fragment at the cloning stage; however, if
chemical fluorophores are desired then the labeling procedure is
identical to that of AFF.One difference of FREX is that the two com-
ponents of the sensor are on average very far apart in the absence of
ligand (at reasonable protein concentrations), so donor/acceptor
pairs with a wide range of Frster distances can be considered.
40 Jeung-HoiHa andStewartN.Loh
6 Concluding Remarks
Acknowledgments
References
1. Stratton MM, Mitrea DM, Loh SN (2008) A 3. Zheng H, Bi J, Krendel M, Loh SN (2014)
Ca2+-sensing molecular switch based on alter- Converting a binding protein into a biosensing
nate frame protein folding. ACS Chem Biol conformational switch using protein fragment
3:723732 exchange. Biochemistry 53(34):55055514.
2. Stratton MM, Loh SN (2010) On the mecha- doi:10.1021/bi500758u
nism of protein fold-switching by a molecular 4. Ha JH, Shinsky SA, Loh SN (2013) Stepwise
sensor. Proteins 78:32603269 conversion of a binding protein to a fluorescent
Engineering Allosteric Protein Switches 41
Abstract
A protein switch is a protein that changes between inactive (off) and active (on) states in response to
a biomolecule or physical signal. These switches can be created by fusing two domains in such a way that
the activity of the output domain is regulated by the input domains recognition of an input signal (such
as the binding of a molecule, recognition of light). Here, we describe several methods for randomly fusing
two domains to create domain insertion libraries from which protein switches can be identified by selections
and/or screens.
Key words Protein switch, Domain insertion, Circular permutation, Directed evolution
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_3, Springer Science+Business Media LLC 2017
43
44 Lucas F. Ribeiro et al.
Fig. 1 Schematic depiction of the creation of protein switches by domain insertion. A protein switch is a fusion of
two domains (by domain insertion) in such a way that the activity of the output domain is regulated by the
input domains recognition of an input signal. (a) DNA sequences are depicted as lines and (b) their corre-
sponding proteins as geometric shapes. A light gray color of the output domain indicates that the domain is inac-
tive or less active. The signal that modulates the switch is depicted as a black triangle
can encode for the input or output domain. These fusion proteins
are then subjected to selections and/or screens to find a chimeric
protein that possesses signal-dependent behavior. Using this strat-
egy our lab has produced several examples of ligand-activated pro-
tein switches [1, 5, 718]. In one example, we created a
ligand-activated enzyme with a 600-fold change in enzyme activ-
ity in response ligand binding [7].
One of the major steps in constructing protein switches by
directed evolution is creating diversity in the ways you fuse the two
domains. Random insertion libraries can be created using DNase I
or S1 nuclease to generate a single double-stranded break throughout
the plasmid that encodes the acceptor gene [7, 10, 12] (see Fig. 2a).
However, some drawbacks of using these nuclease-digestion meth-
ods include the generation of insertions outside the gene-coding
sequence and out-of-frame or inverted insertions, resulting in a
significant fraction of the library encoding undesired and nonfunc-
tional library members. Therefore, this strategy is best combined
with a robust screening/selection system. In comparison to these
nuclease methods, multiplex inverse PCR affords much greater
control over the library composition. In inverse PCR, abutting
primers are designed to open up a plasmid to facilitate domain
insertion (see Fig. 2b). A separate inverse PCR reaction is per-
formed for each desired insertion site, each of which requires a
unique set of primers (see Fig. 2d). One feature of this method is
the ability to use it for both random domain insertion (i.e., inverse
PCR at each codon) or for insertions at sites chosen by rational
design (i.e., achieved by inverse PCR only at designed positions).
Another layer of diversity can be created by circular permutation
of the insert gene, thus increasing the overall diversity of the
protein switch library. Conceptually, circular permutation is chang-
ing the intramolecular order of amino acids. Circular permutation
Engineering Protein Switches by Domain Insertion 45
A B C
Circular permuted insert
Acceptor plasmid Acceptor plasmid
geneB
linker
D 3F
2F
1F
Gene codon 1 2 3 4 5 6
1R
2R
3R
Fig. 2 Schematic of the methods to create random domain insertion libraries, and circularly permuted insert
genes. (a) The plasmid DNA containing the acceptor gene can be randomly linearized using DNase I or S1
nuclease. (b) The plasmid can be linearized at targeted positions in the acceptor gene by multiplex inverse
PCR. (c) Inverse PCR on a fused gene duplication is used to make a library of circularly permuted inserts. (d)
Scheme of primers for multiplex inverse PCR.Three forward and reverse primers are shown for the first three
codons of a gene. Different forward and reverse primer pairs can be used in PCR to create codon deletions or
duplications. For example, using 1F and 2R duplicates codon 2 at either end of the PCR product. Using primers
3F and 2R results in a PCR product that lacks codon 3
2 Materials
3 Methods
3.1 Preparing 1. Prepare 100g of plasmid DNA containing the gene encoding
Acceptor Vector Using the acceptor domain (see Note 1).
DNase I 2. Prepare a 50L working solution of DNase I (1U/mL) in a
0.5mL microcentrifuge tube by combining 50U DNase I,
25mM TrisHCl pH 7.5 and 50% glycerol. Store at 20C
(see Note 2).
3. Prepare 1.2mL of diluent solution in a 1.5mL microcentri-
fuge tube with a final concentration of 50mM TrisHCl pH
7.5, 1mM MnCl2 and 0.5 of BSA.Vortex to mix and store at
room temperature (see Note 3).
4. Before creating a library, determine the concentration of DNase
I that will produce the most DNA vectors with a single double-
stranded break. To determine this optimum concentration,
combine 20g of plasmid DNA and 380L of the diluent solu-
tion in a 1.5mL microcentrifuge tube. Mix and centrifuge
briefly to collect all the liquid at the bottom of the tube. Aliquot
95L each into four 0.5mL microcentrifuge tubes and incu-
bate these tubes at 22C for 10min.
5. After the incubation, add 5L of diluted DNase I to each tube
at different concentrations (i.e., 1, 2, 4, and 8mU) and incu-
bate at 22C for 8min.
6. To inactivate the DNase I, add 2.4L of 0.5M EDTA to each
tube and incubate at 75C for 10min.
7. Purify each reaction using the Zymo DNA Clean and
Concentrator kit or a PCR purification kit column. Elute with
water.
8. Run 510L of each sample on a 0.8% agarose gel made with
1 TAE buffer to determine the concentration of DNase I that
yields the best digestion results (see Notes 4 and 5).
9. Once the optimal DNase I dilution is determined, prepare
80g plasmid DNA in 1520mL of diluent solution and aliquot
95L into 16 microtubes (i.e., 5g DNA per tube). Incubate
for 10min at 22C.
10. Add 5 L of the correct DNase dilution to each tube in 30s
intervals (it will take 8min to add DNase I to all tubes). After
8min, stop the reaction as described in step 6 (see Note 6).
11. Combine all the reactions into a 15mL Nalgene test tube and
purify the DNA using four 25-g columns from a Zymo DNA
Clean and Concentrator Kit. Elute the DNA from each column
in two 20L volumes of water pre-warmed to 65C.Combine
the eluate from each spin column (160L total) (see Note 7).
48 Lucas F. Ribeiro et al.
3.2 Preparing 1. Prepare 50g of plasmid DNA containing the gene encoding
Acceptor Vector Using the acceptor domain (see Note 1).
S1 Nuclease 2. In a 1.5mL microcentrifuge tube, add 26g of plasmid DNA,
1 S1 Nuclease buffer, and 125 units of S1 Nuclease to a final
volume of 325L.Aliquot 25L each into 13 microtubes
(i.e., 2g DNA per tube). Incubate at 37C for 20min.
3. Combine all the reactions and purify using two 25-g spin col-
umns of a Zymo DNA Clean and Concentrator Kit. Elute the
DNA from each column into two 20L aliquots of water pre-
warmed to 65C.Combine the eluate from each spin column
(80L total) (see Note 7).
4. Determine the DNA concentration using a NanoDrop and elec-
trophorese 100ng of sample to estimate the percentage of linear
DNA using gel-imaging software (see Note 4).
5. Once the concentration is known, proceed to the repair, gel
purification, and dephosphorylation steps (see Subheading 3.1,
steps 1319).
Engineering Protein Switches by Domain Insertion 49
3.3 Preparing 1. Design one set of primers for each insertion site (see Fig. 2c
Acceptor Vector Using and Note 10).
Multiplex Inverse PCR 2. Purify the plasmid using the Qiagen Plasmid Miniprep Kit
following the manufacturers instructions.
3. Measure the concentration of the DNA using a NanoDrop
(see Note 11).
4. Dilute the template DNA to 10ng/L in DNase-free water.
You will need 1L per PCR reaction.
5. Prepare 10M primer mixes in a 96-well plate (one primer mix
for each primer pair). To each well, add 10L of 100M for-
ward primer, 10L of 100M reverse primer, and 80L of
water to bring the primer mix to 100L total (see Note 12).
6. Prepare a dilute DNA solution by mixing the template DNA
and DNase-free water in a 1.5mL microcentrifuge tube. For
every PCR reaction, add 8L of water and 1L of the diluted
DNA stock solution. A separate PCR reaction is required for
each primer mix.
7. To each well of a 96-well PCR plate, add 9L of the diluted
DNA solution, 1L of primer mix, and 10L of Phusion 2
Master Mix. Decrease the volume setting on the pipette and
mix by pipetting up and down several times (see Note 13).
8. Centrifuge for 30s at 720g to collect all reaction compo-
nents at the bottom of the wells.
9. Use the following guidelines to design your amplification pro-
gram (see Note 14):
1 cycle: 98C for 2.5min.
25 cycles: (1) 98C for 30s, (2) Topt for 30s, and (3)
72C for 30s/kilobases of your vector.
1 cycle: 72C for 10min.
10. Analyze 5L from 20 or more random samples using DNA gel
electrophoresis with a 0.8% agarose gel at 90V for 40min to
confirm successful amplification of most reactions.
11. After confirmation, pool together 5L from each PCR reac-
tion. Using DNA electrophoresis and a 0.8% agarose gel, elec-
trophorese your sample at 90V for 1h to allow separation of
the template DNA and PCR product.
12. Excise the PCR product from the gel and purify using
Invitrogens PureLink Gel Extraction Kit.
13. Check the concentration and quality of the DNA using a
Nanodrop. If the 260/280 and 260/230 values are too low,
purify the DNA sample using the Zymo Clean and Concentrate
Kit and elute in 20L of DNase-free water (see Note 11).
50 Lucas F. Ribeiro et al.
3.5 Ligation 1. Starting with 200ng of prepared vector, calculate the pmol of
oftheInsert vector using the following formula:
andAcceptorDNA
pmol = (ng of DNA ) / ( kilobase pairs of vector 650 Da ) .
3.6 Transformation 1. Turn on the Gene Pulser. Adjust the voltage to 2.5kV.
2. Place the following on ice: high-efficiency (>108cfu/g DNA)
electrocompetent cells, a 0.2cm Gene Pulser Cuvette, a
0.5mL microcentrifuge tube and your purified and concen-
trated ligation (see Note 24).
3. Once the cells are thawed, aliquot 40L of cells into the
microcentrifuge tube with the ligation, ensuring the cells
engulf the DNA sample. Mix well.
4. Pipette the cells into the cuvette (see Note 25).
5. Place the cuvette in the Gene Pulser and slide into the cham-
ber, ensuring that the cuvette clicks into place.
6. Simultaneously hold down the pulse buttons until you hear the
beep. Then, release the buttons.
7. Quickly, add 1mL of SOC media to the cuvette.
8. Transfer the cell/SOC mix to a 1.5mL microcentrifuge tube.
Engineering Protein Switches by Domain Insertion 51
4 Notes
1. We have found that the Qiagen Miniprep kits have better yield
and less genomic DNA contamination compared to the
Midiprep or Maxiprep kits.
2. This working solution is good for at least 3 months.
3. If chilled on ice, solids may fall out of solution. If this happens,
a fresh diluent must be prepared.
4. The slowest migrating band is nicked open plasmid. The fast-
est migrating band is supercoiled DNA and the band in the
middle is linear DNA.
5. The optimal DNase I concentration is the one that produces a
sharp band of linearized plasmid. To achieve this, 3050% of
the plasmid usually remains supercoiled. Overdigestion of the
plasmid will result in smearing indicating deletions at the ends
of the digestion products.
6. The 30s staggered intervals are to insure that each tube will be
stopped at exactly 8min. We recommend that experiments
be performed on the same day as the optimization. If the
reactions will be completed on a different day, prepare fresh
DNase dilutions.
7. The prepared DNA can be stored at 20C.
8. This step creates blunt ends by filling in the end or by chewing
away any overhanging DNA.Note the amount of T4 DNA
Ligase and T4 DNA Polymerase should be calculated based on
the amount of linear DNA.
9. Do not load more than 2.5g per lane (of the medium-sized
lanes). If possible, do not use UV light or ethidium bromide as
these can cause DNA damage.
10. Your primers should adhere to the following guidelines as
much as possible: (1) 4060% GC, (2) at least 18 nucleotides
52 Lucas F. Ribeiro et al.
the end of that gene, you can PCR amplify the second copy of
gene (with a stop codon) to add a suitable linker and directly
ligate this amplified gene at the 3 end of the first gene copy
using the restriction site. When no restriction site is available,
the genes can be fused together by overlap PCR.
17. Linker connecting the original N- and C-termini: Linker
length and composition can interfere with the folding, topology,
and stability of the protein, so it must be rationally designed.
Here are some considerations. (a) Lengththe distance
between the alpha carbons of the N- and C-termini residues
can be determined using Pymol or similar molecular visualiza-
tion software. Depending on the secondary structure of the
linker residues, one amino acid typically spans a distance of
1.53.5. Linkers that bridge distances greater than 10
require more careful design. Depending on the situation, the
proteins surface properties must be taken into account. (b)
CompositionFlexible backbones can help accommodate
emerging conformational strains; thus, in most cases, glycine-
rich (Gly) bridges are preferred. Typically, a GlySerGlyGly
linker is sufficient to span a distance of 78. However, linkers
of more diverse composition can be tested.
18. Inter-domain linker: In order to alleviate possible disturbances
caused by domain insertion, we usually add two residues to the
new termini of the permuted protein. This can be done using
degenerate primers with two codons of 5-NNK-3 at 5 end of
the forward and reverse primers. Note that the reverse primer
must encode the reverse complement of 5-(NNK)2-3.
19. Reducing library size: For large proteins, purchasing compre-
hensive sets of primers can be expensive. To decrease primer
costs and the library size, you can create select circular permuta-
tions that focus on residues that are solvent accessible, flexible,
loosely packed, and between secondary structure elements.
20. Phosphorylated primers can be ordered from most manufac-
turers or unphosphorylated primers can be phosphorylated
using T4 Polynucleotide Kinase (New England Biolabs,
Ipswich, MA) following the manufacturers instructions.
Alternatively, you can phosphorylate the PCR product.
21. For the best results, do not exceed 10ng of vector per L of the
ligation reaction. Note that the ligase used is high concentra-
tion ligase (2,000,000 units/mL) for this blunt end ligation
reaction.
22. The ligation reaction can be scaled up. For the best results,
prepare a master mix of the ligation and split it into 20L ali-
quots for the incubation.
23. Alternatively, you can elute in 6L of DNA but this may
decrease your yield.
54 Lucas F. Ribeiro et al.
24. You can use any high-efficiency competent cells that suit your
system. We recommend NEB 5-alpha cells.
25. Check to make sure the cell/DNA sample reaches the bottom
of the cuvette, that it does not have any bubbles and that it is
making contact with both electrodes within the cuvette.
26. Make one large 245245mm plate (approximately 250mL
of LB agar) and at least three 10cm petri dishes of LB agar
(approximately 25mL of LB agar/plate).
27. If you used multiplex inverse PCR to prepare your vector, you
want the number of transformants to be >5 times the number of
possible variants to have a high probability that the library con-
tains all possible variants (assuming that each library member is
expected to appear at the same frequency). For an in-depth
discussion of this topic, see Bosley and Ostermeier [20].
28. Both DNase I and S1 Nuclease generate libraries with deletions
(and occasionally duplications) distributed along the acceptor
sequence. These deletions contribute to the sequence variability
of the library, potentially generating relevant diversity for the
creation of new properties in the chimeric proteins [11, 19].
Library construction using S1 is usually easier and results in
smaller deletions since S1 nuclease digestion of plasmid DNA is
halted after the first double-stranded break [10]. However, S1
digestion can be heavily biased to occur in inverted repeats
regions in the plasmid, if they are present [8].
References
1. Wright CM, Wright RC, Eshleman JR, xylose-stimulated xylanase. Biotechnol Biofuels
Ostermeier M (2011) A protein therapeutic 8:118
modality founded on molecular regulation. Proc 6. Dagliyan O, Shirvanyants D, Karginov AV,
Natl Acad Sci U S A 108(39):1620616211 Ding F, Fee L, Chandrasekaran SN, Freisinger
2. Alicea I, Marvin JS, Miklos AE, Ellington AD, CM, Smolen GA, Huttenlocher A, Hahn KM,
Looger LL, Schreiter ER (2011) Structure of Dokholyan NV (2013) Rational design of a
the Escherichia coli phosphonate binding pro- ligand-controlled protein conformational
tein PhnD and rationally optimized phospho- switch. Proc Natl Acad Sci U S A 110(17):
nate biosensors. JMol Biol 414(3):356369 68006804
3. Deuschle K, Fehr M, Hilpert M, Lager I, 7. Guntas G, Mansell TJ, Kim JR, Ostermeier M
Lalonde S, Looger LL, Okumoto S, Persson J, (2005) Directed evolution of protein switches
Schmidt A, Frommer WB (2005) Genetically and their application to the creation of ligand-
encoded sensors for metabolites. Cytometry A binding proteins. Proc Natl Acad Sci U S A
64(1):39 102(32):1122411229
4. Deuschle K, Okumoto S, Fehr M, Looger LL, 8. Tullman J, Guntas G, Dumont M, Ostermeier
Kozhukh L, Frommer WB (2005) Construction M (2011) Protein switches identified from
and optimization of a family of genetically diverse insertion libraries created using S1
encoded metabolite sensors by semirational pro- nuclease digestion of supercoiled-form plasmid
tein engineering. Protein Sci 14(9):23042314 DNA. Biotechnol Bioeng 108(11):25352543
5. Ribeiro LF, Nicholes N, Tullman J, Ribeiro 9. Tullman J, Nicholes N, Dumont MR, Ribeiro
LFC, Fuzo CA, Vieira DS, Furtado GP, LF, Ostermeier M (2015) Enzymatic protein
Ostermeier M, Ward RJ (2015) Insertion of a switches built from paralogous input domains.
xylanase in xylose binding protein results in a Biotechnol Bioeng 9999:17
Engineering Protein Switches by Domain Insertion 55
10. Tullman J, Guntas G, Dumont M, Ostermeier protein switches derived from antibody
M (2011) Protein switches identified from mimetic proteins. Protein Eng Des Sel
diverse insertion libraries created using S1 nucle- 29(2):7785
ase digestion of supercoiled-form plasmid DNA. 16. Choi JH, Laurent AH, Hilser VJ, Ostermeier
Biotechnol Bioeng 108(11):25352543 M (2015) Design of protein switches based on
11. Guntas G, Mitchell SF, Ostermeier M (2004) an ensemble model of allostery. Nat Commun
A molecular switch created by invitro recombi- 6: 6968
nation of nonhomologous genes. Chem Biol 17. Choi JH, Zayats M, Searson PC, Ostermeier M
11(11):14831487 (2016) Electrochemical activation of engi-
12. Guntas G, Ostermeier M (2004) Creation of neered protein switches. Biotechnol Bioeng
an allosteric enzyme by domain insertion. 113(2):453456
JMol Biol 336(1):263273 18. Heins RA, Choi JH, Sohka T, Ostermeier M
13. Ostermeier M, Guntas G (2003) Engineering a (2011) In vitro recombination of non-
protein molecular switch by combinatorial homologous genes can result in gene fusions
domain insertion. Abstr Pap Am Chem S that confer a switching phenotype to cells.
225:U243U243 PLoS One 6(11):e27302
14. Guntas G, Kanwar M, Ostermeier M (2012) 19. Yu Y, Lutz S (2011) Circular permutation: a
Circular permutation in the omega-loop of different way to engineer enzyme structure and
TEM-1 beta-lactamase results in improved function. Trends Biotechnol 29(1):1825
activity and altered substrate specificity. PLoS 20. Bosley AD, Ostermeier M (2005) Mathematical
One 7(4):e35998 expressions useful in the construction,
15. Nicholes N, Date A, Beaujean P, Hauk P, description and evaluation of protein libraries.
Kanwar M, Ostermeier M (2016) Modular Biomol Eng 22(13):5761
Part II
Peptide Switches
Chapter 4
Abstract
Amyloid-like fibrils assembled from de novo designed peptides lock ligands in a conformation optimal for
metal binding and catalysis in a manner similar to how metalloenzymes provide proper coordination envi-
ronment through fold. These supramolecular assemblies efficiently catalyze p-nitrophenyl ester hydrolysis
in the presence of zinc and phenol oxidation by dioxygen in the presence of copper. The resulting hetero-
geneous catalysts are inherently switchable, as addition and removal of the metal ions turns the catalytic
activity on and off, respectively. The ease of peptide preparation and self-assembly makes amyloid-like
fibrils an attractive platform for developing catalysts for a broad range of chemical reactions. Here, we present
a detailed protocol for the preparation of copper-containing fibrils and for kinetic characterization of their
abilities to oxidize phenols.
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_4, Springer Science+Business Media LLC 2017
59
60 AlexSternisha andOlgaMakhlynets
Fig. 1 Formation of fibrils creates a coordination sphere optimal for metal ion binding (Cu2+ or Zn2+). These
amyloid assemblies can catalyze ester hydrolysis and DMP oxidation
Preparation and Screening of Amyloid Fibrils 61
2 Materials
3 Methods
3.2 Kinetic Assay 1. Determine the path length in the 96-well plate for a volume of
200L (see Note 7).
2. Prepare two working buffers: (1) 25mM Hepes-KOH, pH
8mix 0.5mL of 1M Hepes-KOH and 19.5mL of water in
a 50mL Falcon tube; (2) 28.4mM Hepes-KOH, pH 8mix
0.568mL of 1M Hepes-KOH and 19.4mL of water.
3. Dilute 50mM CuSO4 into water to 10mM and then further
dilute the solution tenfold to make 1mM stock of CuSO4 in
water (see Note 8).
4. Prepare 2mL of 2mM DMP solution in water: mix 1.825mL
of water, 125L of isopropanol, 50L of 80mM DMP.
5. Prepare a mixture of peptide and Cu2+ in buffer: mix 40L of
1mM peptide stock in 10mM HCl and 20L of 1mM Cu2+
in water, then add 440L of 28.4mM Hepes-KOH buffer,
pH 8 (see Note 9). This will give 500L of solution with
40 M Cu2+ and 80M peptide. For a blank solution, mix
40 L of 10mM HCl, 20L of 1mM Cu2+ in water, and
440L of 28.4mM Hepes-KOH buffer, pH 8.
6. Fill reaction reservoir (trough) with 25mM Hepes-KOH buf-
fer, pH 8. Using a 12-channel pipette dispense 100L of this
buffer into each well to be used of the 96-well plate.
7. Add 50L of Cu-peptide solution (40M Cu2+ and 80M
peptide) or blank. Each sample should be analyzed at least
three times (use three wells).
8. Set up an experiment on the plate reader to follow the absor-
bance at 476nm, taking measurements every 10s for 5min.
9. Fill another trough with 2mM DMP.Using a 12-channel
pipette deliver 50L of 2mM DMP into each well. Gently
pipette up and down four times to mix (see Note 10).
10. Place the 96-well plate into the plate reader and start the mea-
surements (see Note 11).
11. Plot the absorbance at 476nm as a function of time (s) and
determine the slope of the linear portion of each kinetic trace;
this will give the change in absorbance per second. To calculate
initial rate, divide the slope by the extinction coefficient of the
DMP oxidation product (3,3,5,5-tetramethoxy biphenyl-
4,4-diol)14800M1 cm1 [16, 21]. The following formula
illustrates how to calculate initial rate in units of mol/min
(1.35 is a coefficient for path length correction):
12. Compare the initial rates of blank sample (Cu2+ in buffer) and
Cu-peptide samples (see Note 12).
64 AlexSternisha andOlgaMakhlynets
3.3 Mixing Peptides 1. Prepare 4mM peptide stocks in 10mM HCl, as described in
withDifferent Subheading 3.1 (see Note 13).
Sequences 2. Mix the two different peptide stock solutions (4mM) in differ-
ent ratios to a final volume of 40L.
3. Add 150L of 8M urea to each sample, mix and incubate at
room temperature for 15min (see Note 14).
4. Add 40L of 2mM Cu2+ in water.
5. Initiate fibril formation by adding 1.77mL of 28.4mM Hepes-
KOH buffer, pH 8. Final concentrations of peptide and Cu2+
are 80 and 40M, respectively (see Note 15).
6. For the blank sample, mix 40L of 10mM HCl, 150L of
8M urea, 40L of 2mM Cu2+, and 1.77mL of 28.4mM
Hepes-KOH buffer, pH 8.
7. Set up kinetic assay as described in Subheading 3.2, steps
610.
4 Notes
Table 1
Extinction coefficients of amino acids at 214nm (M1 cm1)
Acknowledgment
References
1. Hakemian AS, Rosenzweig AC (2007) The 12. Punniyamurthy T, Rout L (2008) Recent
biochemistry of methane oxidation. Annu Rev advances in copper-catalyzed oxidation of
Biochem 76:223241 organic compounds. Coord Chem Rev
2. Wallar BJ, Lipscomb JD (1996) Dioxygen activa- 252:134154
tion by enzymes containing binuclear non-heme 13. Ikeda R, Sugihara J, Uyama H, Kobayashi S
iron clusters. Chem Rev 96(7):26252658 (1996) Enzymatic oxidative polymerization
3. Merkx M, Kopp DA, Sazinsky MH, Blazyk JL, of 2,6-dimethylphenol. Macromolecules 29:
Mller J, Lippard SJ (2001) Dioxygen activa- 87028705
tion and methane hydroxylation by soluble 14. Baesjou PJ, Driessen WL, Challa G, Reedijk
methane monooxygenase: a tale of two irons J(1998) A kinetic study of the copper-catalyzed
and three proteins. Angew Chem Int Ed Engl oxidative coupling of 2,6-dimethylphenol. The
40:27822807 role of copper, base and phenol concentrations.
4. Hoffman BM, Lukoyanov D, Yang Z-Y, Dean JMol Catal A: Chem 135:273283
DR, Seefeldt LC (2014) Mechanism of nitro- 15. Cassagnes L-E, Herv V, Nepveu F, Hureau C,
gen fixation by nitrogenase: the next stage. Faller P, Collin F (2013) The catalytically active
Chem Rev 114:40414062 copper-amyloid-beta state: coordination site
5. Sakurai T, Kataoka K (2007) Basic and applied responsible for reactive species production.
features of multicopper oxidases, CueO, billi- Angew Chem Int Ed Engl 52:1111011113
rubin oxidase, and laccase. Chem Rec 16. Solano F, Lucas-Elo P, Lpez-Serrano D,
7(4):220229 Fernndez E, Sanchez-Amat A (2001)
6. Yu F, Cangelosi VM, Zastrow ML, Tegoni M, Dimethoxyphenol oxidase activity of different
Plegaria JS, Tebo AG, Mocny CS, Ruckthong microbial blue multicopper proteins. FEMS
L, Qayyum H, Pecoraro VL (2014) Protein Microbiol Lett 204:175181
design: toward functional metalloenzymes. 17. Mattinen M-L, Maijala P, Nousiainen P, Smeds
Chem Rev 114:34953578 A, Kontro J, Sipil J, Tamminen T, Willfr S,
7. Rufo CM, Moroz YS, Moroz OV, Sthr J, Viikari L (2011) Oxidation of lignans and lig-
Smith TA, Hu X, DeGrado WF, Korendovych nin model compounds by laccase in aqueous
IV (2014) Short peptides self-assemble to pro- solvent systems. JMol Catal B: Enzym
duce catalytic amyloids. Nat Chem 6:303309 72:122129
8. Friedmann MP, Torbeev V, Zelenay V, Sobol 18. Wan Y, Du Y, Miyakoshi T (2008) Enzymatic
A, Greenwald J, Riek R (2015) Towards prebi- catalysis of 2,6-dimethoxyphenol by laccases
otic catalytic amyloids using high hroughput and products characterization in organic solu-
screening. PLoS One 10:e0143948 tions. Sci China Ser B: Chem 51(7):669676
9. Maeda Y, Makhlynets OV, Matsui H, 19. Reiss R, Ihssen J, Richter M, Eichhorn E,
Korendovych IV (2016) Design of catalytic Schilling B, Thny-Meyer L (2013) Laccase
peptides and proteins through rational and versus laccase-like multi-copper oxidase: a
combinatorial approaches. Annu Rev Biomed comparative study of similar enzymes with
Eng 18:311328 diverse substrate spectra. PLoS One 8(6):
10. Makhlynets OV, Gosavi PM, Korendovych IV e65633
(2016) Short self-assembling peptides are able 20. Korendovych IV, Kim YH, Ryan AH, Lear JD,
to bind to copper and activate oxygen. Angew DeGrado WF, Shandler SJ (2010) Computational
Chem Int Ed Engl 55(31):90179020 design of a self-assembling beta-peptide oligo-
11. Rasik CM, Brown MK (2014) Total synthesis mer. Org Lett 12(22):51425145
of gracilioether F: development and application 21. Kataoka K, Komori H, Ueki Y, Konno Y,
of Lewis acid promoted ketene-alkene [2+2] Kamitaka Y, Kurose S, Tsujimura S, Higuchi Y,
cycloadditions and late-stage C-H oxidation. Kano K, Seo D, Sakurai T (2007) Structure
Angew Chem Int Ed Engl 53:1452214526 and function of the engineered multicopper
68 AlexSternisha andOlgaMakhlynets
oxidase CueO from Escherichia colideletion ent amino acids at 214nm to enable quantita-
of the methionine-rich helical region covering tive reverse phase high-performance liquid
the substrate-binding binding site. JMol Biol chromatography-mass spectrometry analysis.
373:141152 JAgric Food Chem 55:54455451
22. Kuipers BJH, Gruppen H (2007) Prediction of
23. Hitchman ML (1978) Measurement of dis-
molar extinction coefficients of proteins and solved oxygen. Wiley, NewYork
peptides using UV absorption of the constitu-
Part III
Abstract
Small molecule biosensors based on Frster resonance energy transfer (FRET) enable small molecule sig-
naling to be monitored with high spatial and temporal resolution in complex cellular environments. FRET
sensors can be constructed by fusing a pair of fluorescent proteins to a suitable recognition domain, such
as a member of the solute-binding protein (SBP) superfamily. However, naturally occurring SBPs may be
unsuitable for incorporation into FRET sensors due to their low thermostability, which may preclude
imaging under physiological conditions, or because the positions of their N- and C-termini may be subop-
timal for fusion of fluorescent proteins, which may limit the dynamic range of the resulting sensors. Here,
we show how these problems can be overcome using ancestral protein reconstruction and circular permu-
tation. Ancestral protein reconstruction, used as a protein engineering strategy, leverages phylogenetic
information to improve the thermostability of proteins, while circular permutation enables the termini of
an SBP to be repositioned to maximize the dynamic range of the resulting FRET sensor. We also provide
a protocol for cloning the engineered SBPs into FRET sensor constructs using Golden Gate assembly and
discuss considerations for in situ characterization of the FRET sensors.
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_5, Springer Science+Business Media LLC 2017
71
72 BenE.Clifton et al.
2 Materials
3 Methods
3.1 Sequence Given a reference SBP with the desired binding specificity, recon-
Collection struction of an ancestral SBP with improved thermostability and
the same binding specificity requires a dataset of protein sequences
that are homologous to the reference SBP (see Note 2). These
sequences can be identified using a BLAST (Basic Local Alignment
Search Tool) search of protein sequence databases, such as the
NCBI database of nonredundant protein sequences or the
UniProt-KB database. The protein sequences should be selected to
maximize sequence diversity and phylogenetic diversity, but should
have the same binding specificity as the reference SBP (see Notes 3
and 4). The sequences should be evenly distributed throughout
sequence space; in other words, clusters of sequences with very
high identity (>90%) and outlier sequences with low identity to
any other sequence in the dataset should be avoided. A small set of
outgroup sequences should also be selected for rooting the phylo-
genetic tree (see Note 5). In the case of SBPs, a suitable outgroup
would be an SBP homologous to the reference SBP, but with a
different binding specificity; for example, in our recent work,
anionic amino acid-binding proteins served as an outgroup for cat-
ionic and neutral amino acid-binding proteins [6].
As a guideline, between 50 and 250 sequences should be
selected for the phylogenetic analysis. If too many sequences are
included, the phylogenetic analysis will be computationally inten-
sive, while if too few sequences are included, there may be insuffi-
cient data to reconstruct the ancestral sequences accurately, or the
sequence diversity within the dataset may be insufficient to make
the ancestral proteins more thermostable than the reference SBP.
3.2 Multiple Before the sequences can be used for phylogenetic analysis, they
Sequence Alignment must be collated in a multiple sequence alignment. In the phyloge-
netic analysis and subsequent reconstruction of ancestral sequences,
it is assumed that each column in the multiple sequence alignment
corresponds to a set of residues that originated from a common
ancestor. If the alignment is incorrect, this assumption is violated;
hence, the quality of the multiple sequence alignment is a critical
factor in the success of the project. The number of gaps should be
minimized by careful editing of the alignment to remove poorly
76 BenE.Clifton et al.
3.5 Reconstruction 1. Ensure that the alignment file and tree file are properly for-
ofAncestral matted for input into PAML [26] (see Note 13).
Sequences 2. Set up the program by modifying the control file (codeml.ctl),
as shown in Table 1.
3. Run the program from the command line using the command
codeml.
Table 1
Variables in the control file for ancestral protein reconstruction
using PAML
seqfile Filename of alignment
treefile Filename of tree
outfile Filename of output
noisy 9
verbose 2
runmode 0
seqtype 2
clock 0
aaRatefile Filename of rate matrix (e.g., lg.dat for the LG matrix)
model 2
Mgene 0
fix_alpha 0 to use +G model, else 1
alpha 0.5 to use +G model, else 0
Malpha 0
ncatG Number of rate categories to use for the +G model
getSE 0
RateAncestor 1
Small_Diff .5e-6
cleandata 0
method 0
Deviations from the settings in the default control file are indicated in bold. The
remaining variables in the control file are not applicable to amino acid-based analysis
and can be removed
Improving FRET Sensors by Ancestral Gene Resurrection 79
4. Open the result file (rst) and scroll down to the text tree
with node labels. Copy the tree into a new file and open
thefile in FigTree. Identify the ancestral nodes of interest
(see Note 14) and record the node labels that identify them.
5. Search the result file for the text node #x (where x is the
number identifying the ancestral node) to find the maximum-
likelihood ancestral sequence associated with that ancestral
node.
6. Open the alignment file in SeaView and add the ancestral pro-
tein sequences to the alignment. Edit the ancestral sequences
to remove any remaining insertions that are artifacts of the
reconstruction process (see Note 7).
3.6 Characterization Once the ancestral protein sequences have been obtained, they are
ofAncestral Proteins back-translated into nucleotide sequences and codon-optimized for
expression in Escherichia coli, and the genes are synthesized. The
synthetic genes are cloned into expression vectors, and the ancestral
proteins are expressed in E. coli and purified. The thermostability of
the ancestral proteins can be assessed using methods such as circular
dichroism spectroscopy, differential scanning fluorimetry (DSF), or
differential scanning calorimetry. The binding specificity of the
ancestral proteins can be assessed using methods such as isothermal
titration calorimetry (ITC), DSF, or (in some cases) fluorescence
spectroscopy. If the ancestral SBPs have high thermostability and
the desired binding specificity, they are strong candidates for circu-
lar permutation and incorporation into FRET sensor constructs.
3.7 Design The circular permutation of SBPs has been described by Okada
ofCircularly etal. [2]. It is critical to identify sites for the new N-and C- termini
Permuted SBPs that will produce a sensor with high dynamic range without nega-
tively affecting the binding affinity or stability of the protein.
1. Using a crystal structure or homology model of the ancestral
SBP (created using the Phyre2 server [27], for example), select
the positions of the new N- and C-termini. The new termini
must be located on different lobes of the SBP to maximize the
change in their relative positions due to the ligand-induced
conformational change. This can be achieved by deleting a sec-
tion of the protein that links the two lobes (i.e., a hinge strand)
(see Note 15). The result is a theoretical protein with the origi-
nal N- and C-termini, and additional N*- and C*-termini, i.e.,
two protein fragments.
2. Design a linker sequence to fuse the original N- and C-termini
of the SBP.Each repeat of a flexible (GGS)n linker is approxi-
mately 11.4 in length. Measure the distance between the
N- and C-termini of the SBP; the linker should have enough
(GGS)n repeats to bridge this distance.
80 BenE.Clifton et al.
3.8 Cloning Carry out all procedures at room temperature unless otherwise
intoaFRET Sensor specified.
Construct
1. Using standard PCR with a high-fidelity DNA polymerase
(e.g., Phusion Hot Start II), amplify the SBP gene using the
cloning primers from Subheading 3.7. Purify the PCR prod-
uct using a PCR purification kit, according to the manufac-
turers instructions.
2. In a thin-walled PCR tube, chilled on ice, mix 2L of 10 T4
DNA Ligase buffer, 1L 400U/L T4 DNA ligase, 1L
10U/L SapI, 100ng pDOTS4 or pDOTS10, a fivefold
molar excess of the purified PCR product from the previous
step, and water to give a final volume of 20L.
3. Perform the Golden Gate assembly reaction using the follow-
ing thermocycling protocol: 33 cycles of (37C for 2min,
then 16C for 3min); 55C for 10min; 80C for 5min;
then hold at 4C.
4. Transform one aliquot of E. coli TOP10 cells with 2.5L of
the Golden Gate assembly reaction mixture by electroporation
(see Note 18). After electroporation, resuspend the cells in
1mL YenB and incubate with shaking at 37C for 1h. Plate
100 L of the culture on an LB/ampicillin agar plate and
incubate at 37C overnight (see Note 19).
5. Use colony PCR and Sanger sequencing of the resulting PCR
products to confirm correct insertion of the gene into the vec-
tor (see Note 20).
3.9 Characterization After expression of the FRET sensor in E. coli and subsequent puri-
oftheFRET Sensors fication (see Notes 21 and 22), the dynamic range of the sensor
InVitro andInSitu and the affinity of the sensor for its ligand should be measured
Improving FRET Sensors by Ancestral Gene Resurrection 81
4 Notes
Acknowledgments
References
1. Wang H, Nakata E, Hamachi I (2009) Recent 8. Akanuma S, Nakajima Y, Yokobori S etal
progress in strategies for the creation of (2013) Experimental evidence for the thermo-
protein-based fluorescent biosensors. philicity of ancestral life. Proc Natl Acad Sci
Chembiochem 10:25602577 USA 110:1106711072
2. Okada S, Ota K, Ito T (2009) Circular permu- 9. Risso VA, Gavira JA, Mejia-Carmona DF etal
tation of ligand-binding module improves (2013) Hyperstability and substrate promiscuity
dynamic range of genetically encoded FRET- in laboratory resurrections of Precambrian
based nanosensor. Protein Sci 18:25182527 -lactamases. JAm Chem Soc 135:28992902
3. Hires SA, Zhu Y, Tsien RY (2008) Optical 10. Perez-Jimenez R, Ingls-Prieto A, Zhao Z-M
measurement of synaptic glutamate spillover etal (2011) Single-molecule paleoenzymology
and reuptake by linker optimized glutamate- probes the chemistry of resurrected enzymes.
sensitive fluorescent reporters. Proc Natl Acad Nat Struct Mol Biol 18:592596
Sci 105:44114416 11. Risso VA, Gavira JA, Sanchez-Ruiz JM (2013)
4. Okumoto S, Looger LL, Micheva KD etal Thermostable and promiscuous Precambrian
(2005) Detection of glutamate release from proteins. Environ Microbiol 16:14851489
neurons by genetically encoded surface- 12. Gaucher EA, Thomson JM, Burgan MF etal
displayed FRET nanosensors. Proc Natl Acad (2003) Inferring the palaeoenvironment of
Sci 102:87408745 ancient bacteria on the basis of resurrected
5. Dwyer MA, Hellinga HW (2004) Periplasmic proteins. Nature 425:285288
binding proteins: a versatile superfamily for 13. Cole MF, Gaucher EA (2011) Utilizing natu-
protein engineering. Curr Opin Struct Biol ral diversity to evolve protein function: appli-
14:495504 cations towards thermostability. Curr Opin
6. Whitfield JH, Zhang W, Herde MK etal Chem Biol 15:399406
(2015) Construction of a robust and sensitive 14. Williams PD, Pollock DD, Blackburne BP etal
arginine biosensor through ancestral protein (2006) Assessing the accuracy of ancestral pro-
reconstruction. Protein Sci 24:14121422 tein reconstruction methods. PLoS Comput
7. Gaucher EA, Govindarajan S, Ganesh OK Biol 2:e69
(2008) Palaeotemperature trend for 15. Bershtein S, Goldin K, Tawfik DS (2008)
Precambrian life inferred from resurrected Intense neutral drifts yield robust and evolvable
proteins. Nature 451:704707 consensus proteins. JMol Biol 379:10291044
Improving FRET Sensors by Ancestral Gene Resurrection 87
16. Risso VA, Gavira JA, Gaucher EA etal (2014) 30. Hashimoto H, Isobe K, Suda A etal (2010)
Phenotypic comparisons of consensus variants Measurement of two-photon excitation spec-
versus laboratory resurrections of Precambrian tra of fluorescent proteins with nonlinear
proteins. Proteins 82:887896 Fourier-transform spectroscopy. Appl Optics
17. Heinemann U, Hahn M (1995) Circular per- 49:33233329
mutation of polypeptide chains: implications 31. Engler C, Kandzia R, Marillonnet S (2008) A
for protein folding and stability. Prog Biophys one pot, one step, precision cloning method
Mol Biol 64:121143 with high throughput capability. PLoS One
18. Yang Z, Rannala B (2012) Molecular phyloge- 3:e3647
netics: principles and practice. Nat Rev Genet 32. Fu L, Niu B, Zhu Z etal (2012) CD-HIT:
13:303314 accelerated for clustering the next-generation
19. Merkl R, Sterner R (2016) Ancestral protein sequencing data. Bioinformatics 28:31503152
reconstruction: techniques and applications. 33. Katoh K, Standley DM (2013) MAFFT mul-
Biol Chem 397:121 tiple sequence alignment software version 7:
20. Yang Z (2014) Molecular evolution: a statisti- improvements in performance and usability.
cal approach. Oxford University Press, Oxford Mol Biol Evol 30:772780
21. Edgar RC (2004) MUSCLE: multiple 34. Di Tommaso P, Moretti S, Xenarios I etal
sequence alignment with high accuracy and (2011) T-Coffee: a web server for the multiple
high throughput. Nucleic Acids Res 32: sequence alignment of protein and RNA
17921797 sequences using structural information and
22. Gouy M, Guindon S, Gascuel O (2010) homology extension. Nucleic Acids Res
SeaView version 4: a multiplatform graphical 39:1317
user interface for sequence alignment and phy- 35. Lytynoja A, Goldman N (2010) webPRANK:
logenetic tree building. Mol Biol Evol a phylogeny-aware multiple sequence aligner
27:221224 with interactive alignment browser. BMC
23. Yang Z (1994) Maximum likelihood phyloge- Bioinformatics 11:579
netic estimation from DNA sequences with 36. Lytynoja A, Goldman N (2008) Phylogeny-
variable rates over sites: approximate methods. aware gap placement prevents errors in
JMol Evol 39:306314 sequence alignment and evolutionary analysis.
24. Darriba D, Taboada GL, Doallo R etal (2011) Science 320:16321635
ProtTest 3: fast selection of best-fit models of pro- 37. Talavera G, Castresana J(2007) Improvement
tein evolution. Bioinformatics 27:11641165 of phylogenies after removing divergent and
25. Guindon S, Dufayard J, Lefort V etal (2010) ambiguously aligned blocks from protein
New algorithms and methods to estimate sequence alignments. Syst Biol 56:564577
maximum- likelihood phylogenies: assessing 38. Nguyen LT, Schmidt HA, Von Haeseler A
the performance of PhyML 3.0. Syst Biol etal (2015) IQ-TREE: a fast and effective sto-
59:307321 chastic algorithm for estimating maximum-
26. Yang Z (2007) PAML 4: phylogenetic analysis likelihood phylogenies. Mol Biol Evol 32:
by maximum likelihood. Mol Biol Evol 268274
24:15861591 39. Stamatakis A (2014) RAxML version 8: a tool
27. Kelley LA, Mezulis S, Yates CM etal (2015) for phylogenetic analysis and post-analysis
The Phyre2 web portal for protein modeling, oflarge phylogenies. Bioinformatics 30:
prediction and analysis. Nat Protoc 10: 13121313
845858 40. Ashkenazy H, Penn O, Doron-Faigenboim A
28. Okubo Y, Sekiya H, Namiki S etal (2010) etal (2012) FastML: a web server for probabi-
Imaging extrasynaptic glutamate dynamics in listic reconstruction of ancestral sequences.
the brain. Proc Natl Acad Sci USA 107: Nucleic Acids Res 40:580584
65266531 41. Lo WC, Wang LF, Liu YY etal (2012) CPred:
29. Helmchen F, Denk W (2005) Deep tissue a web server for predicting viable circular per-
two-photon microscopy. Nat Methods 2: mutations in proteins. Nucleic Acids Res
932940 40(W1):W232W237
Chapter 6
Abstract
Biosensors that exploit Frster resonance energy transfer (FRET) can be used to visualize biological and
physiological processes and are capable of providing detailed information in both spatial and temporal
dimensions. In a FRET-based biosensor, substrate binding is associated with a change in the relative posi-
tions of two fluorophores, leading to a change in FRET efficiency that may be observed in the fluorescence
spectrum. As a result, their design requires a ligand-binding protein that exhibits a conformational change
upon binding. However, not all ligand-binding proteins produce responsive sensors upon conjugation to
fluorescent proteins or dyes, and identifying the optimum locations for the fluorophores often involves
labor-intensive iterative design or high-throughput screening. Combining the genetic fusion of a fluores-
cent protein to the ligand-binding protein with site-specific covalent attachment of a fluorescent dye can
allow fine control over the positions of the two fluorophores, allowing the construction of very sensitive
sensors. This relies upon the accurate prediction of the locations of the two fluorophores in bound and
unbound states. In this chapter, we describe a method for computational identification of dye-attachment
sites that allows the use of cysteine modification to attach synthetic dyes that can be paired with a fluorescent
protein for the purposes of creating FRET sensors.
Key words Synthetic dye, Optical sensor, Computational modeling, Frster resonance energy transfer
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_6, Springer Science+Business Media LLC 2017
89
90 Joshua A. Mitchell et al.
2 Materials
2.2 Cloning 1. The gene of interest in an expression vector (see Subheading 3.3).
andProtein 2. Primers containing the mutation of interest (see Subheading 3.3).
Purification
3. High-fidelity DNA polymerase kit.
Components
4. Gibson assembly kit.
5. Thin-walled PCR tubes.
6. PCR thermocycler.
7. PCR purification kit.
8. Competent cells for cloning (Top10).
9. Competent cells for protein expression (BL21DE3).
10. Materials for colony PCR and analysis by gel electrophoresis:
(a) PCR master mix.
(b) T7 primers.
(c) 1% agarose gel made with SB buffer (46g/L boric acid,
8g/L sodium hydroxide), with a visualizing stain.
(d) DNA ladder mix.
(e) Agarose gel electrophoresis apparatus.
2.3 Dye Labeling 1. Buffer solution, Phosphate buffer (see Note 1): 0.05M Sodium
Components phosphate, 0.2M NaCl. Adjust the pH to what is appropriate
for both the protein of interest and the chemistry that is needed
to label the protein with the synthetic dye (using either hydro-
chloric acid or sodium hydroxide).
2. TCEP stock solution: dissolve 0.1437g of Tris(2-carboxyethyl)
phosphine hydrochloride (TCEP-HCl) in 1mL of buffer
solution (501mM stock solution) (see Note 2).
3. Dye stock solution: Add a suitable solvent to the synthetic dye
to achieve a stock solution with a final concentration of
10mM.In the case of the Alexa Fluor 532 C5 Maleimide,
1mg was dissolved in 123L of phosphate buffer (10mM
stock solution) (see Note 3).
92 Joshua A. Mitchell et al.
3 Methods
3.1 Computational First, prepare models of the target fusion protein in both its bound
Screening andResidue and unbound conformations. This involves modeling both the
Selection solute-binding and fluorescent domains with the appropriate
linker. Start with crystal structures or high-quality homology mod-
els of the desired binding core in both conformations and the fluo-
rescent protein. Ensure no nonstandard residues exist in the
models, as these are not parameterized in the MARTINI forcefield
(see Note 5). Reconstruct any residues missing from the crystal
structures at the termini by which they are fused. Then, construct
the linker sequence as expressed experimentally (see Note 6).
Complete the model by fusing the two domains (see Note 7). Save
both SBP-linker-FP models as .PDB files.
Create a directory for each conformation, copy the appropriate
.PDB file into each, and also copy simulations.sh into each (see
Note 8). The script simulations.sh automatically prepares and runs
a number of MARTINI simulations. It depends on all of the soft-
ware in Subheading 2.1 except MARTINI, which is downloaded
automatically by the script, provided all software dependencies are
available in your $PATH (see Note 9). The script can be config-
ured by making a copy of it in each conformation directory and
editing the leading CONFIG portion. Most defaults should be
appropriate; however, the input_file, system_name and linker_resi-
dues variables should be set for your system (see Note 10).
Configure and run the script, read and follow the directions given,
then repeat for the other conformation.
Run the second script process-data.py, giving as the first two
arguments the locations of each set of output files. The residue
number of the central residue of the FP fluorophore and the range
of residues that should be checked for sensor generation should
also be given as arguments, respectively, with the f and r switches
(see Note 11). process-data.py reads the given .PDB files, and pre-
dicts dynamic ranges for sensors formed by labeling each residue in
the given range with a dye with configurable Forster distance. This
output is stored by default as comma-separated values with appro-
priate headers in sensor_predict.csv and can be visualized graphi-
cally using a program such as Excel.
Synthetic-Dye Fluorescent Protein FRET Sensors 93
Fig. 1 A graphical representation of the script output. The data shown in this
instance is hypothetical and is not based on a true set of calculations. The script
determines the dynamic range for a hypothetical sensor that has been labeled
with a fluorescent dye at a given residue. For example, for a construct with an
ECFP fused at the N-terminus of the binding protein, a sensor construct that has
been labeled at residue 50 is predicted to have a very small or nonexistent
dynamic range. Conversely, for a sensor that has been labeled at residue 200,
the dynamic range should be large, as it is approaching the theoretical maximum
dynamic range possible for the construct
3.2 Cloning 1. The sensor construct (SBP fused with the fluorescent protein)
andPurification should be first cloned into an expression vector (with a T7
oftheMutant Proteins promoter). The sequence to be cloned should match the
sequence used to model the sensor exactly, with the exception
94 Joshua A. Mitchell et al.
Fig. 2 A generic structure of an amino acid-binding protein (PDB 3IP9) used to illustrate that residue location
and function needs to be considered along with the computational prediction. Residues 100 (blue) and 200
(red) are shown. Although labeling residue 200 would produce a sensor with the theoretically largest dynamic
range (Fig. 1), in reality, as this would require the dye to occupy the ligand-binding site between the two
domains, it would not result in a functional sensor. Alternatively, residue 100 is also predicted to yield a sensor
with a significant dynamic range and is located on a flexible loop, where chemical modification and mutagen-
esis is less likely to negatively impact correct function of the binding protein
5. The PCRs using these primer sets should result in two fragments,
with one fragment overlapping with the T7 promoter region
and the mutagenic region, and the other fragment overlapping
with the mutagenic region and the T7 terminator region. The
mutagenic regions of these fragments will overlap and anneal
during Gibson assembly. Gel purification is highly recom-
mended to improve cloning efficiency, even if the agarose gel
electrophoresis of the PCR product shows a single clear band.
6. Linear vector for use in the Gibson assembly reaction can be
made through PCR using complementary primers of the T7
regions. Specifically, a T7 terminator forward primer and a T7
promoter reverse primer should be used. The linearized vector
produced from this PCR reaction will have T7 regions that can
overlap with the T7 regions of the gene fragments for the
Gibson assembly reaction.
7. The PCR fragments (for both the sensor and vector) can then
be combined into the Gibson master mix (in equimolar ratios).
The typical incubation time for the master mix is 50C for 1h.
8. The Gibson assembly mixture should then be transformed into
competent cells that are designed for DNA cloning (e.g.,
TOP10 cells). If electrocompetent cells are used, the Gibson
mix can be diluted with water to prevent arcing.
9. After confirming that the cloning is successful through
sequencing, the gene should be transformed into an expression
cell type (e.g., BL21DE3).
10. If the sensor construct contains a histidine tag, it can then be
purified through nickel affinity chromatography.
3.3 Dye Labeling 1. To a volume of 849L buffer add 100L of the concentrated
andPurification protein solution (assuming the concentration of the protein
solution is 500M) and 1L of the TCEP solution. Wait
approximately for 5min to allow this solution to equilibrate to
room temperature and for any disulfides to be reduced. This
reaction can be performed in an Eppendorf tube or an equiva-
lent (see Note 14).
2. To the reaction mixture add 50L of the dye stock. The final
composition of the reaction mixture should contain approxi-
mately 50M of protein, 500M TCEP, and 500M dye.
The reaction should be allowed to proceed overnight (16h) at
4C in the dark with constant agitation (see Note 15).
3. After the reaction period, centrifuge the reaction mixture at high
speed (18,000g, 5min) to separate out any precipitated dye
or protein (see Note 16).
4. The mixture should then be purified through gel filtration,
with a desalting column usually being sufficient (see Note 17).
96 Joshua A. Mitchell et al.
4 Notes
13. There are two conserved cysteine residues in the GFP family;
we have had success with the mutations C49S and C71V with
minimal fluorescence loss, as described by Suzuki etal. [8].
14. The reaction volume and reagents should be scaled appropriately,
relative to the concentration of the protein stock solution.
15. When agitating the solution, care should be made that the
solution does not begin to form froth or foam as this can lead
to precipitation of protein.
16. Filtration can be used instead of centrifugation; however, there is
typically some volume/yield loss when filtering small volumes.
17. PD-10 columns (GE healthcare) are usually sufficient to sepa-
rate free dye from the protein. If the purity of the protein is a
concern, the protein should be first buffer exchanged to
remove excess TCEP and then purified with SEC (GE health-
care, Hiload 26/600 superdex 200pg, adequate for most pro-
teins). This should separate labeled protein from free dye and
any contaminant proteins.
References
1. Scanziani M, Hausser M (2009) Electrophysiology 5. Suzuki M, Tanaka S, Ito Y, Inoue M, Sakai T,
in the age of light. Nature 461(7266):930939 Nishigaki K (2012) Simple and tunable Frster
2. Hou B-H, Takanaga H, Grossmann G, Chen resonance energy transfer-based bioprobes for
L-Q, Qu X-Q, Jones AM, Lalonde S, Schweissgut high-throughput monitoring of caspase-3 acti-
O, Wiechert W, Frommer WB (2011) Optical sen- vation in living cells by using flow cytometry.
sors for monitoring dynamic changes of intracel- Biochim Biophys Acta 1823(2):215226.
lular metabolite levels in mammalian cells. Nat doi:10.1016/j.bbamcr.2011.07.006
Protoc 6(11):18181833. http://www.nature. 6. Hess B, Kutzner C, Van Der Spoel D, Lindahl E
com/nprot/journal/v6/n11/abs/ (2008) GROMACS 4: algorithms for highly effi-
nprot.2011.392.html#supplementar y- cient, load-balanced, and scalable molecular sim-
information ulation. JChem Theory Comput 4(3):435447
3. Masharina A, Reymond L, Maurel D, Umezawa 7. Monticelli L, Kandasamy SK, Periole X, Larson
K, Johnsson K (2012) A Fluorescent sensor for RG, Tieleman DP, Marrink S-J (2008) The
GABA and synthetic GABAB receptor ligands. MARTINI coarse-grained force field: extension to
JAm Chem Soc 134(46):1902619034. proteins. JChem Theory Comput 4(5):819834
doi:10.1021/ja306320s 8. Suzuki T, Arai S, Takeuchi M, Sakurai C, Ebana
4. Namiki S, Sakamoto H, Iinuma S, Iino M, H, Higashi T, Hashimoto H, Hatsuzawa K,
Hirose K (2007) Optical glutamate sensor for Wada I (2012) Development of cysteine-free
spatiotemporal analysis of synaptic transmis- fluorescent proteins for the oxidative environ-
sion. Eur JNeurosci 25(8):22492259. ment. PLoS One 7(5):e37551. doi:10.1371/
doi:10.1111/j.1460-9568.2007.05511.x journal.pone.0037551
Chapter 7
Abstract
Biosensors are used in many fields to measure the concentration of analytes, both in a cellular context and
in human samples for medical care. Here, we outline the design of two types of modular biosensors:
SNAP-tag-based indicators with a Fluorescent Intramolecular Tether (SNIFITs) and LUCiferase-based
Indicators of Drugs (LUCIDs). These semisynthetic biosensors quantitatively measure analyte concentra-
tions invitro and on cell surfaces by an intramolecular competitive mechanism. We provide an overview of
how to design and apply SNIFITs and LUCIDs.
Key words Biosensors, Protein engineering, Protein switches, Intramolecular ligands, Self-labeling
proteins, SNAP-tag, CLIP-tag, Polyproline linkers, Therapeutic drug monitoring, Cell-surface
biosensors
1 Introduction
1.1 SNIFITS Small molecule analytes are central to many biological systems.
andLUCIDs: The ability to quantify such analytes is important in basic research
Semisynthetic to better understand anabolic, metabolic, and signal relay pro-
Modular Biosensors cesses. It is important to quantify small molecules not only in basic
research, but also in healthcare, where it is crucial to be able to
monitor the levels of drugs and metabolites for therapeutic pur-
poses. The use of biosensors is one method for this quantification,
and has many different applications [1, 2].
Several natural proteins bind small molecule analytes. If such a
binding protein undergoes a conformational change upon analyte
binding, it can be used as part of a biosensor system [3, 4]. For
example, it can be sandwiched in between two fluorescent proteins
that are Frster resonance energy transfer (FRET)-partners [5, 6]
or between two bioluminescent resonance energy transfer (BRET)-
partners [7]. In both cases, the change in distance and orientation
between the two resonance energy transfer (RET) partners is trans-
lated into changes in the optical properties of the system, which
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_7, Springer Science+Business Media LLC 2017
101
102 Helen Farrants et al.
Fig. 1 The Architecture of SNIFITs and LUCIDs. An intramolecular tether (dashed line) containing a RET accep-
tor and ligand for the binding protein is covalently attached to SNAP-tag, a self-labeling protein (SLP). SNAP-
tag is fused to a RET donor and a binding protein. Displacing the intramolecular ligand by an analyte of interest
leads to an overall change in the sensor geometry, and the RET efficiency between a RET donor and RET
acceptor. The RET donor can be a synthetic dye covalently attached to a second orthogonal SLP, a fluorescent
protein, or a luciferase
SNIFITS and LUCIDs: Semi-Synthetic Modular Biosensors 103
Fig. 2 Mechanisms of SLPs used in the work of SNIFITs and LUCIDs. SNAP-tag reacts selectively with
O6-benzylguanine moieties while CLIP-tag reacts with O2-benzylcytosine (BC). The SLPs are used to
covalently attach the intramolecular tether and sometimes a fluorescent molecule (here annotated as R),
to the fusion protein
104 Helen Farrants et al.
Fig. 3 A typical titration curve from a RET-based biosensor. The sensor is described by the lowest and highest
possible ratios of the RET donor and RET acceptor emission ratios (lower and upper plateaus), the dynamic
range and the c50
SNIFITS and LUCIDs: Semi-Synthetic Modular Biosensors 105
1.2 The Rational Some common design principles can be followed to construct a
Design ofSNIFIT SNIFIT or a LUCID for a specific analyte. Over the years, we have
andLUCID Biosensors gathered experience from our design of biosensors from analytes
ranging from sulfonamides and neurotransmitters to cancer thera-
peutics such as methotrexate. Here, we give an overview of how to
design these biosensors, followed by an overview of their practical
applications.
1.2.1 The Binding A binding protein is required to display sufficient affinity and speci-
Protein ficity for the analyte of interest. Since SNIFITs and LUCIDs are
based on competition with another ligand, the dissociation con-
stant of the binding protein for the analyte of interest must be
lower compared to the desired response range.
Another important factor when choosing the binding protein
is the availability of structural information, ideally in complex with
a potential intramolecular ligand. This is not only crucial for the
geometrical optimization of the sensor, but also for the choice of
derivatization points of the ligand. In this regard, it can be advan-
tageous if the binding protein is small, monomeric, and stable. Yet,
if no suitable natural binding protein is available for the analyte of
interest, computational methods can be used to design a protein
with tailor-engineered binding properties [20].
Fig. 4 Example of an intramolecular tether. This intramolecular tether is composed of the reactive group for the
SLP (O6- benzylguanine), a fluorophore (Cy3) and a ligand for the binding protein (methotrexate)
Fig. 5 Sensors equilibria. The affinity of the intramolecular ligand determines the equilibrium between the
closed and open states of the sensor. In the presence of free analyte [A], a second equilibrium is established
in which there is competitive binding of the free analyte to the binding protein
S( open )
K1 = = M eff (1)
S closed K d ,lig
( )
S( open ) A
K2 = =K (2)
S open [ A ]
d , analyte
( )
M eff
K tot = K 1K 2 = K d ,analyte (3)
K d ,lig
The response of the sensor can be described in two steps:
unbinding of the intramolecular ligand (K1, Eq. (1)) followed by
binding of the analyte (K2, Eq. (2)) (Fig. 5). Equation (1) shows
that the ratio between the closed (S(closed)) and open (S(open)) state of
the sensor in the absence of analyte is directly proportional to the
affinity of the intramolecular ligand. Equation (3) describes the
relationship between the sensors apparent affinity for the analyte
(Ktot) and the analytes affinity for the receptor protein (Kd,analyte)
(see [21] for a more detailed discussion).
The effective molarity (Meff) of the intramolecular ligand in
SNIFIT and LUCID sensors is in the order of 100M [22]. The
SNIFITS and LUCIDs: Semi-Synthetic Modular Biosensors 107
1.2.3 Sensor Geometry To achieve a large dynamic range, the RET efficiency should be
high in the closed state and low in the open state of the sensor.
Since the RET efficiency depends strongly on distance, this can be
achieved by modifying the sensor geometry. The modular architec-
ture of SNIFITs and LUCIDs allows to control the distance
between the RET partners in the closed (see D1in Fig. 6) and open
states (see D2in Fig. 6) independently of each other.
It may be difficult to obtain close proximity between the RET
donor and RET acceptor in the closed state of the sensor (i.e., aim-
ing to minimize D1in Fig. 6) which strongly depends on the
structural characteristics of a binding protein that is available for a
given analyte. If the terminus of the binding protein through
which it is fused to the RET donor is close to the analyte binding
site, the distance D1 will be small and the construct does not have
to be optimized further by protein engineering. Yet, if neither of
the two termini are suitable, it is sometimes possible to circular
permute the binding protein to create new termini closer to the
binding site of the analyte (Fig. 7). Circular permutation of the
binding protein may, however, be cumbersome, and may affect the
properties of the binding protein.
Fig. 6 Sensor geometry optimization. D1 refers to the distance in space between the RET donor and acceptor
in the closed state, and can be optimized by changing the linker length L1. L1 refers to the distance along the
polypeptide chain covered by parts of the synthetic tether, the ligand-binding domain and the connecting linker
(highlighted in blue). Similarly, D2 refers to the distance in space in between the RET donor and acceptor in the
open state and can be optimized by increasing L2. L2 refers to the distance along the polypeptide chain cov-
ered by parts of the synthetic tether, the SNAP tag, and the connecting linker (highlighted in orange)
108 Helen Farrants et al.
Fig. 7 An example of the binding protein dihydrofolate reductase from E. coli with
bound ligand. The crystal structure of eDHFR (PDB ID: 1RA3) is represented in
gray cartoon, the methotrexate analyte is represented in gray sticks. The site of
derivatization for the intramolecular ligand is highlighted by an arrow. The sites
for circular permutation are shown as dashed lines
2 Materials
Intramolecular Dynamic
Analyte Use Design ligand Mechanism range c50
HCA inhibitors [22, SNIFIT SNAP-mCherry-HCA Sulfonamides FRET 390% (iv) 220600M
(M) and Zn2+ 25] in vitro and cell SNAP-CLIP-HCA dye -fluorescent protein 230% (cells)
(nM) surface SNAP-PP-CLIP-HCA Cy5-mCherry
Dye-dye
Cy5-DY547
Glutamate (high [27] SNIFIT SNAP-PP15-CLIP- Glutamate FRET 90% (iv) 12M
M) in vitro and cell iGluR5-S1S2 Dye-dye 56% (cells)
surface Cy5-DY547
-Aminobutyric [28] SNIFIT SNAP-CLIP-GB1a and GABAB receptor FRET 80% (cells) 100M
acid (GABA) cell surface GB2 coexpressed antagonist CGP Opposite mechanism,
(MmM) 51783 Dye-dye
Cy5-Alexa488
ACh and AChE [29] SNIFIT AChE-CLIP-(GPGGA)8- Decamethonium FRET 65% 7nM10mM
inhibitors in vitro and cell SNAP or edrophonium-C13 Dye-dye
(nMmM) surface Cy5-Cy3
Methotrexate [30] LUCID SNAP-PP30-NLuc- Trimethoprim/ BRET 1340% 0.7585M
(nMmM) cpDHFRL24G5 methotrexate Cy3-Nluc
Tacrolimus and [30] LUCID SNAP-PP30-NLuc- Two-headed ligand BRET 460% 17nM
sirolimus (nM) FKBP12 Cy3-Nluc
Cyclosporine A [30] LUCID SNAP-PP30-NLuc- Mixed urea BRET 192% 500nM
(nM) cphuman cyclophilin Cy3-Nluc
R149G5
Topiramate (M) [30] LUCID SNAP-PP30-NLuc-HCA Parasulfonamide BRET 591% 7.3M
SNIFITS and LUCIDs: Semi-Synthetic Modular Biosensors
TMR-Nluc
Digoxin [30] LUCID DIG10.3-NLuc-PP30-SNAP- Progesterone BRET 485% 22nM
TMR-Nluc
109
110 Helen Farrants et al.
2.2 In Vitro Labeling 1. Labeling buffer: 50mM HEPES, 50mM NaCl, pH 7.2,
andCharacterization 1mg/mL bovine serum albumin (BSA).
2. Fluorescein or tetramethylrhodamine (TMR) labeled ligand
stock solution in DMSO, for characterizing the binding
strength by means of fluorescence polarization.
3. BG-fluorophore-ligand conjugate stock solution in DMSO, for
labeling SNAP-tag based sensors with an intramolecular tether.
4. BC-fluorophore-ligand conjugate stock solution in DMSO, for
labeling CLIP-tag-based sensors with an intramolecular tether.
5. Nonbinding multiwell plates (black or white).
6. Plate reader with filters for fluorescent polarization and fluo-
rescent measurements.
7. Nano-glo substrate from Promega.
3 Methods
3.1 Generation Standard methods of cloning can be used to construct the expression
ofFusion Proteins plasmids for the recombinant fusion proteins. We initially utilized
forExpression inE. restriction-enzyme cloning and ligation methods, but have recently
coli started to use newer ligation methods such as Gibson assembly [26].
We advise using a pET51b(+) (Novagen) expression vector
that contains a double-purification system of a His-tag and a Strep-
tag. Other purification systems can be used, but it is important to
use affinity purification tags on both the N- and C-termini of the
protein to prevent purifying truncated versions of the sensor. We
provide here a general protocol for the expression of sensors, but
modification of the method may be necessary if the binding pro-
tein is unstable or insoluble.
1. Clone the sensor into a bacterial expression vector using stan-
dard cloning methods (see Note 1).
2. Transform RosettaGami DE3 pLysS E. coli cells for protein
production, plate cells onto selective LB agar medium, and let
colonies grow at 37C overnight.
3. Pick a single colony and use it to inoculate 2mL of selective
LB medium and allow the bacteria to grow overnight, with
shaking at 220rpm at 37C.
4. Inoculate 1L selective LB medium with 1mL of the precul-
ture and incubate (220rpm at 37C) until an OD600nm of 0.6-
0-8 is reached.
5. Cool the incubator to the expression temperature and induce
the expression of the protein depending on the promoter used
(see Note 2).
6. After expression, harvest the cells by centrifugation and resus-
pend the bacteria in a total of 30mL of Ni2+-NTA lysis buffer
supplemented with 1mM PMSF and 0.25mg/mL of
lysozyme.
7. Lyse cells by sonication on ice.
8. Centrifuge at 40,000g for 10min at 4C to remove cell
debris and insoluble proteins.
9. Incubate the supernatant with 1mL Ni2+-NTA agarose slurry
under agitation for 1h at 4C.Then centrifuge gently and
transfer the resin onto a propylene column.
112 Helen Farrants et al.
10. Wash the Ni2+-NTA agarose with at least six column volumes
of cold Ni2+-NTA wash buffer.
11. Elute the protein with 500L aliquots of Ni2+-NTA elution
buffer. Estimate the protein concentration of each fraction
using Bradford Reagent and/or absorbance at 280nm.
12. Take aliquots of the eluate of the Ni2+-NTA column to follow and
analyze the purification process by SDS-PAGE (see Note 3).
13. Load all of the eluted fractions that contain protein onto a
StrepTactin-column.
14. Wash the column using the Strep-tag washing buffer. Wash
with six column volumes.
15. Elute the protein using 500L fractions of Strep-tag elution
buffer (for a 1mL column). Estimate the protein concentra-
tion of each fraction using a Bradford quantification and/or
absorbance at 280nm.
16. Take aliquots of each step and run an SDS-PAGE to verify the
purity of the protein.
17. Concentrate the protein using molecular-weight dependent
filtration devices, with the recommendation of the provider,
and change the buffer to storage buffer. Dilute the sample in a
1:1 ratio with glycerol 87% and store it at 20C at a concen-
tration between 20 and 200M.
3.2 Chemical The synthesis of the intramolecular tether heavily depends on the
Synthesis chemical properties of the intramolecular ligand. In one approach,
oftheIntramolecular each component of the intramolecular tether (i.e., the BG-reactive
Tether group, fluorophore, and intramolecular ligand) can be synthesized
separately in a modular approach and the tether subsequently
assembled using standard chemical methods such as amide bond
formation, click chemistry, and alkylation. For examples, see [22,
25, 2730]. When making the intramolecular tether, it is worth
making also a ligand that only carries a fluorophore and can subse-
quently be used to measure the Kd by means of fluorescence polar-
ization measurements.
3.3 Determining Many methods can be used to determine the affinity of the recep-
theAffinity tor protein for both the intramolecular ligand and the free analyte.
oftheIntramolecular We routinely use fluorescence polarization to determine both of
Ligand these parameters.
1. Prepare serial dilutions of the receptor protein in labeling buf-
fer that contains 20nM fluorescein or tetramethylrhodamine
(TMR)-labeled ligand.
2. Pipette 100L of each dilution into the wells of a black 96-well
plate.
3. Incubate the plate for 10min at room temperature.
SNIFITS and LUCIDs: Semi-Synthetic Modular Biosensors 113
3.4 In Vitro Labeling 1. Label the recombinant fusion protein with synthetic mole-
cules. Common concentrations are 1M sensor protein with
2M BG-based substrate for SNAP-tag, and 10M BC-based
substrate for CLIP-tag in labeling buffer (see Note 4).
2. For SNIFITs, remove the excess labeling reagents using three
washes with labeling buffer in centrifugal filtering devices, or using
a small gel filtration column. This is not needed for LUCIDs.
3. Quantify the amount of labeled protein by estimating the con-
centration of dye from its specific absorbance and comparing it
to the protein absorbance at 280 using a spectrophotometer,
such as the nanodrop.
4. The quantitative labeling of the sensor, assuming fully func-
tional SLPs, can also be verified by SDS-PAGE and in-gel fluo-
rescence scanning. To this end, incubate the labeled sensor
with an additional fivefold excess of a BG- or BC-based deriva-
tive labeled with a second fluorophore for 30min at room
temperature, and then separate the samples by SDS-PAGE.
114 Helen Farrants et al.
3.5 In Vitro Titrations 1. Prepare a suitable dilution of the sensor in labeling buffer and
add 98L into each well of a 96-well plate. Use nonbinding
black 96-well plates for fluorescence and white plates for lumi-
nescence measurements. We find that 50nM sensor is suitable
for SNIFITs and 5nM for LUCIDs.
2. Prepare serial dilutions of the analyte of interest in DMSO, and
add 2L of the dilutions to each well with the sensor.
3. Incubate for 1h at room temperature, or until the sensor is
fully open (see Note 5).
4. Record spectra on a spectrophotometer exciting the FRET
donor, or add luciferase substrate to give an adequate concen-
tration. We usually use a 400-fold dilution in storage buffer of
Nano-glo substrate from Promega stock with LUCIDs.
5. Plot the intensity ratio (R) between the RET donor and RET
acceptor against the sensor concentration, and fit it to a com-
petitive single binding site isotherm.
I donor
R=
I acceptor
Rsat - Rzero
R = Rzero +
c50
1+
[ Analyte]
3.6 Application 1. Clone the sensor of interest into a pDisplay mammalian expres-
ofSNIFITs andLUCIDs sion vector using standard cloning protocols. We usually use
ontheCell Surface transient transfection for sensor evaluation on cell surfaces, but
semistable cell lines can also be prepared.
2. Sterilize glass coverslips ( 15mm) by dipping them into an
ethanol bath and briefly holding them in a Bunsen burner
flame.
3. Place the sterile coverslips into 12-well cell culture plates.
4. Coat the coverslips by adding 1mL poly-L-lysine solution
(0.7mg/mL in sterile water) per well. Incubate the plate over-
night at 37C.
5. Remove the poly-l-lysine and wash the cover slips once with
1mL sterile water.
6. Seed HEK293 cells to around 30% confluency in DMEM
Glutamax medium supplemented with 10% fetal bovine serum,
and grow at 37C and 5% CO2 in a humidified incubator.
7. The next day, transfect the cells with the plasmid using a trans-
fection agent of choice. We routinely use Lipofectamine 2000.
Dilute the target DNA to a final concentration of 0.8g/mL
in Opti-MEM I reduced serum medium and add Lipofectamine
2000 to a final concentration of 1L/mL.Allow to stand at
room temperature for 20min to form a pre-complex. Dilute a
SNIFITS and LUCIDs: Semi-Synthetic Modular Biosensors 115
4 Notes
References
1. Vigneshvar S, Sudhakumari CC, Senthilkumaran An engineered protein tag for multiprotein
B, Prakash H (2016) Recent advances in biosen- labeling in living cells. Chem Biol 15(2):128
sor technology for potential applicationsan 136. doi:10.1016/j.chembiol.2008.01.007
overview. Front Bioeng Biotechnol 4:11. 12. Los GV, Encell LP, McDougall MG, Hartzell
doi:10.3389/fbioe.2016.00011 DD, Karassina N, Zimprich C, Wood MG,
2. Zhang D, Liu Q (2016) Biosensors and bio- Learish R, Ohana RF, Urh M, Simpson D,
electronics on smartphone for portable bio- Mendez J, Zimmerman K, Otto P, Vidugiris G,
chemical detection. Biosens Bioelectron Zhu J, Darzins A, Klaubert DH, Bulleit RF,
75:273284. doi:10.1016/j.bios.2015.08.037 Wood KV (2008) HaloTag: a novel protein
3. Hochreiter B, Garcia AP, Schmid JA (2015) labeling technology for cell imaging and pro-
Fluorescent proteins as genetically encoded tein analysis. ACS Chem Biol 3(6):373382.
FRET biosensors in life sciences. Sensors doi:10.1021/cb800025k
(Basel, Switzerland) 15(10):2628126314. 13. Hinner MJ, Johnsson K (2010) How to obtain
doi:10.3390/s151026281 labeled proteins and what to do with them.
4. Tainaka K, Sakaguchi R, Hayashi H, Nakano S, Curr Opin in Biotechnol 21(6):766776.
Liew FF, Morii T (2010) Design strategies of doi:10.1016/j.copbio.2010.09.011
fluorescent biosensors based on biological 14. Chen X, Wu Y-W (2016) Selective chemical
macromolecular receptors. Sensors (Basel) labeling of proteins. Org Biomol Chem.
10(2):13551376. doi:10.3390/s100201355 doi:10.1039/C6OB00126B
5. Thestrup T, Litzlbauer J, Bartholomaus I, 15. Xue L, Karpenko IA, Hiblot J, Johnsson K
Mues M, Russo L, Dana H, Kovalchuk Y, (2015) Imaging and manipulating proteins in
Liang Y, Kalamakis G, Laukat Y, Becker S, live cells through covalent labeling. Nat
Witte G, Geiger A, Allen T, Rome LC, Chen Chem Biol 11(12):917923. doi:10.1038/
T-W, Kim DS, Garaschuk O, Griesinger C, nchembio.1959
Griesbeck O (2014) Optimized ratiometric
16. Giepmans BNG, Adams SR, Ellisman MH,
calcium sensors for functional invivo imaging Tsien RY (2006) The fluorescent toolbox for
of neurons and T lymphocytes. Nat Methods assessing protein location and function.
11(2):175182. doi:10.1038/nmeth.2773 Science 312(5771):217224. doi:10.1126/
6. Hamers D, Voorst Vader L, Borst JW, science.1124618
Goedhart J(2013) Development of FRET 17. Yan Q, Bruchez MP (2015) Advances in chem-
biosensors for mammalian and plant systems. ical labeling of proteins in living cells. Cell
Protoplasma 251(2):333347. doi:10.1007/ Tissue Res 360(1):179194. doi:10.1007/
s00709-013-0590-z s00441-015-2145-4
7. Xiong TC, Ronzier E, Sanchez F, Corratge- 18. Thorne N, Inglese J, Auld DS (2010)
Faillie C, Mazars C, Thibaud JB (2014) Illuminating insights into firefly luciferase and
Imaging long distance propagating calcium other bioluminescent reporters used in chemi-
signals in intact plant leaves with the BRET- cal biology. Chem Biol 17(6):646657.
based GFP-aequorin reporter. Front Plant Sci doi:10.1016/j.chembiol.2010.05.012
5:43. doi:10.3389/fpls.2014.00043 19. Hall MP, Unch J, Binkowski BF, Valley MP,
8. Valle-Blisle A, Plaxco KW (2010) Structure- Butler BL, Wood MG, Otto P, Zimmerman K,
switching biosensors: inspired by nature. Curr Vidugiris G, Machleidt T, Robers MB, Benink
Opin Struct Biol 20(4):518526. HA, Eggers CT, Slater MR, Meisenheimer PL,
doi:10.1016/j.sbi.2010.05.001 Klaubert DH, Fan F, Encell LP, Wood KV
9. Keppler A, Gendreizig S, Gronemeyer T, Pick (2012) Engineered luciferase reporter from a
H, Vogel H, Johnsson K (2003) A general deep sea shrimp utilizing a novel imidazopyr-
method for the covalent labeling of fusion pro- azinone substrate. ACS Chem Biol 7(11):1848
teins with small molecules invivo. Nat Biotechnol 1857. doi:10.1021/cb3002478
21(1):8689. doi:10.1038/nbt765
20. Tinberg CE, Khare SD, Dou J, Doyle L,
10. Keppler A, Kindermann M, Gendreizig S, Pick Nelson JW, Schena A, Jankowski W, Kalodimos
H, Vogel H, Johnsson K (2004) Labeling of CG, Johnsson K, Stoddard BL, Baker D
fusion proteins of O6-alkylguanine-DNA alkyl- (2013) Computational design of ligand-bind-
transferase with small molecules invivo and ing proteins with high affinity and selectivity.
invitro. Methods 32(4):437444. Nature 501(7466):212216. doi:10.1038/
doi:10.1016/j.ymeth.2003.10.007 nature12443
11. Gautier A, Juillerat A, Heinis C, Corra IR Jr, 21. Krishnamurthy VM, Semetey V, Bracher PJ,
Kindermann M, Beaufils F, Johnsson K (2008) Shen N, Whitesides GM (2007) Dependence
SNIFITS and LUCIDs: Semi-Synthetic Modular Biosensors 117
of effective molarity on linker length for an 26. Gibson DG, Young L, Chuang R-Y, Venter JC,
intramolecular proteinligand system. JAm Hutchison CA, Smith HO (2009) Enzymatic
Chem Soc 129(5):13121320. doi:10.1021/ assembly of DNA molecules up to several hun-
ja066780e dred kilobases. Nat Methods 6(5):343345.
22. Brun MA, Tan K-T, Nakata E, Hinner MJ, http://www.nature.com/nmeth/journal/
Johnsson K (2009) Semisynthetic fluorescent v6/n5/suppinfo/nmeth.1318_S1.html
sensor proteins based on self-labeling protein 27. Brun MA, Tan K-T, Griss R, Kielkowska A,
tags. JAm Chem Soc 131(16):58735884. Reymond L, Johnsson K (2012) A semisyn-
doi:10.1021/ja900149e thetic fluorescent sensor protein for glutamate.
23. Evers TH, van Dongen EMWM, Faesen AC, JAm Chem Soc 134(18):76767678.
Meijer EW, Merkx M (2006) Quantitative doi:10.1021/ja3002277
understanding of the energy transfer between 28. Masharina A, Reymond L, Maurel D, Umezawa
fluorescent proteins connected via flexible pep- K, Johnsson K (2012) A fluorescent sensor for
tide linkers. Biochemistry 45(44):13183 GABA and synthetic GABAB receptor ligands.
13192. doi:10.1021/bi061288t JAm Chem Soc 134(46):1902619034.
24. Schuler B, Lipman EA, Steinbach PJ, Kumke doi:10.1021/ja306320s
M, Eaton WA (2005) Polyproline and the 29. Schena A, Johnsson K (2014) Sensing acetyl-
spectroscopic ruler revisited with single- choline and anticholinesterase compounds.
molecule fluorescence. Proc Natl Acad Sci Angew Chem Int Ed 53(5):13021305.
USA 102(8):27542759. doi:10.1073/ doi:10.1002/anie.201307754
pnas.0408164102 30. Griss R, Schena A, Reymond L, Patiny L,
25. Brun MA, Griss R, Reymond L, Tan K-T, Piguet Werner D, Tinberg CE, Baker D, Johnsson K
J, Peters RJRW, Vogel H, Johnsson K (2011) (2014) Bioluminescent sensor proteins for
Semisynthesis of fluorescent metabolite sensors point-of-care therapeutic drug monitoring.
on cell surfaces. JAm Chem Soc 133(40):16235 Nat Chem Biol 10(7):598603. doi:10.1038/
16242. doi:10.1021/ja206915m nchembio.1554
Chapter 8
Abstract
We recently developed a protein-protein interaction assay, FlimPIA (Firefly luminescent intermediate-based
Protein-protein Interaction Assay) based on the catalytic mechanism of firefly luciferase (Fluc) that can be
divided into two half-reactions: the adenylation step and the oxidative luminescent steps. We engineered
two mutant Fluc enzymes named Donor and Acceptor where the oxidative luminescent activity of the
Donor is almost eliminated and the adenylation activity of the Acceptor is suppressed. When the Donor
and the Acceptor are each fused to one of two interacting partners, and put together to interact, the Donor
and the Acceptor come sufficiently close such that the Acceptor can react with the luciferyl-adenylate
intermediate (LH2-AMP) produced by the Donor, and thus emit luminescence.
FlimPIA can be used invitro and in cultured cells. Owing to recent improvements, it has several
advantages in terms of signal/background ratio, detectable size of interacting partner, and sensitivity over
conventional protein-protein interaction assays based on Frster/fluorescence resonance energy transfer
and protein-fragment complementation performed invitro. Here, we describe a protocol to make use of
the latest version of FlimPIA which shows even lower background and higher signal than previously
described ones.
Key words Protein-protein interaction, Firefly luciferase, Substrate channeling, Reaction intermedi-
ate, Sensitivity, Detectable distance, Signal-background ratio
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI 10.1007/978-1-4939-6940-1_8, Springer Science+Business Media LLC 2017
119
120 YukiOhmuro-Matsuyama andHiroshiUeda
Fig. 1 Principle of FlimPIA (a) Chemical reactions catalyzed by Fluc. Fluc produces
excited state oxyluciferin (OxL) from d-luciferin (LH2) by a two-step catalysis, the
adenylation step, and the following oxidative steps. (b) Working mechanism of
FlimPIA.The adenylation acitivity of the Donor is suppressed, on the other hand,
the oxidative activity of the Acceptor is suppressed. Donor and Acceptor are
enough close that the Acceptor use luciferyl-AMP (LH2-AMP) produced by Donor
when binding domains are interacting. Adapted with permission from Fig.1c in
Ref. 2. Copyright John Wiley and Sons
Sensitive Protein-Protein Interaction Assay 121
2 Materials
3 Methods
3.1 Construction 1. Amplify the DNA fragment encoding FLuc derived of Photinus
oftheBinding pyralis (Ppy) by PCR using pGEX-Ppy [4] or pGEM-luc vector
Domain-Fused as a template, and primers NotG4SBack (with G4S linker and a
Expression Vectors NotI site) and XhoFor (with an XhoI site).
(Fig. 2) 2. Digest the amplified fragment with restriction enzymes NotI
and XhoI, and subclone into the multicloning site of pET32b
between NotI and XhoI sites.
3. Prepare a pair of DNA fragments each encoding a binding
domain (BD) of your interest, which are appended with restric-
tion sites NcoI and NotI by PCR.Digest the product with the
same enzymes, and ligate each with the plasmid prepared in 2
that was digested with NcoI and NotI (see Notes 3 and 4).
Here, the procedure is exemplified with FKBP12 and FRB that
are denoted as BD1 and BD2, respectively (see Note 5).
4. Transform JM109 competent E. coli cells with the ligation
mixture.
5. Culture the cells on LBA agar plates and incubate overnight at
37C.
6. Pick a colony and culture it in 4mL LBA medium and incu-
bate overnight at 37C.
7. Extract the plasmid, and confirm the nucleotide sequence of
the entire open reading frame.
A
His6 G 4S H245D E354K K443A His6
Trx FKBP12 Fluc
B
His6 G4S E354K R437K K529Q His6
Fig. 2 Schematic structure of the constructs of BD/Donor and BD/Acceptor. (A) The structure of BD1/Donor. The
Donor is expressed as a fusion protein with thioredoxin (Trx), which is originally encoded in pET32, and FKBP12 with
a short linker GGGS (G4S). (B) The structure of BD2/Acceptor. The Acceptor is expressed as a fusion protein with Trx
and FRB with a G4S linker. Adapted with permission from Fig. S2in Ref. 2. Copyright John Wiley and Sons
Table 1
Nucleotide sequence of the primers
Sequence (53)
NotG4SBack GGCGCGCCGCGGCCGCCGGTGGTGGTGGTAGCATGGAA GACGCCAAA
AACATAAAG
XhoFor GGCGCGCCTCGAGCTTTCCGCCCTTCTTGGCCT
H245D GTTCCATTCCATGACGGTTTTGGAATGT
K443A GACCTCTTGAAGTCTTTAATTGCATACAAAGGATATCAGGTGGC
L530R CCGAAAGGTCTTACCGGTAAACGCGACGCAAGAAAAATC
E354K TTCTGATTACACCCAAGGGGGATGATAAA
K529Q CCGAAAGGTCTTACGGTCRRCTCGACGCAAGAAAATCAGAGAG
FlucEcoBack CAATTGCACTGATAATGAA
FlucR437KFor GATATCCTTTGTATTTAATTAAAGACTTGAKCTTATCAACTATGAAG
AAGTGTTCGTC
3.5 Chemical 1. Dissolve 15mg of adenylic acid (AMP) and 5mg of LH2 in
Synthesis 1mL of dimethyl sulfoxide.
andPurification 2. Dissolve 100mg of dicyclohexylcarbodiimide in 1mL of
ofLH2-AMP dimethyl sulfoxide.
(See Note 13) [5, 6] 3. Mix the solutions of 1 and 2.
4. Incubate for 10min at room temperature (see Note 14).
5. Add 5mL of acetone to stop the reaction.
6. Centrifuge and carefully remove the supernatant.
7. Add 3mL of acetone.
8. Centrifuge and carefully remove the supernatant.
9. Repeat steps 7 and 8.
10. Dissolve the precipitate in 1.5mL of the solution of acetic acid
(10mM) and NaCl (40mM).
11. Apply to the column containing the resin of Toyopearl HW-40S
(bed volume ~2mL).
12. Collect the fraction by adding 1mL of diluted hydrochloric
acid (pH4.5) (see Notes 15 and 16).
13. Repeat step 12 1015 times.
14. Measure the fluorescence spectrum of the each fraction in
steps 12 and 13 with excitation wavelength of 327nm, and
collect the fractions that emit fluorescence peaking at around
535nm (see Note 17) [7]. When the peak values of LH2-AMP
and x nM of LH2 are y and z, respectively, the concentration of
LH2-AMP can be determined as follows (see Note 18).
x y
The concentration of LH2-AMP (nM) =
z 0.45.
4 Notes
Acknowledgment
References
1. Ohmuro-Matsuyama Y, Nakano K, Kimura A, rapamycin-receptor complex. Nature
Ayabe K, Ihara M, Wada T, Ueda H (2013) A 369(6483):756758. doi:10.1038/369756a0
protein-protein interaction assay based on the 9. Chen J, Zheng XF, Brown EJ, Schreiber SL
functional complementation of mutant firefly (1995) Identification of an 11-kDa FKBP12-
luciferases. Anal Chem 85(16):79357940. rapamycin-binding domain within the 289-
doi:10.1021/ac4016825 kDa FKBP12-rapamycin-associated protein
2. Kurihara M, Ohmuro-Matsuyama Y, Ayabe K, and characterization of a critical serine resi-
Yamashita T, Yamaji H, Ueda H (2016) Ultra due. Proc Natl Acad Sci U S A 92(11):
sensitive firefly luciferase-based protein-protein 49474951
interaction assay (FlimPIA) attained by hinge 10. Chiu MI, Katz H, Berlin V (1994) RAPT1, a
region engineering and optimized reaction mammalian homolog of yeast Tor, interacts
conditions. Biotechnol J11(1):9199. with the FKBP12/rapamycin complex. Proc
doi:10.1002/biot.201500189 Natl Acad Sci U S A 91(26):1257412578
3. Ohmuro-Matsuyama Y, Hara Y, Ueda H 11. Branchini BR, Southworth TL, Murtiashaw
(2014) Improved protein-protein interaction MH, Wilkinson SR, Khattak NF, Rosenberg
assay FlimPIA by the entrapment of luciferase JC, Zimmer M (2005) Mutagenesis evidence
conformation. Anal Chem 86(4):20132018. that the partial reactions of firefly biolumines-
doi:10.1021/ac403065v cence are catalyzed by different conformations
4. Kitayama A, Yoshizaki H, Ohmiya Y, Ueda H, of the luciferase C-terminal domain.
Nagamune T (2003) Creation of a thermosta- Biochemistry 44(5):13851393. doi:10.1021/
ble firefly luciferase with pH-insensitive lumi- bi047903f
nescent color. Photochem Photobiol 12. Gulick AM (2009) Conformational dynamics
77(3):333338 in the Acyl-CoA synthetases, adenylation
5. Ayabe K, Zako T, Ueda H (2005) The role of domains of non-ribosomal peptide synthetases,
firefly luciferase C-terminal domain in efficient and firefly luciferase. ACS Chem Biol
coupling of adenylation and oxidative steps. 4(10):811827. doi:10.1021/cb900156h
FEBS Lett 579(20):43894394. 13. Fujii H, Noda K, Asami Y, Kuroda A, Sakata
doi:10.1016/j.febslet.2005.07.004 M, Tokida A (2007) Increase in biolumines-
6. Viviani VR, Ohmiya Y (2006) Bovine serum cence intensity of firefly luciferase using genetic
albumin displays luciferase-like activity in pres- modification. Anal Biochem 366(2):131136.
ence of luciferyl adenylate: insights on the origin doi:10.1016/j.ab.2007.04.018
of protoluciferase activity and bioluminescence 14. White PJ, Squirrell DJ, Arnaud P, Lowe CR,
colours. Luminescence 21(4):262267. Murray JA (1996) Improved thermostability of
doi:10.1002/bio.916 the North American firefly luciferase: satura-
7. Morton RA, Hopkins TA, Seliger HH (1969) tion mutagenesis at position 354. Biochem
The spectroscopic properties of firefly luciferin J319(Pt 2):343350
and related compounds. An approach to prod- 15. Branchini BR, Murtiashaw MH, Magyar RA,
uct emission. Biochemistry 8(4):15981607 Anderson SM (2000) The role of lysine 529, a
8. Brown EJ, Albers MW, Shin TB, Ichikawa K, conserved residue of the acyl-adenylate-
Keith CT, Lane WS, Schreiber SL (1994) A forming enzyme superfamily, in firefly luciferase.
mammalian protein targeted by G1-arresting Biochemistry 39(18):54335440
Chapter 9
Abstract
Ataxia telangiectasia mutated (ATM) is a serine/threonine kinase critical to the cellular DNA-damage
response, including DNA double-strand breaks (DSBs). ATM activation results in the initiation of a complex
cascade of events facilitating DNA damage repair, cell cycle checkpoint control, and survival. Traditionally,
protein kinases have been analyzed invitro using biochemical methods (kinase assays using purified pro-
teins or immunological assays) requiring a large number of cells and cell lysis. Genetically encoded biosen-
sors based on optical molecular imaging such as fluorescence or bioluminescence have been developed to
enable interrogation of kinase activities in live cells with a high signal to background. We have genetically
engineered a hybrid protein whose bioluminescent activity is dependent on the ATM-mediated phosphoryla-
tion of a substrate. The engineered protein consists of the split luciferase-based protein complementation pair
with a CHK2 (a substrate for ATM kinase activity) target sequence and a phospho-serine/threonine-binding
domain, FHA2, derived from yeast Rad53. Phosphorylation of the serine residue within the target sequence
by ATM would lead to its interaction with the phospho-serine-binding domain, thereby preventing comple-
mentation of the split luciferase pair and loss of reporter activity. Bioluminescence imaging of reporter
expressing cells in cultured plates or as mouse xenografts provides a quantitative surrogate for ATM kinase
activity and therefore the cellular DNA damage response in a noninvasive, dynamic fashion.
Key words ATM, Bioluminescence, Complementation, In vivo, Kinase activity, Live cell, Molecular
imaging, Reporter, Split-luciferase
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_9, Springer Science+Business Media LLC 2017
131
132 Shyam Nyati et al.
Table 1
Luciferase complementation-based reporters for imaging of kinase activities
Phospho
peptide-binding
Kinase Substrate Peptide sequence domain Reference
AKT FOXO4/AFX1 QSRPRSCTWPLPRPEKKK FHA2 [9]
ATM CHK2 LETVSTQELYSI FHA2 [12]
EGFR EPS15 KPANFSAYPSEEDMIE SH2 [2]
FADD KINASES FADD QNRSGAMSPMSWNSDASTSEAS FHA2 [3]
GSK3/CKI -CATENIN SYLDSGIHSGATTTAPSLSG FHA2 [4]
c-MET PYK2 LSESCSIESDIYAEIPDETLR SH2 [10]
TGFR SMAD2 LTQMGSPSVRCSSMS FHA2 [6]
2 Materials
2.2 Cell Culture 1. HEK293T cells or other readily transfectable cell lines.
2. Desired cell line(s) for biologic question of interest (i.e.,
D54, U87).
3. Fetal bovine serum (FBS).
4. Complete growth medium with FBS: Growth media with 10%
FBS, and 1% penicillin/streptomycin.
5. Serum-free medium: Growth media without FBS and penicillin/
streptomycin.
6. Trypsinization medium: 0.05% Trypsin-EDTA.
7. 1000 penicillin stock solutions: 10,000 Units/mL penicillin.
8. 1000 streptomycin stock solution: 10mg/mL streptomycin.
9. 1000 geneticin/G418 stock solution: 50mg/mL geneticin/
G418.
Molecular Imaging of ATM Kinase Activity 135
2.4 Animal Imaging 1. Appropriate mouse strain for desired experimental system such
as immunocompromised mice (nude, SCID, or NSG) for
human tumor xenografts.
2. Optional: Small animal shaver such as Wahl trimmer.
3. 40mg/mL luciferin stock in PBS, store in tightly sealed dark
tubes at 20 or 80C.
4. 2830 gauge insulin syringe for intra-peritoneal (IP) luciferin
injection in mice.
5. Bioluminescence imaging instrument (IVIS or similar instrument)
with a heated platform and isoflurane anesthesia injection and
controller systems.
6. Additional accessories such as nose cones, animal partitions,
black paper sheets, ear tags, markers, 70% alcohol, and 10%
bleach or similar solution for disinfecting bench surfaces.
136 Shyam Nyati et al.
3 Methods
3.1 Construct Firefly 1. Select a substrate such as CHK2 and determine the length of
Luciferase the substrate sequence that can be used for the construction of
Complementation- the reporter (see Note 1). We typically select 1220 amino acid
Based ATM kinase long substrate sequences with the target residue/s at the center
Activity Reporter of the sequence where possible (Table 1). For the construction
of the ATM kinase reporter (ATMR), we selected a 12-residue
sequence derived from CHK2 (Figs. 1 and 2).
2. Add a 57 amino acid long linker sequence at both the ends of
the substrate sequence. We typically use GGSGG as the linker
in our kinase reporters. For Ser/Thr kinases, attach a phospho-
peptide-binding domain such as FHA2 (residues 420582)
[32]. For Tyr kinases, attach a SH2 domain (residue 374465
of mouse shc2 [33, 34]). Use appropriate N-terminal (N-Luc)
and C-terminal (C-Luc) firefly luciferase fragment pairs [19] at
the flanks.
Fig. 1 The DNA-coding sequence and translated amino acid sequence for all the domains of the ATM kinase
activity reporter. In frame short linker sequences (linker) inserted between each functional domain provide
flexibility for the intramolecular domain interaction in the chimeric reporter molecule. N-Luc denotes amino
acids 1416 of firefly luciferase and C-Luc denotes amino acids 398550. The target peptide sequence was
derived from the CHK2 coding sequence (amino acids 6374). The Ser/Thr phospho-peptide-binding domain
(FHA2) comprises amino acids 420522 of Rad53P protein
Molecular Imaging of ATM Kinase Activity 137
Fig. 2 The components and functional basis of the ATM kinase activity reporter.
(a) The ATM reporter consists of a phospho Ser/Thr-binding domain (FHA2), sub-
strate peptide (CHK2), and split firefly luciferase. The substrate sequence is
flanked by short linker sequences at either end. The functional basis of the
reporter is demonstrated in part figure (b). In the presence of ATM kinase activity,
the CHK2 target peptide is phosphorylated, resulting in interaction with the FHA2
domain, producing stearic constraints that inhibit functional reconstitution of the
luciferase. In the absence of ATM kinase activity such as by small molecule
inhibitors, siRNA-mediated knockdown (of ATM), or over-expression of phospha-
tases, the CHK2 consensus sequence is hypo-phosphorylated, allowing for lucif-
erase enzyme reconstitution and increased bioluminescent activity
Fig. 3 Firefly complementation-based live cell assay for noninvasive monitoring of ATM kinase activity. (a) D54
cells stably expressing the ATM kinase activity reporter (ATMR) were plated in black-walled 96-well plates
(5000 cells/well). Cells were incubated with mock (DMSO) or an increasing concentration of ATM kinase inhibi-
tor KU-55933, which increased the signal in a dose-dependent way. (b) A representative image of the biolumi-
nescence acquired in response to various concentrations of KU-55933 is shown. ROI in a grid is created and
overlaid in the pseudocolored image to quantitate the photons emitted. Scale bar shows photon flux in pseu-
docolor with blue as the lowest and red as the highest counts. (c) D54-ATMR cells plated in white-walled
96-well plates and treated as described above and read on Envision plate reader
3.3 In Vivo Imaging 1. D54-ATMR cells are expanded, trypsinized, and suspended in
ofATM Kinase Activity serum-free media at 40106 cells/mL. 50L of this suspen-
sion is injected into each flank (2106 cells) in nude mice
using a 22-gauge needle. We usually wait until the tumor
reaches 60100mm3 size (34weeks) before starting the
experiments.
2. We acquire baseline bioluminescence measurements 36h
before starting the treatment (Fig. 4a). Each mouse is injected
with 100L d-luciferin (4mg/mL stock prepared in sterile
140 Shyam Nyati et al.
Fig. 4 In vivo measurement of ATM kinase activity in mouse tumor xenograft model. (a) CD-1 nude mice harboring
D54-ATMR WT tumor xenografts were injected with luciferin and bioluminescence was acquired as described
3h before treatments. (b) The animals were injected with KU-55933 (25mg/kg) or vehicle control (DMSO) and
bioluminescence was acquired 1, 4, 8, and 24h posttreatment. The ATM reporter fold activation upon ATM
inhibition is plotted over mock treatment. (c) Similarly, mouse harboring D54-ATMR WT tumor xenografts
were whole body irradiated with 5Gy of radiation or sham irradiated and bioluminescence was measured for
up to 24h. About 70% decrease in the reporter activity was observed 8h post irradiation
4 Notes
16. Due to the sensitivity of the imaging system, one typically gets
some background bioluminescence in nude and SCID mice. It is
important to shave and NAIR the mice if using a mouse strain
with hair to reduce the background and determine the correct
size, shape, and position of a ROI.
17. Bioluminescence data acquired in a mouse xenograft model
should be validated by biochemical methods such as Western
blotting or immunohistochemistry (IHC). For validation of
the bioluminescence data for ATMR, tumor tissue should be
analyzed with pATM and pCHK2 antibodies after control,
KU-55933, KU-60019, or radiation treatments.
Acknowledgments
References
1. Bhojani MS, Nyati S, Rao HR, Rehemtulla A Res 17(23):74247439. doi:10.1158/1078-
(2010) Molecular imaging in lung cancer 432.Ccr-11-1248
0
metastases. In: Lung cancer metastasis. 7. Williams TM, Nyati S, Ross BD, Rehemtulla A
Springer, NewYork, pp267287 (2013) Molecular imaging of the ATM kinase
2. Khan AP, Contessa JN, Nyati MK, Ross BD, activity. Int JRadiat Oncol Biol Phys 86(5):969
Rehemtulla A (2011) Molecular imaging of epi- 977. doi:10.1016/j.ijrobp.2013.04.028 S0360-
dermal growth factor receptor kinase activity. 3016(13)00457-4 [pii]
Anal Biochem 417(1):5764. doi:10.1016/j. 8. Zhang L, Bhojani MS, Ross BD, Rehemtulla A
ab.2011.05.040 (2008) Molecular imaging of protein kinases.
3. Khan AP, Schinske KA, Nyati S, Bhojani MS, Cell Cycle 7(3):314317
Ross BD, Rehemtulla A (2010) High- 9. Zhang L, Lee KC, Bhojani MS, Khan AP,
throughput molecular imaging for the identifi- Shilman A, Holland EC, Ross BD, Rehemtulla
cation of FADD kinase inhibitors. JBiomol A (2007) Molecular imaging of Akt kinase
Screen 15(9):10631070 activity. Nat Med 13(9):11141119.
4. Nyati S, Ranga R, Ross BD, Rehemtulla A, doi:10.1038/nm1608
Bhojani MS (2010) Molecular imaging of gly-
10. Zhang L, Virani S, Zhang Y, Bhojani MS,
cogen synthase kinase-3 and casein kinase-1 Burgess TL, Coxon A, Galban CJ, Ross BD,
kinases. Anal Biochem 405(2):246254 Rehemtulla A (2011) Molecular imaging of
5. Nyati S, Ross BD, Rehemtulla A, Bhojani MS c-Met tyrosine kinase activity. Anal Biochem
(2010) Novel molecular imaging platform for 412(1):18. doi:10.1016/j.ab.2011.01.028
monitoring oncological kinases. Cancer Cell
11. Johnson SA, You Z, Hunter T (2007)
Int 10:23. doi:10.1186/1475-2867-10-23 Monitoring ATM kinase activity in living cells.
6. Nyati S, Schinske K, Ray D, Nyati M, Ross BD, DNA Repair 6(9):12771284. doi:10.1016/j.
Rehemtulla A (2011) Molecular imaging of dnarep.2007.02.025
TGF beta-induced smad2/3 phosphorylation
12. Nyati S, Schinske-Sebolt K, Pitchiaya S,
reveals a role for receptor tyrosine kinases in Chekhovskiy K, Chator A, Chaudhry N, Dosch
modulating TGF beta signaling. Clin Cancer J, Van Dort ME, Varambally S, Kumar-Sinha
Molecular Imaging of ATM Kinase Activity 145
C, Nyati MK, Ray D, Walter NG, Yu H, Ross 23. Choi S, Srivas R, Fu KY, Hood BL, Dost B,
BD, Rehemtulla A (2015) The kinase activity Gibson GA, Watkins SC, Van Houten B,
of the Ser/Thr kinase BUB1 promotes TGF- Bandeira N, Conrads TP, Ideker T, Bakkenist
beta signaling. Sci Signal 8(358):ra1. CJ (2012) Quantitative proteomics reveal ATM
doi:10.1126/scisignal.2005379 kinase-dependent exchange in DNA damage
13. Schinske KA, Nyati S, Khan AP, Williams TM, response complexes. JProteome Res
Johnson TD, Ross BD, Toms RP, Rehemtulla 11(10):49834991. doi:10.1021/pr3005524
A (2011) A novel kinase inhibitor of FADD 24. Lavin MF, Kozlov S (2007) ATM activation
phosphorylation chemosensitizes through the and DNA damage response. Cell Cycle
inhibition of NF-B.Mol Cancer Ther 6(8):931942
10(10):18071817 25. Mu JJ, Wang Y, Luo H, Leng M, Zhang J,
14. McCaffrey A, Kay MA, Contag CH (2003) Yang T, Besusso D, Jung SY, Qin J(2007) A
Advancing molecular therapies through invivo proteomic analysis of ataxia telangiectasia-
bioluminescent imaging. Mol Imaging mutated (ATM)/ATM-Rad3-related (ATR)
2(2):7586 substrates identifies the ubiquitin-proteasome
15. Contag CH, Bachmann MH (2002) Advances system as a regulator for DNA damage check-
in invivo bioluminescence imaging of gene points. JBiol Chem 282(24):1733017334.
expression. Annu Rev Biomed Eng doi:10.1074/jbc.C700079200
4:235260 26. Kim ST, Lim DS, Canman CE, Kastan MB
16. Choy G, Choyke P, Libutti SK (2003) Current (1999) Substrate specificities and identification
advances in molecular imaging: noninvasive of putative substrates of ATM kinase family
invivo bioluminescent and fluorescent optical members. JBiol Chem 274(53):3753837543
imaging in cancer research. Mol Imaging 27. Sancar A, Lindsey-Boltz LA, Kang TH,
2(4):303312 Reardon JT, Lee JH, Ozturk N (2010)
17. Greer LF 3rd, Szalay AA (2002) Imaging of Circadian clock control of the cellular response
light emission from the expression of lucifer- to DNA damage. FEBS Lett 584(12):2618
ases in living cells and organisms: a review. 2625. doi:10.1016/j.febslet.2010.03.017
Luminescence 17(1):4374 28. Stracker TH, Roig I, Knobel PA, Marjanovic
18. Stacer AC, Nyati S, Moudgil P, Iyengar R, M (2013) The ATM signaling network in
Luker KE, Rehemtulla A, Luker GD (2013) development and disease. Front Genet 4:37.
NanoLuc reporter for dual luciferase imag- doi:10.3389/fgene.2013.00037
ing in living animals. Mol Imaging 29. Weber AM, Ryan AJ (2015) ATM and ATR as
12(7):113 therapeutic targets in cancer. Pharmacol Ther
19. Luker KE, Smith MC, Luker GD, Gammon 149:124138. doi:10.1016/j.
ST, Piwnica-Worms H, Piwnica-Worms D pharmthera.2014.12.001
(2004) Kinetics of regulated protein-protein 30. Shiotani B, Zou L (2009) Single-stranded
interactions revealed with firefly luciferase DNA orchestrates an ATM-to-ATR switch at
complementation imaging in cells and living DNA breaks. Mol Cell 33(5):547558.
animals. Proc Natl Acad Sci U S A doi:10.1016/j.molcel.2009.01.024
101(33):1228812293 31. Kozlov S, Gueven N, Keating K, Ramsay J,
20. Bakkenist CJ, Kastan MB (2003) DNA dam- Lavin MF (2003) ATP activates ataxia-
age activates ATM through intermolecular telangiectasia mutated (ATM) invitro.
autophosphorylation and dimer dissociation. Importance of autophosphorylation. JBiol
Nature 421(6922):499506. doi:10.1038/ Chem 278(11):93099317
nature01368 32. Durocher D, Jackson SP (2002) The FHA
21. Bensimon A, Schmidt A, Ziv Y, Elkon R, Wang domain. FEBS Lett 513(1):5866
SY, Chen DJ, Aebersold R, Shiloh Y (2010) 33. Filippakopoulos P, Muller S, Knapp S (2009)
ATM-dependent and -independent dynamics SH2 domains: modulators of nonreceptor tyro-
of the nuclear phosphoproteome after DNA sine kinase activity. Curr Opin Struct Biol
damage. Sci Signal 3(151):rs3. doi:10.1126/ 19(6):643649. doi:10.1016/j.sbi.2009.10.001
scisignal.2001034 34. Schlessinger J(1994) SH2/SH3 signaling pro-
22. Bhatti S, Kozlov S, Farooqi AA, Naqi A, Lavin teins. Curr Opin Genet Dev 4(1):2530
M, Khanna KK (2011) ATM protein kinase: 35. Frosina G (2009) DNA repair and resistance of
the linchpin of cellular defenses to stress. Cell gliomas to chemotherapy and radiotherapy. Mol
Mol Life Sci 68(18):29773006. doi:10.1007/ Cancer Res 7(7):989999. doi:10.1158/1541-
s00018-011-0683-9 7786.MCR-09-0030
Part IV
-lactamase Sensors
Chapter 10
Abstract
Antibody-based molecular switches that are able to recognize a range of exogenous antigens can be highly
useful as a versatile biosensor. However, regulating the catalytic activity of enzymes by antibodies is still
hard to achieve. Here, we describe a design method of unique antibody variable region Fv introduced with
two circular permutations, called Clampbody. By tethering the Clampbody to a circularly permuted
TEM-1 -lactamase (BLA), we successfully constructed a genetically encoded molecular switch Cbody-cpBLA
that shows antigen-dependent catalytic activity.
Key words TEM-1 -lactamase, Antibody variable region, Circular permutation, Allosteric regulation,
Immunosensor
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_10, Springer Science+Business Media LLC 2017
149
150 Hiroto Iwai et al.
Fig. 1 Creation of Clampbody and its fusion to cpBLA. (a) Schematic structure of single chain Clampbody (sc-
Cbody). cpVH and cpVL chains are shown in magenta and cyan, respectively. The (G4S)3 linkers connecting their
native N- and C-termini are drawn as dashed lines. Two cysteine residues were inserted at the N- and C-termini
of cpVH to promote correct folding via disulfide linkage. The SG4 linker connecting cpVH and cpVL is drawn as
dotted line. (b) Schematic structure of Cbody-cpBLA, in which the structure of cpBLA (PDB code 4DXB) is
shown in green. (c, d) Expression and purification of Cbody-cpBLA. (c) CBB-stained SDSPAGE. (1) MW
marker, (2) concentrated culture supernatant, (3) soluble fraction from the cell lysate, (4) insoluble fraction
from the same, (5) solubilized insoluble protein, (6) purified and refolded protein. (d) Western blot to detect the
His tag. The lanes are the same as in (c). The bands for Cbody-cpBLA are indicated by arrows. Reproduced
from Iwai etal. [10] with permission from American Chemical Society
Regulation of -Lactamase Activity by Clampbody 151
2 Materials
VLNotfor 5-CGTGCGGCCGCCCGTTTTATTTCCAGC-3
NcoCcpVHrev 5-GATGGCCATGGCCGGACAAGGCCTTGAATGGATC-3
VHG4Sfor 5-CGACCCGCCACCGCCGCTGCCACCTCCGCCTGAACCGCCTCCACCGCTGGAGACGGTGACCGTGGTC-3
G4S3VHrev 5-GGTGGAGGCGGTTCAGGCGGAGGTGGCAGCGGCGGTGGCGGGTCGGAGGTACAGCTGGAGGAG-3
cpVHCSpefor 5-CGGACTAGTACATGGGCTCTGTTTGACCCAGTG-3
AgecpVLrev 5-GATACCGGTGGCCAGTCTCCAAAGCTCCTG-3
VLG4Sfor 5-AGATCCGCCACCGCCAGAGCCACCTCCGCCTGAACCGCCTCCACCCCGTTTTATTTCCAGCTTGG-3
G4S3VLrev 5-GGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCTGATATTGTGCTGACCCAATCT-3
cpVLNotfor 5-CGTGCGGCCGCTGGCTTCTGCAGGTACCAATG-3
MCScpBLArev 5-CCTCCATGGTACGAGATCTCAATCTCGAGGCAAACTAGTAACAATGAAGCCATACCAAACG-3
cpBLAMCSfor 5-GGGTGCGGCCGCATTGGTCGACATGGGATATCAGAGACCGGTTTTGGCTTCATTCAGCTCCGGT-3
InfVHSpeRG13rev 5-GTCTCCTCAACTAGTTGGTTTATTGCTGATAAATC-3
RG13OL1for 5-GACCACCTCCTGAACCCCAATGCTTAATCAGTGA-3
RG13OL2rev 5-GGTTCAGGAGGTGGTCACCCAGAAACGCTGGTG-3
RG13AgeVLInffor 5-GCACAATATCACCGGTGCCAGCCGGAAGGGCCGA-3
VHBGPEAAAK2Spefor 5-CGGACTAGTCTTGGCAGCCGCCTCTTTAGCCGCGGCTTCGCTCGAGACGGTGACCGTG-3
AgeEAAAK2EcoVLrev 5-GATACCGGTGAAGCCGCGGCTAAAGAGGCGGCTGCCAAGGATATCGTGCTGACCCAATC-3
TSG4TGrev 5-CTAGTGGAGGTGGCGGTA-3
TSG4TGfor 5-CCGGTACCGCCACCTCCA-3
Regulation of -Lactamase Activity by Clampbody 153
2.2 Protein 1. SHuffle T7 express lysY competent cells (New England Biolabs).
Expression 2. LB medium: 1% tryptone, 0.5% yeast extract, 0.5% NaCl, pH7.0.
3. LBK medium: LB containing antibiotics (50g/mL kanamycin).
4. Agar.
5. 1M Isopropyl--d-thiogalactopyranoside (IPTG).
6. Supersonic homogenizer (e.g., VP-15S Taitec, Saitama, Japan).
7. 2-mercaptoethanol.
8. 0.5M EDTA, pH8.0.
9. Guanidium hydrochloride (Gdn-HCl).
10. TALON extraction buffer: 300mM NaCl, 50mM sodium
phosphate, adjusted to pH7.0.
11. TALON metal affinity resin and TALON disposable gravity
column (Clontech, CA).
12. TALON elution buffer: TALON extraction buffer supplement
with 200mM imidazole.
13. Pierce BCA protein assay kit for determining protein con-
centrations (Thermo Fisher Scientific, Waltham, MA).
2.4 Western Blot 1. SDS-PAGE gradient gels (5~20%) (e.g., e-PAGEL, ATTO,
ofClampbodies Tokyo, Japan).
2. SDS running buffer: 25mM TrisHCl, 192mM l-glycine,
1g/L sodium dodecyl sulfate.
3. PVDF membrane (e.g., Clear Blot Membrane P plus, ATTO).
154 Hiroto Iwai et al.
2.6 Enzyme Assays 1. Black 96-well microplates (e.g., Corning Costar 3693).
forClampbodies 2. Transparent 96-well microplates (e.g., Greiner 655061).
3. Dimethyl sulfoxide (DMSO).
4. Fluorocillin Green 495/525 -Lactamase Substrate, soluble
product (Thermo Fisher Scientific, Waltham, MA). 1mM
stock solution in DMSO can be stored for several months
at 30C.
5. Nitrocefin (e.g., Calbiochem, Darmstadt, Germany). 20mM
stock solution in DMSO can be stored for several months
at 30C.
6. PBS containing 1% Triton X-100.
7. PBS containing 3M urea.
8. PBS containing 20mg/mL bovine serum albumin (BSA)
(e.g., Sigma-Aldrich, St. Lois, MO).
9. A fluorescence microplate reader (e.g., GENios Pro Tecan, San
Jose, CA).
10. A microplate reader (e.g., SH-1000, Corona Electric, Hitachi,
Ibaraki, Japan).
Regulation of -Lactamase Activity by Clampbody 155
3 Methods
3.2 Construction Make a construct for a circularly permuted VH (cpVH), whose new
ofthecpVH Gene termini are generated between Pro41 and Gly42 (as described
according to Kabat numbering) while the native N- and C-termini
are connected via a flexible linker (G4S)3. Considering the possible
lesser stability of VH fragment, two Cys residues are added at the
N- and C-termini of cpVH to promote the correct folding and
increased stability through the disulfide bridge.
1. Amplify the DNA fragment encoding Gly42 to Ser113 of VH
with a linker peptide (G4S)3 at the C-terminus by PCR using
the primers NcoCcpVHrev and VHG4Sfor, pET26/Fv-cpBLA
as a template, and KOD FX DNA polymerase.
2. Amplify the DNA fragment encoding Glu1 to Pro41, described
according to Kabat numbering, with the linker at the
N-terminus by PCR using G4S3VHrev and cpVHCSpefor as
primers.
3. Purify these fragments by Wizard SV Gel and PCR Clean-Up
System.
4. Perform overlap-extension PCR with the gel-purified PCR
products (20ng each) and KOD FX for 15cycles without
primers and 35cycles with NcoCcpVHrev and cpVHCSpefor
primers.
5. Purify these fragments by Wizard SV Gel and PCR Clean-Up
System.
6. Ligate into pCR4Blunt-TOPO.
156 Hiroto Iwai et al.
3.3 Construction Similarly, make a construct for the circularly permuted VL (cpVL)
ofthecpVL Gene with new termini between Pro40 and Gly41. In this case, two Cys
residues at the N- and C-termini of cpVL are not added to avoid
unfavorable interdomain crosslinking at the later stage.
1. Amplify the DNA fragment encoding Gly41 to Arg108 of VL
with a linker peptide (G4S)3 at the C-terminus by PCR using
the primers AgecpVLrev and VLG4Sfor, pET26/Fv-cpBLA as
a template, and KOD FX DNA polymerase.
2. Amplify the DNA fragment encoding Asp1 to Pro40 with the
linker at the N-terminus by PCR with G4S3VLrev and cpVL-
Notfor as primers.
3. Purify these fragments by Wizard SV Gel and PCR Clean-Up
System.
4. Perform overlap-extension PCR with the gel-purified PCR
products (20ng each) and KOD FX DNA polymerase for
15cycles without primers and 35cycles with AgecpVLrev and
cpVLNotfor primers.
5. Purify these fragments by Wizard SV Gel and PCR Clean-Up
System.
6. Ligate into pCR4Blunt-TOPO.
3.4 Construction To make a fusion protein comprising Clampbody and cpBLA, first
ofthecpBLA(RG13) make a construct for the cpBLA with known 3D structure that
Gene Guntas etal. reported [23, 24].
1. Amplify the DNA fragment encoding Trp227 to Trp286 of
TEM-1 -lactamase with a short peptide linker (GSGGS) at
the C-terminus by PCR using the primers InfVHSpeRG13rev
and RG13OL1for, pIT2/31IJ3 as a template, and PrimeSTAR
Max DNA Polymerase.
2. Amplify the fragment encoding His24 to Gly226 with the
linker at the N-terminus by PCR with RG13OL2rev and
RG13AgeVLInffor as primers.
3. Purify these fragments by Wizard SV Gel and PCR Clean-Up
System.
4. With the gel-purified PCR products (20ng each), perform
overlap-extension PCR with PrimeSTAR Max DNA
Polymerase for 15cycles without primers and 35cycles with
InfVHSpeRG13rev and RG13AgeVLInffor primers.
5. Purify these fragments by Wizard SV Gel and PCR Clean-Up
System.
3.5 Construction Make a construct for a fusion protein comprising Clampbody and
ofCbody-cpBLA cpBLA by connecting cpVH and cpVL to the N- and C-termini of
Fusion Protein cpBLA [7] with a minimum number of amino acid residues
Expression Vectors (Clampbody-cpBLA, Cbody-cpBLA) (Fig. 1b, c).
Regulation of -Lactamase Activity by Clampbody 157
3.6 Construction Prepare a single-chain protein construct where cpVH and cpVL are
ofscCb Expression connected by a short linker G4S (single-chain Clampbody, scCb)
Vectors to evaluate the antigen-binding activity of the Clampbody.
1. Anneal TSG4TGrev and TSG4TGfor in Tris-EDTA buffer to
prepare the DNA fragment encoding the SG4 linker.
2. Insert the fragment into pClamp-cpBLA digested with AgeI
and SpeI, resulting in pClamp-SG4.
3.7 Expression When Clampbody and Cbody-cpBLA are expressed in E. coli, the
and Purification majority of the expressed proteins will accumulate in inclusion
ofClampbodies [6, 25] body even if cultured at lower temperature. In such cases, perform
the following procedures to solubilize the insoluble Clampbodies.
1. Transform SHuffle T7 Express lysY competent cells with
expression vectors (see Note 1).
158 Hiroto Iwai et al.
3.9 Western Blotting After the preparation of Clampbodies, perform SDS-PAGE and
Western blotting to confirm the purity and the amount of the
proteins (Fig. 1c, d).
1. Analyze the proteins by SDS-PAGE using a 520% gradient
gel and SDS running buffer.
2. Transfer the protein from the gel to a PVDF membrane with
Transfer buffer.
3. Incubate the membrane in TBST-S at 4C overnight.
4. Wash membrane three times with TBST.
5. Incubate the membrane with HRP-conjugated anti-His6 anti-
body 4000-times diluted in TBST at 4C for 1h.
6. Wash membrane three times with TBST.
7. Soak membrane in Amersham ECL Prime as per manufactur-
ers instructions.
8.
Detect the luminescence using a LAS-4000 mini
Luminoimager.
160 Hiroto Iwai et al.
Fig. 2 Antigen-binding activity of Fv, sc-Cbody, and Cbody-cpBLA. (a) Binding of parental Fv (red triangle) and
sc-Cbody (blue circle) to the biotinylated BGP-C11 antigen immobilized at the indicated concentrations. (b)
Binding of Cbody-cpBLA to the biotinylated BGP-C11 immobilized at 0.9M. Blue and red bars indicate the
binding signals to antigen-positive and negative wells, respectively. Averages of three samples with an error
bar of 1 SD are shown. Reproduced from Iwai etal. [10] with permission from American Chemical Society
4 Notes
Fig. 4 S-V plots for BLA and Cbody-cpBLA. (a) 2nM BLA or (b) 70nM Cbody-cpBLA was added with nitrocefin
substrate in the presence or absence of antigen 1M BGP-C10, in PBS containing 1.2M urea, incubated at
30C, and read for absorbance. Background absorbance of the samples without BLA or Cbody-cpBLA was
subtracted for each condition. Initial velocities are plotted against the substrate concentration. Averages of
three samples with an error bar for 1 SD are shown. Fitted curves based on the Michaelis-Menten equation are
shown for each condition. Statistical analysis was conducted using the two-tailed unpaired Students t-test.
() p<0.01. Reproduced from Iwai etal. [10] with permission from American Chemical Society
Acknowledgment
References
1. Stains CI, Furman JL, Porter JR, Rajagopal S, Stabilization of a recombinant Fv fragment by
Li Y, Wyatt RT, Ghosh I (2010) A general base-loop interconnection and V(H)-V(L) per-
approach for receptor and antibody-targeted mutation. JMol Biol 268:107117
detection of native proteins utilizing split- 12. Motlagh HN, Wrabl JO, Li J, Hilser VJ (2014)
luciferase reassembly. ACS Chem Biol The ensemble nature of allostery. Nature
5:943952 508:331339
2. Alderson RF, Toki BE, Roberge M, Geng W, 13. Choi JH, San A, Ostermeier M (2013) Non-
Basler J, Chin R, Liu A, Ueda R, Hodges D, allosteric enzyme switches possess larger
Escandon E, Chen T, Kanavarioti T, Bab L, effector-induced changes in thermodynamic
Senter PD, Fox JA, Schellenberger V (2006) stability than their non-switch analogs. Protein
Characterization of a CC49-based single-chain Sci 22:475485
fragment--lactamase fusion protein for 14. Choi JH, Ostermeier M (2015) Rational
antibody-directed enzyme prodrug therapy design of a fusion protein to exhibit disulfide-
(ADEPT). Bioconjug Chem 17:410418 mediated logic gate behavior. ACS Synth Biol
3. Schumacher FF, Sanchania VA, Tolner B, 4:400406
Wright ZVF, Ryan CP, Smith MEB, Ward JM, 15. Choi JH, Laurent AH, Hilser VJ, Ostermeier
Caddick S, Kay CWM, Aeppli G, Chester KA, M (2015) Design of protein switches based on
Baker JR (2013) Homogeneous antibody frag- an ensemble model of allostery. Nat Commun
ment conjugation by disulfide bridging intro- 6:6968
duces spinostics. Sci Rep 3:1525
16. Ohmuro-Matsuyama Y, Chung CI, Ueda H
4. Yokozeki T, Ueda H, Arai R, Mahoney W, (2013) Demonstration of protein-fragment
Nagamune T (2002) A homogeneous non- complementation assay using purified firefly
competitive immunoassay for the detection of luciferase fragments. BMC Biotechnol 13:31
small haptens. Anal Chem 74:25002504
17. Ohiro Y, Ueda H, Shibata N, Nagamune T
5. Ueda H, Yokozeki T, Arai R, Tsumoto K, (2007) Enhanced fluorescence resonance
Kumagai I, Nagamune T (2003) An optimized energy transfer immunoassay with improved
homogeneous noncompetitive immunoassay sensitivity based on the Fab-based immuno-
based on the antigen-driven enzymatic com- conjugates. Anal Biochem 360:266272
plementation. JImmunol Methods
279(12):209218 18. Chung CI, Makino R, Dong J, Ueda H (2015)
Open flower fluoroimmunoassay: a general
6. Kojima M, Iwai H, Dong J, Lim S-L, Ito S, method to make fluorescent protein-based
Okumura K, Ihara M, Ueda H (2011) immunosensor probes. Anal Chem 87:
Activation of circularly permutated -lactamase 35133519
tethered to antibody domains by specific small
molecules. Bioconjug Chem 22:633641 19. Ohmuro-Matsuyama Y, Hara Y, Ueda H
(2014) Improved protein-protein interaction
7. Guntas G, Mitchell SF, Ostermeier M (2004) assay FlimPIA by the entrapment of luciferase
A Molecular switch created by invitro conformation. Anal Chem 86:20132018
recombination of nonhomologous genes.
Chem Biol 11:14831487 20. Kurihara M, Ohmuro-Matsuyama Y, Ayabe K,
Yamashita T, Yamaji H, Ueda H (2016) Ultra
8. Guntas G, Mansell TJ, Kim JR, Ostermeier M sensitive firefly luciferase-based protein-protein
(2005) Directed evolution of protein switches interaction assay (FlimPIA) attained by hinge
and their application to the creation of ligand- region engineering and optimized reaction
binding proteins. Proc Natl Acad Sci U S A conditions. Biotechnol J11:9199
102:1122411229
21. de Wildt RM, Mundy CR, Gorick BD,
9. Nicholes N, Date A, Beaujean P, Hauk P, Tomlinson IM (2000) Antibody arrays for
Kanwar M, Ostermeier M (2016) Modular high-throughput screening of antibody-
protein switches derived from antibody antigen interactions. Nat Biotechnol 18:
mimetic proteins. Protein Eng Des Sel 989994
29:7785
22. Lim S-L, Ichinose H, Shinoda T, Ueda H
10. Iwai H, Kojima-Misaizu M, Dong J, Ueda H (2007) Noncompetitive detection of low
(2016) Creation of a ligand-dependent molecular weight peptides by open sandwich
enzyme by fusing circularly permuted anti- immunoassay. Anal Chem 79:61936200
body variable region domains. Bioconjug
Chem 27:868873 23. Ke W, Laurent AH, Armstrong MD, Chen Y,
Smith WE, Liang J, Wright CM, Ostermeier
11. Brinkmann U, di Carlo A, Vasmatzis G, M, van den Akker F (2012) Structure of an
Kurochkina N, Beers R, Lee B, Pastan I (1997) engineered -lactamase maltose binding protein
Regulation of -Lactamase Activity by Clampbody 165
fusion protein: insights into heterotropic 25. Tsumoto K, Shinoki K, Kondo H, Uchikawa
allosteric regulation. PLoS One 7:e39168 M, Juji T, Kumagai I (1998) Highly efficient
24.
Wright CM, Majumdar A, Tolman JR, recovery of functional single-chain Fv frag-
Ostermeier M (2010) NMR characterization ments from inclusion bodies overexpressed in
of an engineered domain fusion between malt- Escherichia coli by controlled introduction of
ose binding protein and TEM1 beta-lactamase oxidizing reagentapplication to a human
provides insight into its structure and allosteric single-chain Fv fragment. JImmunol Methods
mechanism. Proteins 78:14231430 219:119129
Chapter 11
Abstract
Peptide motifs are crucial mediators of protein-protein interactions as well as sites of specific protease activity.
The detection and characterization of these events is therefore indispensable for a detailed understanding
of cellular regulation. Here, we present versatile and modular sensors that allow the user to detect protease
activity and protein-peptide interactions, as well as to screen for inhibitors using chromogenic, fluorescent,
or luminescent output.
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_11, Springer Science+Business Media LLC 2017
167
168 Hui Chin Goh et al.
2 Materials
2.3 Purification 1. Lysis and Binding buffer: 50mM sodium phosphate, 300mM
ofExpressed Protein sodium chloride, 30mM imidazole, pH7.4.
2. Elution buffer: 50mM sodium phosphate, 300mM sodium
chloride, 500mM imidazole, pH7.4.
3. Sonicator or other means of cell lysis.
4. Syringes and 0.45m filter to clarify cell lysate.
5. 1mL Nickel Sepharose His Trap column (GE Healthcare).
6. SDS-PAGE electrophoresis equipment to verify protein
expression and quality.
2.4 Biosensor Assay 1. 96- or 384-well transparent bottom plate (Greiner Bio) for
absorbance reading. For alternative readouts based on fluores-
cence or luminescence, other types of plates are required.
2. Phosphate buffered saline (PBS) as diluent: 10mM Na2HPO4,
2mM KH2PO4, 137mM NaCl, and 2.7mM KCl, pH7.4.
3. 1mM nitrocefin substrate stock solution: 1mg nitrocefin
(Merck) dissolved in 100L DMSO and 1.9mL PBS as per
manufacturers instructions.
4. Multi-well plate reader capable of reading OD at 492nm.
Target protease or target protein binder whose cleavage or
binding site is present in the biosensor linker. By way of exam-
ple, enterokinase (NEB), TEV protease, and anti-HA tag anti-
body have been successfully detected [13].
3 Methods
3.1 Plasmid 1. After the gene coding for Tem1-BLIP (see Note 3) has been
Construction synthesized, it may be used as a standard template for inserting
suitable peptides as required. We generally use custom gene
synthesis to obtain the backbone, but the plasmid may also be
obtained from our lab upon request. For cloning, we typically
use inverse PCR with a reverse primer binding at the 3 end
of the Tem1 ORF and a forward primer binding at the 5 end
of the BLIP ORF while the 5 tails encode the desired peptide
and linker amino acids. Furthermore, the 5 fifteen bases of the
primers are complementary to each other to enable Infusion
cloning. Alternatively, if the sequence of the insert is too long,
the desired plasmid can be constructed by means of serial PCR
using overlapping primers. We frequently employ primers that
have been gel purified, especially if the oligonucleotide is
greater than 40 bases to avoid single-base dropouts and
frameshifts.
2. A typical PCR reaction based on Pfu Turbo polymerase typically
contains in a total volume of 50L (Pfu Turbo polymerase is
172 Hui Chin Goh et al.
3.3 Biosensor 1. The assays are generally carried out at room temperature in a
Assays 384-well transparent bottom plate.
3.3.1 Protease 2. The exact concentration of the sensor and protease or macro-
andMacromolecule- molecular binder must be determined empirically. Before start-
Binding Assay ing the assay, test a range of sensor concentrations with varying
concentrations of protease or macromolecular binder to deter-
mine the point of optimal sensitivity.
3. When setting up multiple reactions, it is desirable to make a
master mix containing the common components. The typical
reaction in a total volume of 25L is set up as follows.
4. Add a suitable volume of PBS that will eventually make up a
total reaction volume of 25L (i.e., we add PBS first to pre-
vent small volumes of other reagents from sticking to the side
of the well or remaining stuck to the pipette tip).
5. Add 2L of diluted sensor to a final concentration of approxi-
mately 5nM and mix with 25L of various dilutions of protease
or macromolecular binder. The final optimal concentration of
components needs to be determined empirically. For enterokinase
or TEV protease, the threshold of detection is approximately in
the mid-picomolar to low-nanomolar range, respectively.
6. Initiate the reaction by adding 57L 1mM nitrocefin
substrate stock solution to a final concentration of 250M
(see Notes 6 and 7).
7. After the addition of nitrocefin, immediately insert the plate
into a plate reader and measure the OD at 492nm every 2min.
174 Hui Chin Goh et al.
3.3.2 Protease 1. The protease exclusion assay is carried out as above with the
ExclusionAssay important exception that the macromolecular binder is added
to the sensor and allowed to bind before the protease is added.
This prevents premature cleavage of the sensor by protease
before the macromolecule has an opportunity to bind and pro-
tect the sensor.
2. The typical reaction is set up as follows (see Note 9):
3. Add a suitable volume of PBS that will eventually make up a total
reaction volume of 25L (see step 4 in Subheading 3.3.1).
4. Add 2L of diluted sensor to a final concentration of approxi-
mately 5nM and mix with 25L of a macromolecular binder.
This should be in excess of the sensor concentration to fully
block all sensor molecules. The exact ratio will depend on the
Kd and should be confirmed empirically. Ideally, these compo-
nents should be part of a master mix.
5. Add 2L of the macromolecular antagonist. The concentra-
tion of the antagonist should be at least as much as the macro-
molecule to allow complete dissociation.
6. After adding the macromolecular binder, incubate for 510min
to allow an equilibrium to be reached (see Notes 10 and 11).
7. Add 2L of protease. The optimal concentration needs to be
determined empirically, e.g., for enterokinase we found
~0.15nM to be suitable.
8. Initiate the enzyme reaction by adding 57L 1mM nitroce-
fin substrate stock solution to a final concentration of 250M
(see Notes 6 and 7).
9. Analyze the reaction by plotting the rate of substrate turnover
against the concentration of the antagonist or blocking
macromolecule.
4 Notes
tion tags like His6-tag on the same side as the inhibitor. This
ensures that if truncated fragments are present in the cell lysate,
it is the inhibitor and not free enzyme which is pulled down.
Free enzyme can lead to a high background.
3. The DNA sequence coding for Tem1-BLIP is given below. For
expression, it may be inserted into pET28a NdeI XhoI sites:
5-aaaaaaCATATGCACCCGGAAACCCTGGTTAAAGTCA
AAGATGCCGAAGACCAGCTGGGTGCACGCGTTGGC
TATATTGAACTGGATCTGAACTCAGGCAAAATCCTG
GAATCGTTTCGTTCTGAAGAACGCTTCCCGATG
AT G T C A A C C T T TA A A G T T C T G C T G T G C G G T G
C TAT C C T G T C G C G TAT T G AT G C G G G T C A G G A A
CAACTGGGCCGTCGCATCCATTATTCACAGAAT
GATCTGGTCGAATACTCGCCGGTGACCGAAAAA
CACCTGACCGACGGCATGACGGTGCGCGAACTGT
GTAGCGCCGCAATTACCATGTCTGATAACACGGCT
G C G A AT C T G C T G C T G A C C A C G AT C G G T G G T
CCGAAAGGCCTGACCGCCTTCCTGCATAACATGGG
T G AT C A C G T TA C G C G T C T G G A C C G C T G G G A A
CCGGAACTGAACGAAGCCATTCCGAATGA
TGAACGTGACACCACGACCCCGGTGGCAATGG
CAACCACGCTGCGCAAACTGCTGACCGGCGAAC
TGCTGACGCCGGCGAGTCGTCAGCAACTGA
T G G AT T G G AT G G A A G C C G A C A A A G T G G C A G G T
C C G C T G C T G C G TA G C G T G C T G C C G G C A G G T T
G G T T TAT C G C A G ATA A A A G T G G T G C A G G C G A A
CGTGGTTCCCGCGGCATTGTGGCTGCAC
TGGGTCCGGATGGCAAACCGAGTCGCATT
G T G G T TAT C TATA C C A C G G G C T C C C A G G C G A
CCATGGATGAACTGAATCGCCAAATTG
CTGAAATCGGTGCGAGCCTGATCAAACAT
TGGGGCGGTAGTGGTGGCGAAAAAATTCG
T C T G C G T G G AT C C G C T G G T G T TAT G A C C G G
C G C G A A AT T TA C G C A G AT T C A AT T C G G TAT
G A CCCG T CA G C A A G T C C T G G ATAT C G C C G G C G
C A G A A A A C T G C G A A A C C G G C G G TA G C T T T G G T
GACTCTATTCATTGTCGTGGTCACGCAGCAGGT
GCATATTACGCGTATGCAACCTTTGGCTTCACG
AGCGCAGCTGCGGATGCCAAAGTGGACTCAAAAT
CGCAGGAAAAACTGCTGGCTCCGTCTGCACCGACC
CTGACGCTGGCAAAATTCAATCAGGTCACCGTGGGT
ATGACGCGTGCTCAGGTGCTGGCGACCGTTGG
TCAAGGCAGTTGCACCACGTGGTCCGAATATTAC
CCGGCTTACCCGAGCACCGCAGGTGTGACGCTGA
GTCTGTCTTGTTTTGATGTTGACGGTTATAGCTCT
ACCGGTTTCTACCGTGGCTCCGCGCATCTGTGGTTT
ACGGATGGTGTCCTGCAGGGCAAACGCCAATGGGA
CCTGGTGGGCGGTGGGAGCTCCTATCCGTACGAT
GTTCCGGACTACGCCTAACTCGAGaaaaaa-3.
176 Hui Chin Goh et al.
References
1. Fanning AS, Anderson JM (1996) Protein- 11. Li J, Gierach I, Gillies AR, Warden CD, Wood
protein interactions: PDZ domain networks. DW (2011) Engineering and optimization of
Curr Biol 6(11):13851388 an allosteric biosensor protein for peroxisome
2. Kuriyan J, Cowburn D (1997) Modular pep- proliferator-activated receptor gamma ligands.
tide recognition domains in eukaryotic sig- Biosens Bioelectron 29(1):132139.
naling. Annu Rev Biophys Biomol Struct doi:10.1016/j.bios.2011.08.006
26:259288. doi:10.1146/annurev. 12. Legendre D, Soumillion P, Fastrez J(1999)
biophys.26.1.259 Engineering a regulatable enzyme for homoge-
3. Pawson T, Gish GD, Nash P (2001) SH2 neous immunoassays. Nat Biotechnol
domains, interaction modules and cellular wir- 17(1):6772. doi:10.1038/5243
ing. Trends Cell Biol 11(12):504511 13. Nirantar SR, Yeo KS, Chee S, Lane DP,
4. Huntington JA (2005) Molecular recognition Ghadessy FJ (2013) A generic scaffold for con-
mechanisms of thrombin. JThromb Haemost version of peptide ligands into homogenous
3(8):18611872. doi:10.1111/j.1538-7836. biosensors. Biosens Bioelectron 47:421428.
2005.01363.x doi:10.1016/j.bios.2013.03.049
5. Dougherty WG, Parks TD (1991) Post- 14. Nirantar SR, Li X, Siau JW, Ghadessy FJ (2014)
translational processing of the tobacco etch Rapid screening of protein-protein interaction
virus 49-kDa small nuclear inclusion polyprot- inhibitors using the protease exclusion assay.
ein: identification of an internal cleavage site Biosens Bioelectron 56:250257.
and delimitation of VPg and proteinase doi:10.1016/j.bios.2013.12.060
domains. Virology 183(2):449456 15. Kang SG, Park HU, Lee HS, Kim HT, Lee KJ
6. Owicki JC (2000) Fluorescence polarization (2000) New beta -lactamase inhibitory protein
and anisotropy in high throughput screening: (BLIP-I) from Streptomyces exfoliatus SMF19
perspectives and primer. JBiomol Screen and its roles on the morphological differentia-
5(5):297306 tion. JBiol Chem 275(22):1685116856.
7. Velumani S, Ho HT, He F, Musthaq S, doi:10.1074/jbc.M000227200
Prabakaran M, Kwang J(2011) A novel pep- 16. Kather I, Jakob RP, Dobbek H, Schmid FX
tide ELISA for universal detection of antibod- (2008) Increased folding stability of TEM-1
ies to human H5N1 influenza viruses. PLoS beta-lactamase by invitro selection. JMol
One 6(6):e20737. doi:10.1371/journal. Biol 383(1):238251. doi:10.1016/j.
pone.0020737 jmb.2008.07.082
8. Ayela C, Roquet F, Valera L, Granier C, Nicu 17. Lobstein J, Emrich CA, Jeans C, Faulkner M,
L, Pugniere M (2007) Antibody-antigenic Riggs P, Berkmen M (2012) SHuffle, a novel
peptide interactions monitored by SPR and Escherichia coli protein expression strain capa-
QCM-D.A model for SPR detection of IA-2 ble of correctly folding disulfide bonded
autoantibodies in human serum. Biosens proteins in its cytoplasm. Microb Cell Fact
Bioelectron 22(12):31133119. doi:10.1016/ 11:56. doi:10.1186/1475-2859-11-56
j.bios.2007.01.020 18. http://www.merckmillipore.com/SG/en/
9. Cummings RT, Salowe SP, Cunningham BR, product/nitrocefin, EMD_BIO-484400
Wiltsie J, Park YW, Sonatore LM, Wisniewski D, 19. Wang J, Zhang Z, Palzkill T, Chow DC (2007)
Douglas CM, Hermes JD, Scolnick EM (2002) Thermodynamic investigation of the role of con-
A peptide-based fluorescence resonance energy tact residues of beta-lactamase-inhibitory protein
transfer assay for Bacillus anthracis lethal factor for binding to TEM-1 beta-lactamase. JBiol
protease. Proc Natl Acad Sci U S A 99(10):6603 Chem 282(24):1767617684. doi:10.1074/
6606. doi:10.1073/pnas.062171599 jbc.M611548200
10. Guntas G, Mansell TJ, Kim JR, Ostermeier M
20. Reichmann D, Cohen M, Abramovich R,
(2005) Directed evolution of protein switches Dym O, Lim D, Strynadka NC, Schreiber G
and their application to the creation of ligand- (2007) Binding hot spots in the TEM1-BLIP
binding proteins. Proc Natl Acad Sci U S A interface in light of its modular architecture.
102(32):1122411229. doi:10.1073/pnas. JMol Biol 365(3):663679. d oi:10.1016/j.
0502673102 jmb.2006.09.076
Chapter 12
Abstract
Synthetic protein switches that sequence-specifically respond to oligonucleotide-based input triggers provide
valuable tools for the readout of oligonucleotide-based biomolecular systems and networks. Here, we
discuss a highly modular approach to reversibly control the DNA-directed assembly and disassembly of a
complex between TEM1--lactamase and its inhibitor protein BLIP.By conjugating each protein to a
unique handle oligonucleotide, the enzyme-inhibitor pair is noncovalently assembled upon the addition of
a complementary ssDNA template strand, resulting in inhibition of enzyme activity. Hybridization of an
input-oligonucleotide that is complementary to a target recognition sequence in the ssDNA template
strand results in the formation of a rigid dsDNA helix that mechanically disrupts the enzyme-inhibitor
complex, hereby restoring enzyme activity. Following this noncovalent approach allowed straightforward
tuning of the ssDNA template recognition sequence and target oligonucleotide lengths with only a single
set of oligonucleotide-functionalized enzyme and inhibitor domains. Using a fluorescent substrate, as little
as 10pM target oligonucleotide resulted in a distinguishable increase in enzyme activity.
Key words -lactamase, Reporter enzyme, DNA detection, Synthetic biology, Protein-DNA conjugation,
Biosensor
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_12, Springer Science+Business Media LLC 2017
179
180 WouterEngelen andMaartenMerkx
2 Materials
2.5 Enzyme Activity 1. PBS+: 50mM sodium phosphate, 100mM NaCl, 1mg/mL
Assay ofReconstituted bovine serum albumin (BSA) at pH7.0.
DNA-Directed Enzyme- 2. 50 M ssDNA template stock solution dissolved in H2O
Inhibitor Complex (Table 1).
3. 50 M ssDNA target stock solution dissolved in H 2O
(Table 1).
4. 500M nitrocefin, chromogenic -lactamase substrate (e.g.,
EMD Millipore, VWR, Cat No: 80,017707) dissolved in
PBS.
5. Multiwell plate reader (with absorbance mode).
6. Transparent 96-well plates.
2.6 Enzyme Activity 1. PBS+: 50mM sodium phosphate, 100mM NaCl, 1mg/mL
Assay atDifferent BSA at pH7.0.
Input Oligonucleotide 2. 50 M ssDNA template stock solution dissolved in H2O
Concentrations (Table 1).
3. 50M ssDNA target stock solution dissolved in H2O (Table 1).
4. 20 M CCF2-FA, fluorescent -lactamase substrate (e.g.,
Invitrogen, Cat No: K1034) dissolved in PBS.
5. Multiwell plate reader (with fluorescence mode).
6. Black 96-well plate.
184
Table 1
Sequences of handle oligonucleotides, ssDNA templates, and ssDNA targets
Name Sequence
ODN1 5-TGTCACCGATGAAACTGTCTA-NH23
ODN2 5-H2N-GTGATGTAGGTGGTAGAGGAA-3
Template 0 5-TTCCTCTACCACCTACATCACTAGACAGTTTCATCGGTGACA-3
Template 10 5-TTCCTCTACCACCTACATCACCACCACCGCATAGACAGTTTCATCGGTGACA-3
WouterEngelen andMaartenMerkx
Template 20 5-TTCCTCTACCACCTACATCACCACACCACCACCGCAACCACTAGACAGTTTCATCGGTGACA-3
Template 30 5-TTCCTCTACCACCTACATCACCACAACACACCACCACCGCAACCACCCACCTAGACAGTTTCATCGGTGACA-3
Template 40 5-TTCCTCTACCACCTACATCACCAACCCACAACACACCACCACCGCAACCACCCACCACCAATAGACAGTTTCATCGG
TGACA-3
Template 50 5-TTCCTCTACCACCTACATCACCAACACAACCCACAACACACCACCACCGCAACCACCCACCACCAACACCATAGACAGT
TTCATCGGTGACA-3
Target 10 5-TGCGGTGGTG-3
Target 20 5-GTGGTTGCGGTGGTGGTGTG-3
Target 30 5-GGTGGGTGGTTGCGGTGGTGGTGTGTTGTG-3
Target 40 5-TTGGTGGTGGGTGGTTGCGGTGGTGGTGTGTTGTGGGTTG-3
Target 50 5-TGGTGTTGGTGGTGGGTGGTTGCGGTGGTGGTGTGTTGTGGGTTGTGTTG-3
DNA Sensors Based on -Lactamase 185
3 Methods
Fig. 2 (a) Crystal structure of a complex between TEM1--lactamase and BLIP (PDB: 3C7V). (b) ODN-protein
conjugation strategy. Amine-modified oligonucleotides are reacted with the NHS-ester of the heterobifunc-
tional crosslinker Sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carbocylate (Sulfo-SMCC) install-
ing a thiol-reactive maleimide moiety on the oligonucleotides. After the removal of the excess crosslinker by
ethanol precipitation, the maleimide-activated oligonucleotides are reacted with a cysteine in the proteins.
Adapted with permission from ref. 13. Copyright 2015 American Chemical Society
186 WouterEngelen andMaartenMerkx
3.1 Expression 1. Transform competent E. coli BL21 (DE3) cells separately with
andPurification the pET29a_TEM1--lactamaseE104D and pET29a_BLIP
ofRecombinant plasmids (see Note 3).
Proteins 2. For each construct, inoculate 20mL of LB medium supple-
mented with 30mg/L kanamycin with a single colony of
transformed bacteria and incubate overnight at 37C in a
shaking incubator at 250rpm.
3. Transfer the seed culture to 2L of LB medium supplemented
with 30mg/L kanamycin.
4. Grow the bacteria in a shaking incubator at 200rpm at
37C.At an optical density at =600nm of 0.6, add 2mL of
IPTG stock yielding a final concentration of 100M IPTG
and incubate at 16C for 20h.
5. Harvest the cells by centrifugation at 10,000g for 10min
at 4C.
6. Resuspend the pelleted cells in 300mL osmotic shock solution
and incubate for 10min at room temperature.
7. Pellet the cells by centrifugation at 12,000g for 20min.
8. To extract the periplasmic fraction, resuspend the pelleted
cells in 300mL ice-cold low salt solution and incubate for
10min on ice prior to centrifugation at 40,000g for 40min
at 4C.
9. Add 10 TrisHCl buffer to the supernatant (i.e., the periplasmic
fraction) to yield a final concentration of 20mM TrisHCl.
10. Charge a 2mL His-bind column (gravity flow) with Ni2+ ions
by washing the column with 10 column volumes of charge
buffer and subsequently equilibrate with 10 column volumes
bind buffer.
11. Load the periplasmic fraction on the His-bind column and
allow it to enter the column bed completely. Wash the column
with 10 column volumes of wash buffer and subsequently elute
the protein of interest with 10 column volumes of elution
buffer.
12. Concentrate the eluted proteins to a final volume of ~2.5mL
using the centrifugal filter unit.
13. Exchange the buffer to storage buffer by gel filtration using a
PD-10 desalting column and determine the concentration by
measuring the optical absorption at =280nm with the
Nanodrop UV-VIS spectrophotometer and calculated extinction
coefficients (see Note 4).
14. Flash-freeze the purified proteins in liquid nitrogen and store
at 80C.
188 WouterEngelen andMaartenMerkx
Fig. 3 SDS-PAGE analysis of the conjugation and anion exchange purification of a maleimide-functionalized
oligonucleotide to a cysteine in (a) TEM1--lactamase and (b) BLIP on a 12% SDS-PAGE gel stained with
Coomassie blue. (rxn: reaction mixture, buffer A wash: first five wash fractions with buffer A (low ionic strength)
from the anion-exchange spin column, buffer B elution: first eight elution fractions with buffer B (high ionic
strength) from the anion-exchange spin column
190 WouterEngelen andMaartenMerkx
Fig. 4 Semi-native 12% SDS-PAGE analysis of the reconstitution of the DNA-directed enzyme-inhibitor pair.
Low micromolar concentrations of the synthetic protein switch components were sequentially mixed at a ratio
of 1:1.2:2 of ODN1-TEM1--lactamaseE104D, ssDNA template, and ODN2-BLIP. Lanes 6, 812 show efficient
formation of the ternary complex containing different lengths of target recognition sequence. A gel-shift to
higher molecular weight is observed upon the addition of 10 equivalents of target oligonucleotide (30 nucleo-
tides), indicating efficient binding of the input oligonucleotide to the synthetic protein switch. Adapted with
permission from ref. 13. Copyright 2015 American Chemical Society
4 Notes
Acknowledgments
The authors would like to thank Dr. Brian Janssen for co-developing
the methods described in this chapter. This work was supported
by an ERC Starting grant (ERC-2011- StG-280255) and by
NanoNextNL, a micro and nanotechnology consortium of the
government of The Netherlands and 130 partners.
References
1. Merkx M, Golynskiy MV, Lindenburg LH etal 8. Banala S, Aper SJA, Schalk W etal (2013)
(2013) Rational design of FRET sensor pro- Switchable reporter enzymes based on mutu-
teins based on mutually exclusive domain inter- ally exclusive domain interactions allow anti-
actions. Biochem Soc Trans 41:12011205 body detection directly in solution. ACS Chem
2. Ricci F, Valle-Blisle A, Porchetta A etal (2012) Biol 8:21272132
Rational design of allosteric inhibitors and activa- 9. Furman JL, Badran AH, Ajulo O etal (2010)
tors using the population-shift model: In vitro Toward a general approach for RNA-templated
validation and application to an artificial biosen- hierarchical assembly of split-proteins. JAm
sor. JAm Chem Soc 134:1517715180 Chem Soc 132:1169211701
3. Arts R, den Hartog I, Zijlema SE etal (2016) 10. Sancho Oltra N, Bos J, Roelfes G (2010)
Detection of antibodies in blood plasma using Control over enzymatic activity by DNA-
bioluminescent sensor proteins and a smart- directed split enzyme reassembly. ChemBio
phone. Anal Chem 88:45254532 Chem 11:22552258
4. Vinkenborg JL, Nicolson TJ, Bellomo EA etal 11. Strynadka NC, Jensen SE, Alzari PM etal
(2009) Genetically encoded FRET sensors to (1996) A potent new mode of beta-lactamase
monitor intracellular Zn2+ homeostasis. Nat inhibition revealed by the 1.7 X-ray crystal-
Methods 6:737740 lographic structure of the TEM-1-BLIP com-
5. Hessels AM, Chabosseau P, Bakker MH etal plex. Nat Struct Biol 3:290297
(2015) eZinCh-2: a versatile, genetically 12. Wang J, Palzkill T, Chow DC (2009) Structural
encoded FRET sensor for cytosolic and intra- insight into the kinetics and Cp of interac-
organelle Zn2+ imaging, ACS Chem. Biol tions between TEM-1 -lactamase and
10:21262134 -lactamase inhibitory protein (BLIP). JBiol
6. van der Velden LM, Golynskiy MV, Bijsmans Chem 284:595609
ITGW etal (2013) Monitoring bile acid trans- 13. Janssen BMG, Engelen W, Merkx M (2015)
port in single living cells using a genetically DNA-directed control of enzymeinhibitor
encoded Frster resonance energy transfer sen- complex formation: a modular approach to
sor. Hepatology 57:740752 reversibly switch enzyme activity. ACS Synth
7. Golynskiy MV, Rurup WF, Merkx M (2010) Biol 4:547553
Antibody detection by using a FRET-based 14. Tyagi S, Kramer FR (1996) Molecular beacons:
protein conformational switch. ChemBioChem probes that fluoresce upon hybridization. Nat
11:22642267 Biotechnol 14:303308
Part V
Proteolytic Sensors
Chapter 13
Abstract
Proteases are finding an increasing number of applications as molecular tools and reporters in biotechnology
and basic research. Proteases are also increasingly incorporated into synthetic genetic signaling circuits
equipping cells with tailored new functions. In the majority of cases however, proteases are employed in
constitutively active forms which limits their utility and application as molecular sensors. The following
chapter provides a detailed experimental protocol for converting constitutively active proteases into regulated
protease receptors. Such receptors can potentially sense, transduce, and amplify any molecular input,
thereby opening up a range of new applications in basic research, biotechnology, and synthetic biology.
1 Introduction
1.1 Proteases Proteases constitute one of the most abundant classes of enzymes
asVersatile Tools that execute key physiological functions across all kingdoms of
inBiotechnology life [1]. Proteases have evolved to function inside as well as outside
andBasic Research cellular environments taking on diverse roles such as regulating cell
death, controlling blood coagulation, digesting nutrients, and
remodeling the extracellular environment. Chemically, proteases
catalyze the irreversible cleavage of a peptide bond. Their substrate
specificity ranges from peptide motives as short as two amino acids,
to complex tertiary interactions that are mediated by structurally
distinct protein domains. Given the central importance of prote-
ases to many physiological processes and the irreversible nature of
the proteolytic cleavage, protease function is frequently tightly
regulated. One common mechanism relies on the expression of
inactive zymogens that require additional posttranslational pro-
cessing by an activating protease that cleaves off an active site-
directed inhibitor or triggers complex conformational
rearrangements allowing a protease to transition into a catalytically
active conformation.
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_13, Springer Science+Business Media LLC 2017
197
198 ViktorStein andKirillAlexandrov
Fig. 1 Schematic summary of different types of synthetic protease sensors and amplification circuits based on
modularly organized autoinhibited protease modules. (a) An elementary autoinhibited protease transducer P1
can be engineered by connecting a competitive autoinhibition domain that can be specifically cleaved off by
an activating protease P2. (b) An allosterically regulated protease receptor P1 can be engineered by replacing
the cleavage site for an activating protease with an allosteric binding receptor R1-R2 that undergoes a large
conformational change upon binding its cognate ligand L. (c) To accelerate the response time and improve
sensitivity, the signal generated by the primary allosterically regulated protease sensor P1 can be transduced
to cleave and activate a secondary protease amplifier P2. (d) Alternatively, activation of the secondary amplifier
can be based on the ligand L induced colocalization of a primary transducer P1 with a secondary amplifier P2
to engineer a proximity-dependent protein-protein interaction sensor
2 Materials
2.2 Construction 1. Chemically competent Top10 E. coli cells (or equivalent) for
ofDNA Libraries DNA cloning.
withUSEREnzyme 2. Pfu CX DNA polymerase (Agilent).
3. 10 Pfu Cx reaction buffer.
4. 10mM dNTPs each.
5. Primer-For: 5-GCTGAAGTCTTACGAGGAAGAGTTGGC-3
(TM=70.5C).
6. Primer-C-Ter: 5-ACGGTUTCGCGACCTACACCG-3
(TM=72.1C).
7. Primer-Library: 5-AACCGUGCGCTTTNNNNNNGGAA
GCACCCACCACCATCAT-3 (TM=70.3C).
8. Primer-Rev.: 5-CGTTGTAAAACGACGGCCAGTG-3 (TM
= 70.3C).
9. Vector for the expression of recombinant NIa proteases with
maltose binding protein (MBP): e.g., pRK793 based on
pMAL-C2.
10. 10 T4 DNA ligase buffer (NEB).
11. 400U/LT4 DNA ligase (NEB).
12. 1U/L USER Enzyme Mix (NEB).
13. Restriction enzymes NcoI and BamHI to digest the pRK793
vector backbone.
14. Gibson Assembly Kit.
15. Wizard SV Gel and PCR Clean-Up System.
16. Miniprep plasmid DNA purification system.
2.4 Expression 1. Terrific broth (TB): 1.2% (w/v) tryptone, 2.4% (wt/vol) yeast
andPurification extract, 0.04% glycerol, 0.17M KH2PO4, and 0.72M K2HPO4.
ofTVMV andHCV 2. TB-based autoinduction medium: TB supplemented with 0.2%
Protease Switches lactose, 0.05% glucose, and 2mM MgCl2.
3. Phosphate buffered saline (PBS): 10mM Na2HPO4, 2mM
KH2PO4, 137mM NaCl, and 2.7mM KCl, pH7.4.
4. Washing and binding buffer: 20mM Na2HPO4 and 20mM
imidazole pH8.0 supplemented with 300mM NaCl for
TVMVThr-AI protease transducers, 500mM NaCl for
HCVTVMV-AI protease transducers, and 1M NaCl for TVMV-
FN3-PDZ-AI allosteric receptors.
5. Elution buffer: 20mM Na2HPO4 and 500mM imidazole
pH8.0 supplemented with 300mM NaCl for TVMVThr-AI
protease transducers, 500mM NaCl for HCVTVMV-AI, and
1M for TVMV-FN3-PDZ-AI allosteric receptors.
6. Protein storage buffer: 50mM TrisHCl and 10% (v/v)
glycerol, pH8.0 supplemented with 1mM EDTA and 2mM
DTT for TVMVThr-AI protease transducers, 1M NaCl, 1mM
EDTA, and 2mM DTT for TVMV-FN3-PDZ-AI allosteric
receptors, and 500mM NaCl and 2mM -mercaptoethanol
for HCVTVMV-AI protease transducers.
7. 0.25-m nitrocellulose filters.
8. Ni-NTA columns (e.g., 5mL HisTrap FF Crude from GE
Healthcare).
9. Centrifugal filters with 10-kDa cutoff.
10. PD-10 desalting columns.
2.5 Assay Synthetic 1. Protease Assay Buffer: 50mM TrisHCl, 100mM NaCl,
Protease Receptors 50g/mL BSA and 2mM DTT, pH8.0 (see Note 1).
2. Summary of protease reagents and their working concentra-
tions is given in Table 1.
3. Summary of protease peptide substrate, ligand peptides, and
AI domains used to characterize individual protease receptors
is provided in Table 2.
204 ViktorStein andKirillAlexandrov
Table 1
Summary of working concentration of individual protease switches in different assays and
applications
Table 2
Summary of protease substrates, affinity clamp ligands, and AI domains
3 Method
3.1 Cloning Viral protease receptors are expressed as fusion proteins with
Autoinhibited maltose-binding protein (MBP) based on pRK793 [11]. This con-
Proteases Modules struct has previously been developed to facilitate the expression of
the NIa protease from Tobacco Etch Virus (TEV) where MBP acts
as a molecular chaperone to enable more efficient recombinant
expression of NIa proteases in E. coli [12, 13]. To construct focused
libraries, a variety of DNA library generation and DNA assembly
techniques are available. For instance, combinatorial DNA libraries
with degenerate codons coding for different amino acids are suitable
to bridge the P1-P1 junction or improve the affinity between the
206 ViktorStein andKirillAlexandrov
Fig. 2 Summary of cloning procedure to engineer autoinhibited protease modules exemplified with the NIa
protease of TVMV. (a) First commercially gene synthesize an autoinhibited protease module that serves as a
template for subsequent engineering attempts. This includes restriction sites NcoI and BamHI flanked by 50bp
homology regions to enable integration of the synthetic DNA fragment into a target vector, in this case pRK793,
by means of Gibson Assembly. The autoinhibited protease module contains an N-terminal cleavage site for
autocatalytic processing from MBP and a C-terminal cleavage site as the lead for a product-based competitive
inhibitor. The latter is additionally separated by a cleavage site for thrombin and an affinity tag to enable puri-
fication of the full-length protease transducer. (b, c) Using suitable primer pairs amplify DNA fragments coding
for the N- and C-terminal portion of TVMV while randomizing the P1-P1 junction using degenerate codons that
will ultimately yield a dipeptide motif that can bind across the P1-P1 junction, yet cannot be cleaved.
Recombination of the two DNA fragments is mediated through USER enzyme-dependent ligation. (d) Summary
of the USER enzyme-dependent recombination site including the coding amino acid sequence
Engineering Synthetic Protease Switches 207
(a) Synthetic DNA Fragment Coding for Elementary Autoinhibited Protease Module
gctgaagtcttacgaggaagagttggcgaaagatccacgtattgccgccaccatggaaaacgcccagaaa
ggtgaaatcatgccgaacatccctcagatgtccgctttctggtatgccgtgcgtactgcggtgatcaacg
ccgccagcggtcgtcagactgtcgatgaagccctgaaagacgcgcagactaattcgatcacaagtttgta
caaaaaagcaggctcggaaaccgtgcgtttccagtctggtggttctgggtcttctaaagctttgctgaag
ggcgtgcgcgattttaatccgatctctgcttgcgtatgcctgctggaaaactcctcggatggtcatagtg
aacgtctgtttggcattggttttggcccgtatatcattgccaaccagcatctgtttcgtcgtaacaatgg
cgaactgaccatcaaaaccatgcatggtgaattcaaagtcaaaaactctacccagctgcagatgaaaccg
gttgaaggccgtgacattatcgttatcaaaatggctaaagacttcccgccgttcccgcagaaactgaaat
tccgtcagccgaccatcaaagatcgtgtgtgcatggtgtccaccaactttcagcagaaaagcgtctcgag
cctggtgtctgaatcctctcacattgtgcataaagaagacacttctttctggcagcactggatcaccact
aaagatggccagtgtggcagcccactagtttccatcattgatggcaacattctgggcatccacagcctga
ctcataccaccaacggtagcaactacttcgtggaatttccggaaaaattcgtggcgacttatctagatgc
cgcggatggttggtgcaaaaactggaaattcaacgcggataaaatcagctggggttcctttaccctggtt
gaagatgcgccggaagatttcatgagtggtctggtgccgcgcggtgtaggtcgcgaaaccgtgcgctttc
agtctggaagcacccaccaccatcatcatcactgaggatcctctagagtcgacctgcaggcaagcttggc
actggccgtcgttttacaacg
Sequence Annotation
- Restriction sites NcoI and BamHI, and USER Enzyme recombination sites arehighlighted in black
- 50 bp homologous recombination sites with vector backbone are underlined
- TVMV protease is dotted-underlined
- TVMV cleavage sites are double-underlined
- Thrombin cleavage site is wave-underlined
- His affinity purification tag is thick-underlined
- P1-P1 junction is highlighted in grey
(d) USER Enzyme Dependent Recombination Site with Randomized P1-P1 Junction
G V G R E T V R F X X G S T H H H H
5-AACCGUGCGCTTTNNNNNNGGAAGCACCCACCACCATCAT-3
3-GCCACATCCAGCGCTUTGGCA-5
208 ViktorStein andKirillAlexandrov
3.2 Engineering Once a DNA library has been generated, it needs to be screened
Autoinhibited Protease experimentally to identify mutants with the desired properties. The
Modules: High- following generic protocol can be used to screen the function of
Throughput Screening autoinhibited protease modules, sensors, and switches aiming to
optimize the binding strength of the AI-domain, or the length and
structure of the connecting linkers.
1. Transform the library of autoinhibited TVMV mutants into
chemically competent BL21(DE3)-RIL cells hosting the
autolysis plasmid 05665 (see Note 5).
2. Plate transformed cells on LB agar plates supplemented with
100g/mL carbenicillin, 50g/mL kanamycin, and 34g/mL
chloramphenicol.
3. Following overnight incubation at 37C, inoculate single col-
onies into 96-deep-well plates filled with 1mL minimal PA-5052
autoinduction medium [10] supplemented with 100g/mL
carbenicillin, 50g/mL kanamycin, and 34g/mL
chloramphenicol.
Engineering Synthetic Protease Switches 209
3.4 Quantification Once purified, individual protease receptors can be assayed and
ofSynthetic Protease characterized under defined reaction conditions: e.g., to assess
Switches their maximum induction ratios, determine the dissociation con-
stants of allosteric protease receptors for their cognate ligands,
measure the inhibition constants of AI-domain peptides, or assess
the purity of protease transducers by means of kinetic analysis. The
preferred assay reaction volume is 200L while individual assay
components are preferably added in increments of 50L based on
4 working stock solutions of individual reagents.
([Sensor ] + [Ligand ] + K )
D
Y = V0 + (V MAX - V0 )
D
(1)
2 [ Sensor ]
Y = V Max
[Substrate] (2)
[Substrate] + K M
Y = V Max
[Substrate]
(3)
[Inhibitor ]
[Substrate] + K M 1 +
Ki
4 Notes
Acknowledgments
References
1. Neil D.Rawlings GS (eds) (2013). Handbook tide inhibitors of hepatitis C virus NS3/4A
of proteolytic enzymes, Academic Press, protease. Biochemistry 39:1289812906.
Cambridge, Massachusetts. doi:10.1021/bi001590g
2. Stein V, Alexandrov K (2014) Protease-based 6. Huang J, Makabe K, Biancalana M etal (2009)
synthetic sensing and signal amplification. Structural basis for exquisite specificity of affin-
Proc Natl Acad Sci U S A 111:1593415939. ity clamps, synthetic binding proteins generated
doi:10.1073/pnas.1405220111 through directed domain-interface evolution.
3. Stein V, Alexandrov K (2015) Synthetic protein JMol Biol 392:12211231. doi:10.1016/j.
switches: design principles and applications. jmb.2009.07.067
Trends Biotechnol 33:101110. doi:10.1016/j. 7. Huang J, Koide A, Makabe K, Koide S (2008)
tibtech.2014.11.010 Design of protein function leaps by directed
4. Cesaratto F, Burrone OR, Petris G (2016) domain interface evolution. Proc Natl Acad
Tobacco etch virus protease: a shortcut across Sci U S A 105:65786583. doi:10.1073/
biotechnologies. JBiotechnol 231:239249. pnas.0801097105
doi:10.1016/j.jbiotec.2016.06.012 8. Xu L, Li S, Ren C etal (2006) Heat-inducible
5. Ingallinella P, Bianchi E, Ingenito R etal autolytic vector for high-throughput screen-
(2000) Optimization of the P-region of pep- ing. Biotechniques 41:319323. doi:10.2144/
000112219
218 ViktorStein andKirillAlexandrov
Abstract
Dynamic proteinprotein interactions (PPIs) are fundamental building blocks of cellular signaling and
monitoring their regulation promotes the understanding of signaling in health and disease. Genetically
encoded split protein biosensor assays, such as the split TEV method, have proved to be highly valuable
when studying regulated PPIs in living cells. Split TEV is based on the functional complementation of two
previously inactive TEV protease fragments fused to interacting proteins and provides a robust, sensitive
and flexible readout to monitor PPIs both at the membrane and in the cytosol. Thus, split TEV can be
used to analyze interactomes of receptors, membrane-associated proteins, and cytosolic proteins. In par-
ticular, split TEV is useful to assay activities of relevant drug targets, such as receptor tyrosine kinases and
G protein-coupled receptors, in compound screens. As split TEV uses genetically encoded readouts,
including standard reporters based on fluorescence and luminescence, the technique can also be combined
with scalable molecular barcode reporter systems, allowing the integration into multiplexed high-
throughput assay approaches. Split TEV can be used in standard heterologous cell lines and primary cell
types, including neurons, either in a transient or stably integrated format. When using cell lines, the basic
protocol takes 3096 h to complete, depending on the complexity of the experimental question addressed.
Key words Proteinprotein interaction, Split TEV, Biosensor, Split biosensor assay, RTK, GPCR,
Phosphorylation-dependent interactions, Dose-response assay, Compound profiling
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_14, Springer Science+Business Media LLC 2017
219
220 Jan P. Wintgens et al.
Fig. 1 Types of proteinprotein interactions that can be monitored by split TEV.The candidates in a split TEV
assay can be membrane proteins, membrane-associated proteins, and soluble proteins in the cytosol. Proteins
localized to these subcellular areas can be tested for regulated interactions in all combinations, which are (a)
membrane | membrane, (b) membrane | membrane-associated, (c) membrane | cytosolic, (d) membrane-
associated | membrane-associated, (e) membrane-associated | cytosolic, and (f) cytosolic | cytosolic
blocks the active site of the TEV protease [37]. NTEV and CTEV
fragments are fused to candidate proteins, preferably to the
C-terminal end of the protein candidates. For NTEV, N-terminal
fusions are also functional. Protein Interaction-induced reassembly
of the NTEV and CTEV moieties leads to the reconstitution of
TEV proteolytic activity, which activates TEV-specific reporters.
These can be either of proteolytic or of transcriptional type, and
they maybe fluorescent or luminescent-based. Notably, the
luciferase-based transcriptional reporters proved to be most sensi-
tive and robust as the readout is functionally uncoupled from the
interaction event itself and background readings were commonly
lower compared to other options. Transcriptional reporters based
on luciferase exhibit another feature as they comprise three levels
of signal amplification: In addition to the proteolytic cleavage and
a transcriptional amplification step, enzyme-based (i.e., luciferase)
reporters allow a third step of amplifying the initial signal resulting
in a robust and sensitive readout.
1.2 Split TEV Assays For monitoring dynamic PPIs at the membrane, a membrane pro-
forMembrane tein or membrane-associated protein candidate is fused to the
andMembrane- NTEV fragment along with a TEV protease cleavage site (tevS,
Associated Proteins encoded by the amino acids ENLYFQG; the TEV protease cleaves
between Q and G) and the artificial transcriptional co-activator
Characterising Dynamic PPIs Using Split TEV 223
Fig. 2 Schematic representation of split TEV assays. (a) Split TEV assays for membrane and membrane-
associated proteins. A candidate receptor is fused to the NTEV fragment, followed by the TEV protease cleav-
age site (tevS) and the co-transcriptional co-activator GAL4-VP16 (GV). A candidate soluble protein is fused to
the CTEV fragment. Upon ligand stimulation, the receptor and the soluble protein associate with each other,
bringing the TEV fragments into close proximity. This results in the reconstitution of TEV proteolytic activity,
which is indicated by the outer glow shown in blue at the NTEV and CTEV fragments. Regained TEV protease
activity cleaves at the tevS to release GV, as indicated by the scissors. Liberated GV translocates to the nucleus
to transcriptionally activate a firefly luciferase reporter gene (Fluc) through binding to upstream activating
enhancer sequences (UAS). (b) Split TEV assays for soluble proteins. A candidate soluble protein is fused to
NTEV, a second soluble candidate is fused to CTEV.A cytosolic TEV reporter composed of a central GV unit that
is trapped and flanked by ERT2 domains, each fused via a tevS, is additionally present in the cell. Association
between the two candidates causes the TEV proteolytic activity to be reconstituted. Regained TEV protease
activity cleaves at both tevS (indicated by the scissors) to liberate GV, which travels into the nucleus to activate
the firefly luciferase reporter
even a protein that shuttles between the cytosol and the nucleus.
PPI-induced reconstituted TEV protease activity cleaves off GV,
which translocates into the nucleus and activates a firefly luciferase
reporter gene, which is placed under the control of upstream acti-
vating sequences that contain DNA sequences recognized by GV.
Split TEV assays can be used to monitor ligand-dependent
interactions of cell surface receptors, such as RTKs and GPCRs,
thus allowing to assess their activity. For instance, the Neuregulin1-
induced association between ERBB4, an RTK of the ERBB family,
and the regulatory subunit alpha of the PI3K, PIK3R1, was deter-
mined in a dose-response assay (Fig.3a), as well as its inhibition by
lapatinib (Fig.3b). Sample constitutive interactions assayed using
split TEV are shown for the membrane-associated protein KIBRA
(Fig.3c). For assessing GPCR activities, we have recently reported
a detailed protocol on the split TEV-based GPCR/-Arrestin2
recruitment assay, which uses a truncated version of -Arrestin2
and a modified NTEV-tevS-GV tag for improved sensitivity [38].
We therefore refer the reader to this specified GPCR split TEV
protocol. Notably, the split TEV method proved to be more sensi-
tive than the full-TEV Tango approach when assaying selected
GPCR activities [15].
1.3 Split TEV Assays Interactions between candidate proteins that stay strictly cyto-
forSoluble Proteins solic and do not shuttle into the nucleus may be monitored using
the hybrid NTEV-tevS-GV tag (see Note 1). For candidate pro-
teins that show a certain degree of nuclear localization, candi-
dates are fused to the NTEV fragment only (Fig.2b). The other
candidate protein is fused to CTEV.When pursuing the sole
NTEV/CTEV tagging strategy, PPI-induced TEV protease activ-
ity leads to the activation of a cytosolically localized transcrip-
tional TEV reporter (denoted GV-2ER), which contains a central
GV unit that is trapped by two ERT2 domains, each fused to GV
via a tevS.ERT2 domains are modified oestrogen receptor
domains, that do not respond to endogenous oestrogen, but to
4-hydroxytamoxifen. Liberated GV translocates into the nucleus
and activates the firefly luciferase reporter. MST1 dimer forma-
tion based on the C-terminal SARAH domain is shown as an
example for soluble protein interactions (Fig.3d). Dynamic
interactions like AKT-induced and phosphorylation-regulated
BAD/143-3 and rapamycin- regulated FKBP/FRB have also
been described using split TEV [9, 33].
1.4 Assay Controls When studying PPIs using split TEV, tagged proteins of interest
are commonly introduced into cells at rather high expression lev-
els, either transiently by transfection or by stable integration.
Therefore, assay components should be expressed at rather low
levels, possibly close to those of endogenous counterparts.
Further, each assay should be individually validated by specific
Characterising Dynamic PPIs Using Split TEV 225
Fig. 3 Examples of constitutive and regulated split TEV assays. (a, b) Dose response split TEV assays for the
ERBB4 receptor using (a) the agonist EGF-like domain (EGFld) and (b) the antagonist lapatinib. ERBB4-NTEV-
tevS-GV and PIK3R1-CTEV fusions were transiently transfected into PC12 cells and treated for 20 h using the
indicated compound concentrations. (a) ERBB4/PIK3R1-transfected assay cells were stimulated with increas-
ing concentrations of EGFld. The EC50 value was calculated at 3.06 ng/ml EGFld. (b) ERBB4/PIK3R1-transfected
assay cells were stimulated with increasing concentrations of lapatinib, followed 1 h later by the addition of
a constant stimulus of 10 ng/ml EGFld. The IC50 value was calculated at 0.42 M lapatinib (b). Six replicates
per condition, error bars represent SEM. (c) Constitutive split TEV assays for the kinase MST1. MST1 dimer-
izes through its C-terminally located SARAH domain (lane 2). Note that MST1-C, which contains residues
1432 only and lacks the SARAH domain, does not interact with MST1 full-length, and thus only background
signals are produced. Likewise, the missense mutation L444P disrupts the MST1 dimer formation [39]. (d)
MST1 is not suitable for the hybrid tag NTEV-tevS-GV.MST1-NTEV-tevS-GV is cleaved and produces high
background readings (lane 4). By contrast, MST1 interacting proteins MST2, SAV1 and RASSF1A (R1A) yield
low background readings. Readings are compared to a strong PPI (KIBRA::KIBRA) (lane 1) and a background
control (KIBRA::RASSF6 (R6)) (lane 2). RLU relative luciferase units; six replicates per condition, error bars
represent SD
1.5 Experimental The split TEV technique can been applied to study constitutive
Setups forConstitutive and regulated interactions that are modulated by ligands, ago-
andRegulated nists, antagonists, or a combination thereof. Experimental setups
Interaction Split TEV for constitutive split TEV assays can be comfortably completed
Assays within 30 h (Fig.4a). Dynamic interaction split TEV assays using
agonists or agonist/antagonist combinations typically require up
to 4 days, depending on the individual experimental design (cell
seeding parameters, starving conditions, stimulation paradigms,
etc.) (Fig.4b, c). The effects of compound actions, either stimula-
tory or inhibitory, are optimally assessed in dose response assays,
which allow the calculation of EC50 and IC50 values (concentra-
tions of agonist/antagonist compounds at half-maximal stimula-
tory/inhibitory response).
In summary, the split TEV technique is a powerful and sensi-
tive tool providing a robust readout to monitor dynamic PPIs
within their natural context. The split TEV method is character-
ized by various features as it enables (1) the detection of dynamic
Fig. 4 Suggested timelines for split TEV assays. Cells are plated on the day before (or alternatively in the morn-
ing) and transfected with assay plasmids. (a) Constitutive assay. After transfection, cells are incubated for 20
h before lysis. (b) Agonist assay: After transfection, plasmids are allowed to express for 20 h, followed by a
medium change to starve the cells in low-serum media. The following day, an agonist is added for 620 h,
depending on the setup of the assay. (c) Antagonist assay: Transfection and medium change are performed as
in (b). Before an agonist is added, cells are treated with an antagonist for 1 h. The stimulation time is depen-
dent on the assay setup
Characterising Dynamic PPIs Using Split TEV 227
2 Materials
2.2 Cells HEK293 (ATCC), PC12 cells (PC12 Tet-Off, Clontech), any
other heterologous cell line, or primary cells that are amenable to
efficient transfection and allow studying proteinprotein interac-
tions (see Note 4).
2.3 Reagents 1. Medium, depending on the cell line chosen (e.g., for HEK293
cells: DMEM 4.5 g glucose/l without l-glutamine, each with
and without phenol red). See complete media formulations for
HEK293 and PC12 cells below.
2. Fetal bovine serum (FBS), heat-inactivated, 500ml (Life
Technologies)
3. Horse serum (HS), heat-inactivated, 500ml (Life Technologies)
(only needed for PC12 cells).
4. GlutaMAX, 100, 100ml (Life Technologies).
5. Penicillin and Streptomycin, 100, 100ml (Life Technologies).
6. Opti-MEM (Life Technologies).
7. Poly-l-lysine, mol wt 70,000150,000, diluted in a final con-
centration of 0.02 mg/ml in H2O (Sigma).
8. Lipofectamine 2000 transfection reagent (Life Technologies).
9. Passive lysis buffer, 5 (Promega, E1941).
10. Dual-Luciferase Reporter 1000 Assay System (Promega,
E1980) (for an alternative using self-made substrates, see
Note 14).
2.4 Equipment 1. 96-well plates: white with flat bottom for luciferase-based
assays (Falcon).
2. 96-well plates: clear with flat bottom for optical transfection
control and fluorescence-based assays (Falcon).
3. 75cm2 flasks (Falcon) or 15cm dish (Falcon) (for mainte-
nance of cell lines).
4. Cell culture facility including flow hood and incubator set to
5% CO2 and 37 C.
5. Luciferase reader (e.g., Mithras, Berthold Technologies or
Envision, PerkinElmer).
6. Fluorescence microscope (to check for transfection efficiency).
2.5 Media Prepare for each cell line used the appropriate media for mainte-
Formulation nance and assay conditions.
1. HEK293 cells, assay medium: DMEM (4.5 g glucose/l, with-
out l-glutamine and without phenol red), 500 ml, supple-
mented with 0.5% FBS and 2 mM GlutaMAX.
2. HEK293 cells, medium for maintenance: DMEM (4.5 g
glucose/l, without L-glutamine, with phenol red), 500 ml,
Characterising Dynamic PPIs Using Split TEV 229
3 Methods
Table 1
Troubleshooting advice
4 Notes
for the firefly luciferase substrates, and then for the Renilla
luciferase substrates.
14. If using the self-made substrates for the Mithras device from
Berthold Technologies, a different protocol for measuring the
Renilla luciferase signals will be applied, as this substrate has a
decreased stability. The substrate is injected, followed by an
orbital shake of 2 s, and then immediately measured for 2 s.
This Process is repeated well by well. The detailed protocol for
making both firefly (a) and Renilla (b) substrates is listed
below. We regularly order special reagents from p.j.k. GmbH,
Kleinblittersdorf, Germany; these include coelenterazine,
D-luciferin, co-enzyme A, ATP, DTT (1,4 dithiothreitol).
c(0.001, 0.01, 0.1, 1, 10, 100),
(a) Substrate for firefly luciferase
Acknowledgment
References
1. McNeill H, Woodgett JR (2010) When path- 4. Billingsley ML (2008) Druggable targets and
ways collide: collaboration and connivance targeted drugs: enhancing the development of
among signalling proteins in development. Nat new therapeutics. Pharmacology 82:239244.
Rev Mol Cell Biol 11:40413. doi:10.1038/ doi:10.1159/000157624
nrm2902. 5. Michnick SW, Ear PH, Manderson EN, Remy
2. Heng BC, Aubel D, Fussenegger M (2013) An I, Stefan E (2007) Universal strategies in
overview of the diverse roles of G-protein cou- research and drug discovery based on protein-
pled receptors (GPCRs) in the pathophysiology fragment complementation assays. Nat Rev
of various human diseases. Biotechnol Adv Drug Discov 6:569582. doi:10.1038/
31(8):167694. doi:10.1016/j.biotechadv. nrd2311
2013.08.017. 6. Wehr MC, Rossner MJ (2016) Split protein
3. Lemmon MA, Schlessinger J. Cell signaling by biosensor assays in molecular pharmacological
receptor tyrosine kinases. Cell. 2010;141:1117 studies. Drug Discov Today 21:41529.
34. doi:10.1016/j.cell.2010.06.011. doi:10.1016/j.drudis.2015.11.004.
Characterising Dynamic PPIs Using Split TEV 237
7. Hubbard SR, Miller WT (2007) Receptor tyro- 18. Ghosh I, Hamilton AD, Regan L (2000)
sine kinases: mechanisms of activation and sig- Antiparallel leucine zipper-directed protein
naling. Curr Opin Cell Biol 19:117123. reassembly: application to the green fluorescent
doi:10.1016/j.ceb.2007.02.010 protein. JAm Chem Soc 122:56585659.
8. Petschnigg J, Groisman B, Kotlyar M, Taipale doi:10.1021/ja994421w
M, Zheng Y, Kurat CF, Sayad A, Sierra JR, 19. Hu C-D, Chinenov Y, Kerppola TK (2002)
Usaj MM, Snider J, Nachman A, Krykbaeva I, Visualization of interactions among bZIP and
Tsao M-S, Moffat J, Pawson T, Lindquist S, Rel family proteins in living cells using bimo-
Jurisica I, Stagljar I (2014) The mammalian- lecular fluorescence complementation. Mol
membrane two-hybrid assay (MaMTH) for Cell 9:789798
probing membrane-protein interactions in 20. Shyu YJ, Liu H, Deng X, Hu C-D (2006)
human cells. Nat Methods. doi:10.1038/ Identification of new fluorescent protein frag-
nmeth.2895 ments for bimolecular fluorescence comple-
9. Wehr M, Reinecke L, Botvinnik A, Rossner M mentation analysis under physiological
(2008) Analysis of transient phosphorylation- conditions. BioTechniques 40:6166
dependent protein-protein interactions in living 21. Luker KE, Smith MCP, Luker GD, Gammon
mammalian cells using split-TEV. BMC Bio ST, Piwnica-Worms H, Piwnica-Worms D
technol 8:55. doi:10.1186/1472-6750-8-55 (2004) Kinetics of regulated proteinprotein
10. Antczak C, Bermingham A, Calder P, Malkov interactions revealed with firefly luciferase com-
D, Song K, Fetter J, Djaballah H (2012) plementation imaging in cells and living ani-
Domain-based biosensor assay to screen for mals. PNAS 101:1228812293. doi:10.1073/
epidermal growth factor receptor modulators pnas.0404041101
in live cells. Assay Drug Dev Technol 10:24 22. Paulmurugan R, Umezawa Y, Gambhir SS
36. doi:10.1089/adt.2011.423 (2002) Noninvasive imaging of protein-protein
11. Dorsam RT, Gutkind JS (2007) G-protein- interactions in living subjects by using reporter
coupled receptors and cancer. Nat Rev Cancer protein complementation and reconstitution
7:7994. doi:10.1038/nrc2069 strategies. Proc Natl Acad Sci U S A 99:15608
12. Lagerstrm MC, Schith HB (2008) Structural 15613. doi:10.1073/pnas.242594299
diversity of G protein-coupled receptors and
23. Kaihara A, Kawai Y, Sato M, Ozawa T,
significance for drug discovery. Nat Rev Drug Umezawa Y (2003) Locating a protein-pro-
Discov 7:339357. doi:10.1038/nrd2518 tein interaction in living cells via split Renilla
13. Kohout TA, Lefkowitz RJ (2003) Regulation luciferase complementation. Anal Chem 75:
of G protein-coupled receptor kinases and 41764181
arrestins during receptor desensitization. Mol 24. Paulmurugan R, Gambhir SS (2003)
Pharmacol 63:918 Monitoring protein-protein interactions using
14. MacDonald ML, Lamerdin J, Owens S, Keon split synthetic renilla luciferase protein-
BH, Bilter GK, Shang Z, Huang Z, Yu H, Dias fragment- assisted complementation. Anal
J, Minami T, Michnick SW, Westwick JK Chem 75:15841589
(2006) Identifying off-target effects and hidden 25. Remy I, Michnick SW (2006) A highly sensi-
phenotypes of drugs in human cells. Nat Chem tive protein-protein interaction assay based on
Biol 2:329337. doi:10.1038/nchembio790 Gaussia luciferase. Nat Methods 3:977979.
15. Djannatian MS, Galinski S, Fischer TM, doi:10.1038/nmeth979
Rossner MJ (2011) Studying G protein- 26. Kim SB, Otani Y, Umezawa Y, Tao H (2007)
coupled receptor activation using split-tobacco Bioluminescent indicator for determining
etch virus assays. Anal Biochem 412:141152. protein-protein interactions using intramolecu-
doi:16/j.ab.2011.01.042 lar complementation of split click beetle lucifer-
16. Barnea G, Strapps W, Herrada G, Berman Y, ase. Anal Chem 79:48204826. doi:10.1021/
Ong J, Kloss B, Axel R, Lee KJ (2008) The ac0621571
genetic design of signaling cascades to record 27. Hida N, Awais M, Takeuchi M, Ueno N,
receptor activation. Proc Natl Acad Sci 105:64 Tashiro M, Takagi C, Singh T, Hayashi M,
69. doi:10.1073/pnas.0710487105 Ohmiya Y, Ozawa T (2009) High-sensitivity
17. Misawa N, Kafi AKM, Hattori M, Miura K, real-time imaging of dual protein-protein inter-
Masuda K, Ozawa T (2010) Rapid and high- actions in living subjects using multicolor lucif-
sensitivity cell-based assays of protein-protein erases. PLoS ONE 4:e5868. doi:10.1371/
interactions using split click beetle luciferase journal.pone.0005868
complementation: an approach to the study of 28. Galarneau A, Primeau M, Trudeau L-E,
G-protein-coupled receptors. Anal Chem Michnick SW (2002) Beta-lactamase protein
82:25522560. doi:10.1021/ac100104q fragment complementation assays as invivo and
238 Jan P. Wintgens et al.
invitro sensors of protein protein interactions. 37. Nunn CM, Jeeves M, Cliff MJ, Urquhart GT,
Nat Biotechnol 20:619622. doi:10.1038/ George RR, Chao LH, Tscuchia Y, Djordjevic
nbt0602-619 S (2005) Crystal structure of tobacco etch virus
29. Blakely BT, Rossi FM, Tillotson B, Palmer M, protease shows the protein C terminus bound
Estelles A, Blau HM (2000) Epidermal growth within the active site. J Mol Biol 350:145155.
factor receptor dimerization monitored in live doi:10.1016/j.jmb.2005.04.013
cells. Nat Biotechnol 18:218222. doi:10.1038/ 38. Wehr MC, Galinski S, Rossner MJ (2015)
72686 Monitoring G Protein-Coupled Receptor
30. Rossi F, Charlton CA, Blau HM (1997) Activation Using the Protein Fragment
Monitoring protein-protein interactions in Complementation Technique Split TEV.
intact eukaryotic cells by beta-galactosidase Methods Mol Biol 1272:107118.
complementation. Proc Natl Acad Sci U S A doi:10.1007/978-1-4939-2336-6_8
94:84058410 39. Praskova M, Khoklatchev A, Ortiz-Vega S,
31. Johnsson N, Varshavsky A (1994) Split ubiqui- Avruch J (2004) Regulation of the MST1
tin as a sensor of protein interactions invivo. kinase by autophosphorylation, by the growth
Proc Natl Acad Sci U S A 91:1034010344 inhibitory proteins, RASSF1 and NORE1, and
32. Stagljar I, Korostensky C, Johnsson N, Heesen by Ras. The Biochemical journal 381:453462
S etal (1998) A genetic system based on split- 40. Genevet A, Wehr MC, Brain R, Thompson BJ,
ubiquitin for the analysis of interactions Tapon N (2010) Kibra is a regulator of the
between membrane proteins invivo. PNAS Salvador/Warts/Hippo signaling network.
95:51875192 Dev Cell 18:300308. doi:10.1016/j.devcel.
33. Wehr MC, Laage R, Bolz U, Fischer TM, 2009.12.011
Grnewald S, Scheek S, Bach A, Nave K-A, 41. Wehr MC, Holder MV, Gailite I, Saunders RE,
Rossner MJ (2006) Monitoring regulated Maile TM, Ciirdaeva E, Instrell R, Jiang M,
protein-protein interactions using split TEV. Nat Howell M, Rossner MJ, Tapon N (2013) Salt-
Methods 3:985993. doi:10.1038/nmeth967 inducible kinases regulate growth through the
34. Hamdan FF, Audet M, Garneau P, Pelletier J, Hippo signalling pathway in Drosophila. Nat
Bouvier M (2005) High-throughput screening Cell Biol 15:6171. doi:10.1038/ncb2658
of G protein-coupled receptor antagonists using 42. Botvinnik A, Wichert SP, Fischer TM, Rossner
a bioluminescence resonance energy transfer MJ (2010) Integrated analysis of receptor acti-
1-based beta-arrestin2 recruitment assay. vation and downstream signaling with
JBiomol Screen 10:463475. doi:10.1177/ EXTassays. Nat Meth 7:7480. doi:10.1038/
1087057105275344 nmeth.1407
35. Vrecl M, Jorgensen R, Pogacnik A, Heding A
43. Ura S, Masuyama N, Graves JD, Gotoh Y
(2004) Development of a BRET2 screening assay (2001) Caspase cleavage of MST1 promotes
using beta-arrestin 2 mutants. JBiomol Screen nuclear translocation and chromatin conden-
9:322333. doi:10.1177/1087057104263212 sation. Proc Natl Acad Sci USA 98:10148
36. Kapust RB, Tzsr J, Fox JD, Anderson DE, 10153. doi:10.1073/pnas.181161698
Cherry S, Copeland TD, Waugh DS (2001) 44. Stark C, Breitkreutz B-J, Reguly T, Boucher L,
Tobacco etch virus protease: mechanism of Breitkreutz A, Tyers M (2006) BioGRID: a
autolysis and rational design of stable mutants general repository for interaction datasets.
with wild-type catalytic proficiency. Protein Nucleic Acids Res 34:D535539. doi:10.1093/
Eng 14:9931000 nar/gkj109
Part VI
Optogenetic Switches
Chapter 15
Abstract
In eukaryotic cells, virtually all regulatory processes are influenced by proteolysis. Thus, synthetic control
of protein stability is a powerful approach to influence cellular behavior. To achieve this, selected target
proteins are modified with a conditional degradation sequence (degron) that responds to a distinct signal.
For development of a synthetic degron, an appropriate sensor domain is fused with a degron such that
activity of the degron is under control of the sensor. This chapter describes the development of a light-
activated, synthetic degron in the model organism Saccharomyces cerevisiae. This photosensitive degron
module is composed of the lightoxygenvoltage (LOV) 2 photoreceptor domain of Arabidopsis thaliana
phototropin 1 and a degron derived from murine ornithine decarboxylase (ODC). Excitation of the pho-
toreceptor with blue light induces a conformational change that leads to exposure and activation of the
degron. Subsequently, the protein is targeted for degradation by the proteasome. Here, the strategy for
degronmodule development and optimization is described in detail together with experimental aspects,
which were pivotal for successful implementation of light-controlled proteolysis. The engineering of the
photosensitive degron (psd) module may well serve as a blueprint for future development of sophisticated
synthetic switches.
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_15, Springer Science+Business Media LLC 2017
241
242 Christof Taxis
by the proteasome [1, 2]. The substrates contain linear motifs that
are recognized by a specialized E3, which ensures selectivity of the
process. These motifs are called degradation-inducing sequence
or shortly degron, if they are necessary and sufficient for recogni-
tion by the degradation machinery. Thus, modification of a stable
protein by a degron will lead to its destabilization. In rare cases,
proteins are also directly recognized by the proteasome and
degraded in a ubiquitin-independent way [3].
Due to the importance of proteolysis in eukaryotic cells, syn-
thetic control of protein stability is a powerful tool to interfere
with regulatory mechanisms and to influence cellular activities. To
implement synthetic regulation, the activity of a degron is switched
from an inactive to an active state by a distinct signal. Until now,
signals like temperature, small molecules, nutrients, cell cycle stage
or light have been used to regulate the stability of conditional
degrons in eukaryotic cells [49]. To confer synthetic regulation
on a selected target protein, one of the degrons is fused to the tar-
get gene to create a cell line in which target protein abundance and
activity is controlled synthetically.
Development of such a degradation tool requires two protein
domains or sequences: a sensor domain that converts the signal
into an output, e.g., a conformational change and a degron that is
controlled by this switch. For generation of a light-controlled
degron, the lightoxygenvoltage (LOV) 2 photoreceptor domain
of Arabidopsis thaliana phototropin 1 was selected as sensor due to
precise knowledge about the molecular changes in the LOV2
domain after light-exposure. The LOV2 domain binds the cofactor
flavin-mononucleotide (FMN), which is excited by blue light.
Subsequently, the side-chain of a cysteine residue of LOV2 forms a
covalent bond with the C4a atom of FMN.This induces structural
changes in the LOV2 core resulting in unfolding of the so-called
J-helix at the carboxy terminus of the photoreceptor [10, 11].
The degradation sequence selected for the conditional degron
was derived from the well-studied murine ornithine decarboxylase
(ODC). The ODC degron sequences are located at the very
carboxy-terminus of the enzyme. It is somewhat unusual, as ubiq-
uitin is not necessary for proteasomal degradation of ODC, whereas
the vast majority of proteasome substrates are degraded in an ubiq-
uitin-dependent way [12]. The active ODC degron has two require-
ments: a cysteine-alanine motif located 19 amino acids upstream of
the C-terminus flanked by sequences without secondary structure
comprising a length of 37 amino acids in total [13, 14].
To generate the light-activated degron, the A. thaliana LOV2
domain was fused to a 23 amino acid long peptide of a synthetic
variant of the ODC degron called cODC1 [9, 15]. Several variants
of this construct were produced to assess the overall performance
of the degron, which was finally named photosensitive degron
(psd) module (Fig.1a). The variants that were used in comparison
Controling Protein Stability with Light 243
Fig. 1 Engineering of the photosensitive degron (psd) module. (a) Design of the psd module and its variations.
The psd module is composed of A. thaliana LOV2 of phototropin 1 and a degron derived from murine ODC.As
photoreceptor, the LOV2 domain (amino acids M460 to P616 indicated by blue color) was chosen; at the
C-terminus it carries the so-called J-helix (orange color). The full degron sequences are given (green color).
The control for maximum degron activity was a fusion of LOV2 with ODC36, the control for minimal activity was
a LOV2 domain lacking any degron sequence. Degron sequences similar to ODC23 were fused to the LOV2
domain during optimization of the psd module. Variations in the LOV2 sequence comprised point mutations
that kept the LOV2 domain in the lit (LOV2I608E) or the dark (LOVC512A) state and were used to characterize the
behavior of the module with minimal and maximal photoreceptor activity. To optimize the construct, site-
directed mutagenesis was performed and the fusion point between LOV2 and the degron sequence was var-
ied. Finally, the whole construct was used in a random mutagenesis approach. (b) Mechanism of psd module
activation by blue light. Measurement of psd module variant performance was done with the constructs fused
to red fluorescence protein (RFP). The constitutive ADH1 promoter was used to express psd module variants.
In vivo, the psd module is inactive in darkness and the protein is stable. Upon blue light excitation of the LOV2
domain, the J-helix (indicated in yellow) is unfolded and the cODC1 degron is exposed and activated. This
induces ubiquitin-independent degradation of the construct by the proteasome. (c) Scheme showing RFP-psd
behavior in yeast. During growth in darkness, the RFP-psd fusion protein is highly abundant and the yeast cells
show high levels of red fluorescence. Cells grown in the presence of blue light show low fluorescence levels
due to depletion of RFP-psd
244 Christof Taxis
with the psd module were constructs with the full cODC1 sequence
and without any degron sequence to assess the maximal and mini-
mal degradation activity, respectively. Similarly, LOV2 mutants
that abolish signaling and lock the photoreceptor in the dark state
or the light state were used as well [9]. The optimization process
included the testing of psd module variants with changes in the
degron sequence, alterations of the fusion sequence between
LOV2 and cODC1 sequence, as well as testing of variants obtained
by site-directed mutagenesis and random mutagenesis [9, 16]. For
all constructs, red fluorescent protein (RFP) was used as reporter
sequence, which allowed facile quantification of psd module vari-
ant performance (Fig.1b, c). Examples for the diverse characteris-
tics that were measured in psd module variants are given in Table1.
Several conclusions can be drawn from our approach of gener-
ating a synthetic degron reactive to light, which might be valid for
the generation of other synthetic constructs as well. For successful
generation of a synthetic switch, the molecular mechanisms within
the sensor and the effector domain should be known. It is essential
to take every detail into account that influences the activity states
of both domains. Several different fusions of both domains should
Table 1
Characteristics of selected psd module variants
2 Materials
2.1 Yeast Strains For homologous recombination and analysis of the psd module,
no specific yeast strain is required; every wild type lab strain that
has the necessary auxotrophy markers can be used (e.g., ESM3561
[17], S288C background).
2.3 Yeast Media Standard media were used for yeast growth [18].
1. Yeast complete medium (YPD): 1% (w/v) yeast extract, 2%
(w/v) peptone, 2% (w/v) glucose.
2. Low-fluorescence medium [16]: 5 g/l (NH4)2SO4, 1 g/l
KH2PO4, 0.5 g/l MgSO4, 0.1 g/l NaCl, 0.1 g/l Ca2Cl, 0.5
mg/l H3BO4, 0.04 mg/l CuSO4, 0.1 mg/l KI, 0.2 mg/l
FeCl3, 0.4 mg/l MnSO4, 0.2 mg/l Na2MoO4, 0.4 mg/l
ZnSO4, 2 mg/l biotin, 0.4 mg/l calcium pantothenate, 2
mg/l inositol, 0.4 mg/l niacin, 0.2 mg/l 4-aminobenzoic acid
246 Christof Taxis
2.5 Plasmid Rescue 1. Breaking buffer: 2% (v/v) Triton X-100, 1% (w/v) sodium
fromYeast dodecylsulfate (SDS), 100 mM NaCl, 10 mM TrisHCl pH
8.0, 1 mM EDTANaOH pH 8.0.
2.6 Cell Lysis 1. Alkaline lysis buffer: 1.85M NaOH, 7.5% -mercaptoethanol.
andImmunoblotting 2. High urea buffer: 5% (w/v) SDS, 8M urea, 200 mM Na2HPO4/
NaH2PO4 pH 6.8, 0.1 mM EDTA, 0.01% (w/v) bromophenol
blue.
3. Protein-precipitation buffer: 55% trichloroacetic acid (TCA)
(w/v)
4. Cycloheximide stock solution: 20 mg/ml.
5. Sodium azide buffer: 100 M NaN3.
6. Antibodies recognizing tagRFP are available from evrogen
(www.evrogen.com), antibodies against Tub1 (loading con-
trol) were obtained from Abcam (www.abcam.com).
2.7 Illumination 1. Light emitting diode (LED) stripes or clusters for illumination
ofYeast withBlue of yeast cells grown on plate or in liquid medium. The LED
Light setup should include a dimmer to achieve a photon flux of 30
mol m2 s1 at the level of the yeast cells. Single wavelength
LEDs for blue light illumination (output wavelength 465 nm)
or RGB LEDs with an appropriate controller can be used.
Homogeneous illumination is advisable, which might be easier
to achieve with many LEDs of lower light intensity output
then with few high-power LEDs.
2. An optometer (e.g., P2000, equipped with light detector
D-9306-2, Gigahertz-Optik, Trkenfeld, Germany) to mea-
sure the light-intensity used for illumination of yeast cells.
Controling Protein Stability with Light 247
3 Methods
3.1 Cloning Generation of shuttle vectors for yeast and Escherichia coli by
byHomologous homologous recombination has been described previously [19].
Recombination The method can be adapted in many ways to generate gene fusions
inYeast (Fig.2).
1. Design primers for amplification of the gene of interest. The
primers have two parts: for the 3-end, sequences that allow
AtLOV2 amplification are chosen. At the 5-end, sequences
derived from the vector are added, which will be used for the
homologous recombination step in yeast that generates the
final vector.
2. Perform PCR to generate the DNA fragment with the LOV2
photoreceptor domain (see Note 1). To generate photorecep-
tor variants, a PCR using mutagenic conditions can be per-
formed (see Note 2).
3. Linearize the target vector by restriction enzymes. The
sequences for homologous recombination should flank the gap.
4. Cotransform the fragments into frozen-competent S. cerevisiae
cells.
5. Rescue the plasmid from yeast into E. coli cells, isolate it and
verify the construct by enzymatic digest and sequencing.
3.2 Design Target gene-specific primers contain sequences that are homolo-
ofPrimers forCloning gous to the target gene and sequences homologous to the vector
byHomologous sequence, which are added to the 5 ends (Fig.2). The resulting
Recombination PCR product contains the target gene (e.g., LOV2 photoreceptor)
flanked by sequences for homologous recombination. In the same
way, the vector backbone can be generated with one or several
oligonucleotide pairs (see Note 1).
248 Christof Taxis
Fig. 2 Workflow chart of psd module generation. Step 1: Primer design strategy for the cloning of the photore-
ceptor LOV2 into a yeast vector by homologous recombination. The primers have two parts; the 3-end con-
tains the sequence necessary to amplify the LOV2 gene, the 5-end consists of sequence, which is identical to
the vector sequence and will be used for homologous recombination in yeast. Step 2: Generation of the PCR
product for homologous recombination. For a directed evolution approach, this PCR can be performed with
conditions that enhance the error rate of the polymerase, which results in PCR products containing a library of
photoreceptor mutants. Step 3: Linearization of the target vector, the sequences for homologous recombina-
tion should flank the gap in the plasmid. Step 4: Cotransformation of the linearized vector and the PCR prod-
ucts results in generation of the plasmid by homologous recombination. In case a directed evolution approach
is undertaken, an appropriate assay is performed at this stage to identify interesting clones. Step 5: Plasmid
rescue from yeast into E. coli to isolate the plasmid. The identity of the plasmid can be tested by enzymatic
digest and sequencing. Yeast is transformed with verified constructs for further tests. Step 6: Functional char-
acterization of the novel construct; quantification of target protein levels by fluorescence measurements and
immunoblotting as well as cycloheximide chase analysis at different illumination conditions. Characteristics of
several psd module variants are shown in Table1
Controling Protein Stability with Light 249
3.3 High-Fidelity 1. Standard PCR conditions can be used to generate the products
andError-Prone PCR used for homologous recombination. For cloning purposes, a
toGenerate DNA kit containing a high-fidelity polymerase (e.g., Phusion, KOD,
forHomologous or Herculase) is advisable to reduce the introduction of errors
Recombination during the reaction.
2. For a directed evolution approach, error-prone PCR followed
by in yeast ligation generates a library of clones [16, 20].
3. PCR is performed with Taq polymerase under conditions that
increase the error rate of the enzyme which is achieved by the
presence of different concentrations of MnCl2 (0, 0.62, and
1.25 mM) and a twofold excess of dCTP and dTTP (500 M
each in the final PCR reaction).
4. If necessary, the template vector can be destroyed after the
PCR step by enzymatic digest with DpnI, which cleaves
methylated DNA.Products obtained in this way are used
without further manipulations for homologous recombina-
tion in yeast.
3.4 Site-Directed The QuickChange protocol can be followed to change single posi-
Mutagenesis toCreate tions in the psd module by site-directed mutagenesis, which may
Specific psd Module result in psd modules with distinct characteristics. Mutations
Variants should be selected based on previous studies examining the same
photoreceptor domain or a homologous one. Furthermore,
changes that have been found in different variants obtained by ran-
dom mutagenesis can be combined in a single construct by this
method.
1. The oligonucleotides are designed as follows: the changed
codon is flanked by 15 bases matching the vector sequence.
Both forward and reverse primers are the reverse complement
of each other. At each end, a cytosine or guanidine is preferred
due to increased binding stability.
2. A whole vector PCR is performed with the template plasmid
using standard conditions. A low number of cycles is recom-
mended (<20).
3. The template plasmid is digested with DpnI that cleaves spe-
cifically methylated DNA.
4. The product of the PCR is transformed into E. coli by a stan-
dard method [21].
3.5 Yeast The protocol for yeast transformation is based on the lithium ace-
Transformation tate method [22] and has been described previously [2326].
1. Yeast cells are inoculated from an overnight preculture (approx.
1:50 dilution) and grown to an optical density (A600) of 0.81.0
at 30 C in 50ml of YPD medium.
250 Christof Taxis
3.6 Plasmid Rescue A modified standard method is used to transfer plasmids from yeast
fromYeast to E. coli for further usage [21].
1. An amount of yeast cells corresponding to the size of a match
head is scraped off a plate and dissolved in 500 l of breaking
buffer.
2. 200 l of phenolchloroformisoamyl alcohol mixture
(25/24/1, buffered with TE, pH 7.58) and 0.3 g of glass
beads (~200 l) are added.
3. Cells are disrupted by vortexing (5 min, highest speed) and
phases are separated in a microcentrifuge (10 min, 16,000 g).
4. 400 l of the aqueous layer are transferred to a new tube and
1ml of ethanol is added to this tube.
5. The tube is incubated at 20 C for 10min and then subjected
to centrifugation (10 min, 16,000 g).
6. The supernatant is removed and the pellet is washed with 70%
ethanol.
7. The tube is centrifuged again (3 min, 16,000 g), the super-
natant removed and the pellet air-dried for 3min.
8. The pellet is dissolved in 20 l of desalted water.
9. 1 l of the solution is used for transformation of E. coli cells by
electroporation.
Controling Protein Stability with Light 251
3.7 Detection ofthe The target protein can be detected by immunoblotting using anti-
Target Protein RFP bodies directed against the tester protein tagRFP.For immunob-
byImmunoblotting lotting, crude cell extracts can be prepared by alkaline lysis [27].
1. 1ml of logarithmically growing cells (A600 = 1) is treated with
150 l of alkaline lysis buffer and kept for 10min on ice.
2. Protein precipitation is induced by addition of 150 l 55%
(w/v) trichloroacetic acid (TCA) followed by 10min incuba-
tion on ice.
3. The samples are subjected to centrifugation (10 min, 16,000
g) and the supernatant is removed. The pellet is dissolved in 60
l of high urea buffer by mixing the sample vigorously at 65 C.
4. The extracts are cleared from cell debris by centrifugation (10
min, 16,000 g), 1020 l of sample is loaded onto an SDS-
PAGE gel. Standard procedures can be used for SDS-PAGE
and blotting [28, 29].
3.9 Quantification The target protein RFP can directly detected by fluorescence mea-
ofTarget Protein surements with a fluorimeter. For the interpretation of the results,
Levels the maturation time of the used fluorescent protein has to be taken
byFluorescence into account.
1. 1ml of logarithmically growing cells (A600 = 1) is treated with
100 l of sodium azide buffer.
2. Samples are subjected to centrifugation (3 min, 500 g) and
1ml of the supernatant is removed. The pellet is dissolved in
the remaining supernatant.
252 Christof Taxis
3.10 Blue Light The photosensitive degron module is activated by blue light (465
Illumination ofYeast nm, 30 mol m2 s1); cells are grown under continuous illumina-
tion (see Note 3). The illumination regimen canbe easily adapted
for yeast cells growing on solid medium (see Note 4).
1. Yeast cells are grown in low fluorescence medium supple-
mented with 2% glucose in darkness or under continuous illu-
mination until mid-log phase is reached (see Note 5).
2. Degradation of the psd module is initiated by exposure of the
cells to blue light (465 nm, 30 mol m2 s1). The time frame
until depletion of the target proteinis achieved depends on the
psd module variant, but it can be expected that 24 h are suf-
ficient for short-lived psd module variants (see Note 3).
Immunoblotting or fluorescence measurements can be used to
quantify RFP-psd levels. Measuring the abundance of the con-
struct in cells kept under restrictive conditions (blue light-
exposed) and permissive conditions (darkness) gives a measure
for the depletion efficiency and the overall performance of the
psd module variant. Ongoing target protein synthesis will lead
to minimal amounts of target protein even after prolonged
exposure to blue light (see Note 6). The overall performance
of a psd module variant can be assessed with mutants, in which
the degron or the photoreceptor is inactivated (see Note 7).
4 Notes
Acknowledgments
References
1. Hershko A, Ciechanover A (1998) The ubiqui- 4. Dohmen RJ, Wu P, Varshavsky A (1994) Heat-
tin system. Annu Rev Biochem 67:425479 inducible degron: a method for constructing
2. Pickart CM (2001) Ubiquitin enters the new temperature-sensitive mutants. Science
millennium. Mol Cell 8(3):499504 263(5151):12731276
3. Ravid T, Hochstrasser M (2008) Diversity of 5. Banaszynski LA, Chen LC, Maynard-Smith
degradation signals in the ubiquitin-proteasome LA, Ooi AG, Wandless TJ (2006) A rapid,
system. Nat Rev Mol Cell Biol 9(9):679690 reversible, and tunable method to regulate
Controling Protein Stability with Light 255
protein function in living cells using synthetic 19. van Leeuwen J, Andrews B, Boone C, Tan G
small molecules. Cell 126(5):9951004 (2015) Rapid and efficient plasmid construc-
6. Taxis C, Stier G, Spadaccini R, Knop M (2009) tion by homologous recombination in yeast.
Efficient protein depletion by genetically con- Cold Spring Harb Protoc 2015(9): pdb
trolled deprotection of a dormant N-degron. prot085100
Mol Syst Biol 5:267 20. Renicke C, Spadaccini R, Taxis C (2013) A
7. Nishimura K, Fukagawa T, Takisawa H, tobacco etch virus protease with increased sub-
Kakimoto T, Kanemaki M (2009) An auxin- strate tolerance at the P1' position. PLoS One
based degron system for the rapid depletion of 8(6):e67915
proteins in nonplant cells. Nat Methods 21. Ausubel FM, Kingston, R.E., Seidman, F.G.,
6(12):917922 Struhl, K., Moore, D.D., Brent, R., and Smith,
8. Jungbluth M, Mosch HU, Taxis C (2012) F.A. (eds) (1995) Current protocols in molecu-
Acetate regulation of spore formation is under lar biology. John Wiley and Sons, NewYork,
the control of the Ras/cyclic AMP/protein NY
kinase A pathway and carbon dioxide in 22. Schiestl RH, Gietz RD (1989) High efficiency
Saccharomyces cerevisiae. Eukaryot Cell 11(8): transformation of intact yeast cells using single
10211032 stranded nucleic acids as a carrier. Curr Genet
9. Renicke C, Schuster D, Usherenko S, Essen 16(56):339346
LO, Taxis C (2013) A LOV2 domain-based 23. Janke C, Magiera MM, Rathfelder N, Taxis C,
optogenetic tool to control protein degrada- Reber S, Maekawa H, Moreno-Borchart A,
tion and cellular function. Chem Biol 20(4): Doenges G, Schwob E, Schiebel E, Knop M
619626 (2004) A versatile toolbox for PCR-based tag-
10. Christie JM, Salomon M, Nozue K, Wada M, ging of yeast genes: new fluorescent proteins,
Briggs WR (1999) LOV (light, oxygen, or more markers and promoter substitution cas-
voltage) domains of the blue-light photorecep- settes. Yeast 21(11):947962
tor phototropin (nph1): binding sites for the 24. Taxis C, Knop M (2006) System of centro-
chromophore flavin mononucleotide. Proc meric, episomal, and integrative vectors based
Natl Acad Sci U S A 96(15):87798783 on drug resistance markers for Saccharomyces
11. Harper SM, Neil LC, Gardner KH (2003) cerevisiae. Biotechniques 40(1):7378
Structural basis of a phototropin light switch. 25. Taxis C, Knop M (2012) TIPI: TEV protease-
Science 301(5639):15411544 mediated induction of protein instability.
12. Erales J, Coffino P (2014) Ubiquitin- Methods Mol Biol 832:611626
independent proteasomal degradation. 26. Lutz AP, Renicke C, Taxis C (2016) Controlling
Biochim Biophys Acta 1843(1):216221 protein activity and degradation using blue
13. Takeuchi J, Chen H, Coffino P (2007) light. Methods Mol Biol 1408:6778
Proteasome substrate degradation requires 27. Yaffe MP, Schatz G (1984) Two nuclear muta-
association plus extended peptide. EMBO tions that block mitochondrial protein import
J26(1):123131 in yeast. Proc Natl Acad Sci U S A 81(15):
14. Takeuchi J, Chen H, Hoyt MA, Coffino P 48194823
(2008) Structural elements of the ubiquitin- 28. Laemmli UK (1970) Cleavage of structural
independent proteasome degron of ornithine proteins during the assembly of the head of
decarboxylase. Biochem J410(2):401407 bacteriophage T4. Nature 227(5259):
15. Jungbluth M, Renicke C, Taxis C (2010) 680685
Targeted protein depletion in Saccharomyces 29. Towbin H, Staehelin T, Gordon J(1979)
cerevisiae by activation of a bidirectional Electrophoretic transfer of proteins from poly-
degron. BMC Syst Biol 4:176 acrylamide gels to nitrocellulose sheets: proce-
16. Usherenko S, Stibbe H, Musco M, Essen LO, dure and some applications. Proc Natl Acad Sci
Kostina EA, Taxis C (2014) Photo-sensitive U S A 76(9):43504354
degron variants for tuning protein stability by 30. Ninnemann H, Butler WL, Epel BL (1970)
light. BMC Syst Biol 8:128 Inhibition of respiration in yeast by light.
17. Pereira G, Tanaka TU, Nasmyth K, Schiebel E Biochim Biophys Acta 205(3):499506
(2001) Modes of spindle pole body inheritance 31. Yee EF, Diensthuber RP, Vaidya AT, Borbat PP,
and segregation of the Bfa1p-Bub2p check- Engelhard C, Freed JH, Bittl R, Moglich A,
point protein complex. EMBO J20(22): Crane BR (2015) Signal transduction in light-
63596370 oxygen-voltage receptors lacking the adduct-
18. Sherman F (2002) Getting started with yeast. forming cysteine residue. Nat Commun
Methods Enzymol 350:341 6:10079
Chapter 16
Abstract
Optogenetic approaches enable the control of biological processes in a time- and space-resolved manner.
These light-based methods are noninvasive and by using light as sole activator minimize side effects in
contrast to chemical inducers. Here, we provide a protocol for the targeted control of the activity of protein
kinases in mammalian cells based on the photoreceptor cryptochrome 2 (CRY2) of Arabidopsis thaliana
and its interaction partner CIB1. Blue light (450nm)-induced binding of CRY2 to CIB1 allows the
recruitment of a chimeric cytosolic protein kinase AKT1 to the plasma membrane accompanied with
stimulation of its kinase activity. This protocol comprises the transient and stable implementation of the
light-regulated system into mammalian cells and its stimulation by blue light-emitting diodes (450nm)
irradiation as well as analysis of the light-activated AKT1.
Key words Optogenetics, Signal transduction, Protein kinases, Membrane recruitment, AKT, CRY2
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_16, Springer Science+Business Media LLC 2017
257
258 Wignand W.D. Mhlhuser et al.
Fig. 1 Functional principle of a CRY2/CIBN-based optoKinase. Irradiation of the system with blue light (450nm)
results in a conformational change of CRY2 to its biological active form within seconds. (a) The photoexcited
CRY2 fusion proteins form homooligomers which leads to clustering of the chimeric kinase. (b) In the presence
of CIBN, photoexcited CRY2 additionally forms heterodimers with CIBN.This characteristic can be utilized for
recruitment of the chimeric kinase toward specific subcellular compartments. Oligomers dissociate in the dark
within minutes. CRY2: photolyase homology domain of CRY2, aa 1489; CIBN: CIB1, aa 1170
2 Materials
2.4 Irradiation 1. Light boxes: Build out of opaque PVC material. Panels of
andReadout LEDs emitting light with a wavelength of 450nm should be
placed on the top of the box (Roithner LaserTechnik, LED450-
series). The intensity of the LEDs has to be adjustable. Further,
it is advantageous to include a mean of further programming
the LEDs ON/OFF time to address temporal aspects of sig-
naling. A ventilation of the light box should be included to
ensure that the temperature as well as atmosphere in the box
corresponds to the surroundings (see Note 1).
2. LED safe lights with wavelength longer than 500nm.
2.5 Western Blot 1. 5 SDS-loading buffer: 10% (w/v) SDS, 0.3M TrisHCl (pH
6.8), 50% (v/v) Glycerin, 12.5% (v/v) -mercaptoethanol,
0.05% (w/v) bromphenol blue in fully desalinated H2O.
2. ECL solutions.
3. TENT cell lysis buffer (modified): 20mM TrisHCl (pH 8.0),
1mM EDTA, 100mM NaCl, 0.5% (v/v) Triton X-100, 1mM
sodium orthovanadate, 10mM sodium pyrophosphate,
Optogenetic Control of Protein Kinases 261
2.7 Cell Lines 1. C2C12: DSMZ, Braunschweig, Germany, cat. no. ACC 565.
2. HEK293T: DSMZ, Braunschweig, Germany, cat. no. ACC 635.
3. Platinum E: Cell Biolabs, INC., San Diego, USA, cat. no.
RV-101.
4. MCF7: DSMZ, Braunschweig, Germany, cat. no. ACC 115.
HEK293T, Platinum E, and MCF7 cells are cultured in DMEM
supplemented with 10% (v/v) FCS and penicillin (100U/ml)/
streptomycin (100g/ml). C2C12 cells are cultured in DMEM sup-
plemented with 15% (v/v) FCS and 1% (v/v) penicillin/streptomycin.
Starvation was performed with DMEM supplemented with penicillin
(100U/ml)/streptomycin (100g/ml) (see Note 2).
262 Wignand W.D. Mhlhuser et al.
Table 1
List of constructs used for the described methods in this protocol
2.8 DNA Constructs See Table 1 for the list of constructs. For the transfection, it is
important to use high-purity plasmid DNA, which can be obtained
for example with Jetstar 2.0 Midiprep kit.
3 Methods
3.1 Expression 1. Day 1: Begin with a 10-cm plate with ~80% confluent
ofoptoAKT HEK293T (transfection and lentiviral vector transduction) or
inMammalianCells Platinum E (retroviral vector transduction) cells. Pre-warm
culture medium, PBS, and trypsin-EDTA solution in a 37C
water bath. When preparing samples for fluorescence microscopy,
place autoclaved coverslips into wells of 24-well plate.
2. Aspirate culture medium and wash once with PBS to remove
residual culture medium before adding 1ml of trypsin-EDTA
solution. Place cells back into incubator for ~3min. After incu-
bation use a serological pipette to flush the plate with 5ml
culture medium and transfer the cell suspension into a 15ml
conical centrifuge tube. Centrifuge the conical centrifuge tube
containing the cell suspension for 3min at 300g. Afterward,
discard the supernatant and resuspend the cell pellet in 10ml
culture medium. Dilute appropriate amount of cell suspension
(dependent on CASY setup) in 10ml CASY ton buffer within
a CASY cup and determine cell number using CASY cell counter
(see Note 3).
3.2 Light Experiment 1. Day 1: Start with optoAKT expressing cells on 6-well or
andReadout 24-well plate transfected/seeded the day before (see
Subheadings 3.1.1 and 3.1.2, respectively), which should have
a confluence of ~80% in the evening. Replace culture medium
with starvation medium (see Note 13) and place plates back
into incubator. It is important that the cells are not exposed to
any source of irradiation (390480nm) that would inadver-
tently excite the optogenetic system during starvation.
2. Day 2: In the morning (~1215h post starvation) cells are
ready for the experiment. The exact conditions of irradiation
vary depending on the desired readout.
3.2.1 Western Blot 1. For analysis of optoAKT by Western blotting set the intensity
Analysis of the LEDs in the light box to 150mol/(m2s) and irradiate
the cells 15 times for 5s/min or constantly with a lower inten-
sity (see Note 14). Intensities higher than 50mol/(m2s) may
induce photo-cytotoxic effects when applied for extended time
periods. Before further processing the cells ensure that ambi-
ent light is turned off and safe light is turned on (see Note 15)
and that there are no additional sources of light which acciden-
tally could activate the optogenetic system.
2. Aspirate medium and wash cells once with PBS before adding
250l ice-cold modified TENT cell lysis buffer. Gently shake
the plates to evenly distribute the lysis buffer. Incubate the
plates for 10min on ice.
3. Use a cell scraper to detach the cells and transfer the cell lysate
into a precooled 1.5ml Eppendorf tube. Sonicate the lysate for
15min (30s/min pulses) at 4C to fragment DNA and lower
viscosity. In the next step, centrifuge lysates for 15min at
10,000g and 4C to pellet the insoluble components.
266 Wignand W.D. Mhlhuser et al.
3.2.2 Fluorescence 1. Day 1: Place one of the 24-well plates you transfected/seeded
Microscopy (see Subheadings 3.1.1 and 3.1.2) the day before into a light
box while the control plate remains in the dark. Afterward irradi-
ate cells with 1.5mol/(m2s) for 5min.
2. Switch on safe lights before taking cells out of the incubator to
prevent uncontrolled activation of the optoKinase system.
Subsequently, wash them once with DPBS before adding
200 l 4% paraformaldehyde cell fixation solution per well
(see Note 18).
3. Let the cells incubate for 10min on ice and subsequently for
additional 10min at room temperature. Afterward, the sam-
ples do not have to be handled under safe light anymore.
4. Apply 7l mowiol (with DABCO) onto a microscope slide, try
to avoid generating air bubbles.
5. Use pincers to pick up cover slip and dip it a couple of times
into water to remove excess of paraformaldehyde. Use a cos-
Optogenetic Control of Protein Kinases 267
Fig. 2 Western blot analysis of cells expressing optoAKT. (a) HEK293T cells were transiently co-transfected with
CRY2-EGFP-AKT1 (pGR427) and either membrane anchored CIBN-mCherry-CaaX (pGR464) (+) or junk DNA ().
After overnight serum-starvation those cells were irradiated with blue light (450nm, 40mol/(m2s)) for 15min (+)
or kept in the dark (). Whole cell lysates were prepared and subjected to Western blot analysis using the designated
antibodies. (b) MCF7 cells co-transduced with CRY2-EGFP-HA-AKT1PH (pWM043) and membrane anchored m/p-
mCherry-CIBN (pWM023) were serum-starved overnight. Afterward, those cells were either irradiated with blue light
(450nm) with an intensity of 150mol/(m2s) for 5s/min 15 times (Pulse), with a constant intensity of 5mol/(m2s)
for 15min (Const.) or kept in the dark (). Whole cell lysates were prepared and equal amounts of lysate were sub-
jected to Western blot analysis using the designated antibodies. endog. AKT endogenous AKT
Fig. 3 Fluorescence microscopic analysis of light-induced plasma membrane recruitment. Transduced cells,
co-expressing photoactivatable CRY2-YFP-AKT1 [6] and membrane anchored m/p-mCherry-CIBN (pWM029),
were seeded on cover slips and serum-starved overnight. Serum-starved cells were then either irradiated with
blue light (450nm, 1.5mol/(m2s)) for 5min or kept in the dark. Afterward, cells fixated with paraformaldehyde
were analyzed by fluorescence microscopy. Scale bar: 10m
metic tissue to absorb the water and place the coverslip with
the cells first on the drop of mowiol. Let the slides dry over-
night in the dark to prevent bleaching.
6. Day 2: Use nail polish to seal the samples before looking at
them under the fluorescence microscope (Fig. 3).
268 Wignand W.D. Mhlhuser et al.
4 Notes
1. For a detailed description of the light boxes, see refs. 16, 17.
2. It is also possible to use other cell lines. However, be aware
that signal transduction can differ between cell lines and that
the procedure described here might not be directly transfer-
able to other cell lines.
3. When no CASY cell counter is available, a hemocytometer in
combination with a bright field microscope can be used to deter-
mine the cell number. If there is also no hemocytometer available,
the amount of cells to be seeded can be vaguely estimated.
One dense 10-cm plate contains approximately 1.5107cells.
4. When rocking the plate try to form a lying eight or perform a
north-south followed by an east-west movement. Avoid circu-
lar movement, since this is causing an accumulation of the cells
in the middle of the plate. Once placed in the incubator do not
move the plate for at least a couple of hours to ensure attach-
ment of the cells.
5. To optimize the optoSystem the amount and/or the ratio of
CRY2 and CIBN constructs can be adjusted.
6. Perform same movement as for seeding to prevent local accu-
mulation of transfection mix.
7. The generation of a stable cell line takes time to begin with but
is going to save time later. Furthermore, the overall expression
level of the recombinant proteins can be further refined by cell
sorting.
8. Instead of using a packaging cell line (i.e., Platinum E) the
generation of retroviral vectors can be conducted by transfecting
HEK293T cells with the appropriate helper plasmids.
9. When filtrating viral particles use a filter with low protein-
binding properties. PVDF and nitrocellulose filter will bind
viral particles and strongly reduce transduction efficiency.
10. Wrap plates carefully with parafilm to prevent accidental splash-
ing of viral particles and to delay equilibration of CO2 with
surrounding.
11. In case trypsin-sensitive cells are used it may be advisable to
centrifuge the cells and discard the supernatant to remove all
trypsin; alternatively, an enzyme-free detachment solution can
be used.
12. It is possible (and a good idea) to expand the stable cell line
generated at this point or after a first experiment, ensuring
proper functionality of the optoSystem. This allows skipping
future work under BSL2 conditions and also provides a backup
of cells.
Optogenetic Control of Protein Kinases 269
Acknowledgments
References
1. Hubbard MJ, Cohen P (1993) On target with 5. Chatelle CV, Hvermann D, Mller A etal
a new mechanism for the regulation of protein (2016) Optogenetically controlled RAF to
phosphorylation. Trends Biochem Sci 18:172 characterize BRAF and CRAF protein kinase
177. doi:10.1016/0968-0004(93)90109-Z inhibitors. Sci Rep 6:23713. doi:10.1038/
2. Tischer D, Weiner OD (2012) Illuminating srep23713
cell signalling with optogenetic tools. Nat Rev 6. Katsura Y, Kubota H, Kunida K etal (2015)
Mol Cell Biol 15:551558. doi:10.1038/ An optogenetic system for interrogating the
nrm3837 temporal dynamics of Akt. Sci Rep 5:14589.
3. Beyer HM, Naumann S, Weber W, Radziwill G doi:10.1038/srep14589
(2015) Optogenetic control of signaling in 7. Ahmad M, Cashmore AR (1993) HY4 gene of
mammalian cells. Biotechnol J10:273283. A. thaliana encodes a protein with characteris-
doi:10.1002/biot.201400077 tics of a blue-light photoreceptor. Nature
4. Wend S, Wagner HJ, Mller K etal (2014) 366:162166. doi:10.1038/366162a0
Optogenetic control of protein kinase activity 8. Cui Y, Choudhury SR, Irudayaraj J(2014)
in mammalian cells. ACS Synth Biol 3:280 Quantitative real-time kinetics of optogenetic
285. doi:10.1021/sb400090s proteins CRY2 and CIB1/N using single-
270 Wignand W.D. Mhlhuser et al.
molecule tools. Anal Biochem 458:5860. recombinase. Nat Chem Biol 12(6):425430.
doi:10.1016/j.ab.2014.04.023 doi:10.1038/nchembio.2063
9. Kennedy MJ, Hughes RM, Peteya LA etal 14. Reiser J, Harmison G, Kluepfel-Stahl S etal
(2010) Rapid blue-light-mediated induction of (1996) Transduction of nondividing cells using
protein interactions in living cells. Nat Methods pseudotyped defective high-titer HIV type 1
7:973975. doi:10.1038/nmeth.1524 particles. Proc Natl Acad Sci U S A 93:15266
10. Zhang K, Duan L, Ong Q etal (2014) Light- 15271. doi:10.1073/pnas.93.26.15266
mediated kinetic control reveals the temporal 15. Zhang X-Y, La Russa VF, Reiser J(2004)
effect of the Raf/MEK/ERK pathway in PC12 Transduction of bone-marrow-derived mesen-
cell neurite outgrowth. PLoS One 9:e92917. chymal stem cells by using lentivirus vectors
doi:10.1371/journal.pone.0092917 pseudotyped with modified RD114 envelope
11. Kakumoto T, Nakata T (2013) Optogenetic glycoproteins. JVirol 78:12191229.
control of PIP3: PIP3 is sufficient to induce doi:10.1128/JVI.78.3.1219-1229.2004
the actin-based active part of growth cones 16. Mller K, Engesser R, Metzger S etal (2013)
and is regulated via endocytosis. PLoS One A red/far-red light-responsive bi-stable toggle
8:e70861. doi:10.1371/journal. switch to control gene expression in mamma-
pone.0070861 lian cells. Nucleic Acids Res 41:e77.
12. Taslimi A, Vrana JD, Chen D etal (2014) doi:10.1093/nar/gkt002
Probing protein interaction and function. Nat 17. Mller K, Zurbriggen MD, Weber W (2014)
Commun 5:19. doi:10.1038/ncomms5925 Control of gene expression using a red- and
13. Taslimi A, Zoltowski B, Miranda JG etal far-red light-responsive bi-stable toggle switch.
(2016) Optimized second-generation CRY2 Nat Protoc 9:622632. d oi:10.1038/
CIB dimerizers and photoactivatable Cre nprot.2014.038
Chapter 17
Abstract
Ion channels control the electrical properties of cells by opening and closing (gating) in response to a wide
palette of environmental and physiological stimuli. Endowing ion channels with the possibility to be gated
by remotely applied stimuli, such as light, provides a tool for invivo control of cellular functions in behaving
animals. We have engineered a synthetic light-gated potassium (K+) channel by connecting an exogenous
plant photoreceptor LOV2 domain to the K+ channel pore Kcv. Here, we describe the experimental strat-
egy that we have used to evolve the properties of the channel toward full control of light on pore gating.
Our method combines rational and random mutagenesis of the channel followed by a yeast-based screen-
ing system for light-activated K+ conductance.
Key words Functional complementation, Protein evolution, Rational and random mutagenesis,
Light, Screening, S. cerevisiae, Optogenetics, Ion channels, Potassium (K+), Gating
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_17, Springer Science+Business Media LLC 2017
271
272 Cristian Cosentino et al.
2 Materials
2.1 Coding 1.
LOV2 domain: aminoacids 404546 of Avena sativa
Sequences Phototropin 1 (NPH1-1) (GenBank: AAC05083.1).
fortheLOV2 Domain 2. Kcv: aminoacids 294 of Paramecium bursaria Chlorella virus 1
andtheKcv Channel potassium ion channel protein (PBCV-1-Kcv) (NP_048599.1).
2.2 Expression 1. The pYES2-Met25 expression vector [6] was used for protein
Vector expression in Saccharomyces cerevisiae.
2.3 Cloning 1. Escherichia coli (DH5) for cloning procedures and plasmid
andExpression DNA amplification.
Organisms 2. Saccharomyces cerevisiae trk1 trk2 mutant (SGY1528) for
functional complementation by light-driven K+ ion channels.
2.4 E. coli 1. LB medium: add 10g Tryptone, 5g Yeast Extract, 10g NaCl
GrowthMedia to 800mL ultrapure water. Mix and adjust pH to 7.0 with 1M
NaOH.Make up to 1L with water. Autoclave and store at
RT.Before use, add selective antibiotics. For solid LB medium
proceed as previous step and add 15g/L agar. After steriliza-
tion allow the medium to cool down, add selective antibiotics,
and then pour medium into petri dishes. Seal solid plates with
parafilm and store in the dark at +4C (see Note 1).
2. Ampicillin: 50mg/mL stock solution. Weigh 500mg
Ampicillin sodium salt and dissolve in 10mL ultrapure water.
Make aliquots and store in the dark at 20C (see Note 2).
3. Gentamycin: 20mg/mL stock solution. Weigh 200mg
Gentamycin sulfate; prepare a 10mL solution and aliquot as in
the previous step (see Note 2).
2.7 Light Irradiation 1. Functionally effective Blue light: Tri-Star Rebel LED (Luxeon
#MR-R0500-20T) containing three Royal-Blue LEDs, mounted
on 20mm Tri-Star Saber base: 2730mW at recommended
operating current 700mA; =447.5nm (440460nm); beam
angle 125.
2. LED Heat Sink: Alpha Heat Sink (Luxeon #N80-20B) with
convection thermal resistance rating of 2.85C/W and
808020mm footprint.
3. LED adhesive tape: thermally conductive, electrically isolating
and adhesive Bond-Ply 100 pad (Luxeon #LXT-T-12) cut to
fit the 20mm Luxeon LEDs Tri-Star base. Operational tem-
perature from 30C to 120C; thermal performance
4.5C/W.
4. Functionally ineffective Red light: Tri-Start Rebel LED
(Luxeon #MR-H2060-20T) containing three RedOrange
LEDs, mounted on 20mm Tri-Star Saber base: 366mW at
recommended operating current 700mA; =617nm
(610620nm); beam angle 125.
5. Safety light: Deep-Orange co-extruded polycarbonate film
(Rosco Supergel #22) applied to main room light source: RGB
240:80:0; transmittance ~0% at <540nm.
276 Cristian Cosentino et al.
Fig. 2 Growth chamber for yeast-based light/dark complementation assay: (a) side view of the incubation
chamber; (b) top view of the workbench. Detailed scheme of LED assembly and LED components is shown at
the right side of each panel
Engineering Light-Regulated K+ Channels 277
3 Methods
3.2 Transformation Commercially available kits such as the Frozen-EZ yeast transfor-
ofS. cerevisiaeCells mation II allow for a high yield in yeast transformation
procedures.
1. Follow manufacturers instruction to transform cells (see
Note 10).
2. Plate up to 5L cells over 1/3 of a minimal SD medium plate.
3. Incubate plates up to 34days at 30C.
278 Cristian Cosentino et al.
3.3 Rational Two main strategies were followed to build a synthetic light-driven
andRandom ion channel: first, a rational approach was pursued, which consisted
Mutagenesis in connecting the sensor to the pore module in different positions
Strategies guided by what is known on the gating mechanism of the channel.
This was followed by a random mutagenesis approach aiming to
improve the properties of a promising candidate retrieved from the
previous approach. Rational mutagenesis was performed using a
combination of different PCR amplification methods. The stan-
dard thermal cycler program in combination with Pfu DNA poly-
merase is as follows: step 1, 30s at 95C; step 2 (1535cycles),
10s at 95C, 20s at Tm, 1min per kb of amplicon at 72C; step
3, 57min at 72C; step 4, 7C for unlimited time.
3.3.1 Rational TE-PCR extends both termini of a target sequence for further
Mutagenesis: Terminal sequence manipulation (e.g., restriction enzyme cloning; OE-PCR;
Extension PCR (TE-PCR) motif addiction; see Fig. 3a). To set up PCR parameters, only the
primer region annealing to the target sequence has to be taken into
account. The reaction is based on a standard PCR protocol based
on Pfu DNA polymerase, following the standard reagent concen-
tration and the standard thermal cycler program as per manufac-
turers instructions.
3.3.2 Rational The OE-PCR allows joining of regions originally separated in the
Mutagenesis: Overlap native sequence (see Fig. 3b). Two partially overlapping amplicons
Extension PCR (OE-PCR) are generated through terminal extension PCR.
OE-PCR occurs with an initial step using a mixture of these
amplicons as reciprocal primers; following this step, a standard
PCR protocol enriches the newly generated construct.
1. Generate partially overlapping amplicons through TE-PCR
(see Subheading 3.3.1) using a combination of one TE-PCR
primer and one OE-PCR primer: the resulting fragments will
have a common annealing region.
2. Isolate amplicons running the PCR reaction on 1% Agarose gel
and purify the desired fragment with any commercially available
DNA gel extraction kit.
3. First OE-PCR reaction: mix within a PCR tube 0.75U Pfu
DNA polymerase, 1 Pfu polymerase buffer, 200M dNTPs,
40ng of the longest and partially overlapping amplicon; 1:1
molar ratio of the shorter overlapping amplicon; make final
volume up to 50L with ultrapure water.
4. Set up standard PCR protocol, with following modifications:
Step 2, 15cycles and Tm at 55C; skip step 3, move directly
to step 4 (7C).
5. Second OE-PCR reaction: add 0.5L of 10M primers
(forward and reverse) to allow full amplification of the newly
generated construct.
Engineering Light-Regulated K+ Channels 279
Fig. 3 PCR-based cloning methods: (a) terminal extension PCR (TE-PCR) workflow; (b) overlap extension PCR
(OE-PCR) workflow; (c) site directed mutagenesis (SDM-PCR) workflow
3.3.5 Random Gap repair allows the generation of libraries of a randomly mutated
Mutagenesis: GapRepair clone within the same non-mutagenized vector background
(see Fig. 4). High efficiency yeast transformation is recommended.
Gap repair transformation requires an open plasmid, with terminal
regions annealing to the terminal regions of the mutagenized frag-
ment that has to be inserted (see Note 11).
Fig. 4 Gap repair-based library preparation in yeast. RE stands for restriction site; P stands for EP-PCR primer
Engineering Light-Regulated K+ Channels 281
3.4 Light-Driven The yeast mutant strain SGY1528 (see Note 14) is suitable for
Functional functional complementation tests of light-gated synthetic potas-
Complementation sium channels inserted in pYES2-Met25 vector. Functional com-
plementation is performed on SEL-U-M medium supplemented
with KCl at a selective concentration. The differential growth
between light and dark exposed colonies determines which clones
are functional. Light-driven functional complementation can either
be performed in low throughput by means of a drop-test assay or
in high-throughput.
3.4.1 Low-Throughput The drop test method allows fine screening of tens of colonies on
Screening byDrop-Test a single plate by functional complementation. Tenfold serial dilu-
tions of liquid cell culture are spotted onto solid selective medium
and grown under light irradiation or in the dark. The differential
growth rate of the same colony, at the same dilution, at the two
different conditions, reflects a different ability in complementing
the defective yeast phenotype.
282 Cristian Cosentino et al.
3.4.2 High-Throughput This step allows the replication of the same colony over two plates
Screening byReplica with selective medium. The replica plates are then incubated under
Plating different growing conditions and differentially growing colonies
identified and selected for further analysis.
1. With a sterile velvet cloth, replicate colonies grown onto each
nonselective plate onto two different 150mm plates con-
taining SEL-U-M+A supplemented with the desired selective
KCl concentration.
2. Seal and number the two selective plates according to mother
plate number and selection condition and mark each to report
the orientation as for the nonselective plate (see Note 16).
3. Incubate plates at 30C in the growth chamber. One subset of
plates must be placed under effective light irradiation, the
second subset must be grown in the dark (see Note 17).
4. After 3 days, light-irradiated and dark grown plates are compared
to find differentially grown yeast colonies (see Note 18).
Colonies that have been identified by differential growth in
replica plating must be validated to eliminate false positives.
5. To validate the phenotype, identify the colonies that show
differential growth between light and dark conditions follow-
ing replica plating.
6. Inoculate the selected colonies in liquid nonselective medium
(SD-U+A+100mM KCl) and purify plasmid from the liquid
growth.
7. Transform S. cerevisiae competent cells and confirm the pheno-
type (dark/light differential growth) by drop test.
4 Notes
16. Seal plates with parafilm to protect cell culture from contami-
nation and drying. Orientation mark will help to identify the
original colony on the mother plate.
17. Effective irradiation to allow yeast functional complementa-
tion of BLINK light-driven potassium channel [5]:
21020W/cm2 using Royal Blue Light (=447nm).
18. The average yield of differentially growing colonies obtained is
up to 20 per plate.
Acknowledgments
References
1. Ohndorf UM, MacKinnon R (2005) 5. Christie JM, Arvai AS, Baxtger KJ, Heilmann
Construction of a cyclic nucleotide-gated KcsA M, Pratt AJ, OHara A, Kelly SM etal (2012)
K+ channel. JMol Biol 350:857865 Plant UVR8 photoreceptor senses UV-B by
2. McCoy JG, Rusinova R, Kim DM, Kowal J, tryptophan-mediated disruption of cross-dimer
Banerjee S, Jaramillo Cartagena A, Thompson salt bridges. Science 335:14921496
AN, Kolmakova-Partensky L, Stahlberg H, 6. Minor DL, Masseling SJ, Jan YN, Jan LY (1999)
Andersen OS, Nimigean CM (2014) A KcsA/ Transmembrane structure of an inwardly rectify-
MloK1 chimeric ion channel has lipid- ing potassium channel. Cell 96:879891
dependent ligand-binding energetics. JBiol 7. Chatelain FC, Gazzarrini S, Fujiwara Y,
Chem 289(14):95359546 Arrigoni C, Domigan C, Ferrara G, Pantoja C,
3. Arrigoni C, Schroeder I, Romani G, Van Etten Thiel G, Moroni A, Minor DL Jr (2009)
JL, Thiel G, Moroni A (2013) The voltage- Selection of inhibitor-resistant viral potassium
sensing domain of a phosphatase gates the pore channels identifies a selectivity filter site that
of a potassium channel. JGen Physiol affects barium and amantadine block. PLoS
141:389395 One 4(10):e7496
4. Cosentino C, Alberio L, Gazzarrini S, Aquila 8. Tang W, Ruknudin A, Yang WP, Shaw SY,
M, Romano E, Cermenati S, Zuccolini P etal Knickerbocker A, Kurtz S (1995) Functional
(2015) Engineering of a light-gated potassium expression of a vertebrate inwardly rectifying K+
channel. Science 348:707710 channel in yeast. Mol Biol Cell 6:12311240
Chapter 18
Abstract
Proteins frequently display modular architecture with several domains and segments connected by linkers.
Proper protein functionality hinges on finely orchestrated interactions among these constituent elements.
The underlying modularity lends itself to the engineering of hybrid proteins via modular rewiring; novel
properties can thus be obtained, provided the linkers connecting the individual elements are conducive to
productive interactions. As a corollary, the process of protein engineering often encompasses the genera-
tion and screening of multiple linker variants. To aid these steps, we devised the PATCHY method (primer-
aided truncation for the creation of hybrid proteins) to readily generate hybrid gene libraries of predefined
composition. We applied PATCHY to the mechanistic characterization of hybrid receptors that possess
blue-light-regulated histidine kinase activity. Comprehensive sampling of linker composition revealed that
catalytic activity and response to light are primarily functions of linker length. Variants with linkers of 7n
residues mostly have light-repressed activity but those with 7n + 1 residues mostly have inverted, light-
induced activity. We further probed linker length in the context of single residue exchanges that also lead
to an inversion of the signal response. As in the original context, activity is only observed for certain peri-
odic linker lengths. Taken together, these results provide mechanistic insight into signaling strategies
employed by sensory photoreceptors and sensor histidine kinases. PATCHY represents an adequate and
facile method to efficiently generate and probe hybrid gene libraries and to thereby identify key determi-
nants for proper function.
Key words DNA library, Hybrid gene, Lightoxygenvoltage, Protein engineering, Sensor histidine
kinase, Sensory photoreceptor, Signal transduction
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_18, Springer Science+Business Media LLC 2017
287
288 Robert Stabel et al.
a b
1 124 147 261
BsYtvA LOV LY STA
T S
c
linker length i BsYtvA
1. Gene A LA LB Gene B
2.
3.
Fig. 2 The PATCHY template construct contains a tandem fusion of the longest
desired fragments of genes A and B on a circular plasmid (step 1). PATCHY uses
staggered primers to create linear DNA molecules bearing versions of genes A
and B that are terminally truncated at certain positions corresponding to the
primer annealing sites (step 2). The PATCHY hybrid gene library is created through
phosphorylation and blunt-end ligation to yield circular plasmids (step 3)
YF1
YF1 FixJ Ds Red FixK2
Fig. 3 The pDusk-DsRed reporter plasmid. In the absence of blue light, YF1 phos-
phorylates the response regulator BjFixJ which binds to the BjFixK2 promotor
and thereby upregulates reporter gene expression. Blue light inhibits expression
of DsRed by around 1015-fold as it converts YF1 to a net phosphatase [16]
2 Materials
2.2 Lab Equipment 1. Gradient thermal cycler for PCR amplification (e.g., Thermal
Cycler S1000, Bio-Rad).
2. Electrophoresis chamber (e.g., Wide Mini-Sub Cell GT Cell,
Bio-Rad).
3.
Nanodrop spectrophotometer (e.g., Spark 10M with
Nanoquant plate, Tecan).
4. Microplate reader with absorption and fluorescence optics
(e.g., Infinite M200 pro, Tecan).
5. Two incubators (e.g., Incu Line IL10, VWR).
6. Two shakers for microtiter plates (e.g., PMS-1000i, Grant).
7. Blue-light LED array, custom built, 10 8 LEDs of 470
10nm (Winger Electronics).
8. Lamp power meter (model 842-PE, Newport) with silicon
photo detector (model 918DUV-OD3, Newport).
9. Laser safety goggles for fluorescence-based screening on agar
plate (Roithner Lasertechnik, 550nm long pass).
10. Optional: Flow cytometer with sort functionality (e.g., S3e,
Bio-Rad).
3 Methods
Table 1
PATCHY PCR reaction mix
Reagent Quantity
5 HF buffer 10 L
10 mM dNTP mix 1 L (0.2 mM each)
DNA template 1 L (50 pg1 g)
10 M total fwd. primer pool 1.25 L (0.25 M)
10 M total rev. primer pool 1.25 L (0.25 M)
2 U/L Phusion polymerase 1 L
ddH2O Add to 50 L
Table 2
PATCHY PCR program
Table 3
Phosphorylation of linear DNA fragments
Reagent Quantity
10 T4 DNA ligase buffer 3.5 L
Linear PCR fragment 30 L (50 pg1 g)
10 U/L T4 polynucleotide linase 2 L
Table 4
Ligation of phosphorylated linear DNA fragments
Reagent Quantity
Phosphorylation reaction mix 35 L
50% PEG-4000 (w/v) 4 L
0.5 mM ATP (optional) 0.5 L
30 U/L T4 DNA ligase 1 L
3.2 Analysis 1. Sequence analysis of the nave PATCHY library: To assess the
ofPATCHY Libraries quality of the PATCHY library, a number of individual clones
can be analyzed by Sanger sequencing. In case the original
template construct is found with significant frequency, extra
efforts should be taken to deplete it from the library (see
Subheading 3.1, steps 6, 9, and 10 as well as Note 4).
2. Optional: Alternatively, the library can be analyzed by next-
generation sequencing (NGS). In the case study [10], the
entire PATCHY plasmid library was fragmented by ultrasound
and sequenced on an Illumina platform with paired-end
150-base-pair reads. Although most reads covered the invari-
ant plasmid backbone, the low cost of NGS still allowed to get
good coverage of the variant parts of the plasmids. We obtained
approximately 5500 paired-end reads covering the linker
region, corresponding to an ~8-fold oversampling of the
expected 672 different hybrid genes (Fig.4). Out of these 672
variants, 578 could be detected by NGS.The data also indi-
cated that each forward and reverse primer had been used in
the PATCHY PCR reaction albeit to varying extents.
3. Optional: In case the sequence analysis indicates a nonrandom,
biased distribution of expected constructs in the PATCHY
library, one may rerun the PATCHY PCR reaction with
adjusted relative primer concentrations (see Subheading 3.1,
steps 3 and 4 as well as Note 2).
4. Optional: To further diversify the PATCHY library, it can be
subjected to an error-prone PCR reaction (see Note 6).
5. Isolation of hybrid variants from the PATCHY library: The
identification of hybrid variants with desirable traits in the
PATCHY library is obviously governed by the assays available
to read out activity. In principle, individual clones can be iso-
lated and analyzed separately, but ideally functionality can
Generation of Hybrid Gene Libraries 297
15
10
5 10 15 20 25
3.3 PATCHY Case We applied PATCHY to better characterize the underlying design
Studies principles and signal-transduction mechanisms in the chimeric
photoreceptor YF1 [8]. The original YF1 receptor originated from
3.3.1 Linker
the fusion of the blue light-sensitive lightoxygenvoltage photo-
LibrariesofYF1
sensor module of BsYtvA to the effector module of the BjFixL
histidine kinase. Notably, in YF1 the linker between these modules
essentially derived from the BjFixL parental protein, i.e., i = 3 and
j = 25 (see Subheading 3.1 step 1). Sparse sampling of linker
composition had earlier identified linker length as the main deter-
minant for activity and regulation of the hybrid receptors [8]. A
seven-residue periodicity of the dependence of activity and regula-
tory properties on linker length resulted from the coiled-coil con-
formation of the linker, as later evidenced in the high-resolution
structure of dark-adapted YF1 [9]. Notably, only a tiny fraction of
many conceivable hybrid variants were studied at this point [8].
Despite these biochemical and structural data, the mechanism
by which signals are transduced from the LOV photosenor to the
histidine kinase effector remained unclear. We reasoned that com-
prehensive interrogation of linker sequence space could yield addi-
tional mechanistic insight. The linkers between the respective
sensor and effector modules in the parental receptors BsYtvA and
BjFixL comprise 23 and 27 residues, respectively. Provided that
fusions between the parental proteins are restricted to these linker
regions, there are (23 + 1) (27 + 1) = 672 different ways to
recombine the BsYtvA LOV photosensor with the BjFixL effector
(see Figs.1 and 2). Using PATCHY as described in Subheading
3.1, we generated a construct library that theoretically contains
Generation of Hybrid Gene Libraries 299
4
YF1 D21V
10
Count
Count
2
5
0 0
c Helical register m
2 6 3 0 4 1 5
4
H22P
Count
Fig. 5 Linker-length analysis of light-regulated BsYtvA-BjFixL hybrid variants. (a) For YF1, light-repressed vari-
ants (filled circles) showed periodic linker lengths of 7n or 7n + 5 residues but light-activated variants (open
circles) mostly occurred at linker lengths of 7n + 1 residues. (b) Light-activated D21V variants had linkers of
7n or 7n + 1 residues. Two variants with linkers belonging to the 7n and 7n + 3 classes showed inverted,
light-repressed response. (c) For H22P, only light-activated variants were identified that predominantly pos-
sessed linkers of 7n residues
3.3.2 Linker Libraries The inversion of the response to light in YF1 cannot only be
of Signal-Inverted YF1 achieved by linker variations but also by the replacement of certain
residues within the LOV photosensor units [9, 17]. To investigate
the basis for this profound effect on signal transduction, we
repeated the PATCHY analysis of the BsYtvA-BjFixL chimerae in
the background of either the D21V or H22P exchange, both of
which induce inversion of the light response in YF1.
In case of D21V, hybrid variants with the same qualitative sig-
nal response as the original YF1 D21V, i.e., with an increase in
activity upon blue-light exposure, fell into two distinct classes with
linkers of 7n and 7n + 1 residues, respectively (Fig.5b). The pref-
erence for these classes is indicative of the coiled-coil structure of
the linker in the D21V variants. Interestingly, in the YF1 context
the clades 7n and 7n + 1 were associated with light-repressed and
light-induced activity, respectively, whereas in case of D21V they
both predominantly gave rise to light activation. However, two
D21V variants with linkers of 31 (= 7 4 + 3) and 42 (= 7 6) resi-
dues displayed light-repressed activity; in particular, in the former
construct, DsRed reporter fluorescence was enhanced by around
9-fold in darkness versus blue light. Intriguingly, the signal inver-
sion introduced by the D21V exchange could thus be reverted in a
Generation of Hybrid Gene Libraries 301
3.4 Conclusion The PATCHY method offers an efficient route toward libraries of
hybrid genes with a single fusion between defined fragments of
two parental genes A and B.In contrast to related approaches for
the construction of hybrid gene libraries [1115], PATCHY uses a
simpler protocol and obviates incremental nucleolytic digest of the
parental genes which is difficult to precisely adjust. Rather, PCR
amplification with sets of staggered primers exactly delineates
which fragments of A and B are generated and recombined. The
analysis of PATCHY hybrid libraries benefits from efficient activity
assays, in particular cell-based screening and selection approaches.
We demonstrate the utility of PATCHY for the test case of
hybrid blue light photoreceptors. Catalytic activity and response
to light are largely governed by the length of the linker interven-
ing the constituent photosensor and effector modules of the
receptors. A striking seven-residue dependence of receptor func-
tion on linker length is explained by the continuous coiled-coil
302 Robert Stabel et al.
4 Notes
Acknowledgments
References
1. Pawson T, Nash P (2003) Assembly of cell reg- independent of DNA homology. Nat
ulatory systems through protein interaction Biotechnol 17:12051209
domains. Science 300:445452 12. Ostermeier M, Nixon AE, Shim JH, Benkovic
2. Gokhale RS, Khosla C (2000) Role of linkers in SJ (1999) Combinatorial protein engineering
communication between protein modules. by incremental truncation. Proc Natl Acad Sci
Curr Opin Chem Biol 4:2227 96:35623567
3. Amet N, Lee H-F, Shen W-C (2009) Insertion 13. Lutz S, Ostermeier M (2003). Preparation of
of the designed helical linker led to increased SCRATCHY hybrid protein libraries. Directed
expression of Tf-based fusion proteins. Pharm Evolution Library Creation: Methods and
Res 26:523528 Protocols 143151
4. Mglich A, Yang X, Ayers RA, Moffat K (2010) 14. Arnold FH, Georgiou G (2003) Methods in
Structure and function of plant photorecep- molecular biology, vol. 231. Directed evolution
tors. Annu Rev Plant Biol 61:2147 library creation methods and protocols.
5. Ziegler T, Mglich A (2015) Photoreceptor Humana Press, Totowa, NJ
engineering. Front Mol Biosci 2:30 15. Ostermeier M (2003) Theoretical distribution
6. Ryu M-H, Gomelsky M (2014) Near-infrared of truncation lengths in incremental truncation
light responsive synthetic c-di-GMP module libraries. Biotechnol Bioeng 82:564577
for optogenetic applications. ACS Synth Biol 16. Ohlendorf R, Vidavski RR, Eldar A, Moffat K,
3:802810 Mglich A (2012) From dusk till dawn: one-
7. Wu YI, Frey D, Lungu OI, Jaehrig A, plasmid systems for light-regulated gene
Schlichting I, Kuhlman B, Hahn KM (2009) A expression. JMol Biol 416:534542
genetically encoded photoactivatable Rac con- 17. Gleichmann T, Diensthuber RP, Mglich A
trols the motility of living cells. Nature 461: (2013) Charting the signal trajectory in a light-
104108 oxygen- voltage photoreceptor by random
8. Mglich A, Ayers RA, Moffat K (2009) Design mutagenesis and covariance analysis. JBiol
and signaling mechanism of light-regulated his- Chem 288:2934529355
tidine kinases. JMol Biol 385:14331444 18. Lupas AN, Gruber M (2005) The structure of
9. Diensthuber RP, Bommer M, Gleichmann T, alpha-helical coiled coils. Adv Protein Chem
Mglich A (2013) Full-length structure of a 70:3778
sensor histidine kinase pinpoints coaxial coiled 19. Engelhard C, Diensthuber RP, Mglich A, Bittl
coils as signal transducers and modulators. R (2016) Blue-light reception through quater-
Structure 21:11271136 nary transitions. Submitted
10. Ohlendorf R, Schumacher CH, Richter F, 20. Berntsson O, Diensthuber RP, Panman MR, et
Mglich A (2016) Library-aided probing of al (2016) Conformational photoactivation of a
linker determinants in hybrid photoreceptors. light-oxygen-voltage photosensor. Submitted
ACS Synth Biol 5(10):111726. doi:10.1021/ 21. Leung DW, Chen E, Goeddel DV (1989) A
acssynbio.6b00028. method for random mutagenesis of a defined
11. Ostermeier M, Shim JH, Benkovic SJ (1999) A DNA segment using a modified polymerase
combinatorial approach to hybrid enzymes chain reaction. Technique 1:1115
Part VII
Abstract
The over 500 human protein kinases are estimated to phosphorylate at least one-third of the proteome.
This posttranslational modification is of paramount importance to intracellular signaling and its deregulation
is linked to numerous diseases. Deciphering the specific cellular role of a protein kinase of interest remains
challenging given their structural similarity and potentially overlapping activity. In order to exert control
over the activity of user-defined kinases and allow for understanding and engineering of complex signal
transduction pathways, we have designed ligand inducible split protein kinases. In this approach, protein
kinases are dissected into two fragments that cannot spontaneously assemble and are thus inactive. The two
kinase fragments are attached to chemical inducers of dimerization (CIDs) that allow for ligand induced
heterodimerization and concomitant activation of kinase activity.
Key words Protein kinase, Split kinase, Split protein, Ligand gating, Chemical inducer of dimerization
1 Introduction
The activity and function of many, if not all, proteins are regu-
lated by a multitude of chemical perturbations, collectively
termed posttranslational modifications (PTMs) [1]. Of these,
protein phosphorylation may be the most common [2], where
some estimate that three-quarters of the proteome can be phos-
phorylated [3, 4]. Protein phosphorylation is catalyzed by a class
of enzymes known as protein kinases. Protein kinases are involved
in almost all pathways, from cell division to cell death [5], and
their aberrant function is implicated in a plethora of diseases
such as cancer [6], metabolic disorders [7], inflammation [8],
and neurological disorders [9]. This renders kinases very attrac-
tive targets for therapeutic intervention [1012], and protein
kinase inhibitors are currently the second largest group of thera-
peutics. Kinase research has advanced tremendously since the
discovery of the first serine [13] and tyrosine kinases [14],
respectively. However, deciphering the specific cellular role of a
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_19, Springer Science+Business Media LLC 2017
307
308 JavierCastillo-Montoya andIndraneelGhosh
A B
Kinase OH
NTerm Protein
Kinase
Substrate
CTerm
CID FKBP-Rap-FRB
Ligand-Gated
Phosphorylation
CID1 CID2
Ligand-Gated
Split-Kinase OPO32-
CID Interacting PYL-ABA-ABI GID1-GA3-GAI
Proteins
Fig. 1 (a) Split protein kinase consisting of two fragments of a split kinase (NTerm and CTerm), independently
attached to the interacting proteins of a chemical inducer of dimerization (CID) system (CID1 and CID2), that reas-
semble upon the addition of a chemical input. Upon ligand gated reassembly, the split kinase is activated and
phosphorylates protein substrate(s). (b) The three orthogonal small molecule dependent CID systems that have
been used to construct split kinase sensors: rapamycin (Rap), abscisic acid (ABA), and gibberellic acid (GA3)
Translational CID
Machinery
B C
Ni-NTA
Ni NTA Pro
Protein Purification
His-Tag
Binding
Cell
Lysis Washess Ni
NTA
Ni
Ni-NT
Ni-NTA
TA Ni
NTA
Resin
Resin
NTA
HO
O
Substrate
Subs
Substrat
32
P-ATP
HEK293T
K293T in c
cellulo
Protein Expression D
Kinase Assay
HO
-Emission
Count Phosphorylation
Ni
NTA
Fig. 2 General scheme showing the (a) invitro and (b) in cellulo expression of split protein kinase sensors,
followed by (c) His6-tag based protein purification and (d) radioactivity-based kinase activity assay. This meth-
odology allows for the rapid interrogation of activity and optimization of split kinases
Split-Protein Kinases 311
2 Materials
2.1 Plasmid 1. Plasmids encoding for the kinase of interest and the interacting
Construction proteins from the desired CID system (Addgene is a good
andCloning source for plasmids). We have almost exclusively focused on
protein tyrosine kinases and the protocols reflect our bias.
2. Plasmid vector for cloning, such as pRSFDuet-1 and
pcDNA3.1(+).
3. Appropriate oligonucleotide primers to generate inserts.
4. Enzymes for cloning procedures with the necessary reaction
buffers and dNTPs. Thermostable DNA polymerase (such as
Taq, e.g., from New England BioLabs or KAPA from KAPA
Biosystems), Klenow fragment (e.g., New England BioLabs),
appropriate restriction enzymes, calf intestinal alkaline phos-
phatase (CIP, e.g., from New England BioLabs), DNA ligase
(such as T4 DNA ligase, e.g., from New England BioLabs).
5. Competent cells, such as E. coli XL1-Blue, and appropriate
growth media, such as LuriaBertani agar and broth.
6. Plasmid DNA and PCR product purification kits. We typically
use Macherey-Nagel NucleoSpin Plasmid, and NucleoSpin Gel
and PCR Clean-up kits.
2.2 Split Kinase 1. DNA polymerase such as Taq or KAPA with provided reaction
Protein Expression buffer and dNTPs.
2.2.1 In Vitro Expression 2. RNA production system (such as Promega T7 RiboMAX
inRabbit Reticulocyte Large Scale RNA production system), with provided reaction
Lysate buffer and rNTPs.
3. PCR-product purification kit (e.g., from Macherey-Nagel) and
G50-microcolumns for mRNA purification (e.g., from GE
Healthcare).
4. Rabbit reticulocyte lysate (RRL) system (ours was donated
by Luceome Biotechnologies), which contains the cellular
components necessary for protein synthesis (tRNAs, amino
acids, ribosomes, initiation, elongation, and termination factors).
Commercial systems are also optimized to include an energy-
generating system consisting of prequalified phosphocreatine and
phosphocreatine kinase, a mixture of tRNAs to expand the range
of mRNAs that can be translated, hemin to prevent inhibition of
initiation, and potassium acetate and magnesium acetate.
5. CID: 6.25M Rapamycin (Rap, Sigma-Aldrich).
6. CID: 2.5mM Abscisic acid (ABA, AG Scientific).
7. CID: 2.5mM Gibberellic acid (GA3, Sigma-Aldrich).
8. Dimethylsulfoxide (DMSO)
312 JavierCastillo-Montoya andIndraneelGhosh
2.3 Split Kinase 1. Ni-NTA agarose resin for His6-tag based purification such as
Protein Purification Macherey-Nagel.
2. Buffer A: 20mM Tris, 250mM NaCl, 20mM imidazole,
pH8.
3. Buffer B: 20mM Tris, 250mM NaCl, 20mM imidazole,
pH7.
4. Kinase Assay Buffer: 20mM MOPS, 1mM EDTA, 10mM
MgCl2, pH7.
2.4 Radioactivity- 5. Kinase Assay Buffer: 20mM MOPS, 1mM EDTA, 10mM
Based Kinase Activity MgCl2, pH7.
Assay 6. Appropriate kinase peptide substrate such as Srctide, Lyntide,
Kemptide, and PKAtide. These can be bought from suppliers
such as SignalChem or synthesized.
7. Adenosine triphosphate (Cold ATP, Sigma-Aldrich).
8. 32P-labeled ATP (Hot ATP, PerkinElmer).
9. P81 phosphocellulose paper (EMD Millipore).
10. 0.85% Phosphoric acid.
Split-Protein Kinases 313
11. Acetone.
12. Cocktail for liquid scintillation counting such as Budget Solve
Complete Count Cocktail.
3 Methods
3.1 Plasmid 1. Choose an appropriate site to split the kinase of interest. We have
Construction/Cloning utilized a dissimilarity based approach using sequence alignment
of several members of a particular kinase group. (see Note 1).
2. Choose desired CID system for your split kinase, either under
the control of rapamycin, abscisic acid, or gibberellic acid,
which heterodimerize the protein pairs FRB/FKBP, ABIcs*/
PYLcs, and GAI(92)/GID1, respectively.
3. Using standard cloning techniques (see Note 2), attach the
N-Terminal portion of the kinase (NTerm) to one of the CID
interacting proteins (CID1), and the C-Terminal portion of
the kinase (CTerm) to the other CID interacting protein
(CID2), to get the final NTerm-Linker-CID1 and CID2-
Linker-CTerm constructs (see Note 3). Make sure you use the
appropriate vector for your intended purpose (see Note 4).
4. Design one of your split kinase halves to include a His6-tag for
protein purification purposes. We commonly incorporate this
tag at the end of the kinase CTerm (CID2-Linker-CTerm-
His6) (see Note 5).
3.2 Split Kinase 1. In order to use the invitro rabbit reticulocyte lysate system,
Protein Expression invitro translation (IVT) PCR linear products are generated
using the appropriate plasmid as templates, and using a for-
3.2.1 In Vitro Expression
ward primer that incorporates a RNA polymerase promoter,
inRabbit Reticulocyte
such as T7, and a mammalian Kozak sequence, and a reverse
Lysate
primer that incorporates a stabilizing RNA stem loop.
2. With the appropriate IVT PCR linear products in hand, gener-
ate mRNA products using a commercial RNA production sys-
tem, such as Promegas T7 RiboMAX Large Scale RNA
production system. Transcribe 3g of IVT-PCR products
using a RNA polymerase for 4h at 30C (see Note 6) in a final
volume of 25L, with the provided reaction buffer and rNTPs.
mRNA is further purified using G50-microcolumns.
314 JavierCastillo-Montoya andIndraneelGhosh
3.3 Split Kinase 1. All of the buffers used in this procedure should be supple-
Protein Purification mented with the appropriate CID (250nM Rap, 100M
ABA, or 100M GA3) in the activated samples.
2. For invitro translated samples, dilute the 25L of RLL after
translation with 75L of Buffer A, for a final volume of
100L.The in cellulo translated samples are already at a vol-
ume of 100L.
3. For each sample, add 5L of Ni-NTA agarose resin (Macherey-
Nagel) and 100L of Buffer A in a microcentrifuge tube (see
Note 11), and equilibrate for 30min at 4C.Spin down the
resin at 1530 rcf for 1min and remove 75L of supernatant
(see Note 12).
4. Add the 100L of cell lysate either from invitro or in cellulo
translation and bind to the resin for 1h at 4C.Gently spin down
the resin (1530rcf/1min) and remove 100L of supernatant.
5. Wash the resin for 4min with 100L each time with the fol-
lowing buffers: 1 Buffer A, 3 Buffer B, 1 Kinase Assay
Buffer (see Note 13).
6. After the last wash, remove a total of 120L of supernatant,
leaving a total volume of 10L in the microcentrifuge tube
(see Note 14).
3.4 Kinase Assay 1. Add 10L of an appropriate peptide substrate solution (see
Note 15) and incubate at RT for 30min.
2. Add 10L of a 300M ATP solution (83.3nCi/L, equivalent
to adding 1/24 of hot 32PATP PerkinElmer BLU002250UC)
and incubate at room temperature for 4h (see Note 16).
3. Spot the reaction mixture after incubation on P81 paper, and
then wash the paper for 3min 3 with 500mL of 0.85%
phosphoric acid and 1 with 500mL of acetone.
4. Immerse the P81 paper in 10mL of scintillation cocktail in a scin-
tillation vial and measure counts using a scintillation counter.
316 JavierCastillo-Montoya andIndraneelGhosh
4 Notes
Acknowledgment
References
1. Deribe YL, Pawson T, Dikic I (2010) Post- 16. Endicott JA, Noble MEM, Johnson LN (2012)
translational modifications in signal integra- The structural basis for control of eukaryotic
tion. Nat Struct Mol Biol 17:666672 protein kinases. Annu Rev Biochem
2. Hunter T (1995) Protein kinases and phospha- 81:587613
tases: review the yin and yang of protein phos- 17. Taylor SS, Kornev AP (2011) Protein kinases:
phorylation and signaling. Cell 80:225236 evolution of dynamic regulatory proteins.
3. Sharma K, DSouza RCJ, Tyanova S etal Trends Biochem Sci 36:6577
(2014) Ultradeep human phosphoproteome 18. Bishop AC, Kung C-Y, Shah K etal (1999)
reveals a distinct regulatory nature of Tyr and Generation of monospecific nanomolar tyro-
Ser/Thr-based signaling. Cell Rep sine kinase inhibitors via a chemical genetic
8:15831594 approach. JAm Chem Soc 121:627631
4. Hornbeck PV, Kornhauser JM, Tkachev S etal 19. Liu Y, Shah K, Yang F etal (1998) Engineering
(2011) PhosphoSitePlus: a comprehensive Src family protein kinases with unnatural
resource for investigating the structure and nucleotide specificity. Chem Biol 5:91101
function of experimentally determined post- 20. Bishop AC, Ubersax JA, Petsch DT etal (2000)
translational modifications in man and mouse. A chemical switch for inhibitor-sensitive alleles of
Nucleic Acids Res 40:D261D270 any protein kinase. Nature 407:395401
5. Manning G (2002) The protein kinase comple- 21. Karginov AV, Ding F, Kota P etal (2010)
ment of the human genome. Science Engineered allosteric activation of kinases in
298:19121934 living cells. Nat Biotechnol 28:743747
6. Cohen P (2002) Protein kinases: the major 22. Karginov AV, Zou Y, Shirvanyants D etal
drug targets of the twenty-first century? Nat (2011) Light regulation of protein dimeriza-
Rev Drug Discov 1:309315 tion and kinase activity in living cells using
7. Hotamisligil GS (2006) Inflammation and photocaged rapamycin and engineered FKBP.J
metabolic disorders. Nature 444:860867 Am Chem Soc 133:420423
8. Kyriakis JM, Avruch J(2012) Mammalian 23. Gautier A, Nguyen DP, Lusic H etal (2010)
MAPK signal transduction pathways activated Genetically encoded photocontrol of protein
by stress and inflammation: a 10-year update. localization in mammalian cells. JAm Chem
Physiol Rev 92:689737 Soc 132:40864088
9. Mueller BK, Mack H, Teusch N (2005) Rho 24. Shekhawat SS, Ghosh I (2011) Split-protein
kinase, a promising drug target for neurologi- systems: beyond binary proteinprotein inter-
cal disorders. Nat Rev Drug Discov actions. Curr Opin Chem Biol 15:789797
4:387398 25. Camacho-Soto K, Castillo-Montoya J, Tye B,
10. Knight ZA, Lin H, Shokat KM (2010) Ghosh I (2014) Ligand-gated split-kinases.
Targeting the cancer kinome through poly- JAm Chem Soc 136:39954002
pharmacology. Nat Rev Cancer 10:130137 26. Camacho-Soto K, Castillo-Montoya J, Tye B
11. Zhang J, Yang PL, Gray NS (2009) Targeting etal (2014) Small molecule gated split-tyrosine
cancer with small molecule kinase inhibitors. phosphatases and orthogonal split-tyrosine
Nat Rev Cancer 9:2839 kinases. JAm Chem Soc 136:1707817086
12. Lamba V, Ghosh I (2012) New directions in 27. Fegan A, White B, Carlson JCT, Wagner CR
targeting protein kinases: focusing upon true (2010) Chemically controlled protein assem-
allosteric and bivalent inhibitors. Curr Pharm bly: techniques and applications. Chem Rev
Des 18:29362945 110:33153336. doi:10.1021/cr8002888
13. Krebs EG, Fischer EH (1956) The phosphory- 28. Liang FS, Ho WQ, Crabtree GR (2011)
lase b to a converting enzyme of rabbit skeletal Engineering the ABA plant stress pathway for
muscle. Biochim Biophys Acta 20:150157 regulation of induced proximity. Sci Signal 4:rs2
14. Hunter T, Sefton BM (1980) Transforming 29. Miyazono K-I, Miyakawa T, Sawano Y etal
gene product of Rous sarcoma virus phos- (2009) Structural basis of abscisic acid signal-
phorylates tyrosine. Proc Natl Acad Sci ling. Nature 462:609614
77:13111315 30. Miyamoto T, DeRose R, Suarez A etal (2012)
15. Hubbard SR, Till JH (2000) Protein tyrosine Rapid and orthogonal logic gating with a
kinase structure and function. Annu Rev gibberellin-induced dimerization system. Nat
Biochem 69:373398 Chem Biol 8:465470
Split-Protein Kinases 319
Abstract
The ability to sense and process cues about changing environments is fundamental to life. Cells have
evolved elaborate signaling pathways in order to respond to both internal and external stimuli appropri-
ately. These pathways combine protein receptors, signal transducers, and effector genes in highly con-
nected networks. The numerous interactions found between signaling proteins are essential to maintain
strict regulation and produce a suitable cellular response. As a result, a signaling proteins activity in isola-
tion can differ greatly from its activity in a native context. This is an important consideration when study-
ing or engineering signaling pathways. Fortunately, the difficulty of studying network interactions is fading
thanks to advances in library construction and cell sorting. In this chapter, we describe two methods for
generating libraries of mutant proteins that exhibit altered network interactions: whole-gene point muta-
genesis and domain shuffling. We then provide a protocol for using fluorescence-activated cell sorting to
isolate interesting variants in live cells by focusing on the unicellular eukaryotic model organism
Saccharomyces cerevisiae, using as an example recent work that we have done on its G protein-coupled
receptor Ste2.
Key words Signaling pathway, Protein network, Directed evolution, Domain shuffling, Random
mutagenesis, Error-prone PCR, Fluorescence-activated cell sorting
1 Introduction
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1_20, Springer Science+Business Media LLC 2017
321
322 Raphal B. DiRoberto et al.
2 Materials
2.1 Error-Prone PCR 1. DNA primers for error-prone PCR and amplification PCR
reactions (see Note 1).
2. Target DNA (on plasmid).
3. 40mM dNTP mix (10mM each dNTP).
4. Mutazyme II DNA polymerase (Agilent).
5. 10 Mutazyme II reaction buffer (Agilent).
6. DpnI enzyme.
Fig. 1 (continued) significantly increasing the efficiency of the multi-insert cloning step. (b) The identification
of domain boundaries via protein databases is followed by a PCR amplification step that adds AarI recognition
sequence and specific overhangs designed for sequential ligation. The domain library is then ligated into a
vector for which the overhangs match those of the first and last domains that will form shuffled proteins,
resulting in the creation of a large domain-shuffled gene library. Note that an individual domain could be
included at multiple positions in the final multi-domain protein, simply by altering the identity of the flanking
overhangs
326 Raphal B. DiRoberto et al.
3 Methods
3.1 Error-Prone PCR 1. Prepare a stock solution of Target DNA in water. The amount
of Target DNA depends on desired mutation frequency (see
Table 1). As an example we use the yeast G protein-coupled
receptor Ste2.
2. Prepare a 50L reaction as follows:
Rewiring Signaling Networks 327
Table 1
Summary of mutation frequency as a function of target DNA
Table 2
PCR cycling protocol for error-prone PCR with mutazyme
Table 3
PCR cycling protocol for amplifying error-prone PCRs with Pfu DNA
polymerase
Table 4
Setup for ligation reaction
Ligation reaction volume (520L) 100L
Competent E. coli cells volume (2050L) 1000L
Expected number of E. coli colonies (i.e., library size) 70,000 colonies
3.2 AarI Mediated AarI is a Type IIS restriction enzyme that recognizes a 7bp
Domain Shuffling sequence (CACCTGC), cutting 4 and 8bp away from the recog-
nition site, leaving a 4 base overhang, as show in Fig. 1. The fact
that AarI is agnostic to the sequence of the overhangs means that
users can design those sequences, thus enabling scarless cloning
or, more importantly in this case, allowing the use of NON-
PALINDROMIC overhangs. This property is key for multi-insert
cloning, as ligation of multiple fragments flanked by non-
palindromic overhangs is orders of magnitude more efficient than
the ligation of fragments with palindromic ends (as palindromic
overhangs can self-ligate, decreasing the ligation efficiency dramat-
ically). The steps required to generate libraries of shuffled domains
are outlined below.
1. Identify domain boundaries for the genes of interest from
databases (e.g., UniProtKB/Swiss-Prot).
330 Raphal B. DiRoberto et al.
Table 5
Summary of 4bp overhangs
Table 6
Setup for AarI restriction enzyme reaction
Component Amount
DNA (either acceptor plasmid OR PCR fragment) 5g
10 AarI reaction buffer 6L
50 AarI oligonucleotide (0.025mM) 1L
AarI enzyme 2.5L
Water To complete 60L
332 Raphal B. DiRoberto et al.
Table 7
Setup for ligation reaction
Component Amount
Digested/dephosphorylated acceptor plasmid DNA 150ng
Digested insert AB (or mix of multiple AB inserts in As required (based on desired molar ratio)
desired ratios)
Digested insert BC (or mix of multiple BC inserts in As required (based on desired molar ratio)
desired ratios)
Digested insert CD (or mix of multiple CD inserts in As required (based on desired molar ratio)
desired ratios)
T4 DNA ligase 1L
10 T4 DNA ligase buffer 2L
Water To complete 20L
Rewiring Signaling Networks 333
3.3 Yeast-Based The following protocol is designed for the identification of mating
Sorting ofRewired pathway gene variants that enable a strong response to the peptide
Pathway Interactions pheromone -factor. For instance, the gene STE2, which encodes
the pheromone receptor, can be mutated to identify changes that
lead to mating pathway induction in the presence of a pheromone
from the related species Kluyveromyces lactis [14]. In this system, a
ste2 yeast strain which expresses green fluorescent protein (GFP)
from a mating-inducible promoter is transformed with a mutant
STE2 library and used to select active Ste2 variants.
1. Transform yeast cells with the plasmid library of mutant
DNA.We recommend using the high-efficiency lithium ace-
tate transformation method [15]. This method can be expected
to yield 15,000 colonies from an initial 5mL of log-phase
yeast culture and 1g of a 510 kbp DNA plasmid.
2. Pick 100 colonies or more and assay the mating pathway
response of each. This pre-sorting screen will reveal the ratio of
active to inactive mutants as well as the diversity of the active
mutants phenotypes (Fig. 2a).
3. Place individual mutant colonies in 2mL of drop-out medium.
Also inoculate 2mL volumes with a negative control, such as
cells transformed with an empty vector, and a positive control,
such as cells expressing wild-type STE2. Grow overnight at
30C in a 225 RPM shaker incubator.
4. Transfer 40L of the overnight culture to 2mL of drop-out
medium. Grow this dilution to an optical density at 600nm
(OD600) of 0.4 to 0.6 (early log-phase).
5. Add -factor pheromone to each culture to a final concentration
of 100nM.Cultures can also be split into two to measure the
pathway response in the absence of pheromone. Grow for 2h.
6. Add cycloheximide to a final concentration of 10g/mL to
each culture to arrest protein expression, including GFP.
7. Sonicate each log-phase culture briefly to break large cell
aggregates. This typically requires two sonication pulses at the
lowest setting.
8. Run each culture in a flow cytometer to measure GFP fluores-
cence. This requires a 488nm laser and a 525/50nm filter.
9. To proceed with cell sorting, combine the mutant library into
a single liquid culture. For this, dispense 5mL of drop-out
medium onto each plate of transformed yeast cells and scrape
off the colonies using a plating stick. Aspirate the mixed colo-
nies and add them to a tube on ice.
10. Vortex the colony mixture on a low setting for 30s.
11. Inoculate 50mL of drop-out medium with 50L of the col-
ony mixture. Also inoculate 2mL volumes with the negative
and positive controls. Grow overnight.
Fig. 2 Fluorescence-activated cell sorting of yeast mutant libraries. In this example, we show sorting data for
yeast carrying a Ste2 receptor library, with mutants conferring a mating response to K. lactis pheromone. (a)
Gating strategy needed to ensure that most events collected correspond to single cells. The rectangular gates
capture cells in the diagonal, which mostly correspond to single cells (cell aggregates display higher forward
Rewiring Signaling Networks 335
Fig. 2 (continued) and side scattering heights). (b) Gating strategies needed to select cells that activate the
pathway response upon pheromone treatment. Note the exclusion of inactive mutants (left). (c) Flowchart of a
cell sorting experiment. A plasmid library of STE2 mutants is transformed in yeast. An initial phenotypic screen
shows that most mutants cannot sense the pheromone of K. lactis as well as wild type. Following a first round
of cell sorting, almost all mutants selected can sense the pheromone and about half can do so better than wild
type. A second cell-sorting step yields an even greater proportion of strong K. lactis-responsive mutants
336 Raphal B. DiRoberto et al.
4 Notes
Acknowledgments
References
1. Good MC, Zalatan JG, Lim WA (2011) Nat Rev Mol Cell Biol 10(12):866876.
Scaffold proteins: hubs for controlling the flow doi:10.1038/Nrm2805
of cellular information. Science 332(6030):680 4. Leung DW, Chen E, Goeddel DV (1989) A
686. doi:10.1126/science.1198701 method for random mutagenesis of a defined
2. Peisajovich SG (2012) Evolutionary synthetic DNA segment using a modified polymerase
biology. ACS Synth Biol 1(6):199210. chain reaction. Technique 1(1):1115
doi:10.1021/sb300012g 5. Stemmer WPC (1994) DNA shuffling by ran-
3. Romero PA, Arnold FH (2009) Exploring pro- dom fragmentation and reassembly- in-vitro
tein fitness landscapes by directed evolution. recombination for molecular evolution. Proc
Rewiring Signaling Networks 337
Viktor Stein (ed.), Synthetic Protein Switches: Methods and Protocols, Methods in Molecular Biology, vol. 1596,
DOI10.1007/978-1-4939-6940-1, Springer Science+Business Media LLC 2017
339
Synthetic Protein Switches: Methods and Protocols
340 Index
F Photoreceptors242244, 247249, 252,
254, 258, 288, 290, 298, 301
Firefly luciferase119129, 132137, 142, Photosensitive degron 242, 243, 245, 252
221, 223, 224, 227, 231, 234 Phylogenetic analysis 73, 7577, 8284
Firefly luminescent intermediate-based protein-protein Polymerase chain reaction (PCR)
interaction assay (FlimPIA)119129 multiplex inverse PCR 44, 45, 48, 54
Fluorescence activated cell sorting (FACS) 14, 16, overlap extension PCR10, 11, 35, 155,
17, 297, 303, 325, 334335 156, 275, 278, 279
Fluorescence microscopy 115, 228, 259, PATCHY289, 290, 293, 294, 296302
261, 263, 265268 Proteases
Fluorescence spectroscopy 79, 205 receptors 198, 199, 201205, 210212, 216
Fluorescent enzyme assays 10, 154 sensors169, 173, 176, 197217
Fluorescent protein (FP)4, 14, 17, 30, 71, split-TEV sensors219
82, 85, 8999, 101103, 109, 137, 180, 244, 333 switches 198, 199, 203, 204, 209214, 216, 217
Fluorescent protein sensors13 transducers 198201, 203, 206, 209213, 216, 217
Frster resonance energy transfer (FRET) 9, 13, Protein analysis
16, 30, 38, 40, 7186, 8999, 101, 104, 109, 114, 133, SDS-PAGE112, 159, 171, 266, 314
134, 167, 180 semi-native SDS-PAGE 183, 190
FREX (protein/fragment exchange). See Protein/fragment western blotting133, 137, 139, 144, 150, 153154,
exchange (FREX) 159160, 231, 259261, 263, 265267, 269
Protein circular permutation 31, 44, 52, 53, 73, 85, 107
G
Protein complementation assay 121, 141, 151, 220
Genetic assays 17, 18, 308 Protein conjugation 185, 186, 188, 189
Genetic complementation18 Protein degradation251
Genetic screening16, 17 Protein-DNA conjugation179
Genetic selection17, 18 Protein engineering
Green fluorescent protein (GFP) 6, 10, 13, 17, chemical conjugation 38, 91, 182, 185
221, 227, 229, 230, 232, 333, 335 computational 7, 18, 105
domain insertion6, 10
I high-throughput screening and selection 10, 13,
Ion channel engineering 273, 278 18, 200, 208, 209
modular10
M rational 13, 200
Protein evolution 76, 77, 322
Mammalian cell culture
Protein expression 17, 91, 122, 153,
lentiviral transduction 134, 263, 264
156157, 170173, 181182, 185, 201, 202, 231, 273,
protein expression17
311315, 333
transfection 114, 263, 264, 312
Protein/fragment exchange (FREX ) 2830, 34, 35,
Membrane recruitment 259, 267
37, 39, 40
Mouse 97, 132, 134136,
Protein kinases
139, 140, 142144
AKT kinase258
O ATM kinase sensor131144
histidine kinase sensor 290, 298, 300
Optogenetics 258, 265, 269, 272 Protein linker engineering
glycine-serine11
P
polyproline108
Peptide fibrils5966 Protein phosphorylation 198, 307
Peptide switches59 Protein purification
Periplasmic-binding proteins (PBPs)9, 17 His/TALON-tag affinity 111, 181
Phosphorylation257 Strep-tag affinity 111, 181
Photoreceptor engineering Protein receptors 322, 326
Cry2-CIB1257269 Protein refolding 150, 159
Lov2 18, 243, 247, 248, 254, 272, 273 Protein sensors 7, 8, 310
Synthetic Protein Switches: Methods and Protocols
341
Index
Protein stability241254 LUCIDs101115
Protein thermostability 72, 73, SNIFITs101115
75, 79 Solute binding proteins (SBP) 72, 73, 75, 76
7982, 84, 85, 92, 93
R Spectrophometry
Radioactivity-based kinase activity assays310, 312313 absorbance 113, 331, 332
Reaction kinetics circular dichroism33
chemical63 fluorescence33
enzymatic123, luminescence 101, 119, 131
204, 216 UV/Vis 62, 182, 187
Rewiring signal transduction networks321336 Split-proteases219
Split protein kinase307317
S Split-protein sensor310
Split-tyrosine kinase 310, 316
Saccharomyces cerevisiae
Statistical sequence analysis5, 89
chemical transformation249250
Synthetic biology 5, 179, 198
drop test283
Synthetic dye labelling 90, 91, 98
functional complementation 273, 281
Synthetic protein switches 3, 179, 191, 201
genetic complementation18
Synthetic signal transduction4
replica plating283
Self-labelling proteins T
CLIP-tag 103, 110, 113
SNAP-tag 102, 103, 105, 108, 110, 113 Therapeutic drug monitoring101
Semi-synthetic sensors
V
bioluminescent101
fluorescent 89, 101 Viral potassium channel engineering271