Study Questions

Introduction to Microbiology
1. Define microbiology?
1. Study of cells or organisms to small to be seen from the naked eye
2. Where do you find microorganisms?
1. everywhere
3. How many microorganisms are estimated to be on Earth?
1. 5 x 10^30
4. How long have microorganisms been on Earth?
1. Billions of years
5. Are the majority of microorganisms beneficial or harmful?
1. beneficial
6. Do good or bad microorganisms get the most publicity? Why?
1. Good, they have many impacts on our lives
7. How do microorganisms impact our lives through the following:
A. Disease
i. Cure, prevention, and treatment of diseases
B. Agriculture
i. Symbiotic relationships converting atm nitrogen to fixed nitrogen
C. Food
i. Cheeses, yogurt, dairies, food preservation
D. Energy
i. Biofuels, methane, ethanol
E. Bioremediation
i. Help clean toxic spills, clean pollution
F. Biotechnology
i. pharmaceuticals
8. What are microorganisms made of?
1. Cytoplasm, cell membrane, ribosomes, DNA
Structure & Function
1. Name 6 characteristics of living cells.
1. Metabolism
2. Reproduction
3. Communication
4. Differentiation
5. Movement
6. evolution
2. Who was the first to use a microscope to see microorganisms? What did he see? What type of microscopy did
he use?
1. Robert hooke 1665 mold, light
3. Who was the first to use a microscope to see bacteria? How do we know he saw bacteria?
1. Antoni van leuwerisk, pepper water infusions
4. What type of microscopy did he use?
1. electron
5. What are the four types of light microscopy?
1. Brightfield
2. Phase contrast
3. Darkfield
4. fluorescense
6. What must be done to a microorganism to be able to see it with brightfield light microscopy?
1. Must cut the cell, stain them as well. This kills the cells
7. Which types of light microscopy allow you to view a live sample?
1. Phase contrast and darkfield
8. What is the maximum resolution of a compound light microscope? Describe what that value means in practical
terms when viewing a specimen.
1. .2 this means any two organisms next to each other wont be seen as next to each other . wont be seen as
resolved and distinct

9. What are the two types of electron microscopy? When would you use one type instead of the other?
1. Transmissioninternal details
2. Scanning outside features
10. What is the maximum resolution of an electron microscope?
1. .2-4
11. What is the smallest microbial cell size discovered thus far? Would this cell have a high or low surface area-tovolume ratio compared to an average eukaryotic cell?
1. .2, high surface area to volume
12. What is the significance of a cell having a high surface area-to-volume ratio?
1. Good for nutrient and waste exchange
13. Discuss the problems a cell might have it were less than 0.2microns.
1. Wouldnt have all cell components to live
14. Compare and contrast a prokaryotic microbial cell and eukaryotic microbial cell.
1. Proksmaller, no cell organelles, circular DNA, transcription and translation performed together. Have
hopanoids in membrane
2. Euklarger, transcription in nucleus and translation in cytoplasm. Organelles, have sterols in membrane
15. What microorganisms have a phospholipid bilayer form their cytoplasmic membrane?
1. Prok and eukhave ester linkages with fatty acids
16. What microorganisms have a lipid monolayer form their cytoplasmic membrane?
1. Archaeahave ether linkages
17. Contrast the phospholipid bilayer with the lipid monolayer? What molecules make up each? What are the
different linkages characteristic of each?
1. Bilayerpolysaccharides, ester linkages
2. Monolayerether linkages b/t glycerol and hydrophobic side chains
18. What advantage would microorganisms with a lipid monolayer have over those with a lipid bilayer?
1. Harder to break single attached molecule than two separate membranes, heat resistant as well.
19. What are the functions of the cytoplasmic membrane?
1. Permeablility, energy conservation, transport.
2. Specific transport mechanisms for nutrients going against concentration gradient
20. Where is the cell wall located relative to the cytoplasmic membrane?
1. Outside of membrane
21. What Bacteria lack a cell wall?
1. Mycoplasma and chlamydia
22. What are most Bacteria cell walls made of?
1. peptidoglycan
23. The amount of peptidoglycan in the cell walls of Bacteria distinguishes what types of Bacteria?
1. Gram pos--thicker
2. Gram negmultilayer more complex
24. Describe the peptidoglycan structure.
2 sugars: G and M bonded by a beta-1,4 bond. 4 amino acid crosslink
Repeating N-Acetylglucosamine and N-Acetylmuramic acid subunits with peptide crosslinks
25. The glycosidic bond between the two N-acetyl-glucose sugars in peptidoglycan can be cleaved by what enzyme?
What is the significance of using that enzyme to cleave that bond?
1. Lysozymecell lysis, found in animal secretions, tears, saliva, as a defense for bacterial infections
26. Describe what would happen if a bacterial cell were put in a solution with lysozyme added?
1. bursts
27. Describe the Gram-positive cell wall.
1. Thick
2. Smooth
3. Many layers of peptidoglycan
28. What is function of teichoic acids and lipoteichoic acids?
1. Includes all cell wall, membranes, and capsule polymers containing glycerophosphate or ribitol phosphate
residues. Covalently bonded to muramic acid residues in cell wall peptidoglycan.
2. Negatively charged so responsible for Ca2 and Mg2 binding for transport into the cell.
3. Lipoteichoic- some techoic acis covalently bound to membrane lipids.
29. Describe the Gram-negative cell wall.
1. 10% peptidoglycan
2. Most of cell is outer membrane, called lipopolysaccharide layer.
3. Membrane; periplasm; peptidoglycan layer; periplasm; membrane made out of protein and
lipopolysaccharides); wavy
30. What is the lipopolysaccharide layer?
1. Core polysaccharide and O polysaccharide

2. Repeated sugar sequences

31. What part of the LPS is toxic? When is it toxic?
1. Lipid A
2. It is toxic when ingested
32. Compare and contrast Archaea pseudomurein and Bacteria peptidoglycan.
1. Differ in the glycosidic bonds between the sugar derivatives are B-1,3 instead of B-1,4 and the amino
acids are all of the L stereoisomer.
2. Chemically dinstinct. Rose by convergent evolution maybe
3. Pseudomurein has N-acytlglucosamine and N-acytltalosaminuronic
33. What types of cell walls are found in Archaea species?
1. Pseudomurein (ex: methanobacterium)
i. N-acytlglucosamine and N-acytltalosaminuronic
2. S-layers
i. Made of protein or glycoprotein, most common in archaea
3. Polysaccharide (ex: halococcus)
i. Extreme halophile repeating 3 part polysaccharide cell wall structure with sulfate groups on uronic
acid. Sulfate groups bind Na
34. What types of cell walls are found in Eukarya species?
1. Cellulose, chitin, glycoprotein
35. What are the functions of the cell wall? How does the structure of a cell wall suit the functions?
1. Protection, maintain cell shape, prevent osmotic lysis, interaction with the environment; it is rigid and
strong
36. What are fimbriae? What does a prokaryotic cell do with fimbriae?
1. Short protein filaments
2. Used for attachment
3. Makes bacteria look hairy
4. Eggs are sticky because of protein
37. What is a pilus? What does a prokaryotic cell do with a pilus?
1. Hollow tube with genetic info (plasmid) that extends to other cells
2. Exchange genetic info
3. Used for conjugation
38. Where would an S-layer be found? What purpose does it serve?
1. 2 dimensional array of protein
2. Outside of a membrane
3. Selective sieve
39. Can all Bacteria form a capsule?
1. No only some bacterial cells have it
40. What is a capsule made of? How does a capsules composition suit its function?
1. Polysaccharides or peptide layers
2. Sticky
3. Helps cell stick to surface
41. Slime is made for what purpose?
1. Loose layer of polysaccharide used for gliding
42. What type of microorganisms make slime?
1. Nonflagellated prokaryotes
43. Movement using slime secretion is called what?
1. gliding
44. What are the 3 main parts of the prokaryotic flagellum? What is the purpose of each?
1. Motor
2. Hook
3. filament4. motor turns the hook and filament
45. Compare and contrast a prokaryotic and eukaryotic flagellum.
1. Prokaryotici. rotates in a circle; complex, filament rotated by hook attached to motor run by mot proteins with
proton gradient energy source
ii. proton motive force drives the flagellum motor to rotate the flagellum filament
iii. 60 cell length/second can be achieved
2. Eukaryotici. whiplike; 2 micortubules surrounded by 9 pairs of microtubules; moved with motor proteins
46. Would you expect a Bacteria and Archaea flagellum to be the same or different?
1. Somewhat similar, will have similarities to Eukaryotes

47. Identify the two types of flagellation.

1. Polar
i. Flagella located at one or both ends of cell
2. Peritrichous
i. Located everywhere on surface
48. Describe the movement of a polar flagellated prokaryotic cell.
1. Rapid, spinning around from place to place
49. Describe the movement of a peritrichous flagellated prokaryotic cell.
1. Movement typical slow and in straight line
50. What are taxes? Give 3 examples of taxes.
1. Directed movment toward or away from a chemical or physical signal
51. Describe an experiment to demonstrate chemotaxis.
1. chemicals
52. Describe an experiment to demonstrate phototaxis.
1. light
53. Describe an experiment to demonstrate aerotaxis.
1. Oxygen and some bacteria
54. What does a cell use to sense the environment?
1. Receptors
i. Sensory proteins in cytoplasmic membrane detect environment then interact with cytoplasm
proteins to affect motion
55. What are 2 other ways that a cell can move other than gliding and flagella?
1. Gas vesicles
i. Small gas filled structures made of proteins that fill up with air and make the cell lighter so it
floats
2. Magnetosomes
i. Intracellular particles of magnetite
ii. Magnetic, need to be down in sediment
iii. Aquatic microbes like magnetospirilum
iv. Orients cells in direction
56. Describe how a cyanobacterium could move to obtain optimum wavelengths of light for photosynthesis.
1. They sense the light gradient, release or hold in gas to float up and down
57. Where do Gram-negative purple sulfur bacteria store sulfur?
1. periplasm
58. What does the carboxysome store for some bacteria and cyanobacteria?
1. Carbon
59. Describe the process of sporulation.
1. DNA becomes dense in vegetative cell
2. Asymmetric cell division
3. Endospore grows around protoplast
4. Forspore formation
5. Exosporium synthesis; primordial cortex formed between the two membranes; dehydration
6. Ca2 incorporation; further dehydration, production of SASPS and dipicolinic acid; coat layers formed
7. Maturation
8. Lysis of cell and release of endospore
60. How does the structure of an endospore help it to be a survival structure?
1. Has many layers to protect DNA also calcium diplonic acid and acid soluble protein
2. Stabilizes DNA to heat denaturation
61. Where is an endospore formed? Does this vary depending on the microorganism?
1. Inside the cell, where inside the cell depends on the micoorganism
62. Describe the process of germination.
1. Spore transforms into vegetative cell genetically identical to the vegetative cell that made the spore
63. What age is the oldest known endospore to have germinated? Where was the endospore found?
1. Millions years old
2. hermoactinomyces
64. What are the organelles of a eukaryotic cell? What is the purpose of each organelle?
1. Cytoplasm
2. Cell membrane
3. ER
4. Ribosomes
5. Nucleus
6. Nucleolus

65.
66.
67.
68.
69.
70.
71.

72.
73.

74.

7. Nuclear membrane
8. Golgi
9. Cytoplasm
10. Mitochondrion
11. chloroplast
Describe the flow of information within the cell for a digestive enzyme starting with the DNA in the nucleus.
1. Nucleus, rough ER, smooth ER, Golgi complex, lysosyme
Are viruses living cells?
1. no
What is virus made of?
1. Nucleocapsid made of nucleic acid surrounded by a protective protein coat (capsid)
What are the two forms of a virus? In which form does the virus do harm?
1. Extracellularoutside of host/ inert
2. Intracellularreplicates inside host by taking over metabolic machinery of host
Describe the genome of a virus. How do viral genomes differ from the genomes of living cells known today?
1. Very small; DNA or RNA; can be single or double stranded; linear or circular
What part of a virus gives the nucleocapsid its helical or icosahedral symmetry?
1. Capsid proteins
What is a viral envelope? What cell structure is the viral envelope similar too?
1. Outer membrane (lipid bilayer) around capside derived from host cell
2. Either bursts host, or takes membrane of host with it, called budding (enveloped virus)
3. Envelope virus similar to prokaryotic cell but its missing ribosome, so it cant do translation
What does it mean for a virus to have complex structure?
1. It has multiple parts assembled separately
Distinguish between a viroid and a prion. Are they living? Are they viruses?
1. Viroid
i. Smallest known pathogens
ii. Circular, single RNA, no protein
iii. Cause plant disease- potato spindle tuber viroid
2. Prion
i. Protein particle, no nucleic acid
ii. Causes animal neurodegenerative disease
iii. Creutzfeld + Jakob Disease
iv. Bovine Spongiform Encophagy (mad cow)
v. Chronic Wasting Disease
NOT living
Describe the possible mechanism by which a prion causes disease.
1. Mutation
2. Eat neuronal tissue of infected cow
Genetics

1. In what form (single or double stranded, linear or circular) are most prokaryotic genomes?
-single, circular
2. In what form (single or double stranded, linear or circular) are most eukaryotic genomes?
-multiple, linear
3. Describe the process of replication. How does replication differ in bacteria versus eukaryotes? Where does
replication occur in the cell? What is the outcome of replication?
-replication is the splitting of the double helix and synthesized with a complememtary strand.
-in eukaryotes there are multiple origins of replication
-in bacteria there is only one origin
-they both are bidirectional, semiconservative, contain gyrase and helicase, and polymerase is added in the 5-3
direction.
4. What is the origin of replication? How many are there?
-the origin of replication is where the double helix is pulled apart
-eukaryotes: many
-prokaryotes: one
5. Name the enzymes involved in replication and what they do during replication.
-polymerase : help repair damaged DNA
Polymerase I: removes RNA primer and fills in gaps
Polymerase III: Proofreading,main polymerizing enzyme 5-3 (attaches at 3)
-gyrase: unwinds supercoils

-helicase: unwinds double helix

-primase: adds RNA primer
-ligase: repair missing DNA
6. Describe the process of transcription. How does transcription differ in bacteria versus eukaryotes? Where does
transcription occur in the cell? What is the outcome of transcription?
-transcription is the information from DNA RNA. Carried out by RNA polymerase.
-Prokaryotes: The RNA polymerase is attached to the site with the sigma factor. Transcription begins and the
sigma factor is released. RNA chain growth continues to the termination site. Once site is reached growth stops,
polymerase and RNA are released. Occurs in the cytoplasm. Hairpin loops are formed.
-Eukaryotes: Has 3 RNA polymerases (poly I-rRNA, poly II-mRNA, poly III-tRNA). Since polymerases cannot find
start site by itself transcription factors help polymerase bind to promoter site (no sigma factors are found in
eukaryotes). The TATA box is recognized by the transcription factor. Once introns are removed a methyl cap is
added on 5 end and poly A tail is added on 3 end. Occurs in the nucleus and moved through pores to cytoplasm
for translation.
7. What strand of the double stranded (ds) DNA is transcribed 5 to 3 or 3 to 5 ?
-5-3
8. Compare and contrast prokaryotic sigma factor with eukaryotic transcription factors.
-sigma factor and transcription factor both help polymerase find the promoter site.
-sigma factor is only one in prokaryotes
-transcription factors are multiple in eukaryotes
9. How would a single gene be transcribed in a bacterial cell?
-RNA polymerase and sigma factor attach to the promoter site and transcribe more than one coding region
(multiple genes in one mRNA)
10. How would a single gene be transcribed in a eukaryotic cell?
-transcription factors help polymerase find promoter site, introns are removed, methyl cap and poly A tail
11. How would multiple genes of an operon be transcribed in a bacterial cell?
-polycistronic mRNA are transcribed, spacers are removed.
12. Are operons found in eukaryote genomes?
-no
13. Using the arg operon, describe enzyme repression.
A. When is the repressor bound to the operator?
-when arg is available
B. Under what condtions does transcription of the arg operon occur?
-when the arg in the repressor is used by the cell
C. What is the outcome of transcribing the arg operon?
-production of argenine
14. Using the lac operon, describe enzyme induction.
A. When is the repressor bound to the operator?
-when lac is not present
B. Under what condtions does transcription of the lac operon occur?
-when lac is present
C. What is the outcome of transcribing the lac operon?
-production of lac protein
15. How does a repressor protein inhibit the synthesis of a specific mRNA?
-a repressor attaches to the operator site and blocks transcription
16. How does a negatively controlled operon differ than a positively controlled operon?
-a negatively controlled operon prevents transcription while positively controlled operon is an activation
transcription.
17. Using the lac operon, describe catabolite repression.
-both glucose and lactose are used in the catabolite repression. Glucose is used first, then once exhausted the
organism grows on lactose.
18. How is the lac operon regulated by both catabolite repression and enzyme induction?
-both glucose and lactose are used but glucose is absent therefore in order for transcription to occur cAMP must
be present
19. Is catabolite repression of the lac operon positive or negative control of transcription?
-positive??
20. When faced with several sugars as possible carbon sources, do E. coli cells use all of them at the same time or is
there a preference and order to their use?
-glucose is always used first (if available)
21. Using the mal operon, describe positive control of transcription.
A. Under what conditions does transcription of the mal operon occur?
-when maltose is present

22.
23.

24.
25.
26.

27.
28.
29.
30.
31.
32.

B. What is the outcome of transcribing the mal operon?

-a product maltose protein
How does an activator protein differ from a repressor protein?
-an activator protein blocks transcription if substrate is not available(also does not have a operator site). Repressor
protein blocks if protein is available
Describe the process of translation. How does translation differ in bacteria versus a eukaryote? Where does
translation occur in the cell? What is the outcome of translation?
-translation is the coding of RNA to proteins. They both occur in the cytoplasm of the cell. And the outcome is
proteins
In what direction does the ribosome translate mRNA 5 to 3 or 3 to 5 ?
-5-3
If you were given a ribonucleotide (ss mRNA) sequence how would you find the open reading frame? Find AUG
start codon and go to stop codon (UAA,UGA,UAG)
5 AGUCAUGUCAGUACCGAACUGAAAGC 3
If you were given a nucleotide (ds DNA) sequence how would you find the open reading frame?
Translate to RNA sequence, find start codon, find stop codon
5 AGTCATGTCAGTACCGTAGCG 3
3 TCAGTACAGTCATGGCATCGC 5
What three types of RNA are used for translation?
tRNA, mRNA, and ribosomes
How does the ribosome differ in bacteria versus eukaryotes?
-smaller
What part of the ribosome is used to determine which amino acid gets added to the polypeptide?
-bacteria: N-formylmethionine
-eukarya & archea: methionine
What amino acid does AUG code for in bacteria and eukaryotes?
-aminoacyl tRNA
How do nonsense codons signal translation to stop?
-they do not code for amino acids
Describe a way to get a lot of protein from a single mRNA transcript.
-a polysome can translate several ribosomes on a single mRNA
Metabolismno acid fermentation?? Replace with probiotic fermentation?

1. What is a redox reaction?

Electron donor gives electrons to acceptor, donor is oxidized, acceptor reduced
2. What happens to a molecule that is reduced?
It gains an electron. Accepter is reduced.
3. What happens to a molecule that is oxidized?
It loses an electron. Donor is oxidized.
4. What does an electron carrier do?
It transfers electrons from the donor to the acceptor.
5. How can NAD+ act as an electron carrier?
When the NAD+ attaches to an enzyme with a substrate, it gains an electron to and becomes NADH
Gains electrons; product oxidized
6. How can NADH act as an electron carrier?
When NADH binds to an enzyme with a substrate, it donates electrons to the substrate and become NAD+.
Loses electrons; product reduced
7. What are examples of short term energy storage molecules?
Adenosine triphosphate (ATP), and derivatives of coenzyme A thioester bonds
8. What are examples of long term energy storage molecules? How is each considered an energy storage
molecule?
Glycogen, ploy--hydroxybutyrate, and elemental sulfur, They are deposited into the cell as large molecules that can
be broken down in order to make new cell parts when there is no external energy source.
They are insoluble polymers.
9. Where does a chemoorganotroph get its energy and electrons?
It gets its energy and electrons from an organic molecule.
10. Where does a chemolithotroph get its energy and electrons?
It gets its energy and electrons from an inorganic molecule.
11. What type of phosphorylation occurs in glycolysis to make ATP?
Substrate level phosphorylation
12. What type of phosphorylation occurs in fermentation to make ATP?

Substrate level phosphoylation

13. What type of phosphorylation occurs in respiration to make ATP?
Substrate (from glycolysis) and Oxidative phosphorylation
14. What type of phosphorylation occurs in photosynthesis to make ATP?
Photo phosporylation. substrate level and oxidative (just like photosynthesis)
15. What molecules can be fermented?
nucleic acids, proteins, polysaccharides, proteins, alcohols, and others
16. What is syntrophy? When is Syntrophomonas capable of fermenting butyrate? What role would a methanogen
play in helping Syntrophomonas ferment butyrate?
Microorganisms working together to degrade a compound;it can only do it if a methanogen is present; the
methanogen uses the H2 that is created
17. If glucose is fermented, where does the ATP come from? What type of phosphorylation generated that ATP?
What happens to pyruvate? Why is it necessary for pyruvate to be reduced to lactate or other fermention
product?
Pyruvates through glycolysis, SLP, Converted into various molecules to regenerate NAD+, To regenerate NAD+
18. Describe homolactic fermentation of glucose. What microorganisms are capable of this type of fermentation?
Lactate product (2 lactate per glucose, 2 ATP); Gram positive, catalase negative Streptococcus and Lactococcus
19. Describe heterolactic fermentation of glucose. What microorganisms are capable of this type of fermentation?
Lactate and other products (1 lactate per glucose, 1 ATP); Gram positive catalase negative Lactobacillus and
Leuconostoc
20. What are the differences between homolactic and heterolactic fermentation?
The products produced, Homolactic only produces lactic acid, heterolactic produces other products such as
ethanol and CO2 along with lactate
21. Describe mixed acid fermentation. What microorganisms are capable of this type of fermentation? Would a broth
culture of Escherichia coli fermenting glucose have an acidic (low), neutral, or alkaline (high) pH?
Several acids are mixed together in the product, E. coli, low
22. Describe butanediol fermentation. What microorganisms are capable of this type of fermentation? Would a broth
culture of Enterobacter aerogenes fermenting glucose have an acidic (low), neutral, or alkaline (high) pH?
Same types of acids are produced, Enterobacter, neutral
23. How could you tell if an organism did mixed acid fermentation or butanediol fermentation?
Mixed fermentation yields low pH and butanediol fermentation yields neutral pH
24. How is ATP made in a hydrogenosome? What product of glycolysis is used to make ATP in the hydrogenosome?
What kind of microorganism has hydrogenosome? What organelle do these microbes lack?
Pyruvate goes to acetyl CoA then to ATP and acetate; pyruvate is used; anaerobic eukaryotes; these organism
lack mitochondria
25. What product of glycolysis feeds the citric acid cycle?
pyruvate
26. Does the citric acid oxidize or reduce pyruvate to carbon dioxide?
oxidize
27. Where do the NADH and FADH generated by redox reactions of the citric acid cycle go?
They go to the electron transport system, creates proton motive force
28. What are the intermediates of the citric acid cycle, such as oxalacetate and -ketoglutarate used for?
They are used for biosynthesis
29. Aerobic and anerobic respiration differ in what way?
Oxygen is needed from the environment for aerobic respiration
30. What is the terminal electron acceptor for aerobic respiration?
O2
31. What is the terminal electron acceptor for anaerobic respiration?
non-oxygen molecules
32. List 4 protein electron carriers. How many electrons and protons can each accept and donate?
NADH dehydrogenases: accept 2e and 2 H+, donates 2e and 2H+;Flavoproteins:accept 2 e and 2 H+, donate2e;
Iron-sulfur proteins: receive e and donate e; cytochromes: accepts and donates an e
33. Name a very common group of non-protein electron carriers. How many electrons and protons can it accept and
donate?
Quinones receive 2e and 2H+, donate 2e, NAD+ is freely diffusible nonprotein electron carrier able to accept 2
electrons and 2 protons.
34. Which electron carriers contribute to the proton motive force needed to make ATP?
quinones, cytochromes, NADH dehydrogenase and flavoprotein
35. What are the components of an electron transport chain? What is the purpose (the outcome) of an electron
transport chain?
Primary electron donor, electron carriers, terminal electron acceptor; to generate ATP

36. In a eukaryotic cell, in what organelle would an electron transport chain be located? In what membrane? On
which side of the membrane will protons accumulate? On which side of the membrane will ATP be made?
mitochondria; intermembrane/matrix, outside, ATP made in the matrix,
37. In a prokaryotic cell, in what membrane would an electron transport chain be located? On which side of the
membrane will protons accumulate? On which side of the membrane will ATP be made?
Cytoplasmic, outside, inside
38. Facultative aerobes like E. coli have the ability to do aerobic respiration (Fig. 21.14a), anaerobic respiration (Fig.
21.14b), and fermentation (Fig. 15.23a). Which form of metabolism will E. coli use in an oxic environment? Which
form of metabolism will E. coli use in an anoxic environment? Which form of metabolism used by E. coli can be
thought of as a back-up way to make ATP, to be used when the others cannot be used?
aerobic;anaerobic;fermentation
39. What term is used to describe the use of a proton motive force to generate ATP?
Chemiosmosis
40. In what way is the ATP synthase similar to bacterial flagella?
Both are similar rotating motor like proteins, It is rotated by hydrogen atoms as a motor
41. What is the energy source for a phototroph?
Light
42. Name the pigments responsible for harvesting light energy for phototrophs. Where are these pigments located in
a eukaryotic cell? In a prokaryotic cell?
Chlorophylls/bacteriochlorophylls, carotenoids, phycobilins; eukaryotic-chloroplasts; prokaryotic-chlorosomes,
cytoplasmic membrane, thylakoid membranes
43. What pigment resides in the photosynthetic reaction centers in an anoxygenic phototroph?
bacteriochlorophylls
44. What pigment resides in the photosynthetic reaction centers in an oxygenic phototroph?
chlorophylls
45. What do antenna pigments do?
Absorb light energy, transfer energy to rxn center
46. Compare and contrast anoxygenic and oxygenic photosynthesis.
Anoxygenic-does not produce oxygen; oxygenic- produces oxygen, Anoxygenic do not produce oxygen, have
cyclic electron flow, light used to generate ATP, NADH generated by reverse electron flow, inorganic molecules
are electron donors. Oxygenic produces oxygen, z scheme electron flow, ALSO uses light to generate ATP,
NADH generated by z scheme electron flow, water is the electron donor.
47. What is the initial electron donor to anoxygenic photosynthesis?
Inorganic molecule
48. What is the initial electron donor to oxygenic photosynthesis?
water
49. How is oxygen generated in oxygenic photosynthesis?
Water is split, and electrons are taken up, oxygen is released, Chlorophylls that have been excited by enough
light energy take e- from H2O and O2 is released
50. How is NADH generated in anoxygenic photosynthesis?
Reverse electron flow
51. How is NADH generated in oxygenic photosynthesis?
Z-scheme electron flow
52. What process can use the NADH generated by anoxygenic and oxygenic photosynthesis?
Electron transport chain
53. Name a model organism used to study anoxygenic photosynthesis.
Rhodobacter capsulatus
54. Name a prokaryotic model organism used to study oxygenic photosynthesis.
Cyanobacterium, Synechocystis
55. Name a eukaryotic model organism used to study oxygenic photosynthesis.
eukaryotic green alga Chlorella
56. List all catabolic processes discussed in class.
Calvin-Benson cycle, Reverse citric acid pathway, hydroxypropionate pathway, acetyl-CoA pathway
57. The short term energy (ATP) generated by these catabolic processes is used for what?
Biosynthesis
58. Where can organisms get there carbon?
CO2 and organic molecules
59. What name is given to an organism that can take carbon dioxide from the air other organic compounds?
autotrophs
60. Where do heterotrophs get their carbon?
From organic compounds that are not CO2
61. Explain why the Calvin-Benson cycle is often referred to as the dark reaction of photosynthesis.

Light is not required for this rxn to occur, however light does not hinder the rxn from occurring either
62. If we split the term photosynthesis into photo and synthesis, which would be used to describe the CalvinBenson cycle?
synthesis
63. The Calvin-Benson cycle is used by autotrophs to make _____________ .
sugars
64. What is the initial reaction of the Calvin-Benson cycle?
Fixing CO2, RubisCO (see below)
65. RubisCO fixes carbon dioxide (1 carbon) by binding it and ribulose 1,5-bisphosphate (5 carbons) to form two 3carbon molecules of _______________.
phosphoglycerate
66. RubisCO is an acronym. What does it stand for? What other molecule besides carbon dioxide can RubisCO
bind? How could this be a problem?
Ribulose-1,5,-bisphosphate carboxylase ozygenase, Hexose sugars or storage polymers like glycogen or starch,
If RubisCO binds O2, it cannot bind sugar
67. What is the purpose of the Calvin-Benson cycle?
make carbon molecules, fix co2 into sugar
68. What is the purpose of the reverse citric acid pathway?
carbon molecules, cell material, Another pathway to do the same thing, it requires different enzyme
69. What is the purpose of the hydroxypropionate pathway?
CO2 comes in to make cell material
70. What is the purpose of the acetyl-CoA pathway?
Fix CO2 in acetogens
71. How are sugars made? What catabolic process is used? What catabolic process is used in reverse?
glycogenesis; citric acid cycle; glycolysis is used in reverse
72. What are pentose sugars made from?
Ribose and deoxyribose; made by removing CO2 from hexose
73. Use ADPG to explain activated glucose. How does this activated glucose provide the energy to add the glucose
onto a polysaccharide of glucose like glycogen, starch, or cellulose?
ADP is attached to a glucose. When the ADP is split from the glucose. The energy is used to attach the glucose to
the polysaccharide, It carries energy, not at as good as ATP. It carries PO4 group that would be cleaved and
releases enough energy to attach to another by covalent bond; glucose joins glycogen then ADP that can attach
to another molecule
Microbial Growth
Highlighted questions are from articles
1. Distinguish between macronutrients and micronutrients.
Macronutrients: elements required in fairly large amounts
Micronutrients: elements needed in very small amounts
2. Give at least 6 examples of macronutrients.
Carbon, Hydrogen, Oxygen, Nitrogen, Phosphorus, Sulfur, Potassium, Magnesium, Sodium, Calcium, Iron
3. Give at least 4 examples of micronutrients.
Boron, Chromium, Cobalt, Copper, Iron b, Manganese, Nickel, Selenium, Tungsten, Vanadium, Zinc
4. How do growth factors differ from macronutrients and micronutrients?
Organic compounds needed in very small amounts; vitamins. Ex. Lipoic acid
5. Name the 5 groups describing an organisms relationship to oxygen.
Obligate Aerobes: need O2 to make ATP
Facultative Aerobes: prefer O2 to make ATP, can ferment
Microaerophilic Aerobes: use lower O2 levels because they dont require high pressure
Aerotolerant Anaerobes: Ferment regardless of whether O2 is present
Obligate Anaerobes: Ferment in only conditions in which O2 absent
6. What type of broth can be used to determine an organisms oxygen requirement? What does this broth contain
that makes it possible to determine an organisms oxygen requirement?
Thioglycolate broth reducing agent; reacts with oxygen to form water; used to remove oxygen from broth
7. You inoculate the following organisms into tubes containing thioglycolate broth. Where would you expect to see
growth in the tube?
a. Obligate aerobe dense in oxic zone and top of anoxic zone
b. Obligate anaerobe dense in bottom of anoxic zone
c. Facultative aerobe dense in oxic zone, yet evenly spread in anoxic zone
d. Microaerophile sparse in oxic zone, top of anoxic zone

e. Aerotolerate anaerobe evenly spread throughout oxic and anoxic zones

8. What accommodations need to be made to grow an aerobe in the lab?
Need culture medium oxygenated: allow exposure to air, vigorous shaking (250 rpm), bubbling sterile air into the
medium
9. What accommodations need to be made to grow an anaerobe in the lab?
Need oxygen to be excluded from culture medium: bottles/tubes completely filled with media and sealed; use a
reducing agent; anoxic jars; anoxic glove boxes
10. During what process are toxic oxygen molecules generated?
Respiration of peroxidases
11. How does an organism protect themselves from toxic oxygen molecules?
Enzymes made by cells can neutralize toxic forms of oxygen: Catalase, peroxidase, superoxide dismutase,
superoxide reductase, combination of superoxide dismutase and catalase
12. What enzyme combinations would detoxify superoxide (O2-)? In what organisms might those combinations be
found?
Superoxide dismutase/catalase : obligate aerobes and facultative aerobes
Superoxide reductase : obligate anaerobes
13. Where can an organism get nitrogen?
Atmospheric nitrogen; inorganic compounds (ammonia and nitrate)
14. Name a molecule that requires phosphorus. Where can a cell get phosphorus?
Nucleic acids and phospholipids
Phosphate minerals and free phosphates
15. Name a molecule that requires sulfur. Where can a cell get sulfur?
Amino acids (cysteine and methionine); vitamins; iron-sulfur proteins
16. Name a molecule that requires potassium. Where can a cell get potassium?
Enzymes; used to maintain solute concentrations
Free potassium ions or potassium salts
17. Name a molecule that requires magnesium. Where can a cell get magnesium?
Stabilizes ribosomes, membranes, and nucleic acids; required by many enzymes
Salts in various minerals
18. Name a molecule that requires iron. What specialized molecule allows some organisms to sequester iron? What
are two examples of siderophores?
Electron transport chain proteins; siderophores
Siderophores molecules bind iron and transport it into the cell
Enterobactins: Escherichia coli and Salmonella typhimurium
Aquachelin: marine bacteria
19. Name a structure that requires calcium. Where can a cell get calcium? (See Table 5.1)
Stabilizes cell walls; endospores (calcium dipicolinic acid complex)
Calcium ion in solution; calcium sulfate; other calcium salts
20. Name a structure that requires sodium. Where can a cell get sodium? (See Table 5.1) Can sodium motive force
(instead of a proton motive force) be used by some organisms to generate ATP?
Marine microorganisms; stabilizes cell walls; used by ATP synthase
Sodium in solution; sodium chloride; other sodium salts, YES
21. Define growth as it pertains to microorganisms.
Increase in the number of cells
22. What is the most common process by which prokaryotes grow?
Binary fission
23. What genomic event must take place before a cell divides?
DNA replication
24. What proteins are required to move the copies of DNA to opposite sides of the dividing cell?
Min proteins
25. Following DNA replication, what must form for cell division to continue?
Divisome
26. What proteins form the divisome? Where are these proteins located? How does there location correlate with
where division will begin?
Min proteins ensure divisome forms at cell center
FtsZ proteins form ring where cell division begins
FtsA proteins help hold FtsZ ring to cytoplasmic membrane
27. Does the divisome move?
no
28. FtsZ protein has similar amino acid sequence to what eukaryotic cytoskeletal protein?
tubulin
29. As the cell elongates new cell wall is laid down at certain sites determined by the location of what protein?

30.

31.
32.
33.

34.
35.
36.
37.

38.

39.

40.
41.

MreB proteins
Filamentous spiraled bands around inside of cell under cytoplasmic membrane direct new cell wall to be made at
certain locations
As the cell elongates holes are made in the existing cell wall to make room for new cell wall material. What
enzyme makes these holes? What happens if these holes are not quickly filled with new cell wall material? If a
cell lacks FtsI proteins, what will happen once these holes are made?
Autolysins create small openings in existing cell wall
FtsI proteins (penicilling binding proteins) are transpeptidases that insert new peptidoglycan into expanding cell
wall
Autolysis (spontaneous cell lysis due to osmotic pressure) may occur if there is an error in inserting new cell wall
material
How does the new peptidoglycan precursor differ from existing cell wall peptidoglycan?
N-acetylglucosamine/ N-acetylmuramic acid/ pentapeptide
5 amino acids attached to the peptidoglycan precursor (existing peptidoglycan units have 4 amino acids)
How does the new peptidoglycan precursor get to the expanding cell wall?
Bactoprenol transports the precursor across the cytoplasmic membrane
What makes bactoprenol a good molecule to transport the new peptidoglycan precursor across the cytoplasmic
membrane?
*hydrophilic lipid alcohol
sugars cannot go across the cytoplasmic membrane freely
Makes the precursor sufficiently hydrophobic to pass through and interacts with glycolases to insert the
precursors
FstI proteins catalyze what reaction?
Transpeptidation: insertion of peptidoglycan precursors into existingwall
What happens to the peptidoglycan precursor during transpeptidation?
Peptide bond formation between pentapeptide of peptidoglycan precursos and tetrapeptide of an existing
peptidoglycan unit
In binary fission, where is new well wall added relative to the divisome?
Cell wall material is added to many locations to the left and right of the divisome
Describe simple budding. How is simple budding different than binary fission? Give an example of a prokaryotic
microorganism that divides by simple budding. Give an example of a eukaryotic microorganism that divides by
simple budding.
Simple budding: growth only occurs on one side of the cell
When its big enough, DNA will be replicated and placed inside the bud, which will pinch off, producing two
identical cells
Yeasts
Pirella, Blastobacter Hyphomicrobium, rhodomicrobium, pedomicrobium
Saccharomyces cerevisiae, Chlamydomonas reinhardtii
Describe budding by hyphae. How is the new cell different than the parent cell? What is a swarmer cell capable
of doing? Give an example of a prokaryotic microorganism that divides by budding by hyphae.
Mother cell forms a hypha (extension of one side)
Hypha lengthens, DNA replication occurs
DNA passes through the hyphae
Septum forms before disconnection
Daughter cell FORMS FLAGELLA (swarmer cell)
Mother cell hyphae continues to length, DNA replication can begin again
Capable of swimming away, moving to a new location. Different and more plentiful nutrients available. Less
competition
Hyphomicrobium, Rhodomicrobium, Pedomicrobium
Describe cell division in stalked bacteria. How is the new cell different than the parent cell? Give an example of a
prokaryotic microorganism that divides this way.
Swarmer cell loses its flagellum
Synthesis of stalk
Elongation of stalked cell
Synthesis of flagellum
Cross band formation
Cell division
Caulobacter
Compare and contrast cell division in stalked bacteria and budding by hyphae.
Stalked bacteria attach to surface and the daughter cell disattaches and swims away whereas hyphae the parent
is not attached, it simply replicates its DNA, the daughter then swims away with the flagella like the stalk
Describe the growth cycle. Do the growth phases always occur in the order presented in figure 6.10?

Populations of microorganisms show a characteristic growth pattern when inoculated into a fresh culture medium
1. lag phase transition period to allow synthesis of enzymes for biosynthesis
2. exponential phase regularly diving cells
3. stationary phase essential nutrient depleted, toxic products build up, growth stops
death phase cells die
42. If you use a loopful of turbid culture of E.coli in stationary phase to inoculate a new broth culture, at what growth
phase will the cells start?
Lag.
If an inoculum is taken from an old (stationary phase) culture and transferred into the same medium, there is
usually a lag even if all the cells in the inoculum are alive
43. If you use a loopful of turbid culture of E.coli in exponential phase to inoculate a new broth culture, at what growth
phase will the cells start?
Lag
Mircroorganisms always start back at the lag phase to matter the cirumstance
44. If you use a loopful of turbid culture of E.coli in lag phase to inoculate a new broth culture, at what growth phase
will the cells start? Would it matter if the new broth culture was the same medium (same composition) or different
medium?
It would make no difference. The process will always begin back at lag phase.
45. Plot on a graph what the growth cycle would look like during the entire process described here: You grow an
E.coli culture in glucose broth. Once it reaches stationary phase presumably due to consumption of all the
glucose, you add additional glucose.
46. During exponential growth cells predictably ______________.
** During exponential growth cells predictably double
47. Explain why generation time is often referred to as doubling time.
The time required for ONE cell to form TWO cells
48. Graph the exponential growth examples on semilogarithmic graph paper, both of which are posted on Moodle. Be
able to determine from the graphs, the generation time, how many cells after a period of time, and at what time
would there be a certain number of cells.
49. Describe an everyday situation in which exponential growth would be relevant.
Non-sterile, nutrient rich food products such as milk allowed to stand under ideal bacterial growth conditions..
at early exponential growth is not so bad.
during later times of exponential growth can mean spoilage.
50. Know when to use N=N02n. Be able to calculate the final cell number (N) if given the initial cell number and
number of generations of growth. Be able to calculate the initial cell number (N 0) if given the final cell number and
number of generations of growth.
N = No2n = final number of cells
No = initial number of cells
n = number of generations
51. Know when to use g=t/n. Be able to calculate the generation time (g) if given the time of exponential growth and
number of generations. Be able to calculate the amount of time of exponential growth (t) if given the generation
time and number of generations. Be able to calculate the number of generations (n) if given the time of
exponential growth and generation time.
g = t/n = generation time
t = time of exponential growth (hr, min)
52. Give an example of a batch culture.
Fixed volume of culture medium
Closed system
Used for routine laboratory procedures
53. How does a batch culture differ from a chemostat culture?
Chemostat: Continuous culture devices
Maintain cell populations in exponential growth for long periods
54. What can be controlled in a chemostat that allows for a continuous culture to be maintained?
Dilution rate and the concentration of limiting nutrients
55. What are the two types of cell counts? When would you use one type of cell count over the other?
Total cell count: total number of cells, direct microscopic count
Viable count: viable (living, reproducing) cells; plate or colony count
56. What instrument is used for a total cell count?
Counting chamber
57. Viable counts can be done in what 2 ways?
Spread-plate method
Pour-plate method
58. What procedure usually precedes a plate count? Why is this done?

59.
60.
61.
62.
63.

Several 10fold dilutions of the sample are commonly done prior to plating because the initial concentration of
bacteria in the sample is unknown
What property of the culture is being measured by turbidity measurements?
The more turbid a suspension, the more cells present
Indirect measurement of cell count
What instrument is used for a turbidity measurement?
Spectrophotometer
Turbidity is measure in _____________________ units.
optical density
What exactly is the spectrophotometer measuring?
Scattered light
Be able to interpret a graph of turbidimetric measurements as shown in figure 6.17b.

64. What does a standard curve represent?

Correlates turbidity measurements with actual cell number or mass
Made for an organism growing in a particular medium
Can be used for estimating cell number of future cultures
65. Describe the procedure for creating a standard curve.
Plate count to determine titer (cfu/ml) of original culture
Turbidimetric determination of dilutions of original culture
Calculate number of cells in each dilution based on the titer and absorbance of the original culture
66. Graph the standard curve examples on plain graph paper, both of which are posted on Moodle. From the graphs,
be able to determine the optical density of a certain number of cells.
67. Distinguish between species richness and abundance.
Species richness- variety of species
Species abundance a lot of the same kind of species
68. In what type of environment would you expect to have specie richness?
Undisturbed organic-rich soils
69. In what type of environment would you expect to have specie abundance?
Extreme environments
70. In the real world, how do microbes live? as pure cultures?
not as pure cultures, in communites, competive.
71. What term refers to where a microorganism lives?
microenvironment
72. List 3 reasons microbes sometimes grow differently in the lab than they do in their natural habitat?
Suboptimal resources or growth conditions
Distribution of nutrients not uniform in habitat
Microbes growing in mixed populations where competition exists
73. Where do biofilms form?
Solid surfaces
74. Why do biofilms form? What advantages does living in a biofilm offer a microorganism?
Provide defense by number
Allow cells to stay in a favorable niche
Allow cells to live in close association (metabolic cooperation between species)
75. List the stages of biofilm formation. What happens during each stage? At what stage would the biofilm look like a
mushroom?
Attachment: adhesion of a few cells to a suitable solid surface
Colonization: intercellular communication, growth and polysaccharide formation
*Development: more growth and polysaccharide
Psuedomonas aeruginosa mature biofilm mushroom
76. What problems are caused by biofilms?
Cystic fibrosis
Periodontal disease
Infections from implants (catheter, artificial joints)

77.
78.
79.
80.

Pipeline (oil, water) congestion and corrosion

Degradation of submerged objects like offshore oil rigs and boats
Why are antimicrobial agents usually ineffective against biofilms?
There are so many and they are constantly recruiting more bacterial cells
Name a signal molecule released by some microbes to encourage biofilm formation.
Acylated homoserin lacton (AHL)
Communication amongst microbes that form biofilms is called ______________?
Quorum sensing
How do acylated homoserine lactones promote biofilm formation?

81. What quorum sensing signaling molecule does Psuedomonas aeruginosa use?
82. Does Staphylococcus aureus use the same signaling molecule as P. aeruginosa?
83. What is absent from Delisea pulchra? What chemical is responsible for this?
Biofilms; substituted furanones
84. How do furanones prevent biofilm formation? What stage of biofilm formation do furanones prevent?
Furanones bind to bacteria cells at sites normally used by other signals and block signaling molecules from
delivering the message
Colonization
85. Name a researcher who studies biofilms. Name at least one thing she discovered. In what bacteria did she
discover this?
Bonnie Bassier, discovered quorum sensing in Vibrio fischeri
86. What can Vibrio fischeri and Vibrio harveyi do when enough cells get together?
87. What can Vibrio cholerae do when enough cells are present?
88. Are bacteria capable of knowing the cell next to them is like them or not?
Yes
89. What micronutrient is found in AI-2?
Boron
90. Where are most terrestrial microbes found?
Surface of soil particles around plant roots in the rhizosphere
91. In aquatic environments, what types of microbes are found the upper depths and at the surface?
Cyanobacteria and algae
92. In aquatic environments, what types of microbes are found the lower depths?
Purple and green sulfur bacteria
93. Describe the events that take place in a river after the introduction of sewage or other high-nitrogen or highphosphorus input. (see Figure 23.9)
An increase in bacterial numbers and a decrease in oxygen occur immediately upon the spike in organic matter
(sewage)
94. What happens to the oxygen concentration after the introduction of sewage or other high-nitrogen or highphosphorus input? What microbes cause this? What metabolic process is responsible? When will the oxygen
concentration return to previous levels? What microbes are responsible for this? What metabolic process is
responsible?
Oxygen levels decrease because the bacteria take up the nitrogen and phosphorus and go through the process of
anaerobic respiration. The oxygen levels will return to previous levels when the nitrogen and phosphorus levels
decrease. The organisms responsible for the increase in oxygen are algae and cyanobacteria going through
aerobic respiration
95. What is nonpoint pollution referring to?
Runoff from a wide area, not a single source
96. Where does fecal contamination of American beaches primarily come from?
Because of booming growth in US coastal regions, much of the area near the shoreline is covered with
impervious surfaces such as parking lots, roads, and side walks. When it rains, storm water runoff from these
surfaces can carry animal feces and their accompanying microbes into drainage ditches that lead directly to lakes,
streams, and beaches
97. Where would you find oxygenic phototrophs like cyanobacteria and algae within an aquatic environment?
Photic zone
Epilimnion
Between the surface to 100m deep
98. Where would you find anoxygenic phototrophs like the purple and green sulfur bacteria within an aquatic
environment? Why are they located here?

Hypolimnion
Deeper water, anoxic
99. Where in the water column do phototrophs, chemoorganotrophs, and chemolithotrophs each reside in a marine
(i.e. an ocean) environment?
100.
Phototrophs- Surface 100 meters
101.
Chemoorganotrophs- 100- 1000 meters
102.
Chemolithotrophs- 1000- 5000 meters
103.
What are terms used to describe an organisms requirement for elevated pressure?
Barotolerant- tolerate elevated pressure but grows best at low atm
Barophile- grows best under high pressure
Extreme barophile- required high pressure for growth, Moritella
104.
Describe the environmental conditions in the deep sea.
High pressure, low temp & nutrients
Hydrothermal vents are deep sea hot springs where volcanic activity generates fluids containing large amounts of
inorganic energy sources that can be used by autotrophic chemolithotrophs
105.
What structures on the ocean floor provide warmth and inorganic nutrients to organisms that live down
there?
Hydrothermal vents
106.
Where does the carbon dioxide come from that autotrophs use in the deep sea?
CO1 comes from bicarbonate (sediments) and action of carbonic anhydrase
107. Define mutualism. Describe an example of a mutualistic relationship in the deep sea.
Mutualism: an obligate relationship in which both organisms benefit
Marine invertebrate/ Bacteria
Ritfia giant tube worm and sulfide-reducing bacteria

TEST 5 VIRIAL REPLICATION??

108. Do viruses require a living host cell?
yes
109. Is it common for a virus to be able to infect across domains (Bacteria, Archaea, Eukarya)?
no
110. Name the two kinds of prokaryotic virus. Give an example of each.
Virulent virus- Bacteriophage T4
Temperate virus- Bacteriophage Lambda)
111.What are the five steps in virulent phage life cycle?
Attachment to a specific receptor on host cell, usually a membrane protein
Penetration of either the whole virus (eukaryotic) or just its genome (prokaryotic, injection)
Synthesis of nucleic acid and protein host machinery replicates viral genomes and make viral protein (capsid
proteins)
Assemble and packaging of structural subunits and genomes in capsid
Release (lysis) by budding or lysis of host cell; new virions can infect new host cell
112. What are the steps in a temperate phage life cycle? How does the life cycle of a temperate phage differ from a
virulent phage?
A virulent virus goes through the lytic cycle immediately and doesnt go through a stage of dormancy.
113. What term is used to describe the alternative pathway that temperate phages have?
Lysogeny
114. What term is used to describe the temperate virus when it is incorporated into the DNA of the host cell?
Prophage
115. What term is used to describe a host cell harboring a prophage?
- Lysogen
116. Name two repressor proteins that determine whether bacteriophage lambda enters lysogeny. What does each
repressor protein do?
C1 (lambda repressor)- represses genes involved in lysis and is required in low concentration to maintain
lysogeny
Cro- represses genes involved in lysogeny and is needed in greater amounts than C1 to force lambda into lytic
cycle
117. If both CI and Cro are simultaneously made by the virus, then how will levels of CI and Cro differ?
C1 will be in low doses and force the cell to remain in lysogeny and if Cro is in high doses then the cell will lyse.
118. Under what host cell conditions, would lambda enter lysogeny? Will CI or Cro protein concentration be higher?

If the number of viruses is greater than the host cells, then a virus can continue to replicate as a prophage when its
host cell divides. C1 protein concentration will be higher.
119. Under what host cell conditions, would lambda enter the lytic cycle? Will CI or Cro protein concentration be
higher?
If the cell has DNA damage (X-rays, UV, or chemicals) or in nutrient rich environments when many proteins are
present in the host cell. Cro protein concentration will be higher.
120. Name and describe the 4 types of animal viruses. Which animal virus is similar to a virulent bacteriophage?
Which animal virus is similar to a temperate bacteriophage?
Lytic- destruction of host cells; similar to virulent
Persistent- new virions leave host by budding; cells dont die, but remain infected and will produce virions
Latent- virus is not actively replicating, dormant; similar to temperate
Transformation- virus can change normal cell into cancer cell; genetic changes that regulate growth
121. What is the most infamous human retrovirus?
122. Describe of the structure of a typical retrovirus.
123. What is the genome of a retrovirus? RNA or DNA? Single-stranded or double-stranded?
124. What 3 enzymes are packaged inside the nucleocapsid of a retrovirus? What does each of these enzymes do for
the virus?
125. Describe the retroviral replication cycle. At which points are reverse transcriptase, integrase and protease
needed?
126. Name the 3 regions of the retroviral genome. Name and give the purpose of the proteins made from each region.
Gag- structural proteins and protease
Pol- reverse transcriptase and integrase (DNA endonuclease)
Env- envelope glycoproteins
127. With no translational machinery (ribosomes, tRNAs) encoded by the virus, how does the virus makes its proteins?
The virus uses the tRNA found in the host cell. The virus inserts its genome into the host cells DNA and that is how
it transcribed and translated.
128. How do new retrovirus virions leave the host cell?
129. Where does the envelope come from that surrounds some viruses, like retroviruses?
The hosts cytoplasmic membrane
130. How is the viral envelope similar to the host cells cytoplasmic membrane?
The viral envelope is the same cytoplasmic membrane that surrounds the host cell.
131. How is the viral envelope different from the host cells cytoplasmic membrane?
The viral envelope is surrounded by glycoproteins.
Control of Microbial Growth
1. Describe two ways prokaryotes defend against viral infection.
Restriction- using restriction endonucleases to cut viral dsDNA at specific sequences
Methylation- DNA methylases to methylate their own DNA to prevent cleavage by their own and viral restriction
endonucleases
2. What type of DNA is susceptible to restriction endonuclease cleavage?
Double stranded DNA
3. Will restriction be effective against RNA viruses? Against ssDNA viruses?
No ssDNA and RNA viruses are unaffected by restriction systems.
4. How can viruses avoid host defenses?
Double stranded DNA viruses modify DNA to avoid digestion by the hosts restriction endonucleases
Glucosylation- disguising with sugar
Methylation
Viral genomes encode proteins to inhibit host restriction systems
5. What occurs during the latent period of viral replication? (see Fig. 10.9)
The virus is not actively replicating; dormant.
6. Describe RNA interference. What type (animal, prokaryotic, DNA, RNA, etc.) of virus is this effective against?
Dicer- double stranded RNA nuclease dices the viral RNA molecule into small fragments. The RISC complex then
binds to these short fragments to create single stranded RNA. The slicer chops up the complementary strands
that match the RNA found in the RISC complex. The slicer uses single stranded RNA nuclease. Animals and
plants use this type of immune system.
7. What is the primary way for humans to control the spread of viruses?
By controlling attachment and in general vaccinations.
8. What kind of drugs can be used to treat viral infections? What do these medicines target? Can antibiotics be
used to treat viral infections?
Fusion inhibitors- synthetic peptide that binds to an HIV membrane protein preventing the viral membrane from
binding to the host cell membrane

9.
10.
11.

12.
13.
14.
15.
16.
17.
18.

19.
20.
21.
22.

23.
24.
25.
26.
27.

28.

Reverse Transcriptase Inhibitors- block reverse transcription

Protease inhibitors- bind HIV protease, preventing the protease from processing viral polypeptides
No antibiotics cant be used to treat viral infections, only used for bacteria
Who is Louis Pasteur? What hypothesis did he disprove?
Louis Pasteur discovered the process of fermentation as well as pasteurization. He disproved the hypothesis
spontaneous generation, which stated that living organisms can originate from non-living matter.
Is pasteurization the same as sterilization?
Pasteurization is not the same as sterilization. Pasteurization reduces microbial load and kills most pathogens
and inhibits growth of spoilage microorganisms. Sterilization is the killing of all organisms.
List the 4 methods of physical sterilization. Which is most widely used?
Heat- most widely used method of sterilization
Radiation
Filtration
Cold (gas)
Why cant heat be used to sterilize everything?
Some things are heat resistant. endospores
The temperature needed for heat sterilization depends on the ______________ temperature of growth for an
organism.
Optimum
Define decimal reduction time. Would the decimal reduction time be more quickly achieved at lower or higher
temperatures?
What equipment is used to heat sterilize?
Autoclave
How does an autoclave sterilize?
Uses steam heat under pressure; 121 degrees Celsius.
What factors determine the amount of autoclave time needed for sterilization?
Number, size, density
List 4 factors that increase heat resistance.
High pH
High solute concentration
Thermophile
Endospores (high content of small acid soluble proteins and low water content)
What are the different types of radiation used for sterilization?
Ultraviolet radiation
Ionizing radiation
Which kind of radiation is more lethal? Why?
Ionizing radiation because is causes breaks in the DNA strands, breaks hydrogen bonds and disulfide bridges in
proteins.
Compare the damage done by UV versus ionizing radiation.
UV- Causes thymine dimers in DNA
Ionizing- Causes breaks in the DNA strands, breaks hydrogen bonds and disulfide bridges in proteins.
How does filter sterilization work?
Filter is a device that has pores too small for microorganisms to fit through but large enough for the liquid or gas to
pass
Removes microorganisms from liquids that are heat sensitive
Sterilizes air
How do depth filters differ from membrane filters?
Depth filters are fibrous sheets or mats and they trap particles from liquids and the air. Membrane filters are very
thin and act like sieves, trapping particles on the membrane surface.
What is commonly sterilized by depth filters?
Quarantine rooms
What is commonly sterilized by membrane filters?
Antibiotics and other pharmaceuticals
Distinguish cidal agents from static agents.
Cidal agents are chemicals that kill organisms
Static agents inhibit growth of microorganisms
Compare and contrast bacteriocidal agents and bacteriolytic agents in general. (Use Fig. 27.9)
Bacteriocidal agents bind tightly to their cellular targets, lysis does not occur, and triclosan blocks fatty acid
synthesis in many Bacteria
Bacteriolytic agents kill cells by lysis and antibiotics such as penicillin inhibit cell wall synthesis
Primarily what are chemical antimicrobial agents used for by various industries such as paper, petroleum, air
conditioning?

To prevent microbial growth

29. Who is credited with the discovery that sterilizing surgical instruments increased the survival rate of surgery
patients?
Joseph Lister
30. List the 4 categories of chemical antimicrobial agents used to control microorganisms considered to be harmful to
humans. Give an example of each. (See Table 27.4)
Sterilants- Formaldehyde
Disinfectants- Chlorine
Sanitizers- Chlorine
Antiseptics and Germicides- Alcohol, silver nitrate
31. Who was the first to coin the term chemotherapy?
Paul Ehrlich
32. Who is credited with the discovery of the first chemotherapeutic agent? What was it? What was it used to treat?
Did it meet the criteria of selective toxicity?
Paul Ehrlich discovered Salvarsan, which was the first chemotherapeutic antimicrobial drug used to treat Syphilis.
Yes it did meet the criteria of selective toxicity.
33. How does a chemotherapeutic agent differ from an antiseptic?
A chemotherapeutic agent is a chemical antimicrobial agent used inside the human body that kills or inhibits the
growth of microorganisms.
34. In general, how do synthetic chemotherapeutic agents differ from antibiotics?
Synthetic chemotherapeutics are man made.
35. Give examples of synthetic chemotherapeutic agents.
Growth factor analogs- Sulfa drugs and Isoniazid
Nucleic acid base analogs- used to treat cancer
Quinolones- ex. Fluoroquinolones
36. How does the sulfa drug, sulfanilamide, disrupt folic acid synthesis in bacteria?
By tricking the cell into thinking it is taking up aminobenzoic acid, which is needed to make folic acid. The sulfa
drug looks similar but doesnt contain the carbon and oxygen necessary for folic acid.
37. How does isoniazid disrupt mycolic acid synthesis in Mycobacterium?
The cell thinks it is taking up Nicotinamide, which is needed to make mycolic acid, but instead it picks up the
Isoniazid drug, which is similar but has an extra nitrogen group, which disrupts the synthesis of mycolic acid.
38. How does 5-bromouracil alter the DNA in bacteria?
5-bromouracil is a thymine analog that tricks the bacteria into thinking it is taking up thymine but instead takes up
the 5-bromouracil, which will not be able to be transcribed into mRNA.
39. What is the mode of action for quinolones?
Compounds that interact with bacterial DNA gyrase preventing the gyrase from supercoiling DNA.
40. What is the origin of all antibiotics?
Secondary metabolites of other microorganisms
41. What term is used to describe the range of effectiveness for an antibiotic?
Antimicrobial spectrum of activity
42. In general, distinguish broad spectrum antibiotics from narrow spectrum antibiotics.
Broad spectrum antibiotics are effective against a wide variety of bacteria and narrow spectrum antibiotics are
effective on a subset of bacteria. Beta lactam antibiotics are the most important clinical antibiotics.
43. What class of antibiotics has the broadest spectrum of activity?
Beta lactam antibiotics are the most important clinical antibiotics.
44. Name an antibiotic with a narrow spectrum of activity.
Polymxins- Gram-negative bacteria
45. What was the first antibiotic discovered? Who discovered it? What microorganism makes it? What
microorganisms is it effective against? What class of antibiotics does it fall under?
Penicillin G was discovered by Alexander Fleming. Penicillin is made by the fungus Penicilium and grew on the
plate of Staphylococcus. Penicillin is effective against some Gram-negative, all Gram-positive, and some forms of
Chlamydia bacteria. Penicillin belongs to the beta-lactam antibiotics.
46. Who won the Nobel Prize for mass producing penicillin G? What historical event was taking place at that time
giving great significance to the mass production to penicillin G?
In 1945 Alexander Fleming, Walter Florey, and Ernst Boris Chain received the Nobel Prize in medicine. World War
II was going on at the time and Penicillin G saved the lives of many soldiers who received minor wounds that
would have otherwise probably killed them.
47. What is the mode of action of -lactam antibiotics? Are -lactam antibiotics bacteriocidal, bacteriolytic, or
bacteriostatic? What enzyme is capable of destroying -lactam antibiotics with an accessible -lactam ring?
-lactam antibiotics inhibit cell wall synthesis in bacteria by binding to transpeptidases. -lactam antibiotics are
bacteriocidal. -lactamase is capable of destroying -lactam antibiotics.
48. What are the 2 main types of -lactam antibiotics?

Penicillins and Cephalosporins

49. What is the origin of cephalosporin?
Made by the fungus Cephalosporium
50. Name the 2 fungal-derived antibiotics.
Penicillin and Cephalosporins
51. List 6 bacteria-derived antibiotics. What is the mode of action of each? What microorganisms are they effective
against?
Aminoglycosides- bind to the 30s subunit of the ribosome and are effective against Gram-negative bacteria
Macrolides- bind to the 50s subunit of the ribosome and are effective against some Gram-negative, Grampositive, and some Chlamydia bacteria
Tetracyclines- bind to the 30s subunit of the ribosome and are effective against some Gram-negative, Grampositive, Chlamydia, and Rickettsia bacteria.
Vancomycin- binds to pentapeptide of the peptidoglycan precursor and are effective against Gram-positive
bacteria
Daptomycin- binds to and causes depolarization of the cell membrane- disrupts proton gradient and ATP
synthesis and it is effective against Gram- positive bacteria
Platensimycin- inhibits fatty acid biosynthesis enzymes, which can inhibit cell growth and it is effective against
Gram-positive bacteria, including MRSA and VRE
52. What genus of bacteria is responsible for most antibiotics? Name another genus of bacteria we get antibiotics
from.
Streptomyces; Amycolatopsis
53. List 5 resistant mechanisms and for each an example of an antibiotic that the resistant mechanism is used
against.
Reduced permeability- to reduce the uptake of the antibiotic; penicillin
Inactivation of antibiotic- enzymes that alter the makeup of the antibiotic; penicillin
Alteration of target- affects ribosomes, DNA gyrase, RNA polymerase by changing the genetic makeup slightly so
that antibiotics cant attack the target; Erythromycin
Development of resistant biochemical pathway- the making of certain molecules by using resources from the
environment instead of the mineral precursors that some antibiotics resemble; Sulfonamides
Effux- getting rid of antibiotic out of porous membranes; tetracyclines
Lack of structure- no cell wall bacteria will not be affected; penicillin
54. Describe how chromosomal mutation can make a bacterium resistant to an antibiotic.
A mutation in the gene for the 30s ribosomal subunit that still allows the ribosome to function but prevents the
antibiotic from binding to it.
55. Describe how resistance plasmids can make a bacterium resistant to an antibiotic.
Resistance plasmids contain genes encoding enzymes that inactivate antibiotics, prevents uptake of antibiotics,
and actively pumps antibiotics out of the cell.
56. Describe how a virus can make a bacterium resistant to an antibiotic.
A virus can transfer DNA that has genes for resistance during the process called transduction
57. What kinds of proteins are encoded for by genes on resistant plasmids?
58. If humans were not on Earth, would antibiotic resistance still occur?
Yes because bacteria still live in environments where the bacteria who produce certain antibiotics live in harmony
with other bacteria that are resistant to the antibiotics they produce.
59. Having antibiotic resistance allows a bacterium to?
Survive and to pass on the antibiotic resistance to other bacterium.
60. What soil microorganisms would take over if it werent for other microorganisms having mechanisms of bacterial
resistance?
Streptomyces
61. How do humans impact microbial drug resistance?
Resistance can be accelerated by the indiscriminate use of antimicrobial drugs. Humans dont finish the doses
given to them or they receive antibiotics for something that cant be fixed by drugs.
62. Look at figure 27.28a, for which antibiotic are there more resistant fecal strains of bacteria. Explain why there are
more resistant strains of bacteria to those antibiotics that are used most.
Tetracycline; there are more resistant strains of bacteria to those antibiotics that are used most because the
bacteria that was first introduced to these antibiotics that were resistant survived and reproduced and took the
place of the susceptible bacteria.
63. How long does it take for resistant strains of a bacterium to emerge once an antibiotic is being used by the public?
About 5 years
64. List at least 3 things you as a consumer of antibiotics can do to help minimize your impact on microbial drug
resistance.
Get a vaccination
Avoid unnecessary introduction (IV, catheters)

Wash hands
Avoid contact with others
65. List at least 3 things medical physicians can do to help minimize your impact on microbial drug resistance.
Target the pathogen
Use least exotic antimicrobial agent
Full course therapy
66. Why did pharmaceutical companies in the 1980s cut back on searching for new antibiotics? What is the lesson to
be learned from this mistake?
hey thought they had found enough drugs that would last forever and they didnt think bacteria would grow
resistance to these antibiotics. Bacteria strains that are resistant to antibiotics occur within five years of the
introduction of the antibiotic so dont slack.
67. Why must we continue to discover new antimicrobial compounds?
There is always going to be bacteria that are resistant to antimicrobial agents so there needs to be a continuous
search for new cutting edges medicines.
DIVERSITY
1. How old is the Earth?
a. The earth is about 4.5 billion years old
2. What is used to date the Earth to be that old?
a. Calculations, but there are rocks that date back to 3.86 billion years old. They are pillow lavas.
3. Evidence for microbial life are found in rocks that date back 3.5 billion years ago.
4. What are stromatolites? At what time during Earths history were all beaches likely covered in stromatolites?
a. Stromatolites are large groupings of cyanobacteria microorganisms growing together in rock formations.
These date back to about 2.5 billion years ago.
5. What event occurred between 2.2-2.8 billion years ago? What effects did it have on the planet? What kind of
microorganisms were involved?
a. The stromatolites and the oxygenic phototrophic cyanobacteria began to form large amounts of oxygen.
This oxygenation oxidized the iron that was collecting in the oceans. This began the change of earths
atmosphere from mostly carbon dioxide to mostly oxygen.
6. How did the banded iron formations form?
a. Was produced due to the oxygenation of the iron in the oceans. The iron mixed with the oxygen to form
an insoluble iron oxide that sank to the bottom of the ocean.
7. Was the first cell prokaryotic or eukaryotic?
a. Prokaryotic
8. What theory explains the origin of the eukaryotic mitochondria and chloroplast?
a. The endosymbiosis theory
9. Forming the primitive mitochondria there was symbiotic uptake of a cell with what type of metabolism?
a. The organism with a respiratory metabolism is believed to be the ancestor to the mitochondria
10. Forming the primitive chloroplast there was symbiotic uptake of what kind of cell?
a. The cell was capable of photosynthesis.
11. Provide support for the mitochondria and chloroplasts having bacterial origins.
a. Mitochondria and Chloroplasts
i. Have their own genomes
ii. Contain their own ribosomes
1. 70S like prokaryotes
2. Antibodies are effective
3. rRNA sequences are similar to prokaryotic rRNA
12. Describe the hydrogen hypothesis.
a. The hydrogen hypothesis describles a hydrogen dependent archaea cell up taking a hydrogen producing
cell which was the precursor for the mitochondria
b. Also, that a photosynthetic cyanobacterial cell was taken up to form a chloroplast
13. The sequence of what nucleic acid is compared to determine the evolutionary relationship between organisms?
a. The SSU (small subunit) is used to determine evolutionary relationships.
14. Phylogenetic trees represent what type of relationship?
a. A phylogenic tree represents ancestral and descendent relationships.
15. Answer the following questions using the phylogenetic tree below.
a. To which organism is B most closely related?
i. A
b. To which organism is C most closely related?
i. B
c. Which organism is the most recent descent from the ancestor at internal node 2?
i. B

d. Which organism could be the outgroup?

i. E because it is the least related to the rest.

Node 2

16. Traditionally what phenotypic analyses were done to compare organisms? Are these still used today?
a. Traditional analysis was done in the lab, checking morphology, motility, metabolism, physiology, cell
chemistry, and other traits like pigment and antibiotic sensitivity.
17. Use information on GC ratio, DNA:DNA hybridization and 16S/18S rRNA sequence to answer the following
questions.
a. What are the criteria for determining an organism is a new genus?
i. Having no more than 25% DNA in a hybridization match up.
b. What are the criteria for determining an organism is a new species?
i. Having more than a 5% difference in GC ratio, and having less than 70% DNA matchup during
hybridization.
18. What is the GC ratio of an organism?
a. The GC ration is the percent of guanine plus cytosine in an organism Also, the higher the GC ratio the
higher the denaturing temperature.
19. What is the principle behind DNA:DNA hybridization?
a. DNA:DNA hybridization is the idea that the DNA of a known species can be denatured and mixed with the
denatured DNA of an organism believed to be of the same species, and when mixed 70 to 100% of the
two DNA should mix if they are in fact the same species.
20. An endoribonuclease is an enzyme that digests (cuts) RNA. For what test would this be used?
a. This enzyme can be used in ribotyping.
21. In ribotyping, if you see the same pattern of bands on gel for your organism and the positive control organism,
then what would be your conclusion?
a. My conclusion would be that the two organism are from the same species.
22. How does multilocus sequence typing differ from 16S/18S rRNA sequence comparision? What is it useful for
distinguishing between?
a. This test compares between the so called housekeeping genes. These genes are those that every living
thing must have to survive, like DNA polymerase, DNA gyrase This test is useful for determining
between different strains of the same species (Staph mutans/ staph pyrogen)
23. What is a biochemical analysis that will allow you to distinguish between two organisms?
a. The Fatty Acid Methyl Ester (FAME) can be used to identify an organism from those in the database.
24. Can determining the fatty acid composition of an organism be useful in identifying the organism?
a. Yes
25. List the taxonomic hierarchy.
a. Domain, phylum, class, order, family, genius, species
26. What 2 things must a scientist do in order for a newly identified microorganism to be formally recognized by the
scientific community?
a. The organism must have its name and description published into IJSEM
b. Must have a sample of the organism in two international culture collections (so others can use the
organism to study)
HOST MICROBE INTERACTIONS
1. Prior to birth, in the womb, were you sterile?
a. Yes
2. Where do the microorganisms come from that first colonize a newborn human?
a. The microbes come from the air, the food/milk/water, and from physical contact with people.
3. What decides which microorganisms become resident flora for the newborn human?
a. Competition between microorganisms decides which become resident flora.

4. Where does the Escherichia coli come from that colonizes the gastrointestinal tract? Why would a newborn baby
in a developing country likely be colonized by E. coli much sooner than a newborn baby in the United States or
other developed nation?
a. The E. Coli comes from those who are physically touching the child, they will pass it on by not washing
their hands well enough after using the bathroom.
b. Other countries arent as health conscious or as sanitary as the united states, so these E. Coli cells are
passed to the child early on.
5. Do human pathogens colonize a newborn? What prevents them from causing disease? What would allow them
to cause disease?
a. Yes, human pathogens can colonize a newborn.
b. Most newborns are vaccinated for the most common disease causing pathogens for newborns. If a child
were not vaccinated it would have a chance of suffering from a disease.
6. Distinguish between infection and disease.
a. Infection any situation in which a microorganism is established and growing in a host
b. Disease- is damage or injury to the host that impairs host function.
7. Where does infection begin? Where on the human body can you find places like this?
a. Infection begins on the mucosal surfaces (mouth, nose, ears.)
8. What prevents all places and surfaces of the human body from being colonized by microorganisms?
a. Some microorganisms cant survive with the variables of the area. (pH, salt levels, heat)
9. Name four places in the human body that are sterile (microbe-free).
a. The human organs should all be sterile from microbes Heart, brain
10. Where on the skin do microbes colonize? In what ways are these places similar to mucosal surfaces? Why is the
surface of the epidermis microbe free except for the occasional transient?
a. Microbes live on the superficial layers of the epidermis and are also located near hair follicles.
b. The surface is mostly microbe free because the top layer is to dry and acidic for them to survive, and are
easily washed off.
11. What glands are responsible to harboring microbes that cause body odor?
a. The sebaceous glands (around the face and forehead) The eccrine glands (sweat), and the aporine
glands
12. List the 4 most commonly found microbial genera resident of the skin. Are these Gram-positive or Gramnegative? Which is the cause of acne?
a. The most common are Staphylococcus, Micrococci, Streptococcus all gram positive
b. Staph causes acne
13. Are the majority of skin microflora resident or transient?
a. Majority of skin mircoflora are resident.
14. What Gram-negative bacterium commonly colonizes the skin?
a. Most common gram-negative bacteria include Enterobacter, E.Coli, and Acinetobacter.
15. List environmental and human host factors that influence skin microflora composition.
a. Factors that influence composition include the temperature and moisture levels of skin, or the
environment around the skin, the age of the host, personal hygiene.
16. Upon entering your mouth perhaps on a piece of food, a bacterium would be exposed to what in your saliva that
could destroy the bacterium? How could a microbe survive exposure to the enzymes in your saliva to make it to
your stomach?
a. The human mouth contains an enzyme that breaks down the bacteria wall causing death to the cell.
17. How does the microflora of the mouth differ before and after tooth formation?
a. The microbes that form after tooth formation thrive on the calcium of teeth. They attempt to decalcify the
teeth so they can use it to grow.
18. What are the main microbes to colonize the mouth prior to tooth formation? After tooth formation? Why is there a
change in the microflora before and after tooth formation?
a. Before teeth formation there are aerotolerant anaerobes: like Streptococcus and Lactobacillus
b. After Teeth formation anaerobes grow: like Actinomyces, Bacteroides, Spirochetes, Streptococcus
19. What are biofilms on the surface of teeth called?
a. Tooth biofilms are called plaque
20. Describe how Streptococci form dental plaque and provide for other microbes to join the biofilm.
a. Streptococcus mutans use the saliva glycoprotein layer on teeth for attachment
21. Explain how anaerobic microbes predominant the mouth despite their being a constant influx of oxygen from
breathing.
a. Anaerobes dont require oxygen to survive. They use fermentation to produce energy, if there is leftover
food in the mouth bacteria can use it as a carbon source to break down and ferment.
22. How does dental plaque result in dental caries?
a. Dental plague is a buildup of bacteria, these bacteria produce organic acids, which decalcify tooth
enamel.

23. Upon ingestion of sucrose, describe how Streptococci form dental caries.
a. Streptococci produce dextran polysaccharides that allows for attachment of more strep and any other
microbes that live in the mouth.
24. How can dental caries be prevented? What can be used to clean the surface of teeth? What can be used to
clean between teeth and in the gingival crevices?
a. They can be prevented by good hygiene practices. Like the use of fluoride, brushing teeth, and flossing
to clean gingival crevices.
25. How does fluoride help prevent dental caries?
a. Fluoride helps by remineralizing teeth, from the normal break down.
26. What 2 species of Streptococci primarily colonize teeth?
a. Streptococcus mutans and Streptococcus sanguis
27. If there were no more toothbrushes or dental floss or fluorine left on Earth, what could Americans do to prevent
dental caries?
a. Americans could cut down sugar intake, chew sugarless gum, have sealants, use mouthwash.
28. Find 2 things you eat or drink regularly that contain sucrose. (Read the label of your food/drink to determine if is
has sucrose or look up the food/drink online.)
a. Junk foods, soda
29. Would dental caries be considered infectious disease? Why?
a. Infectious diseases are caused by pathogenic disease causeing bacteria. So according to this definition
yes, tooth issues can be infectious diseases.
30. How does the microflora that colonizes your gastrointestinal tract get there in the first place?
a. They are picked up from other individuals
31. What organ is a chemical barrier to microbial growth?
a. Gastric Acid
32. What makes the stomach unfriendly to microbes?
a. The stomach is highly acidic
33. What is the most common microbe found in the stomach?
a. The most common microbe is Helicobacterpylori .
34. Besides pH what factor influences the stomach microflora composition? Do beef-eaters and vegetarians have the
same microflora?
a. No there is a difference between the two and their microflora.
35. What is the primary difference between the stomach and the end of the small intestine that allows for larger
numbers of microbes to be present in the small intestine?
a. The primary difference between the stomach and small intestine is the increase in the pH in the small
intestine making it easier for microbes to live.
36. What is the oxygen requirement for most microbes living in the small and large intestines?
a. Most microbes in the small and large intestines are obligate anaerobes. Dont need oxygen, the number
of microbes increases into the large intestine.
37. Are the small and large intestines oxic or anoxic environments?
a. Anoxic or lacking in oxygen
38. What is another name for the colon that tells you what the microbes are metabolically doing there?
a. The organisms are anaerobic
39. How much bacteria per gram of fecal content is in the colon?
a. 1/3 of the fecal material is bacteria.
40. The symbiotic relationship humans have with some of their intestinal flora is mutualistic. How do each benefit?
a. The intestinal flora break down some of the food particles that the human body cannot so it can absorb
them, the human eats and supplies the bacteria with a food and energy supply.
41. Name 4 gases produced by microorganisms in the human intestine? Do any of these have an odor?
a. Methane, carbon dioxide, and hydrogen Yes
42. Back in human time before fire, did humans contribute to global warming?
a. No
43. What percentage of feces is bacteria? Are the bacteria dead or alive or some of both?
a. Feces are 1/3 bacteria.. Both
44. Is the large intestine like a batch culture or a chemostat?
a. Chemostat, because things are always going in and out, and it is never the same thing over and over.
45. What is the growth rate of bacteria in the intestine lumen?
a. The growth rate is about 1-2 divisions a day.
46. 10,000,000,000,000 What does this number represent?
a. 10^13 number of microbes in or on human body.
47. Describe what antibiotics do to your intestinal microflora
a. Antibiotics inhibit the growth of the normal mircoflora, it causes the loss od antibiotic-susceptible tract.

48. Due to proximity to the exit of the gastrointestinal tract, many microbes that inhabit the gastrointestinal tract find
their way to what other area of the body?
a. They enter the Urogenital tract.
49. What part of the urogenital tract is sterile? What part is colonized?
a. The bladder is sterile, the urinary tract is partially colonized by bacteria.
50. What lactic acid bacteria used to make yogurt is resident flora of the human female vagina? How does this
microorganism affect the pH of the vagina? During the lifetime of a human female when would Lactobacillus
acidophilus expect to be resident of the vagina?
a. Lactobacillus acidophilus, this organism decreases the pH. It would be expected to live there from
puberty to menopause
51. How do birth control pills effect the pH of the vagina? What are the microbial consequences?
a. The birth control pill allows for the increase in growth of cells, thus making the area an inhospitable place
for a baby to grow.
52. What part of the respiratory tract is sterile?
a. The trachea, bronchi, and lungs
53. What 2 opportunistic pathogens often colonize the upper respiratory tract? Why do they not cause disease most
of the time?
a. Flu, and streptococcus bacteria, most of the time the body naturally fights them off.
54. What type of cells line the respiratory tract? How do these cells help prevent microbes from reaching the lower
respiratory tract?
a. Mucus cells and other resident flora take up residence so that the pathogens cannot get to the lower
respiratory system.
55. Smoking damages the ciliated epithelium of the respiratory tract. What occurs due to this loss of function?
Smokers cough in an attempt to do what? Are smokers more susceptible to microbial infections of the lower
respiratory tract?
a. This loss of function opens up the possibility for pathogenic microbes to enter the respiratory system.
They cough in an attempt to expel the microbes from settling in and colonizing. Smokers are more likely
to get lower respiratory infections.
56. Following exposure to a pathogen, list the events of pathogenesis.
a. Adherence
b. Invasion
c. Colonize
d. Damage
57. List 4 adherence factors and an example of each.
a. Adhesin- A surface structure or macromolecule that binds a bacterium to a specific surface
b. Mucous- the mucopolysaccharide layer of glucosaminoglycans covering animal cell mucosal surfaces
c. Biofilm- exopolysaccharide or slime produced by bacteria that attaches imbedded cells to a surface
d. Receptor-A complementary macromolecular binding site on a (eucaryotic) surface that binds specific
adhesins or ligands
58. Describe invasion.
a. Invasion is the process of a pathogen infecting the body.
59. Colonization is also known as microbial _growth_. Is microbial colonization dependent on location in the body?
a. Yes
60. What type of virulence factors are siderophores?
a. Toxin
61. Distinguish between localized and systemic bacterial infection. Which would be easier to treat with antibiotics?
a. Localized bacterial infection is a simple infected cut or scrap on a small part of the body, very easy to
heal. A systemic infection is an infection throughout the entire body, usually causing death.
62. Is bacteremia a localized or systemic infection?
a. Bacteremia is the bacterial infection of the blood, which is systemic.
63. Adherence, invasion, colonization are the steps describing infection. To cause disease what must happen?
a. To cause disease the bacteria must cause damage through toxicity or invasiveness
64. Define toxicity and give an example of a toxin causing disease.
a. Toxicity is the degree to which a substance is able to cause damage. The Clostridium tetani produces an
exotoxin that causes tetanus.
65. Define invasiveness and give an example of an invasive factor helping a microorganisms cause disease.
a. Invasiveness helps the pathogen to invade the host tissue, an example is that Clostridium hyaaluronidase
breaks down hyaluronic acid that holds the cell together.
66. What is the lethal dose50?
a. Lethal dose50, is the median lethal dose, its the dose that needed to kill half of the population.
67. How many cells of a virulent human pathogen like Streptococcus pneumoniae are needed to kill?
a. 100 cells kills a mouse

68. Describe the phenomenon of attenuation. How does a virulent strain become attenuated? Is an attenuated strain
still deadly?
a. Attenuation is the process of taking a pathogen and reducing it to a less harmful or harmless form and
used in a vaccine. The organism is cause to infect a foreign host. This will create a small change in the
organism but making it less harmful to humans. This attenuated strain can cause some symptoms but is
no longer dealy.
69. Viruses and bacteria can be attenuated. Attenuated viruses are given as vaccines of common childhood viruses
that are deadly or that cause major harm to the human body.
70. What makes Salmonella such a virulent pathogen?
a. Salmonella uses a variety of virulence factors to cause disease.
71. Distinguish between exotoxins, enterotoxins and endotoxins.
a. Exotoxins- toxins that are secreted by living cells
b. Enterotoxins- are exotoxins that affect the small intestine, causing changes in intestinal permeability that
lead to diarrhea
c. Endotoxins- toxic bacterial structural component released upon bacterial death
72. Describe what a cytolytic exotoxin does to be toxic and give an example of cytolytic toxin.
a. Cytolytic extotoxins cause the lysis of host cells, ex) Streptolysin O produced by Streptococcus
73. Describe how an AB exotoxin is toxic and give 3 examples of an AB exotoxin.
a. An A-B toxin is composed of two proteins covalently bounded
i. The B subunit binds to the host cell and transfers the A subunit into the host cell to cause damage
ii. Ex.) Diptheria toxin produced by Corynebacterium diptheriae disrupts protein synthesis Tetanus
toxin produced by Clostridium tetani prevents muscle relaxation Botulinum toxin produced by
Clostridium botulinum inhibits muscel contraction
74. Describe how an enterotoxin is toxic and give 2 examples of enterotoxins. What is the main symptom associated
with disease caused by an enterotoxin?
a. This toxin causes intestinal permeability problems, causing diarrhea.
i. Vibrio cholera causes cholera toxin
75. Describe how an endotoxin is toxic and give an example of an endotoxin. What group of bacteria produce
endotoxins?
a. Endotoxins are released upon death of gram-negative bacteria, causes fever.
i. Ex.) Lipopolysacchardies derived from the outer membrane of gram-negative bacteria
76. List 4 risk factors that increase a persons susceptibility to infection.
a. Age, Stress, Diet, Lifestyle, and General health (sleep)
77. List 8 barriers that provide natural resistance to infection by pathogens. (see fig. 28.25)
a. Lysozymes- in tears dissolve cell walls
b. Normal flora-creates competition
c. Skin-physical barrier
d. Stomach- low acidicty/pH
e. Flushing out of urinary tract decreases growth
f. Mucus prevents attachment and growth
78. Provide an explanation for Clostridium tetani causing tetanus if introduced into a deep puncture wound but not
causing any harm if ingested.
a. If the organism gets into a cut it thrives, however if it were ingested it would have to go through the acidic
saliva, and stomach, and compete for room in the intestines which it isnt likely it will get. But in the blood
it can thrive and infect.
79. Provide an explanation for Salmonella causing gastroenteritis if ingested but not causing any harm if introduced in
a puncture wound.
a. Salmonella is an anaerobe meaning it prefers no oxygen around, so it can thrive and grow in the intestinal
tract, it cannot however infect anything if it were in a puncture wound because blood holds lots of oxygen.
80. Provide an explanation for why a mosquito can transmit malaria but a cockroach cannot.
a. Malaria grows in blood, mosquito thrive on blood, having the ability to bite and pass it on the others.
Cockroaches dont bite humans.
81. Provide an explanation for why HIV is harmless on your skin but potentially lethal in your blood.
a. HIV cannot survive outside of the body, it needs a host cell to live.
Immunology
1. Name the leukocytes.
Myeloid precursors, lymphoid precursors, monocytes, dentric cells, macrophages, granuolocytes, neutrophils,
mast cells, T-cells, B-cells, plasma cells
2. Name the phagocytes.

Dentric cells, monocytes, macrophages, neutrophils, mast cells

3. Name the lymphocytes.
B-cells, T-cells, plasma cells
4. Where do all leukocytes come from?
Bone marrow
5. What body fluid systems transport immune cells throughout the body?
Blood stream and lymphatic system
6. What is the first line of internal defense against pathogens?
Innate immunity (non specific immunity) (natural killer lymphocytes, phagocytes)
7. What do Natural Killer cells do? How do they kill?
Find virus, bacterium, and tumor cells, Preforin and grandzymes
8. What do phagocytes do in innate immunity?
Recognize pathogens, phagocytosis, and lysozme fuse with phagosome
9. What do phagocytes have on their cell surface to recognize pathogens?
Phagocyte pattern recognition molecules (PRMs)
10. What part of a pathogen is recognized by a phagocyte?
Pathogen pathogen associated molecular patterm (PAMP, ex. Lps, peptidoglycan, flagellin, etc)
11. What immune response precedes the adaptive immune response?
12. What signaling proteins from the innate immune response activate B and T cells?
13. Describe the events that take place following a macrophage encountering a foreign protein.
14. What part of Gram-negative bacteria stimulates an immune response?
15. Tumor necrosis factor-alpha (TNF-alpha) and interleukin-1 (IL-1) are what type of signaling proteins?
16. What can happen if too much TNF-alpha and IL-1 are made?
17. To what Drosophila melanogaster protein is part of IL-1 similar?
18. What do Toll proteins do in Drosophila?
19. Are there any Toll-like proteins in human in which the full-length human protein is similar to Toll?
20. What does the acronym TLR stand for?
21. How many human TLRs are there?
22. Where are TLRs located?
23. What does TLR2 recognize?
24. What does TLR3 recognize?
25. What does TLR4 recognize?
26. What does TLR5 recognize?
27. In general, what do TLRs recognize?
28. Name 6 other organisms besides humans that have an innate immune response.
29. What immune cells have Toll-like receptors?
30. What would a mutation in TLR4 that abolishes TLR4 activity prevent an immune cell from doing?
31. A drug that is a TLR4 activator would be capable of doing what to the inflammatory response?
32. What potential is there in inhibiting TLRs for treating certain autoimmune diseases?
33. What positive effect would a TLR inhibitor have on someone with an autoimmune inflammatory disease like
rheumatoid arthritis?
34. What negative effect would a TLR inhibitor have on someone with an autoimmune inflammatory disease like
rheumatoid arthritis?
35. How could activating TLRs aid in making a more effective vaccine?
36. What is an adjuvant?
37. What would be a negative consequence of activating TLRs?
38. Is phagocytosis sufficient to kill a pathogen? What does the phagocyte do to kill the pathogen?
No, Secretes enzymes to digest pathogen in phagolysosome (aka phagosome after lysosome is attached)
39. What is a lysosome? What proteins are found inside a lysosome? What are these proteins use for? What other
molecules are in the lysosome that are used to damage pathogens?
Vesicle filled with toxic oxygen products to digest bacteria
Digestive enzymes (H2O2, lysozyme, proteases, phosphatases, nuclease, and lipases)
Digest bacteria
Toxic oxygen products
40. Why are the contents of a lysosome contained within the lysosome instead of free in the cytoplasm of the
phagocyte?
To protect from DNA transduction or conjugation
41. What reaction follows phagocytosis?
inflammation
42. Is inflammation harmful or helpful to the immune response?
Help (inflammation caused by cytokines and especially chemokine to attract macrophages), can be harmful when
inflammation widespread

43. What cells make chemokines?

neutrophils
44. Chemokines are chemoattractants. What do they attract?
macrophages
45. What cells make cytokines? What is an example of a cytokine?
Macrophages, interleukin
46. What do cytokines do?
Contribute to all symptoms of inflammation
47. In what ways can a pathogen protect itself from phagocytosis?
Pigments to neutralize singlet oxygen (carotenoids, protect from enzymes in lysosome)
Molecules scavenge toxic oxygen (special cell wall glycolipids, protect from being destogyed in macrophages)
Leukocidins (kill phagocyte)
Capsule (prevents adherence of phagocyte to bacterial cell)
48. List the 3 properties of adaptive immunity and give an example of each.
Specificity, memory, and tolerance
49. Explain the T-cell selection process.
Positive- select for cells that react with self
Negative- kill cells that react too strongly with self
50. What T-cell characteristics are selected for in the thymus?
React with self but not too strongly
51. Who coined the term autoimmunity?
52. What cells are proactive in helping the body get rid of immune cells that inappropriately interact with the bodys
own tissues?
53. What were T-regs originally named before they were even identified as CD25+ regulatory T cells? How was this
original name descriptive of what the T-regs do?
54. What cytokine promotes T-reg function?
55. What transcription factor is found in abundance in T-regs?
56. Mutant mice with an inactive Foxp3 protein also lack what type of immune cell?
57. If humans have a mutant Foxp3, what is the outcome? Does it matter if you are male or female? Why?
58. Absence of T-regs causes what disease in mice?
59. In your intestines, what organisms do T-regs allow your body to tolerate?
60. Chronic infection by Helicobacter pylori in the stomach could be from what action of T-regs?
61. How might T-regs play a role in pregnant women in helping to protect the development fetus?
62. What level of T-reg activity could be a cause of spontaneous abortion?
63. Describe how T-regs could be used to help organ transplantation? (see fig.)
64. Removal of some T-regs holds promise as a therapy for what kind of diseases?
65. List 2 challenges to the developing medicines targeted at T-regs. How are these challenges being overcome?
66. Is it possible to turn ordinary T-cells into T-regs? How?
67. What type of leukocytes are involved in cell-mediated immunity?
Macrophages and dendric cells
68. What type of T-Cells are involved in cell-mediated immunity?
Cytotoxic and helper 1
69. What type of leukocytes are involved in antibody-mediated immunity?
B cells
70. What type of T-Cells are involved in antibody-mediated immunity?
Helper 2
71. When would T-cytotoxic cells be used?
When mchI on regular cell presents antigen
72. What type of MHC protein is recognized by a T-cytotoxic cell?
MHC I
73. When would T-helper 1 cells be used?
When macrophage or dendritic cells present antigen on MHC II
74. What type of MHC protein is recognized by a T-helper 1 cell?
MCHI
75. When would T-helper 2 cells be used?
When b-cell is presenting antigen
76. What type of MHC protein is recognized by a T-helper 2 cell?
MCH2
77. Describe the events that take place when a T-cytotoxic cell is activated.
Apoptosis of target cell
Effector cell- apoptosis, memory- stays around to recognize future infections
78. Describe the events that take place when a T-helper 1 cell is activated.

Signals for help from other macrophages

Effector- carry out normal t cell functions
Memory- stay around for future infections
79. Describe the events that take place when a T-helper 2 cell is activated.
Signals homologous b cells to turn into plasma cells and begin making antibodies; also create memory cells
80. What do MHC proteins, T-cell receptors and antibodies all have in common?
All recognize eachother; similar structure; one constant region and one variable region
81. What are the 5 classes of antibodies? How is each defined?
Made of four polypeptides; two heavy chains and two light chains; variable regions and constant domains;
antigens bind to variable region; named after type of heavy chain
IgG- major antibody, crosses placenta
IgA- predominant antibody in secretions (saliva, breast milk, intestinal fluid); first response to viral infactions
IgM first class ofantibody in response to infection
IgD- low concentration, functionally similar to IgM
IgE- low concentration, but responsible for allergic reactions
82. What are kappa and lambda?
Heavy chain types; constant region is either kappa or lambda
83. How are the light chains and heavy chains of an antibody connected?
Disulfide linkages
84. How many types of antibodies are made by a single B cell?
85. Overall, how many types of antibodies are possible to make?
86. Describe the antibody-mediated immune response that occurs the first time you are exposed to an antigen.
B-cell receptor finds antigen, internalized, antigen displayed on MCH2; TH2 binds to MCH2 and releases
cytokines that signal other b-cells with same receptors to make and release antibodies
87. What types of cells are made in response to initial antigen exposure? What do these cells do?
Both memory and plasma cells, Memory is waiting for next exposure to antigen
Plasma- makes free antibodies
88. How do plasma cells differ from memory cells?
Plasma cells make free antibodies; memory cells have antibodies anchored to the actual cell
89. Describe the antibody-mediated immune response that occurs the second time you are exposed to an antigen.
How does this differ from the initial antigen exposure immune response?
Faster, doesnt require t-cells, primary response not necessary
90. Describe the antibody-mediated immune response that occurs the third, fourth, fifth, etc. time you are exposed to
an antigen.
Immunity begins to decrease over time after secondary response; only have certain window that secondary
immune response will work; after time memory cells die
91. Describe what the antibodies released from plasma cells do.
Free antibodies; bind to antigen and signal classical complementary protein response; or increase phagocytosis
92. What are complement proteins used for?
Destroy pathogens
93. What immune responses use complement proteins?
Innate and adaptive (all basically)
94. Describe classical complement activation.
Requires antibodies; antibodies signal for complement proteins to come and attach
1. Antibody binds antigen and complement protein
2. Sequential binding of other complement proteins
3. Bacterial cell membrane damage and cell lysis
95. Describe alternate complement activation.
Does not require antibodies
1. Host serum proteins (regularly found in blood) bind to bacterial cell surface
2. C3 binding enhances phagocytosis
96. How do the classical and alternative complement activation pathways differ? How are they the same?
Dont both use antibodies, Both use complement proteins
97. Define hypersensitivity with regard to the immune system.
Inappropriate immune response resulting in host damage
98. Describe the four types of hypersensitivities.
I,II,III,IV
99. Why is Type I called immediate hypersensitivity?
Occurs within minutes of secondary antigen exposure
100.
What common name is used to describe a Type I hypersensitivity?
Anaphylactic shock
101.
What name is given to the antigen that elicits a Type I hypersensitivity?

Allergen (allergens are not pathogens)

102.
What occurs during initial allergen exposure? (see fig. 30.5)
regular response
103.
What occurs during second and subsequent allergen exposure? (see last part of fig. 30.5)
mast cell recognizes allergen and releases molecules that cause allergy symptoms
104.
Name some things that can be done to treat the symptoms of an allergic response.
Removal of allergen
Antihistamines to neutralize histamins
Steroids to reduce inflammation
Adrenalin to counter effects of histamines/seretonin
Desensitization- immunization with increasing does of allergen to shit antibody froduction from IgE to IgE
105.
Why is Type IV also known as delayed hypersensitivity?
Response occurs one to two days after secondary antigen exposure; poison ivy; driven by TH cells
106.
How does Type IV differ from Type I hypersensitivity?
Takes more time to happen
107.
Are antibodies involved in a Type IV hypersensitive response?
108.
What is main symptom associated with a Type IV hypersensitive response?
109.
Can a pathogen elicit a hypersensitive response?
110.
Name at least 3 things that can elicit a Type IV hypersensitive response.
111.What do Type II and III hypersensitivities have in common?
112.
Describe what occurs during a Type II hypersensitive response.
113.
Describe what occurs during a Type III hypersensitive response.
114.
What class of hypersensitivities do drug reactions (for example to penicillin) fall under?
115.
What are superantigens?
Secreted by microbes; elicit overreactive immune response
116.
How do superantigens elicit an abnormal immune response?
Bind to common parts of APC molecules and cause more TH cells than normal; causing too much cytokine;
causing systemic inflammation
117.
What is the main symptom associated with superantigen exposure?
118.
Compare and contrast active and passive immunities.
Active- your own body elicits response to pathogen
Passive- use antibodies from alternate source other than you own body
119.
Compare and contrast natural and artificial active immunities.
Natural active immunity- your natural response to antigen, nothing added
Artificial active immunity- vaccine
120.
Compare and contrast natural and artificial passive immunities.
Natural passive immunity- antibodies passed from mother to child
Artificial passive immunity- antibodies introduced via shot
121.
What type of immunity do vaccinations provide? (active, passive, natural, artificial)
Active artificial,
122.
What did the English physician Edward Jenner do?
123.
Describe the concept of herd immunity.
124.
What percentage of the population needs to be vaccinated to have herd immunity to measles?
125.
Describe 7 kinds of vaccines.
126.
Which vaccines contain no live pathogens?
127.
Which vaccines contain live pathogens?
Microbial Diseases
1. Perhaps make a table to answer these questions:
a. To what diseases are we vaccinated against in early childhood?
b. What causes each of these diseases?
c. How are these pathogens transmitted?
d. How does the pathogen cause disease? (virulence factors)
e. What immune response (innate, cell-mediated, antibody-mediated, innate and cell-mediated, innate and
antibody-mediated, all three) is there to these pathogens?
2. Many airborne-transmitted pathogens cause what type of infections?