G3BP2, a stress granule assembly factor, is dispensable for spermatogenesis in mice
- Published
- Accepted
- Received
- Academic Editor
- Gwyn Gould
- Subject Areas
- Cell Biology, Genetics, Microbiology
- Keywords
- G3bp2, Reproductive health, Male fertility, Spermatogenesis, CRISPR-Cas9, Apoptosis, Sperm, Testis, Conditional knockout, Germ cell
- Copyright
- © 2022 Yun et al.
- Licence
- This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, reproduction and adaptation in any medium and for any purpose provided that it is properly attributed. For attribution, the original author(s), title, publication source (PeerJ) and either DOI or URL of the article must be cited.
- Cite this article
- 2022. G3BP2, a stress granule assembly factor, is dispensable for spermatogenesis in mice. PeerJ 10:e13532 https://doi.org/10.7717/peerj.13532
Abstract
Background
Spermatogenesis is a complex process that includes mitosis, meiosis, and spermiogenesis. During spermatogenesis, genetic factors play a vital role inthe formation of properly functioning sperm. GTPase-activating protein (SH3 domain)-binding protein 2 (G3BP2) is known to take part in immune responses, mRNA transport, and stress-granule assembly. However, its role in male fertility is unclear. Here, we generated a G3bp2 conditional knockout (cKO) mouse model to explore the function of G3BP2 in male fertility.
Methods
Polymerase chain reaction (PCR) and western blotting (WB) were used to confirm testis-specific G3bp2 knockout. Hematoxylin-eosin (HE) staining to observe testicular morphology and epididymal structure. Computer-aided sperm analysis (CASA) to detect sperm concentration and motility. Terminal deoxynucleotidyl transferase-dUTP nick-end labeling (TUNEL) assay was used to detect apoptotic cells.
Results
We found that cKO male mice are fertile with the normal morphology of the testis and sperm. Additionally, CASA of the semen from cKO mice showed that they all had a similar sperm concentration and motility. In addition, sperm from these mice exhibited a similar morphology. But the tunnel assay revealed increased apoptosis in their testes relative to the level in the wild type (WT).
Conclusion
Together, our data demonstrate that G3BP2 is dispensable for spermatogenesis and male fertility in mice albeit with the increased germ-cell apoptosis.
Introduction
Spermatogenesis is a precise and complex process that involves the self-renewal of spermatogonial stem cells and their differentiation into primary spermatocytes, which undergo two meiotic divisions to become haploid spermatids and then undergo a multi-phase maturation process, termed spermiogenesis, to form spermatozoa (de Kretser, Loveland & O.’Bryan, 2016; Fayomi & Orwig, 2018; Ibtisham & Honaramooz, 2020). The entire process is regulated by thousands of genes. Studies have shown that approximately 2,000 genes are expressed in the testis of the mouse (Roy Choudhury et al., 2010; Schultz, Hamra & Garbers, 2003). Among these genes, many, such as Uhrf1, Ddx5, Zglp1, Pramef12, and 1700102P08Rik (Dong et al., 2019; Legrand et al., 2019; Nagaoka et al., 2020; Wang et al., 2019; Wu et al., 2020) are essential for spermatogenesis in the mouse, unlike others, such as Golga4, Rai14, and Dnajb8 (Guo et al., 2020; Wang et al., 2020; Wu et al., 2021) are not essential. However, the functions of these spermatogenic genes, which are highly expressed in the testis, remain unclear. G3bp2 is one of the two GTPase-activating protein (SH3 domain)-binding proteins in the mouse. It is evolutionarily conserved in eutherians, involved in various biological processes, and highly expressed in the testis. Its core domain mainly consists of a nuclear transport factor two-like domain, SH3 domain-binding motifs, an arginine/glycine-rich box, and RNA-binding motifs (Gallouzi et al., 1998; Matsuki et al., 2013; Tourriere et al., 2001). As a core component, G3BP2 regulates the formation of stress granules through phase separation (Guillén-Boixet et al., 2020; Sanders et al., 2020; Yang et al., 2020). G3BP2 regulates breast-tumor initiation through the stabilization of Squamous cell carcinoma antigen recognized by T cells three (SART3) mRNA (Gupta et al., 2017). Additionally, it has been shown to interact with microRNA-23b to regulate fibrosis and proteinuria in diabetic nephropathy (Zhao et al., 2016). It is also involved in isoproterenol-induced cardiac hypertrophy through activating the NF-κB signaling pathway and plays an antiviral role by suppressing the viral replication upon viral infection of the cell (Eiermann et al., 2020; Hong et al., 2018; McCormick & Khaperskyy, 2017). However, a spermatogenic role has not been reported for this gene despite the high testicular expression. This study aimed to assess the function of G3BP2 in spermatogenesis. The Mouse Genome Informatics database states that knocking out this gene from the whole body leads to preweaning lethality in the mouse, and thus a conditional knock-out model has been generated (Bult et al., 2019). We observed that G3BP2 is mainly expressed in the cytoplasm of spermatogonia, spermatocytes, and round spermatids in the mouse. Secondly, G3bp2loxp/loxp mating with stimulated by retinoic acid gene 8-Cre transgenic mice (Stra8-iCre), DEAD-box helicase 4-Cre transgenic mice (Ddx4-Cre) tool mice, and specifically knocked out this gene in germ cells at different stages (Fang et al., 2021; Sadate-Ngatchou et al., 2008). We observed that WT, Stra8-iCre; G3bp2loxp/Δ (SKO), and Ddx4-Cre; G3bp2loxp/Δ (DKO) mice were fertile, with normal testicular morphology, weight, and sperm concentration. Furthermore, no significant difference in testicular histology was observed among WT, SKO, and DKO mice. The stress granules also could form in heat-treated testis. However, the TUNEL assay revealed that both SKO and DKO mice displayed increased apoptosis compared with the level in WT mice. Collectively, our results indicate that G3BP2 is not essential for spermatogenesis and fertility in the mouse even though germ-cell–specific lack of this protein promotes germ-cell apoptosis.
Materials and Methods
Animals
The C57BL/6J background mice were purchased from the animal center of Nantong University. The animals are raised in the Laboratory Animal Center of Nantong University, where they are provided with free food and water under specific pathogen-free conditions with a 12 h/12 h light/dark cycle. All mice were treated humanely and killed by carbon dioxide asphyxiation to collect testicular and epididymis samples for further analysis. The Animal Ethical and Welfare Committee (AEWC) of Nantong University approved this research (Approval No. S20200630-502).
Genotyping
Total DNA was extracted from the mouse tail by using the EasyPure Genomic DNA Kit (Transgen Biotech, Beijing, China), and the genotype was screened using PCR (EasyTaq DNA Polymerase, Transgen Biotech, Beijing, China). The primers are listed in Table 1.
Gene name | Sequence (5′-3′) | Application |
---|---|---|
G3bp2-F | GTAAGCTGTAAGCCTGTGGAGT | Genotyping |
G3bp2-R | GTAATAATAATCATGTCGAAAGAAAG | Genotyping |
Stra8-iCre-F | AGATGCCAGGACATCAGGAACCTG | Genotyping |
Stra8-iCre-R | ATCAGCCACACCAGACACAGAGATC | Genotyping |
Ddx4-Cre-F | CACGTGCAGCCGTTTAAGCCGCGT | Genotyping |
Ddx4-Cre-R | TTCCCATTCTAAACAACACCCTGAA | Genotyping |
G3bp1-qF | AAGAACCTTCCTCCCAGTGG | RT-qPCR |
G3bp1-qR | TCCACATCTCCTGGTTCACC | RT-qPCR |
G3bp2-qF | CCCGAGTATTTGCACAGGTT | RT-qPCR |
G3bp2-qR | TCACTCAAGGTTGCATGAGC | RT-qPCR |
β actin-qF | AGCCATGTACGTAGCCATCC | RT-qPCR |
β actin-qR | CTCTCAGCTGTGGTGGTGAA | RT-qPCR |
Generation of the G3bp2 cKO mouse
Floxed G3bp2 mice (G3bp2loxp/loxp) were generated from embryonic stem cells (ESCs) at Shanghai Research Center for Model Organisms. In brief, ESCs were injected with a mixture of donor (50 ng/µl), sgRNA1 (50 µg/ul), sgRNA2 (50 µg/ul), and Cas9 (100 µg/ul). The donor carried the sequence of G3bp2 Exon3 flanked by loxP sites. The gene editor mice and are C57BL/6J background. G3bp2loxp/loxp mice were confirmed via PCR. Mice with Stra8-Cre or Ddx4-Cre in the C57BL/6J background were purchased from the Jackson Laboratory. Stra8-Cre males were first crossed with G3bp2loxp/loxp females to generate the Stra8-iCre; G3bp2loxp/+ male mice, then the Stra8-iCre; G3bp2loxp/+ male mice were crossed with G3bp2loxp/loxp female mice to obtain the Stra8-iCre; G3bp2loxp/Δ male mice (SKO). Ddx4-Cre; G3bp2loxp/Δ male mice (DKO) were obtained likewise.
Western blotting
Testicular extracts were prepared using RIPA lysis buffer (P0013C; Beyotime Biotechnology, Beijing, China) with the protease inhibitor PMSF (ST506; Beyotime Biotechnology, Beijing, China), and their protein content was resolved via 10% SDS-PAGE. Afterward, the protein bands were transferred from the gel onto a nitrocellulose membrane, which was then blocked with 5% nonfat milk in TBST for 1 h followed by overnight incubation with primary antibodies (Table 2) at 4 °C. Afterward, the membrane was washed three times with TBST and then incubated with secondary antibodies. The target protein bands were detected using an Amersham Typhoon 5 Biomolecular Imager (GE Healthcare Lifescience, Little Chalfont, UK).
Antibody name | Host species | Vendor | Catalog no | Working dilution |
---|---|---|---|---|
G3bp2 | Rabbit | Proteintech | 16276-1-AP | IF 1:200 IB 1:2,000 |
G3bp2 | Rabbit | Abcam | Ab86135 | IF 1:200 IB 1:2,000 |
TIA1 | Rabbit | Proteintech | 12133-2-AP | IF 1:200 |
PLZF | Mouse | R&D systems | MAB2944 | IF 1:400 |
Beta Actin | Mouse | Proteintech | 20536-1-AP | IB 1:3,000 |
GAPDH | Rabbit | Proteintech | 10494-1-AP | IB 1:3,000 |
Mouse IgG (H+L)- Alexa Fluor 555 |
Goat | Thermo Fisher Scientific | A-21424 | IF 1:300 |
Mouse IgG H&L- (IRDye® 680RD) | Goat | Abcam | ab216776 | IB 1:3,000 |
Rabbit IgG H&L- (IRDye® 800CW) | Goat | Abcam | Ab216773 | IB 1:3,000 |
RNA isolation and RT-qPCR
All the organs (brain, heart, kidney, liver, lung, spleen, ovary, and testis) were collected from adult C57BL/6J background mice. Total RNA was extracted from these samples by using TRIzol reagent (Ambion, Foster City, CA, USA) and then reverse-transcribed to cDNA by using the PrimeScrip 1st Strand cDNA Synthesis Kit (TaKaRa, Beijing, China). Quantitative PCR was performed on a LightCycler 96 system (Roche, Mannheim, Baden-Württemberg, Germany) by using a TB Green Premix Ex Taq (Tli RNaseH Plus) Kit (TaKaRa) according to manufacturer protocol. The relative gene expression was quantified using the comparative cycle threshold method, with the β actin expression used for normalization. The primers are listed in Table 1.
Hematoxylin-eosin (HE) staining
Mouse testis and epididymis were fixed in 4% paraformaldehyde at 4 °C for 24–48 h, embedded in paraffin wax, and sectioned at 5 μm. The sections were then deparaffinized and rehydrated as follows: Incubation in xylene for 20 min (performed twice), followed by successive incubations in 100% ethanol, 95% ethanol, 90% ethanol, 80% ethanol, 70% ethanol, and ddH2O for 2 min each. HE staining was carried out using the Hematoxylin-Eosin (HE) Staining Kit (E607318; Sangon Biotech, Shanghai, China).
Immunofluorescence analysis
The testicular sections were prepared as described above for HE staining. Then antigen retrieval using the Improved Citrate Antigen Retrieval Solution (P0083; Beyotime Biotechnology, Beijing, China) was performed at 100 °C for 10 min. Subsequently, the samples were cooled and washed three times with 0.3% Triton X-100 in PBS for 10 min, followed by three PBS washes. Afterward, the samples were blocked with 1% BSA for 30 min and then incubated with primary antibodies (Table 2) in 1% BSA overnight at 4 °C. Subsequently, the samples were washed three times with PBS and then incubated with the secondary antibody for 1 h at room temperature. Next, the samples were washed three times with PBS, and DAPI (D9542) was used to stain the cell nuclei for 10 min at room temperature. Finally, the slides were mounted in glycerol (ZEISS, Oberkochen, Germany) and imaged using a ZEISS Axiocam 503 mono fluorescence microscope.
Evaluation of sperm quality
Cauda epididymis was dissected from WT, SKO, and DKO male mice (10 weeks old, n = 5) and transferred to Tyrode’s solution (T1421-500 ml: Solarbio, Beijing, China). After incubating the samples at 37 °C for 10 min, sperm quality was measured using the CASA system of the Hamilton Thorne CEROS II (Medealab™, Erlangen, Germany).
TUNEL assay
Testes were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned (5 µm). The sections were then deparaffinized and rehydrated as described above, and then incubated with protease K (20 µg/ml) at room temperature for 30 min to the TUNEL assay was performed using the One-Step TUNEL Apoptosis Assay Kit (C1089; Beyotime, Beijing, China) by following the instructions of the manufacturer, and then the nuclei were stained with DAPI. Images were obtained using a ZEISS Axiocam 503 mono fluorescence microscope. We repeated the experiment five times.
Fecundity test
Two female mice (at age of 8 weeks) were caged with each test male mouse (WT, SKO, and DKO, at age of 8 to10 weeks), and copulation was evaluated by checking each morning for a vaginal plug. The number of pups was counted on the day of birth.
Heat stress assay
Adult (10 weeks) male mice (WT, SKO, and DKO) were used for the heat-treatment experiment (Kim, Cooke & Rhee, 2012). Mice were anesthetized and the lower third of the body was placed in the water bath at 42 °C for 20 min. The mice were sacrificed after heat treatment and the testis were collected for further analysis.
Statistical analysis
All data were reported as mean ± SD from at least three replicates for each experiment. Significance testing of student T-tests using Prism 7.0 software using two-tailed failure. P < 0.05 was considered statistically significant. NS means not significant.
Results
G3bp2 is highly expressed in the mouse testis
G3bp family containing G3bp1 and G3bp2, G3bp2 is high expression than G3bp1 in adult testis by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) (Fig. 1A). To explore the spatial expression pattern of G3bp2, we used RT-qPCR and observed high expression in the spleen, brain, and testis (Fig. 1B). Next, we assessed the temporal expression pattern of G3bp2. Toward this end, the testes from adult mice and those aged 1–5 weeks were collected. RT-qPCR analysis showed G3BP2 expression in mouse testis at all stages (Fig. 1C). To evaluate the cellular expression and subcellular localization patterns, we performed immunofluorescence analysis of testis sections for G3BP2. G3BP2 was mainly detected in the cytoplasm of spermatogonia, spermatocytes, and round spermatids, and not detected signals in SKO and DKO (Fig. 1D).
G3bp2 conditional knockout (cKO) mice displayed normal spermatogenesis and fertility
Because whole-body G3bp2 knockout in the mouse leads to preweaning lethality (Bult et al., 2019), we generated germline-specific G3bp2 knockout mice. Toward this end, we inserted a loxP site at each end of exon 3 of the G3bp2 gene (G3bp2loxp/loxp) (Fig. 2A). To explore the effect of germ-cell–specific G3bp2 knockout on spermatogenesis during different stages of post-natal development, we used stra8-iCre mice, which begin expressing Cre recombinase in germ cells at 3 days post-partum (dpp) (Sadate-Ngatchou et al., 2008), and Ddx4-Cre mice, which begin expressing Cre recombinase in germ cells at embryonic stage 15 days (Gallardo et al., 2007). G3bp2loxp/loxp mice were crossed with these mice to generate the following two types of germline-specific G3bp2 knockout mice: Stra8-iCre; G3bp2loxp/Δ (SKO), Ddx4-Cre; G3bp2loxp/Δ (DKO). PCR was used to confirm testis-specific G3bp2 knockout, immunostaining, and western blotting were used to confirm the KO efficiency (Figs. 2B, 2C and 1C). There is still a very faint G3bp2 signal in KO mouse testis, which is presumably Sertoli cell protein. Furthermore, we detect a weak bands by isolate Sertoli cells protein (Fig. 2D). However, sertoli-cell–specific deletion of G3bp2 by using Amh-Cre tool mice did not impact male fertility (data not shown).
We observed that there was no significant difference in testicular morphology among wild-type (WT), SKO, and DKO mice of the same week of age (Fig. 2E). The testis body weight ratio and the fertility test showed no difference in litter size among WT, SKO, and DKO mice (Figs. 2F and 2G). Moreover, full spermatogenesis and normal epididymal structure were observed in SKO and DKO mice in comparison with the WT mice (Figs. 2H and 2I). Additionally, computer-aided sperm analysis (CASA) of the semen from WT, SKO, and DKO mice showed that they all had a similar sperm concentration and motility at 10 weeks old (Figs. 2J and 2K). In addition, sperm from these mice exhibited a similar morphology (Fig. 2L). These results indicate that G3BP2 is not essential for spermatogenesis and male fertility in the mouse.
G3BP2 deficiency-induced germ-cell apoptosis
The TUNEL assay is used to detect the DNA breaks during apoptosis. To have a deeper understanding of the influence of G3bp2 deficiency on reproduction, we performed the TUNEL assay on testicular sections from WT, SKO, and DKO mice at 10 weeks old. Surprisingly, SKO and DKO displayed more apoptotic germ cells than in WT testis (Figs. 3A and 3B), indicating that G3BP2 deficiency promotes germ-cell apoptosis. There are high levels of germ cell death in the G3BP2 KO testis, but no significant difference in sperm concentration. So we speculate there is higher spermatogonia proliferation to balance the loss of germ cells. The WT, SKO, and DKO mouse testis sections were staining PLZF, a spermatogonia marker (Song et al., 2020). The seminiferous tubules from WT, SKO, and DKO contained similar numbers of spermatogonia cells (Fig. 3C). Stress granules condense into being through liquid-liquid phase separation (LLPS), G3bp1 and G3bp2 are the core regulatory components of stress granules, so we speculated whether elimination of G3bp2 has any effect on the formation of stress granules in testis (Guillén-Boixet et al., 2020; Yang et al., 2020). WT, SKO, and DKO mice were killed immediately after being heated in a 42 °C water bath for 20 min and the heat stress testis section was staining TIA1, a stress granules marker (Kim, Cooke & Rhee, 2012; Mackenzie et al., 2017). Statistical analysis of TIA1 positive cells after heat stress, there was no significant difference in WT, SKO, and DKO, suggesting that G3bp2 deletion in not affect stress granules assembly (Fig. 3D).
Discussion
Spermatogenesis is a precise and complex process involving spatiotemporal regulation of gene expression. Numerous genes have been demonstrated to play important roles in spermatogenesis. However, there are still many genes with high testicular expression whose functions remain unknown (Dong et al., 2019; Schultz, Hamra & Garbers, 2003; Nagaoka et al., 2020). The current study revealed that G3BP2 is dispensable for spermatogenesis and male fertility even though G3BP2 deficiency increases germ-cell apoptosis. G3BP2 was found mainly in the cytoplasm of spermatogonia, spermatocytes, and round spermatids. Despite this broad expression pattern in the male germline, germ-cell–specific deletion of G3bp2 did not affect spermatogenesis. There is still a very faint G3bp2 signal in KO mouse testis, which is presumably Sertoli cell protein. We observed a low-level expression of G3bp2 in Sertoli cells via western blotting, and Sertoli-cell–specific deletion of G3bp2 by using Amh-Cre tool mice did not impact male fertility, either (data not shown). G3BP1 and G3BP2 proteins are 59% identical, and the protein domain displays an identical overall molecular organization (Prigent et al., 2000). Thus, there might be redundancy between the functions of G3BP1 and G3BP2, and G3BP1 may have compensated for the loss of G3BP2 in the cKO mouse. Although the KO strategy resulted in G3bp2 frameshift mutations, the truncated protein remains (containing Exon 1 and 2), whose function needs further validation. G3bp2 is mainly expressed in the mouse brain and testis. The mouse brain is the center of the nervous system, playing vital coordination. Mouse testis is the male gonad, whose function consists of the production of sperm and synthesis/secretion of hormones. However, several pieces of evidence indicate marked cellular and molecular similarities between the brain and testis, including a similar gene expression pattern (Matos et al., 2021). Although G3bp2 deficiency increased germ-cell apoptosis, this gene was not found essential for spermatogenesis. Our data would provide a basic experiment on the function of G3BP2 in the brain.
Stress granules (SGs) are membrane-free ribonucleoprotein-based cytoplasmic compartments that form when cells are exposed to stress, such as heat, hypoxia, or oxidative stress (Hofmann et al., 2021). G3BP2 is a core component of SGs, and whether its deficiency affects SG formation is unknown. It has been reported that knocking out the Mage-b4 and Mage-b10 gene or overexpression of G3BP1 makes the male germline hypersensitive to heat stress in vivo (Lee et al., 2020). Our study revealed that germ-cell–specific lack of G3bp2 does not affect spermatogenesis under normal conditions, and, even though the elimination of G3bp2 does not affect the formation of stress granules in heat-treated testis.
The results from the TUNEL assay showed that SKO and DKO mice had more apoptotic spermatogenic cells than WT mice, and the apoptotic signals were mostly in spermatogonia and spermatocytes. Thus, we speculate that G3BP proteins may play a role in germ-cell survival in male mice. G3bp2 is a core component of stress granules, which protect germ cells from heat stress (Huelgas-Morales et al., 2016; Kim, Cooke & Rhee, 2012; Sanders et al., 2020). Thus, without G3BP2, germ cells may be more sensitive to the changes in the environment and predisposed to apoptosis. Meanwhile, spermatogenesis is a process that undergoes both numerical and morphological changes, and the lack of G3bp2 may affect cell autoregulation (de Kretser, Loveland & O.’Bryan, 2016). The previous study had shown that approximately 70% of spermatogonia are estimated to undergo apoptosis under the physiological condition in spermatogenesis (de Kretser et al., 1998; Ogawa, Ohmura & Ohbo, 2005). Although increased apoptosis in germ cells of cKO testis, the remained germ cells could produce enough sperm, so the fertile phenotype is almost unaffected. Accordingly, we plan to explore the causative factors for the apoptotic signals in the cKO mice.
In summary, we generated two male-germline–specific G3bp2 knockout mice (Stra8-iCre; G3bp2loxp/Δ and Ddx4-Cre; G3bp2loxp/Δ), which showed no difference in spermatogenesis or semen parameters from WT mice. However, both of these transgenic lines showed increased apoptosis in the male germline compared with the WT level. Our data provide valuable information for male reproductive health.